Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2020 Aug 9;177(18):4166–4180. doi: 10.1111/bph.15159

Sirtuin 3‐mediated deacetylation of acyl‐CoA synthetase family member 3 by protocatechuic acid attenuates non‐alcoholic fatty liver disease

Ruimin Sun 1, Xiaohui Kang 2, Yan Zhao 1, Zhanyu Wang 3, Ruiwen Wang 1, Rong Fu 1, Yang Li 3, Yan Hu 1, Zhecheng Wang 1, Wen Shan 1, Junjun Zhou 1, Xiaofeng Tian 3,✉, Jihong Yao 1,✉
PMCID: PMC7443473  PMID: 32520409

Abstract

Background and Purpose

Hepatic fatty acid metabolism disorder, a key pathogenic mechanism underlying non‐alcoholic fatty liver disease (NAFLD), is associated with the hyperacetylation of mitochondrial enzymes. Acyl‐CoA synthetase family member 3 (ACSF3), which is involved in the regulation of fatty acid metabolism, was predicted to contain lysine acetylation sites related to the mitochondrial deacetylase sirtuin 3 (SIRT3). The purpose of this study was to explore the underlying mechanism by which SIRT3 deacetylates ACSF3 in NAFLD and the protective effect of the natural phenolic compound protocatechuic acid (PCA) against fatty acid metabolism disorder via the SIRT3/ACSF3 pathway.

Experimental Approach

The role of protocatechuic acid and its molecular mechanism in NAFLD were detected in rats and SIRT3‐knockout mice fed a high‐fat diet (HFD) and in AML‐12 cells treated with palmitic acid (PA).

Key Results

Pharmacological treatment with protocatechuic acid significantly attenuated high‐fat diet‐induced fatty acid metabolism disorder in NAFLD. Molecular docking assays showed that protocatechuic acid specifically bound SIRT3 as a substrate and increased SIRT3 protein expression. However, the protective role of protocatechuic acid was abolished by SIRT3 knockdown, which increased ACSF3 expression and exacerbated fatty acid metabolism disorder. Mechanistically, SIRT3 was shown to specifically regulate the acetylation and degradation of ACSF3, which govern the capacity of ACSF3 to mediate fatty acid metabolism disorder during NAFLD.

Conclusion and Implications

SIRT3‐mediated ACSF3 deacetylation is a novel molecular mechanism in NAFLD therapy and protocatechuic acid confers protection against high‐fat diet‐ and palmitic acid‐induced hepatic fatty acid metabolism disorder through the SIRT3/ACSF3 pathway.

Keywords: ACSF3, fatty acid metabolism, NAFLD, protocatechuic acid, SIRT3

graphic file with name BPH-177-4166-g007.jpg

Abbreviations

Acox1

acyl‐CoA oxidase 1

ACSF3

acyl‐CoA synthetase family member 3

CPT1

carnitine palmitoyltransferase 1

FASN

fatty acid synthase

HFD

high‐fat diet

NAFLD

non‐alcoholic fatty liver disease

PA

palmitic acid

PCA

protocatechuic acid

SIRT3

sirtuin 3

SREBP‐1c

sterol regulatory element‐binding transcription factor 1c

What is already known

  • Extensive protein hyperacetylation during SIRT3 knockout is a key pathogenic mechanism underlying NAFLD.

What this study adds

  • SIRT3 mediates the deacetylation of ACSF3.

  • Protocatechuic acid (PCA) alleviates fatty acid metabolism disorder‐induced NAFLD through the SIRT3/ACSF3 pathway.

What is the clinical significance

  • Targeting the SIRT3/ACSF3 pathway with protocatechuic acid represents an attractive pharmacological strategy for NAFLD therapy.

1. INTRODUCTION

Non‐alcoholic fatty liver disease (NAFLD) comprises a spectrum of pathological disorders ranging from simple fatty liver (steatosis) to non‐alcoholic steatohepatitis (NASH), fibrosis, cirrhosis and finally hepatocellular carcinoma (HCC). NAFLD has become the most widespread chronic liver disease and has emerged as an increasing public health concern worldwide (Cohen, Horton, & Hobbs, 2011). The pathogenesis of NAFLD is multifactorial and the hallmark risk factor for NAFLD is steatosis (Gariani et al., 2016). Accumulating research has demonstrated that imbalanced fatty acid metabolism plays a crucial initial role in the onset and perpetuation of hepatic steatosis (Fabbrini, Sullivan, & Klein, 2010). Imbalanced fatty acid metabolism is characterized by increased de novo fatty acid synthesis and decreased fatty acid oxidation, which subsequently lead to excessive lipid accumulation and steatosis (Goedeke et al., 2018; Srivastava et al., 2017). Thus the identification of a potential target to attenuate fatty acid metabolism disorder may provide the basis for novel therapeutic strategies to alleviate NAFLD.

Current studies have shown that the acetylation of mitochondrial enzymes is instrumental to the regulation of NAFLD (Guo et al., 2016). Sirtuin 3 (SIRT3), the primary regulator of mitochondrial protein acetylation, acts as an indispensable gatekeeper of mitochondrial function and energy homeostasis (Yang et al., 2016). More recent reports indicated the extensive hyperacetylation of mitochondrial proteins in SIRT3‐knockout (SIRT3−/−) mice during NAFLD (Kendrick et al., 2011). However, the molecular mechanisms by which SIRT3 affects de novo fatty acid synthesis and fatty acid oxidation in NAFLD remain to be further elucidated.

Acyl‐CoA synthetase family member 3 (ACSF3), an essential enzyme that activates fatty acids through the formation of thioester bonds to form acyl‐CoA, serves as the substrate for both de novo fatty acid synthesis and oxidation (Sloan et al., 2011). In addition, ACSF3 is the only mitochondrial synthetase of malonyl‐CoA, which is vital for the production of acetyl‐CoA (Witkowski, Thweatt, & Smith, 2011). In obesity and alcoholic liver disease, the level of ACSF3 is significantly increased, which promotes lipid peroxidation and interferes with fatty acid metabolism (Bowman et al., 2017; Liu, Chen, Jin, & Li, 2013). Therefore, the down‐regulation of ACSF3 may protect against NAFLD through inhibiting fatty acid metabolism disorder. Large‐scale acetyl‐proteome approaches have identified a number of acetylation sites in ACSF3 (PLMD; http://plmd.biocuckoo.org). Furthermore, Hebert et al. (2013) exhibited several potential lysine deacetylation sites (K181, K419, K476 and K565) of ACSF3 in SIRT3−/− mice under calorie restriction conditions. However, the relationship between SIRT3 and ACSF3 and the role of SIRT3/ACSF3 pathway in high‐fat diet (HFD)‐induced NAFLD remains unclear.

SIRT3 has been shown to be activated by plant polyphenols, such as quercetin and resveratrol (Mathieu et al., 2016). The hydrophilic phenolic compound protocatechuic acid (PCA), which is found in vegetables, fruits and some Chinese herbal medicines, has anti‐hyperglycaemic, anti‐hyperlipidaemic and anti‐hepatotoxic properties (Harini & Pugalendi, 2010; Scazzocchio et al., 2015). As protocatechuic acid shares structural similarity with the above polyphenols, we therefore postulated that protocatechuic acid may regulate SIRT3 and attenuate fatty acid metabolism disorder in NAFLD.

Based on the above, we hypothesize that SIRT3 protects against high‐fat diet‐induced NAFLD through deacetylating ACSF3. Additionally, we found that protocatechuic acid ameliorates NAFLD by activating the SIRT3/ACSF3 pathway. These findings may provide novel therapeutic insights into NAFLD treatment.

2. METHODS

2.1. Animals and treatments

Male Sprague–Dawley (SD) rats (8 weeks old) weighing 180–220 g and wild‐type (WT) C57BL/6 mice weighing 18–22 g were obtained from the Animal Center of Dalian Medical University (Dalian, China). Global SIRT3−/− mice were purchased from Cyagen Biosciences, Inc. Protocatechuic acid (98% purity) was purchased from Shanghai Winherb Medical Science Co., Ltd. (Shanghai, China).

