Abstract
Purpose
N-acetylmuramoyl-l-alanine amidase known as lytA, is an immunogenic protein that plays an important role in the pathogenesis of Streptococcus pneumoniae. It is highly conserved among S. pneumoniae strains and is absent among other Streptococcus species. In the present study, the level of antibodies against the lytA recombinant protein was evaluated in healthy individuals' sera.
Materials and Methods
DNA was extracted from S. pneumoniae ATCC 49619 to amplify lytA gene by polymerase chain reaction assay. The lytA amplicon and pET28a vector were separately double digested using Nde-1 and Xho1 restriction enzymes and then ligated together with ligase enzyme. The recombinant plasmid was expressed in Escherichia coli BL21 strain and the lytA recombinant protein purified using nickel-nitrilotriacetic acid affinity chromatography. Western blot was carried to detect lytA recombinant protein. Sixty healthy individual's sera (at three age groups: group 1, <2; group 2, 2–40; and group 3, 60–90 years old) were collected and the titers of anti-lytA antibodies were determined.
Results
The lytA gene was highly expressed in E. coli BL21 host. The recombinant lytA protein was purified and confirmed by western blotting. Tukey test analysis showed that there were no significant differences among the age groups considering the anti-lytA titer of 10. However, at the anti-lytA titer of 60, significant differences were observed between group 1 vs. group 2 (p<0.001); group 1 vs. group 3 (p=0.003), and group 2 vs. group 3 (p=0.024).
Conclusion
The lytA protein seems to be a highly immunogenic antigen and a potential target for developing vaccines against pneumococcal infections.
Keywords: Streptococcus pneumoniae, N-acetylmuramoyl-l-alanine amidase, Antibody, Surface protein, Western blotting
Introduction
Streptococcus pneumoniae is a leading cause of pneumonia, meningitis, otitis media, sinusitis, and bacteremia among adults and children globally [1]. Peoples with underlying diseases including individuals with diabetes, asthma, chronic obstructive pulmonary disease, cardiovascular disease, acquired immune deficiency syndrome, and sickle cell disease are more susceptible for pneumococcal infections [2]. Pneumococcal invasive diseases have a mortality rate of 5%–35%, which is associated with some indexes including site of infection, comorbidity, patient's age, and pneumococcus serotype [3].
Currently, two types of pneumococcal vaccines, PPSV23 and PCV13, are used to prevent pneumococcal infections in countries with high incidence rates of these infections. The PPSV23 and PCV13 are polysaccharide vaccines used in children and adults of 5 to 64 years old. However, polysaccharide vaccines do not elicit protective immune responses in children <2 years old. As a result, conjugate vaccines have been introduced in order to resolve this limitation [4].
Although all pneumococcal proteins are potentially immunogenic for the immune system of human body, those proteins exposed on the surface of diplococci can be particularly useful for developing vaccines. The surface proteins of pneumococci encompass four main families including typical Gram-positive surface proteins, lipoproteins, choline-binding proteins (CBPs), and non-classical surface proteins [5].
The pneumococcal major autolysin, N-acetylmuramoyl-l-alanine amidase known as lytA, is expressed at both cytoplasmic and surface membrane levels and plays an important role in the pathogenesis of pneumococci infections [6]. This virulence factor binds to the bacterium cell wall by its choline binding domain and subsequently triggers bacterium autolysis.
The lytA protein is immunogenic and highly conserved among S. pneumoniae strains and is not observed among other Streptococcus species. Nevertheless, it may have cross-reactivity with lytA similar proteins produced by other species and may cause a high level of antibodies against lytA protein. For this reason, in the present study, we examined the titer of anti-recombinant lytA antibodies in the sera of healthy individuals.
Materials and Methods
Gene cloning and recombinant protein production
Genomic DNA was extracted from exponential cultures of S. pneumoniae ATCC 49619 using Genomic DNA Extraction Kit (Favorgen Biotech Corp., Pingtung, Taiwan) according to the manufacturer's instructions. Polymerase chain reaction for lytA gene was carried out using specific forward (CCCACATATGGAAATTAATGTGAGTAAA) and reverse (CCCACTCGAGTTTTACTGTAATCAAGCCAT) primers.
The lytA amplicon and pET28a vector (Novagen Inc., Madison, WI, USA) were separately digested with Nde-1 and Xho1 restriction enzymes (Fermentase, Burlington, Germany) and ligated together with ligase enzyme. Transformation of ligation product into competent Escherichia coli DH5α cells was done using CaCl2 method. Recombinant plasmid was sequenced to confirm the lytA gene sequence. For gene induction, E. coli BL21 (DE3) strain containing recombinant plasmid was cultured in Luria-Bertani (LB) broth (with 50 µg/mL kanamycin) overnight at 37℃ with shaking. Subsequently, the overnight culture was sub-cultured into 250 mL of LB broth containing kanamycin (50 µg/mL) and incubated at 37℃ until its optical density reached 0.6. Plasmid induction was done by adding isopropyl-β-D-thiogalactopyranoside (IPTG; Sigma-Aldrich, St. Louis, MO, USA) (final concentration: 1 mM) and culture were incubated for 4 hours at 37℃ with shaking. Cultures were centrifuged and plate was used for recombinant protein purification [7].
Western blot was carried out using His-tag monoclonal antibody conjugated to horseradish peroxidase (HRP; Thermo Fisher Scientific Inc., Waltham, MA, USA). The lytA recombinant protein was electrophoresed in 10% sodium dodecyl sulfate-polyacrylamide gel and transferred into polyvinylidene fluoride (PVDF) membrane. PVDF blocking was done using 3% skim milk at room temperature for 12 hours. Following washing with phosphate-buffered saline (PBS) containing 0.05% Tween 20, the PVDF membrane was incubated at His-tag monoclonal antibody conjugated to HRP for 1 hour at 25℃. After washing with PBS containing 0.05% Tween 20, the blots were treated with 3, 3′-diaminobenzidine solution (Sigma-Aldrich) for 2 minutes.
The enzyme-linked immunosorbent assay
Sixty human sera samples were collected (group 1, 20 samples from neonatal up to 2 years old; group 2, 20 samples from adults with 2–40 years old; and group 3: 20 samples from elderly with 60–90 years old) and evaluated for antibody titers using an enzyme-linked immunosorbent assay. Ten µg/mL of lytA recombinant protein was coated into 96-well polystyrene plates (Greiner, Stonehouse, UK) and incubated overnight at 4℃. Following 3 times washing with PBS containing 0.05 Tween 20, the wells blocked with PBS containing 3% skim milk for 1 hour at 25℃. Then, wells were washed 3 times and sera added into the wells at dilution of 1:10 to 1:160, and incubated for 1 hour at 25℃. Peroxidase-conjugated mouse anti-human immunoglobulin G (IgG; Cytomatin Gene Co., Isfahan, Iran) (1:4,000 dilution) was added into the wells and incubated for 30 minutes at 25℃. About 50 µL TMB (3,3′,5,5′-tetramethylbenzidine) substrate solution (Cytomatin Gene Co.) was