After acclimatization to standard laboratory conditions for 1 week, the rats and mice were randomly divided into corresponding experimental groups and fed on irradiated standard normal diet (ND) or on a high‐fat diet (2% cholesterol, 7% lard, 8.3% yolk, 16.7% sucrose and 66% standard diet) in a specific pathogen‐free facility. This high‐fat diet includes 4.66 kcal·g−1 with an energy composition of 51.73% from carbohydrate, 31.59% from fat and 16.68% from protein (Li et al., 2011; Zeng et al., 2015). Rats and mice were pretreated with protocatechuic acid (rats, 10 or 20 mg·kg−1·day−1; mice, 30 mg·kg−1·day−1) or the same volume of normal saline. Body weight and food intake were monitored daily. After 8 weeks all animals were killed. All of the procedures were conducted according to the guidelines of the Institutional Animal Care and Use Committee of Dalian Medical University and had been approved by the Institutional Ethics Committee of Dalian Medical University. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010) and with the recommendations made by the British Journal of Pharmacology.

2.2. Histological analysis

Isolated liver lobes were collected, fixed in 4% paraformaldehyde and then embedded in paraffin or used to prepare frozen sections. Liver sections were subjected to haematoxylin–eosin (H&E) and oil red O staining.

2.3. Biochemical assays

Aspartate aminotransferase (AST), alanine aminotransferase (ALT), total cholesterol (TC), triglyceride (TG), LDL cholesterol (LDL‐C), HDL cholesterol (HDL‐C) and fasting blood glucose levels were estimated with assay kits (Jiancheng Corp., Nanjing, China). For the glucose tolerance test, mice were fasted for 12 h and blood samples were obtained from the tail vein. Blood glucose levels were determined at 0, 15, 30, 60, 90 and 120 min (Gydesen et al., 2017).

2.4. Cell culture and treatments

The AML‐12 cell line was obtained from ATCC (Rockefeller, USA; Cat #CRL‐2254, RRID:CVCL_0140) and cultured in DMEM/F12 (1:1) supplemented with 0.005 mg·ml−1 insulin, 0.005 mg·ml−1 transferrin, 0.005 mg·ml−1 selenium, 10% (v/v) FBS and 40 ng·ml−1 dexamethasone (Gibco, CA, USA) in a humidified incubator in 5% CO2 at 37°C.

To establish an in vitro model, AML‐12 cells were treated with palmitic acid (PA) (400 μM) (Sigma, No. P‐0500) as previously described (Zeng et al., 2015). The SIRT3 inhibitor 3‐(1H‐1,2,3‐triazol‐4‐yl)pyridine (3‐TYP) (Selleck, USA) was used to study the effects of SIRT3 deacetylation as previously described (Zeng et al., 2019).

2.5. Nile red staining

Nile red staining (Sigma, No. 19123) was utilized to examine intracellular lipid accumulation (Zeng et al., 2015). The images were observed with a fluorescence microscope.

2.6. Western blotting

Proteins were separated by SDS‐PAGE (8%–12%). Western blotting was performed with primary antibodies against the following: SIRT3 (Cell Signaling Technology, USA; Cat #5490, RRID:AB_10828246), ACSF3 (Santa Cruz Biotechnology, CA, USA; Cat #sc‐136561, RRID:AB_10856870), pan acetyl lysine (Abcam, UK; Cat #ab21623, RRID:AB_446436), fatty acid synthase (FASN) (Affinity Biosciences, USA; Cat #DF6106, RRID:AB_2811172), sterol regulatory element‐binding transcription factor 1c (SREBP‐1c) (Affinity Biosciences; Cat #AF4728, RRID:AB_2811173), carnitine palmitoyltransferase 1 (CPT1) (Proteintech Group, Wuhan, China; Cat #15184‐1‐AP, RRID:AB_2084676), β‐actin (Proteintech Group; Cat #66009‐1‐Ig, RRID:AB_2687938), acyl‐CoA oxidase 1 (Acox1) (ABclonal Biotechnology, Wuhan, China; Cat #A8091, RRID:AB_2768221) and PPARα (ABclonal Biotechnology; Cat #A11924, RRID:AB_2758867).

2.7. Real‐time PCR

RNAiso Plus (TaKaRa, Japan) was applied to isolate the total RNA. Then cDNA synthesis and RNA amplification were carried out with a PrimeScript™ RT reagent kit and SYBR Premix Ex Taq™ II (TaKaRa), respectively. Expression levels in each sample normalized to β‐actin levels were determined by calculating ΔΔCt. Sequences of the primers used are shown in Table 1.

TABLE 1.

Primer sequences

Gene Forward primer (5′‐3′) Reverse primer (5′‐3′)
Rat
FASN GCTGCTACAAACAGGACCATCAC TCTTGCTGGCCTCCACTGAC
SREBP‐1c GCCCAGGTGACCCGACTATT GACAGCGTCAGAACAGCTATTTAGC
CPT1 ACAGCACTGGCCCAGGATT AGCATCTCCATGGCGTAGTAGTT
Acox1 GCCACTACGTGGTCGTTAAGG TGATGATGCTCCCCTCAAGAA
PPARα TCAATGCCCTCGAACTGGAT TGCTCTGCAGGTGGAGCTT
β‐actin GGAAATCGTGCGTGACATTAAAG CGGCAGTGGCCATCTCTT
Mouse
FASN CATGACCTCGTGATGAACGTGT CGGGTGAGGACGTTTACAAAG
SREBP‐1c TCAAAACCAGCCTCCCAAGA CCCCGTCCACAAAGAAACG
CPT1 TGCTCAGTGGGAGCGACTCT CTCAGCAGCCTCCCGTCAT
Acox1 ATGGTTTTCGTAAGGTCCTTCCT CTGCGTCTGAAAATCCAAAATCT
PPARα AACAACCCGCCTTTTGTCATA GACGGTCTCCACGGACATG
β‐actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT
Open in a new tab

2.8. Molecular docking assay

Structures of protocatechuic acid were optimized with the Gaussian 09 program (Frisch et al., 2009) on the level of B3LYP (Lee, Yang, & Parr, 1988)/6‐31G* and optimized structures of ligand molecules were then created in PDB format. The SIRT3 protein structure (PDB: 3GLS) was taken from the Protein Data Bank. Water molecules and the original ligands were removed from the protein structure and polar hydrogen atoms were then added. Co‐ordinates for both the ligand (PCA) and target protein (SIRT3) were prepared with AutoDock Tools‐1.5.6 and molecular docking analysis of ligand–protein complexes was conducted using the AutoDock Vina program (Trott & Olson, 2010). Ligand–protein complexes were geometrically optimized using a genetic algorithm and only ligand–protein complexes with the best scores were used for discussion (Liang et al., 2009). The 3D and 2D structures displayed in Figure 2 were drawn with Discovery Studio version 4.5 (DS 4.5; Accelrys, Inc., San Diego, CA, USA).

FIGURE 2.

FIGURE 2

Open in a new tab

SIRT3 knockout abolishes protocatechuic acid (PCA)‐mediated protection against NAFLD in mice. (a) The protein levels of SIRT3 in rat livers (n = 5). *P < 0.05 versus the normal diet (ND) group, # P < 0.05 versus the high‐fat diet (HFD) group. (b) The protein levels of SIRT3 in mouse livers (n = 5). (c) 3D structure of SIRT3 in complex with PCA, with strongly hydrophilic regions shown in green and strongly hydrophobic regions shown in orange. (d) The SIRT3 and PCA interaction network is composed of van der Waals interactions, hydrogen bonds and π‐interactions. (e–g) Serum levels of ALT, AST, TC, TG, LDL‐C and HDL‐C. (h, i) Body and liver weights. (j, k) Fasting blood glucose levels and glucose tolerance (n = 6). *P < 0.05 versus the WT ND group, # P < 0.05 versus the WT HFD group, & P < 0.05 versus the SIRT3−/− ND group. (l) Representative morphological images of H&E‐stained (200×) and oil red O‐stained (200×) liver sections from the different experimental groups

2.9. Cell transfection

Mouse AML‐12 cells were transfected with small interfering RNAs (siRNAs), pcDNA plasmids, or negative control (GenePharma, Suzhou, China) for 48 h using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. The SIRT3 siRNA sequence was as follows:‐ sense: 5′‐GCAACCUUCAGCAGUAUGATT‐3′, anti‐sense 5′‐UCAUACUGCUGAAGGUUGCTT‐3′. The ACSF3 siRNA sequence was as follows:‐ sense: 5′‐GGAGUUCCUGAUAUGACAUTT‐3′, anti‐sense 5′‐AUGUCAUAUCAGGAACUCCTT‐3′. All siRNAs and plasmids were incubated with transfection medium for 48 h before palmitic acid treatment.

2.10. Immunoprecipitation and coimmunoprecipitation experiments

Total proteins were extracted in immunoprecipitation (IP) lysis buffer (20‐mM Tris–HCl, 150‐mM NaCl, 1% Triton X‐100, pH 7.5). For immunoprecipitation, precleared lysates were incubated with equal amounts of anti‐ACSF3 and protein A/G magnetic beads (Bimake, Selleck Chemical, Houston, USA) according to the manufacturers' protocols as previously described (Zhao et al., 2018). The collected sample was immunoblotted with anti‐ACSF3, anti‐SIRT3 or anti‐acetyl lysine primary antibody.

2.11. Immunofluorescence staining

After fixation in 4% paraformaldehyde, the cells were incubated with primary antibody overnight at 4°C, followed by incubation with vsecondary antibody (Proteintech) at room temperature for 1 h. Then DAPI (Beyotime Institute of Biotechnology) was used to stain nuclei. Images were obtained under a confocal microscope (Nikon 80i) and quantified by ImageJ. The Immuno‐related procedures used comply with the recommendations made by the British Journal of Pharmacology (Alexander et al., 2018).

2.12. Statistical analysis

Student's unpaired t‐test (two‐group comparisons) and one‐way ANOVA (multigroup comparisons) were carried out with GraphPad Prism. All data were analysed to identify the statistical significance between groups. Statistical analysis was undertaken only for studies where each group size was at least n = 5. The post hoc tests were conducted only if F in ANOVA achieved P < 0.05 and there was no significant variance inhomogeneity. Differences with a P‐value less than 0.05 were considered statistically significant and the values are expressed as the mean ± SD. The data and statistical analysis comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2018).

2.13. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018) and are permanently archived in the Concise Guide to PHARMACOLOGY 2019/20 (Alexander et al., 2019).

3. RESULTS

3.1. Protocatechuic acid attenuates hepatic injury and steatosis in vivo and in vitro

We first explored whether protocatechuic acid exerts a protective role in high‐fat diet‐induced hepatic injury. As shown in Figure 1, the body and liver weight, serum ALT, AST, TG, TC and LDL‐C along with fasting blood glucose levels were obviously increased, while HDL‐C levels were decreased in response to an high‐fat diet compared with those in the control group, but protocatechuic acid treatment clearly reversed these changes. These effects occurred without affecting the food intake (Figure S1). Moreover, both morphologic and histological examinations of liver sections revealed remarkably increased liver sizes, altered liver colour and a large number of lipid vacuoles in the hepatocytes of high‐fat diet‐fed rats. However, protocatechuic acid treatment attenuated hepatic lipid accumulation caused by the high‐fat diet (Figure 1e). In vitro, AML‐12 cells were exposed to palmitic acid to mimic NAFLD in vivo. As shown in Figure 1h, the number of lipid droplets observed by Nile red staining was clearly increased in the palmitic acid group and this increase was significantly decreased by protocatechuic acid treatment. Taken together, these data shows that protocatechuic acid powerfully protects against high‐fat diet‐ and palmitic acid‐induced hepatic injury and steatosis.

FIGURE 1.

FIGURE 1

Open in a new tab

Protocatechuic acid (PCA) diminishes high‐fat diet‐ or palmitic acid (PA)‐induced fatty acid metabolism disorder in the liver. (a–d) Serum levels of ALT, AST, TC, TG, LDL‐C, HDL‐C and fasting blood glucose (n = 6). (e) Representative morphological, H&E‐stained (200×) and oil red O‐stained images (200×) of liver sections from the different experimental groups. (f, g) Body and liver weights (n = 6). *P < 0.05 versus the normal diet (ND) group, # P < 0.05 versus the high‐fat diet (HFD) group. (h) Intracellular lipid accumulation was assessed by Nile red staining (200×). *P < 0.05 versus the control group, # P < 0.05 versus the PA group. (i–m) Western blotting and real‐time PCR analysis of hepatic fatty acid synthase (FASN), SREBP‐1c, CPT1, Acox1 and PPARα protein (n = 5) and mRNA (n = 6) levels in rats. *P < 0.05 versus the ND group, # P < 0.05 versus the HFD group

3.2. Protocatechuic acid protects against high‐fat diet‐induced hepatic fatty acid metabolism disorder

High‐fat diet‐induced fatty acid metabolism disorder is a critical trigger of NAFLD. Imbalanced de novo fatty acid synthesis and fatty acid oxidation are the key features of fatty acid metabolism disorder (Goedeke et al., 2018). To study the effect of protocatechuic acid on the regulation of fatty acid metabolism, we evaluated the key enzymes of de novo fatty acid synthesis, fatty acid synthase and SREBP‐1c (Zhao et al., 2016) and the key enzymes of fatty acid oxidation, CPT1, Acox1 and PPARα (Kim et al., 2017). Both the mRNA and protein levels of fatty acid synthase and SREBP‐1c were dramatically increased in the high‐fat diet group compared with the control group, whereas protocatechuic acid prevented these increases in the rate‐limiting enzymes of de novo fatty acid synthesis (Figure 1i,j,l). Furthermore, protocatechuic acid treatment reversed the high‐fat diet‐mediated down‐regulation of CPT1, Acox1 and PPARα at the mRNA and protein levels (Figure 1i,k,m). Therefore, protocatechuic acid regulates fatty acid metabolism during NAFLD through suppressing de novo fatty acid synthesis and promoting fatty acid oxidation.

3.3. Protocatechuic acid inhibits high‐fat diet‐induced hepatic injury and steatosis through SIRT3

Studies have reported that the activation of SIRT3 may impact the pathogenetic molecular cascade and therapeutic mechanisms of NAFLD (Hirschey et al., 2011). Hence, we tested whether protocatechuic acid exerts its protective effect in NAFLD via SIRT3 activation. As shown in Figure 2a,b, hepatic SIRT3 protein expression was remarkably decreased in high‐fat diet‐fed rats and mice. In contrast, protocatechuic acid treatment reversed the loss of SIRT3, whereas protocatechuic acid‐mediated SIRT3 activation was mostly blocked in SIRT3−/− mice, indicating that protocatechuic acid contributes to SIRT3 activation in NAFLD. The specific binding interactions between protocatechuic acid and SIRT3 were studied by molecular docking calculation. As shown in Figure 2c,d, two hydrophilic –OH groups in protocatechuic acid were shown to form hydrogen bonds with Asn229 and Val292. The phenyl group of protocatechuic acid is sandwiched between Ile230 and Phe180 through π–π stacking and π–alkyl interactions. These two residues comprise a strong hydrophobic region. In addition, the nearby residues Gln228, His248, Phe294, Val324, Ala146, Ile291 and Phe293 also contact with protocatechuic acid via van der Waals interactions. Notably, residue His248 is close to protocatechuic acid, which may further affect the deacetylation of SIRT3 (Jin et al., 2009). Therefore, SIRT3 contains binding pockets that are well suited for protocatechuic acid, explaining the mechanism by which protocatechuic acid potently activates the expression of SIRT3. Moreover, without affecting food intake in mice (Figure S1), protocatechuic acid treatment reversed high‐fat diet‐induced increases in body and liver weight, serum ALT, AST, TC, TG and LDL‐C, fasting blood glucose levels, decreases in HDL‐C levels and glucose tolerance in WT mice but not in SIRT3−/− mice (Figure 2e–k). Consistently, morphologic and histological examinations revealed that protocatechuic acid did not ameliorate hepatic injury and steatosis in SIRT3−/− mice (Figure 2l). Thus, protocatechuic acid protects against high‐fat diet‐induced hepatic injury and steatosis in a SIRT3‐dependent manner.

3.4. SIRT3 knockdown prevents protocatechuic acid‐induced promotion of fatty acid metabolism

The loss of SIRT3 increases de novo fatty acid synthesis and decreases fatty acid oxidation (Hirschey et al., 2010; Narita, Weinert, & Choudhary, 2019). Thus, we further investigated whether SIRT3 activation is involved in the protective effect of protocatechuic acid against high‐fat diet‐ or palmitic acid‐induced hepatic fatty acid metabolism disorder. The protocatechuic acid‐mediated down‐regulation of de novo fatty acid synthesis‐related enzymes and up‐regulation of fatty acid oxidation‐related enzymes at both the mRNA and protein levels observed in WT mice were abolished in high‐fat diet‐fed SIRT3−/− mice (Figure 3a–e). AML‐12 cells transfected with SIRT3 siRNA in vitro prior to palmitic acid treatment were used to mimic SIRT3 knockdown and high‐fat diet in vivo. Accordingly, the protocatechuic acid‐mediated augmentation of fatty acid metabolism was mostly blocked by SIRT3 knockdown (Figure 3f–k). Together, these findings demonstrate that the protocatechuic acid‐induced promotion of fatty acid metabolism is mediated by SIRT3 activation.

FIGURE 3.

FIGURE 3

Open in a new tab

protocatechuic acid (PCA) promotes fatty acid metabolism through SIRT3 activation. (a–e) Western blotting and real‐time PCR analysis of hepatic fatty acid synthase (FASN), SREBP‐1c, CPT1, Acox1 and PPARα protein (n = 5) and mRNA (n = 6) levels in mouse livers. *P < 0.05 versus the WT normal diet (ND) group, # P < 0.05 versus the WT high‐fat diet (HFD) group, & P < 0.05 versus the SIRT3−/− ND group. (f–i) The protein expression of FASN, SREBP‐1c, CPT1, Acox1, PPARα and SIRT3 was measured by Western blotting (n = 5). The mRNA levels of (j) FASN, SREBP‐1c, (k) CPT1, Acox1 and PPARα were measured with real‐time PCR (n = 6). *P < 0.05 versus the si‐Control group, # P < 0.05 versus the si‐Control + palmitic acid (PA) group, & P < 0.05 versus the si‐Control + PA + PCA group

3.5. Protocatechuic acid inhibits ACSF3‐induced hepatic fatty acid metabolism disorder through a SIRT3‐dependent mechanism

ACSF3, a central and necessary enzyme in fatty acid metabolism, is highly increased in ob/ob mice (Bowman et al., 2017). We found that AML‐12 cells exhibited an increased ACSF3 protein level following treatment with palmitic acid. Moreover, ACSF3 siRNA abrogated the up‐regulated expression of fatty acid synthase and SREBP1‐c and down‐regulated expression of CPT1, Acox1 and PPARα after palmitic acid exposure (Figure 4a–f). These data demonstrate the essential contribution of ACSF3 to the palmitic acid‐induced inhibition of fatty acid metabolism. Then we explored whether the protective effect of protocatechuic acid against NAFLD occurs through activation of the SIRT3/ACSF3 pathway. As expected, the protein expression of ACSF3 was substantially increased in high‐fat diet‐fed rats and WT mice. However, the protocatechuic acid‐mediated down‐regulation of ACSF3 was blocked in the high‐fat diet‐fed SIRT3−/− mice (Figure 4g,h). These results indicate that ACSF3 is effectively suppressed by the protocatechuic acid‐mediated up‐regulation of SIRT3 in NAFLD.

FIGURE 4.

FIGURE 4

Open in a new tab

Protocatechuic acid (PCA) inhibits ACSF3‐induced fatty acid metabolism disorder through a SIRT3‐dependent mechanism. Representative Western blotting results showing (a–d) fatty acid synthase (FASN), SREBP‐1c, CPT1, Acox1, PPARα and ACSF3 protein levels in AML‐12 cells (n = 5). The mRNA levels of (e) FASN, SREBP‐1c, (f) CPT1, Acox1 and PPARα were measured with real‐time PCR (n = 6). *P < 0.05 versus the si‐Control group, # P < 0.05 versus the si‐Control + palmitic acid (PA) group. (g) Western blotting analysis of the hepatic ACSF3 protein levels in rats (n = 5). *P < 0.05 versus the normal diet (ND) group, # P < 0.05 versus the high‐fat diet (HFD) group. (h) Western blotting analysis of the hepatic ACSF3 protein levels in mice (n = 5). *P < 0.05 versus the WT ND group, # P < 0.05 versus the WT HFD group, & P < 0.05 versus the SIRT3−/− ND group

3.6. SIRT3 regulates the acetylation of ACSF3 in vivo and in vitro

According to proteomic analysis of rats, mice and humans, the lysine acetylation sites of ACSF3 are confirmatory existential (Hebert et al., 2013; Lundby et al., 2012). Thus, ACSF3 may be modified by acetylation/deacetylation. Inhibited ACSF3 expression may be induced by SIRT3‐mediated deacetylation in NAFLD. In accordance with the data in SIRT3−/− mice (Figure 4h), the in vitro knockdown of SIRT3 clearly increased ACSF3 protein levels upon palmitic acid exposure, while SIRT3 overexpression effectively prevented this increase, suggesting that SIRT3 negatively regulates ACSF3 expression in NAFLD (Figure 5a,c). Furthermore, the acetylation of ACSF3 was dramatically increased in high‐fat diet‐fed WT mice and even higher in high‐fat diet‐fed SIRT3−/− mice (Figure 5e). Consistent with these in vivo results, SIRT3 siRNA or the addition of 3‐TYP significantly enhanced ACSF3 acetylation in vitro. However SIRT3 overexpression aggressively suppressed ACSF3 acetylation (Figure 5b,d,f). These data show that the deacetylation of ACSF3 is mediated by SIRT3 in vivo and in vitro.

FIGURE 5.

FIGURE 5

Open in a new tab

SIRT3 reduces ACSF3 acetylation in vivo and in vitro. (a) Western blotting analysis of SIRT3 and ACSF3 protein levels (n = 5). ACSF3 protein was immunoprecipitated with an anti‐ACSF3 antibody and immunoblotted with an anti‐acetyl lysine antibody and then (b) ACSF3 acetylation and protein expression were assessed (n = 5). *P < 0.05 versus the si‐Control group, # P < 0.05 versus the si‐Control + palmitic acid (PA) group. (c, d) Western blotting analysis of SIRT3 protein levels and ACSF3 acetylation and protein levels (n = 5). *P < 0.05 versus the pcDNA3.1 group, # P < 0.05 versus the pcDNA3.1 + PA group. (e) Western blotting analysis of hepatic ACSF3 acetylation in SIRT3−/− mice (n = 5). *P < 0.05 versus the WT normal diet (ND) group, # P < 0.05 versus the SIRT3−/− ND group. (f) Western blotting of ACSF3 acetylation levels (n = 5). *P < 0.05 versus the control group, # P < 0.05 versus the PA group. (g, h) Representative immunoblot analysis showing the interaction of SIRT3 with ACSF3 from PA‐treated AML‐12 cells. The input represents the total protein extracts used for immunoprecipitation. IB, immunoblotting; IgG, negative control; IP, immunoprecipitation. (i) Immunofluorescence analysis with confocal microscopy (scale = 25 μm) showing that SIRT3 and ACSF3 colocalize in AML‐12 cells

Then we performed co‐immunoprecipitation experiments to further evaluate the interaction between SIRT3 and ACSF3 in NAFLD. ACSF3 was co‐immunoprecipitated with SIRT3 in palmitic acid‐treated AML‐12 cells, demonstrating the physical interaction between SIRT3 and ACSF3 (Figure 5g,h). In addition, the immunofluorescence results showed that the SIRT3 and ACSF3 proteins were co‐localized (Figure 5i). These data suggest a potential physical interaction between SIRT3 and ACSF3 in NAFLD.

3.7. The decrease of ACSF3 acetylation and protein stability is related to the SIRT3‐mediated deacetylates at K565

To identify which lysine residue(s) on ACSF3 are targeted by SIRT3 for deacetylation in NAFLD, a replacement of lysine (K) with arginine (R) was used to generate ACSF3 acetylation‐deficient mutants at potential lysine sites (K181R, K419R, K476R and K565R). As shown in Figure 6a, the acetylation of ACSF3 was significantly decreased in the ACSF3‐K565R mutant. Moreover, compared with the acetylation level of WT ACSF3, SIRT3 overexpression or SIRT3 deacetylase inhibition did not exhibit an apparent alteration in the acetylation level of ACSF3 with K565R mutant. These results indicate that SIRT3‐mediated deacetylation of ACSF3 may be mainly targeted at K565 (Figure 6d,f).

FIGURE 6.

FIGURE 6

Open in a new tab

SIRT3 deacetylates ACSF3 at K565 and suppresses ACSF3 protein stability. (a) The acetylation levels of ACSF3 (n = 5). (b) Sequence alignment of the acetylation site K565 in ACSF3 from different species. (c) Immunofluorescence analysis of ACSF3 protein expression in AML‐12 cells with confocal microscopy (scale = 50 μm). *P < 0.05 versus the pcDNA‐ACSF3 WT group. (d–g) Western blotting analysis of ACSF3 acetylation and protein levels (n = 5). *P < 0.05 versus the pcDNA‐ACSF3 WT group. AML‐12 cells were transfected with SIRT3 siRNA or pcDNA‐SIRT3 and subsequently exposed to PA for another 24 h, followed by incubation with cycloheximide (CHX, 100 μg·ml−1) and collection at the indicated time points. (h) Western blotting analysis of ACSF3 protein expression (n = 5). *P < 0.05 versus the si‐Control + PA group (1 h), # P < 0.05 versus the si‐Control + PA group (2 h), & P < 0.05 versus the si‐Control + PA group (4 h), $ P < 0.05 versus the si‐Control + PA group (8 h). (i) Western blotting analysis of ACSF3 protein expression (n = 5). *P < 0.05 versus the pcDNA3.1 + PA group (1 h), # P < 0.05 versus the pcDNA3.1 + PA group (2 h), & P < 0.05 versus the pcDNA3.1 + PA group (4 h)

Protein acetylation profoundly modulates multiple protein functions, including protein stability, subcellular localization and enzymatic activity (Choudhary et al., 2009). In this study, the K565R mutation of ACSF3 resulted in decreased ACSF3 acetylation and protein levels (Figure 6a,c,d–g). Furthermore, SIRT3 knockout up‐regulated the protein levels of ACSF3, which were paralleled by its acetylation (Figures 4h and 5e), suggesting that SIRT3‐mediated deacetylation of ACSF3 influences ACSF3 protein stability. The degradation of ACSF3 was then measured after the administration of cycloheximide (CHX) for various lengths of time. As shown in Figure 6h, SIRT3 knockdown clearly increased the ACSF3 protein level compared to that of the control group, however, SIRT3 overexpression potentiated the protein degradation of ACSF3 (Figure 6i). Collectively, these results suggest that SIRT3‐induced deacetylation of ACSF3 decreases its stability in NAFLD.

Since SIRT3‐mediated deacetylation of ACSF3 would affect its protein expression, we investigated whether lysine deacetylation could further alter the effect of ACSF3 on fatty acid metabolism under conditions of SIRT3 overexpression. The data showed that acetylation‐deficient mutant of ACSF3 rescued fatty acid metabolism disorder. However, SIRT3 overexpression did not further increase the effect of ACSF3‐K565R mutant on fatty acid metabolism, suggesting that SIRT3‐mediated deacetylation of ACSF3 may regulate fatty acid metabolism mainly by targeting the K565 residue (Figure S2).

4. DISCUSSION

The development of NAFLD is strongly related to hepatic steatosis, due to the rate of fatty acid input (de novo fatty acid synthesis) exceeds the rate of fatty acid output (fatty acid oxidation) (Goedeke et al., 2018). Therefore, the simultaneous effective suppression of de novo fatty acid synthesis and stimulation of fatty acid oxidation offers an attractive therapeutic strategy for NAFLD (Srivastava et al., 2017). The current study presents the first attempt to demonstrate the following. (1) SIRT3 is a crucial target for the regulation of fatty acid metabolism during NAFLD. (2) SIRT3 protects against NAFLD through inhibiting ACSF3‐induced fatty acid metabolism disorder. The inhibition of ACSF3 is associated with SIRT3‐mediated deacetylation, which affects the stability of ACSF3. (3) Modulation of the SIRT3/ACSF3 pathway by protocatechuic acid may contribute to alleviating NAFLD.

Fatty acid metabolism disorder is an important contributor to hepatic lipid accumulation and ROS production, which is a major risk factor for NAFLD (Fabbrini et al., 2010; Tomita et al., 2008). As a metabolic sensor of cellular energy homeostasis, SIRT3 is indispensable under basal conditions due to the regulation of fatty acid transport and metabolism, and ATP synthesis as well as ROS generation (De Marchi et al., 2019; Yang et al., 2016; Zeng et al., 2019). Moreover, accumulating studies have revealed the protective effects of SIRT3 in diverse liver diseases, whereas Li et al. (2017) reported that SIRT3 inhibition protected against palmitic acid‐induced lipotoxicity and alleviated fatty liver, which was not consistent with other findings (Rardin et al., 2013; Zhang et al., 2020). One probable explanation for this may be due to the differences in experimental conditions, which induced the variety of the expression of SIRT3 upstream regulators under the fatty liver (e.g. PGC‐1α) (Maruyama, Kiyono, Kondo, Sekimoto, & Yokosuka, 2016; Park et al., 2014; Zhang et al., 2018) and subsequently affect the role of SIRT3. In this study, our data showed that the lack of SIRT3 remarkably aggravated hepatic steatosis, as indicated by the increased expression of fatty acid synthesis‐related enzymes, fatty acid synthase and SREBP‐1c, and decreased expression of fatty acid oxidation‐related enzymes, CPT1, Acox1 and PPARα. Therefore, we propose that targeting SIRT3 may represent a therapeutic approach to attenuate fatty acid metabolism disorder‐induced NAFLD.

Some phenolic compounds have been shown to confer protective effects against hepatic injury by regulating SIRT3 (Mathieu et al., 2016). Protocatechuic acid, a hydrophilic phenolic compound that widely exists in vegetables, fruits and Chinese herbal medicines, possesses a variety of pharmacological effects, such as improvement of type 2 diabetes and reduction of obesity‐associated metabolic disorders (Bhattacharjee et al., 2017; Ormazabal et al., 2018). Furthermore, we recently reported that protocatechuic acid attenuated alcoholic liver disease by reducing ROS formation (Fu et al., 2019). In this study, we further found that SIRT3 is involved in the protective effects of protocatechuic acid against NAFLD. Our data demonstrated that protocatechuic acid protects against NAFLD by improving high‐fat diet‐induced abnormalities in serum levels, body weight, fasting blood glucose, glucose tolerance and promoting the hepatic fatty acid metabolism; however, these changes were mostly abolished by SIRT3 knockdown, indicating the critical role of SIRT3 in mediating the effects of protocatechuic acid in the fatty liver. Interestingly, molecular docking assays confirmed that protocatechuic acid exhibits a strong affinity for SIRT3 due to strong hydrogen bonding, hydrophobic and van der Waals interactions. In addition, in comparison with benzoic acid (data not shown), protocatechuic acid with two extra hydrophilic –OH groups has more binding sites to interact with SIRT3, implying that protocatechuic acid may be a promising activator of SIRT3. These results suggest that protocatechuic acid exerts a protective effect against high‐fat diet‐ and palmitic acid‐induced NAFLD by binding SIRT3. The limitation of the current study is that different in vitro modelling agents (e.g. oleic acid and palmitic acid/oleic acid mixtures) should be applied to better detect the effect of protocatechuic acid on fatty acid metabolism. Furthermore, in addition to restoring fatty acid metabolism balance, protocatechuic acid may relieve fatty liver by affecting other pathological processes, such as its reduction of ROS formation. In the future, further experiments are needed to explore this.

The mitochondrial protein ACSF3 is a novel contributor to cellular metabolism that affects the tricarboxylic acid (TCA) cycle, mitochondrial respiration and oxidative phosphorylation (Sloan et al., 2011; Witkowski et al., 2011). In particular, ACSF3 is an acyl‐CoA synthetase that converts fatty acids into fatty acyl‐CoA esters, which may serve as signalling molecules and participate in the regulation of nuclear transcriptional activity of PPARα and SREBP‐1c, as well as further affect the expression of fatty acid metabolism‐related genes (Coleman, Lewin, Van Horn, & Gonzalez‐Baro, 2002; Hertz, Berman, & Bar‐Tana, 1994; Jørgensen et al., 2002; Monteuuis, Suomi, Keratar, Masud, & Kastaniotis, 2017). Additionally, ACSF3 knockout increased phosphorylated acetyl‐CoA carboxylase (ACC) (Ser79) and subsequently affected the level of malonyl‐CoA, which may further regulate de novo fatty acid synthesis and fatty acid oxidation (Bowman et al., 2017; Fullerton et al., 2013; Wehbe et al., 2019). Moreover, the up‐regulation of ACSF3 was found to induce lipid peroxidation and interfere with the metabolism of fatty acids in alcoholic liver disease (Liu et al., 2013). Consistently, our study has demonstrated that ACSF3 inhibition remarkably attenuated the fatty acid metabolism disorder of NAFLD. Importantly, SIRT3 overexpression or knockdown occurred in parallel with decreased or increased ACSF3 protein levels, respectively, during high‐fat diet‐ and palmitic acid‐induced NAFLD or under physiological conditions. Furthermore, SIRT3 knockdown prevented the protocatechuic acid‐mediated inhibition of ACSF3, indicating that SIRT3/ACSF3 represents a potential therapeutic target for protocatechuic acid in the treatment of NAFLD.

Lysine acetylation, one of the most common posttranslational modifications of cellular proteins, regulates a variety of physiological processes (Choudhary et al., 2009; Rardin et al., 2013). SIRT3 has emerged as a primary mediator of mitochondrial lysine acetylation (Yang et al., 2016). The loss of SIRT3 contributes to the hyperacetylation of mitochondrial proteins, which regulates energy metabolism during NAFLD (Kendrick et al., 2011). Intriguingly, quantitative acetyl‐proteomics identified a number of potentially acetylated proteins in SIRT3−/− mice, among which ACSF3 contains particular lysine residues (K181, K419, K476 and K565) (Hebert et al., 2013). The regulation of ACSF3 by SIRT3 in NAFLD might occur through ACSF3 deacetylation. As expected, ACSF3 acetylation was reduced when SIRT3 was overexpressed, while the opposite trend was observed following SIRT3 knockout. Furthermore, we found that the K565R mutation of ACSF3 disrupted the ability of SIRT3 to deacetylate ACSF3, suggesting that K565 on ACSF3 maybe the primary residue targeted for deacetylation by SIRT3. As protein lysine acetylation influences protein–protein interactions and regulates diverse protein properties, including protein stability and activity (Kim et al., 2006), our data further showed that SIRT3 physically interacts with ACSF3 and promotes ACSF3 protein degradation, indicating that the acetylation of ACSF3 may be required for maintaining its stability. Moreover, bioinformatics predictions showed that ACSF3 possesses phosphorylation (http://gps.biocuckoo.cn/) and ubiquitination (http://ubibrowser.ncpsb.org/ubibrowser/) sites. There is a possibility that SIRT3 crosstalk with the acetylation/phosphorylation/ubiquitination of ACSF3 or other mechanisms affects its protein stability. Further experiments are required investigate this possibility. In addition, to the effects on protein stability, ACSF3 K565 acetylation also affects its ability to regulate fatty acid metabolism. Therefore SIRT3‐mediated deacetylation of ACSF3 on residue K565 may modulate the activity of ACSF3 in the fatty liver. Collectively, these results confirmed that SIRT3 negatively regulates ACSF3 acetylation, which substantially reduces the stability and activity of ACSF3 in NAFLD. However, our current results cannot rule out the participation of other effects of SIRT3 in the regulation of ACSF3, so more experiments are required to explore the precise nature of this regulatory mechanism.

In summary, the results of our study demonstrate that SIRT3 is essential for fatty acid metabolism, which is responsible for the deacetylation of ACSF3 and suppresses its protein stability. Activation of SIRT3 by protocatechuic acid protects against NAFLD, at least in part, by inhibiting ACSF3‐mediated fatty acid metabolism disorder. Our findings highlight pharmacological activation of the SIRT3/ACSF3 pathway as an attractive approach to alleviate NAFLD and suggest protocatechuic acid as a new candidate for NAFLD therapy.

AUTHOR CONTRIBUTIONS

J.Y., X.T. and R.S. designed the study. R.S., X.K., Y.Z., Z.W. and L.Y. performed the experiments. R.W., R.F. and Y.H. analysed the data. Z.W., W.S. and J.Z. contributed materials and collected liver samples. J.Y., X.T., R.S. and X.K. prepared the manuscript. J.Y., Y.H., W.S. and X.K. provided financial support.

CONFLICT OF INTEREST

The authors have no conflicts of interest.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for Design & Analysis, Immunoblotting and Immunochemistry and Animal Experimentation, and as recommended by funding agencies, publishers and other organizations engaged with supporting research.

Supporting information

Figure S1. Effects of PCA on the food intake of (A) rats (n = 6) and (B) mice (n = 6)

Figure S2. Effect of ACSF3 deacetylation on fatty acid metabolism. (A‐C) The protein expression of FASN, SREBP‐1c, CPT1, Acox1 and PPARα was measured by Western blotting (n = 5). The mRNA levels of (D) FASN, SREBP‐1c (E) CPT1, Acox1 and PPARα were measured with real‐time PCR (n = 6). *P < 0.05 vs. the pcDNA‐ACSF3 WT group

Click here for additional data file. (256.5KB, pdf)

ACKNOWLEDGEMENTS

This study was supported by the National Natural Science Foundation of China (81773799, 81603369, 81703771 and 21704011) and the Doctoral Scientific Research Foundation of Liaoning Province China (20180540038).

Sun R, Kang X, Zhao Y, et al. Sirtuin 3‐mediated deacetylation of acyl‐CoA synthetase family member 3 by protocatechuic acid attenuates non‐alcoholic fatty liver disease. Br J Pharmacol. 2020;177:4166–4180. 10.1111/bph.15159

Contributor Information

Xiaofeng Tian, Email: txfdl@dmu.edu.cn.

Jihong Yao, Email: yaojihong65@dmu.edu.cn.

REFERENCES

  1. Alexander, S. P. H. , Roberts, R. E. , Broughton, B. R. S. , Sobey, C. G. , George, C. H. , Stanford, S. C. , … Ahluwalia, A. (2018). Goals and practicalities of immunoblotting and immunohistochemistry: A guide for submission to the British Journal of Pharmacology . British Journal of Pharmacology, 175, 407–411. 10.1111/bph.14112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alexander, S. P. H. , Christopoulos, A. , Davenport, A. P. , Kelly, E. , Mathie, A. , Peters, J. A. , … Pawson, A. J. (2019). The Concise Guide to PHARMACOLOGY 2019/20: G protein‐coupled receptors. British Journal of Pharmacology, 176(Suppl 1), S21–S141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bhattacharjee, N. , Dua, T. K. , Khanra, R. , Joardar, S. , Nandy, A. , Saha, A. , … Dewanjee, S. (2017). Protocatechuic Acid, a Phenolic from Sansevieria roxburghiana Leaves, Suppresses Diabetic Cardiomyopathy via Stimulating Glucose Metabolism, Ameliorating Oxidative Stress, and Inhibiting Inflammation. Frontiers in Pharmacology, 8 10.3389/fphar.2017.00251 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bowman, C. E. , Rodriguez, S. , Selen Alpergin, E. S. , Acoba, M. G. , Zhao, L. , Hartung, T. , … Wolfgang, M. J. (2017). The Mammalian Malonyl‐CoA Synthetase ACSF3 Is Required for Mitochondrial Protein Malonylation and Metabolic Efficiency. Cell Chemical Biology, 24(6), 673–684.e4. 10.1016/j.chembiol.2017.04.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Jørgensen, C. , Krogsdam, A. M. , Kratchmarova, I. , Willson, T. M. , Knudsen, J. , Mandrup, S. , & Kristiansen, K. (2002). Opposing effects of fatty acids and acyl‐CoA esters on conformation and cofactor recruitment of peroxisome proliferator‐activated receptors. Annals of the new York Academy of Sciences, 967, 431–439. [DOI] [PubMed] [Google Scholar]
  6. Choudhary, C. , Kumar, C. , Gnad, F. , Nielsen, M. L. , Rehman, M. , Walther, T. C. , … Mann, M. (2009). Lysine acetylation targets protein complexes and co‐regulates major cellular functions. Science, 325, 834–840. 10.1126/science.1175371 [DOI] [PubMed] [Google Scholar]
  7. Cohen, J. C. , Horton, J. D. , & Hobbs, H. H. (2011). Human fatty liver disease: Old questions and new insights. Science, 332, 1519–1523. 10.1126/science.1204265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Coleman, R. A. , Lewin, T. M. , Van Horn, C. G. , & Gonzalez‐Baro, M. R. (2002). Do long‐chain acyl‐CoA synthetases regulate fatty acid entry into synthetic versus degradative pathways? The Journal of Nutrition, 132, 2123–2126. 10.1093/jn/132.8.2123 [DOI] [PubMed] [Google Scholar]
  9. Curtis, M. J. , Alexander, S. , Cirino, G. , Docherty, J. R. , George, C. H. , Giembycz, M. A. , … Ahluwalia, A. (2018). Experimental design and analysis and their reporting II: Updated and simplified guidance for authors and peer reviewers. British Journal of Pharmacology, 175, 987–993. 10.1111/bph.14153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. De Marchi, U. , Galindo, A. N. , Thevenet, J. , Hermant, A. , Bermont, F. , Lassueur, S. , … Wiederkehr, A. (2019). Mitochondrial lysine deacetylation promotes energy metabolism and calcium signaling in insulin‐secreting cells. The FASEB Journal, 33, 4660–4674. 10.1096/fj.201801424R [DOI] [PubMed] [Google Scholar]
  11. Fabbrini, E. , Sullivan, S. , & Klein, S. (2010). Obesity and nonalcoholic fatty liver disease: Biochemical, metabolic, and clinical implications. Hepatology, 51, 679–689. 10.1002/hep.23280 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Frisch, M. , Trucks, G. , Schlegel, H. , Scuseria, G. , Robb, M. , Cheeseman, J. R. , … Nakatsuji, H. (2009). Gaussian 09, Revision A.02. Wallingford, CT: Gaussian, Inc. [Google Scholar]
  13. Fu, R. , Zhou, J. , Wang, R. , Sun, R. , Feng, D. , Wang, Z. , … Yao, J. (2019). Protocatechuic Acid‐Mediated miR‐219a‐5p Activation Inhibits the p66shc Oxidant Pathway to Alleviate Alcoholic Liver Injury. Oxidative Medicine and Cellular Longevity, 2019, 1–15. 10.1155/2019/3527809 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fullerton, M. D. , Galic, S. , Marcinko, K. , Sikkema, S. , Pulinilkunnil, T. , Chen, Z. P. , … Steinberg, G. R. (2013). Single phosphorylation sites in Acc1 and Acc2 regulate lipid homeostasis and the insulin‐sensitizing effects of metformin. Nature Medicine, 19, 1649–1654. 10.1038/nm.3372 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gariani, K. , Menzies, K. J. , Ryu, D. , Wegner, C. J. , Wang, X. , Ropelle, E. R. , … Auwerx, J. (2016). Eliciting the mitochondrial unfolded protein response by nicotinamide adenine dinucleotide repletion reverses fatty liver disease in mice. Hepatology, 63, 1190–1204. 10.1002/hep.28245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Goedeke, L. , Bates, J. , Vatner, D. F. , Perry, R. J. , Wang, T. , Ramirez, R. , … Shulman, G. I. (2018). Acetyl‐CoA carboxylase inhibition reverses NAFLD and hepatic insulin resistance but promotes hypertriglyceridemia in rodents. Hepatology, 68, 2197–2211. 10.1002/hep.30097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Guo, L. , Zhou, S. R. , Wei, X. B. , Liu, Y. , Chang, X. X. , Liu, Y. , … Tang, Q. Q. (2016). Acetylation of mitochondrial trifunctional protein α‐subunit enhances its stability to promote fatty acid oxidation and is decreased in nonalcoholic fatty liver disease. Molecular and Cellular Biology, 36, 2553–2567. 10.1128/MCB.00227-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gydesen, S. , Hjuler, S. T. , Freving, Z. , Andreassen, K. V. , Sonne, N. , Hellgren, L. I. , … Henriksen, K. (2017). A novel dual amylin and calcitonin receptor agonist, KBP‐089, induces weight loss through a reduction in fat, but not lean mass, while improving food preference. British Journal of Pharmacology, 174, 591–602. 10.1111/bph.13723 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Harding, S. D. , Sharman, J. L. , Faccenda, E. , Southan, C. , Pawson, A. J. , Ireland, S. , … NC‐IUPHAR . (2018). The IUPHAR/BPS Guide to PHARMACOLOGY in 2018: Updates and expansion to encompass the new guide to IMMUNOPHARMACOLOGY. Nucleic Acids Research, 46, D1091–D1106. 10.1093/nar/gkx1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Harini, R. , & Pugalendi, K. V. (2010). Antioxidant and antihyperlipidaemic activity of protocatechuic acid on streptozotocin‐diabetic rats. Redox Report, 15, 71–80. 10.1179/174329210X12650506623285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hebert, A. S. , Dittenhafer‐Reed, K. E. , Yu, W. , Bailey, D. J. , Selen, E. S. , Boersma, M. D. , … Coon, J. J. (2013). Calorie restriction and SIRT3 trigger global reprogramming of the mitochondrial protein acetylome. Molecular Cell, 49, 186–199. 10.1016/j.molcel.2012.10.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hertz, R. , Berman, I. , & Bar‐Tana, J. (1994). Transcriptional activation by amphipathic carboxylic peroxisomal proliferators is induced by the free acid rather than the acyl‐CoA derivative. European Journal of Biochemistry, 221, 611–615. 10.1111/j.1432-1033.1994.tb18773.x [DOI] [PubMed] [Google Scholar]
  23. Hirschey, M. D. , Shimazu, T. , Goetzman, E. , Jing, E. , Schwer, B. , Lombard, D. B. , … Verdin, E. (2010). SIRT3 regulates mitochondrial fatty‐acid oxidation by reversible enzyme deacetylation. Nature, 464, 121–125. 10.1038/nature08778 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hirschey, M. D. , Shimazu, T. , Jing, E. , Grueter, C. A. , Collins, A. M. , Aouizerat, B. , … Verdin, E. (2011). SIRT3 deficiency and mitochondrial protein hyperacetylation accelerate the development of the metabolic syndrome. Molecular Cell, 44, 177–190. 10.1016/j.molcel.2011.07.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jin, L. , Wei, W. , Jiang, Y. , Peng, H. , Cai, J. , Mao, C. , … Perni, R. B. (2009). Crystal structures of human SIRT3 displaying substrate‐induced conformational changes. The Journal of Biological Chemistry, 284, 24394–24405. 10.1074/jbc.M109.014928 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kendrick, A. A. , Choudhury, M. , Rahman, S. M. , McCurdy, C. E. , Friederich, M. , Van Hove, J. L. , … Sack, M. N. (2011). Fatty liver is associated with reduced SIRT3 activity and mitochondrial protein hyperacetylation. The Biochemical Journal, 433, 505–514. 10.1042/BJ20100791 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kilkenny, C. , Browne, W. , Cuthill, I. C. , Emerson, M. , Altman, D. G. , & Group NCRRGW . (2010). Animal research: Reporting in vivo experiments: The ARRIVE guidelines. British Journal of Pharmacology, 160, 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kim, D.‐H. , Jeong, D. , Kang, I.‐B. , Kim, H. , Song, K.‐Y. , & Seo, K.‐H. (2017). Dual function of Lactobacillus kefiri DH5 in preventing high‐fat‐diet‐induced obesity: direct reduction of cholesterol and upregulation of PPAR‐α in adipose tissue. Molecular Nutrition & Food Research, 61(11), 1700252 10.1002/mnfr.201700252 [DOI] [PubMed] [Google Scholar]
  29. Kim, S. C. , Sprung, R. , Chen, Y. , Xu, Y. , Ball, H. , Pei, J. , … Zhao, Y. (2006). Substrate and functional diversity of lysine acetylation revealed by a proteomics survey. Molecular Cell, 23, 607–618. 10.1016/j.molcel.2006.06.026 [DOI] [PubMed] [Google Scholar]
  30. Lee, C. , Yang, W. , & Parr, R. G. (1988). Development of the Colle‐Salvetti correlation‐energy formula into a functional of the electron density. Physical Review B: Condensed Matter, 37, 785–789. 10.1103/PhysRevB.37.785 [DOI] [PubMed] [Google Scholar]
  31. Li, L. , Chen, L. , Hu, L. , Liu, Y. , Sun, H. Y. , Tang, J. , … Wang, H. Y. (2011). Nuclear factor high‐mobility group box 1 mediating the activation of Toll‐like receptor 4 signaling in hepatocytes in the early stage of nonalcoholic fatty liver disease in mice. Hepatology, 54, 1620–1630. 10.1002/hep.24552 [DOI] [PubMed] [Google Scholar]
  32. Li, S. , Dou, X. , Ning, H. , Song, Q. , Wei, W. , Zhang, X. , … Song, Z. (2017). Sirtuin 3 acts as a negative regulator of autophagy dictating hepatocyte susceptibility to lipotoxicity. Hepatology, 66, 936–952. 10.1002/hep.29229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Liang, Y. H. , Feng, X. Q. , Zeng, Z. S. , Chen, F. E. , Balzarini, J. , Pannecouque, C. , & de Clercq, E. (2009). Design, synthesis, and SAR of naphthyl‐substituted diarylpyrimidines as non‐nucleoside inhibitors of HIV‐1 reverse transcriptase. ChemMedChem, 4, 1537–1545. 10.1002/cmdc.200900212 [DOI] [PubMed] [Google Scholar]
  34. Liu, Y. , Chen, S. H. , Jin, X. , & Li, Y. M. (2013). Analysis of differentially expressed genes and microRNAs in alcoholic liver disease. International Journal of Molecular Medicine, 31, 547–554. 10.3892/ijmm.2013.1243 [DOI] [PubMed] [Google Scholar]
  35. Lundby, A. , Lage, K. , Weinert, B. T. , Bekker‐Jensen, D. B. , Secher, A. , Skovgaard, T. , … Olsen, J. V. (2012). Proteomic analysis of lysine acetylation sites in rat tissues reveals organ specificity and subcellular patterns. Cell Reports, 2, 419–431. 10.1016/j.celrep.2012.07.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Maruyama, H. , Kiyono, S. , Kondo, T. , Sekimoto, T. , & Yokosuka, O. (2016). Palmitate‐induced regulation of PPARγ via PGC1α: A mechanism for lipid accumulation in the liver in nonalcoholic fatty liver disease. International Journal of Medical Sciences, 13, 169–178. 10.7150/ijms.13581 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Mathieu, L. , Lopes Costa, A. , Le Bachelier, C. , Slama, A. , Lebre, A. S. , Taylor, R. W. , … Djouadi, F. (2016). Resveratrol attenuates oxidative stress in mitochondrial Complex I deficiency: Involvement of SIRT3. Free Radical Biology & Medicine, 96, 190–198. 10.1016/j.freeradbiomed.2016.04.027 [DOI] [PubMed] [Google Scholar]
  38. Monteuuis, G. , Suomi, F. , Keratar, J. M. , Masud, A. J. , & Kastaniotis, A. J. (2017). A conserved mammalian mitochondrial isoform of acetyl‐CoA carboxylase ACC1 provides the malonyl‐CoA essential for mitochondrial biogenesis in tandem with ACSF3. The Biochemical Journal, 474, 3783–3797. 10.1042/BCJ20170416 [DOI] [PubMed] [Google Scholar]
  39. Narita, T. , Weinert, B. T. , & Choudhary, C. (2019). Functions and mechanisms of non‐histone protein acetylation. Nature Reviews. Molecular Cell Biology, 20, 156–174. 10.1038/s41580-018-0081-3 [DOI] [PubMed] [Google Scholar]
  40. Ormazabal, P. , Scazzocchio, B. , Vari, R. , Santangelo, C. , D'Archivio, M. , Silecchia, G. , … Masella, R. (2018). Effect of protocatechuic acid on insulin responsiveness and inflammation in visceral adipose tissue from obese individuals: Possible role for PTP1B. International Journal of Obesity, 42, 2012–2021. 10.1038/s41366-018-0075-4 [DOI] [PubMed] [Google Scholar]
  41. Park, M. J. , Kim, D. I. , Lim, S. K. , Choi, J. H. , Kim, J. C. , Yoon, K. C. , … Park, S. H. (2014). Thioredoxin‐interacting protein mediates hepatic lipogenesis and inflammation via PRMT1 and PGC‐1α regulation in vitro and in vivo. Journal of Hepatology, 61, 1151–1157. 10.1016/j.jhep.2014.06.032 [DOI] [PubMed] [Google Scholar]
  42. Rardin, M. J. , Newman, J. C. , Held, J. M. , Cusack, M. P. , Sorensen, D. J. , Li, B. , … Gibson, B. W. (2013). Label‐free quantitative proteomics of the lysine acetylome in mitochondria identifies substrates of SIRT3 in metabolic pathways. Proceedings of the National Academy of Sciences of the United States of America, 110, 6601–6606. 10.1073/pnas.1302961110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Scazzocchio, B. , Vari, R. , Filesi, C. , Del Gaudio, I. , D'Archivio, M. , Santangelo, C. , … Masella, R. (2015). Protocatechuic acid activates key components of insulin signaling pathway mimicking insulin activity. Molecular Nutrition & Food Research, 59, 1472–1481. 10.1002/mnfr.201400816 [DOI] [PubMed] [Google Scholar]
  44. Sloan, J. L. , Johnston, J. J. , Manoli, I. , Chandler, R. J. , Krause, C. , Carrillo‐Carrasco, N. , … Sapp, J. C. (2011). Exome sequencing identifies ACSF3 as a cause of combined malonic and methylmalonic aciduria. Nature Genetics, 43, 883–886. 10.1038/ng.908 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Srivastava, J. , Robertson, C. L. , Ebeid, K. , Dozmorov, M. , Rajasekaran, D. , Mendoza, R. , … Sarkar, D. (2017). A novel role of astrocyte elevated gene‐1 (AEG‐1) in regulating nonalcoholic steatohepatitis (NASH). Hepatology, 66, 466–480. 10.1002/hep.29230 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tomita, K. , Oike, Y. , Teratani, T. , Taguchi, T. , Noguchi, M. , Suzuki, T. , … Hibi, T. (2008). Hepatic AdipoR2 signaling plays a protective role against progression of nonalcoholic steatohepatitis in mice. Hepatology, 48, 458–473. 10.1002/hep.22365 [DOI] [PubMed] [Google Scholar]
  47. Trott, O. , & Olson, A. J. (2010). AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. Journal of Computational Chemistry, 31, 455–461. 10.1002/jcc.21334 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wehbe, Z. , Behringer, S. , Alatibi, K. , Watkins, D. , Rosenblatt, D. , Spiekerkoetter, U. , & Tucci, S. (2019). The emerging role of the mitochondrial fatty‐acid synthase (mtFASII) in the regulation of energy metabolism. Biochimica et Biophysica Acta ‐ Molecular and Cell Biology of Lipids, 1864, 1629–1643. 10.1016/j.bbalip.2019.07.012 [DOI] [PubMed] [Google Scholar]
  49. Witkowski, A. , Thweatt, J. , & Smith, S. (2011). Mammalian ACSF3 protein is a malonyl‐CoA synthetase that supplies the chain extender units for mitochondrial fatty acid synthesis. The Journal of Biological Chemistry, 286, 33729–33736. 10.1074/jbc.M111.291591 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yang, W. , Nagasawa, K. , Munch, C. , Xu, Y. , Satterstrom, K. , Jeong, S. , … Guarani, V. (2016). Mitochondrial sirtuin network reveals dynamic SIRT3‐dependent deacetylation in response to membrane depolarization. Cell, 167, 985–1000, e1021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zeng, W. , Shan, W. , Gao, L. , Gao, D. , Hu, Y. , Wang, G. , … Yao, J. (2015). Inhibition of HMGB1 release via salvianolic acid B‐mediated SIRT1 up‐regulation protects rats against non‐alcoholic fatty liver disease. Scientific Reports, 5, 16013 10.1038/srep16013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zeng, X. , Yang, J. , Hu, O. , Huang, J. , Ran, L. , Chen, M. , … Mi, M. (2019). Dihydromyricetin ameliorates nonalcoholic fatty liver disease by improving mitochondrial respiratory capacity and redox homeostasis through modulation of SIRT3 signaling. Antioxidants & Redox Signaling, 30, 163–183. 10.1089/ars.2017.7172 [DOI] [PubMed] [Google Scholar]
  53. Zhang, C. , Deng, J. , Liu, D. , Tuo, X. , Xiao, L. , Lai, B. , … Wang, N. (2018). Nuciferine ameliorates hepatic steatosis in high‐fat diet/streptozocin‐induced diabetic mice through a PPARα/PPARγ coactivator‐1α pathway. British Journal of Pharmacology, 175, 4218–4228. 10.1111/bph.14482 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhang, T. , Liu, J. , Shen, S. , Tong, Q. , Ma, X. , & Lin, L. (2020). SIRT3 promotes lipophagy and chaperon‐mediated autophagy to protect hepatocytes against lipotoxicity. Cell Death and Differentiation, 27, 329–344. 10.1038/s41418-019-0356-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Zhao, H. , Wang, Z. , Tang, F. , Zhao, Y. , Feng, D. , Li, Y. , … Yao, J. (2018). Carnosol‐mediated Sirtuin 1 activation inhibits Enhancer of Zeste Homolog 2 to attenuate liver fibrosis. Pharmacological Research, 128, 327–337. 10.1016/j.phrs.2017.10.013 [DOI] [PubMed] [Google Scholar]
  56. Zhao, Y. , Li, H. , Zhang, Y. , Li, L. , Fang, R. , Li, Y. , … Ye, L. (2016). Oncoprotein HBXIP modulates abnormal lipid metabolism and growth of breast cancer cells by activating the LXRs/SREBP‐1c/FAS signaling cascade. Cancer Research, 76, 4696–4707. 10.1158/0008-5472.CAN-15-1734 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1. Effects of PCA on the food intake of (A) rats (n = 6) and (B) mice (n = 6)

Figure S2. Effect of ACSF3 deacetylation on fatty acid metabolism. (A‐C) The protein expression of FASN, SREBP‐1c, CPT1, Acox1 and PPARα was measured by Western blotting (n = 5). The mRNA levels of (D) FASN, SREBP‐1c (E) CPT1, Acox1 and PPARα were measured with real‐time PCR (n = 6). *P < 0.05 vs. the pcDNA‐ACSF3 WT group

Click here for additional data file. (256.5KB, pdf)

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES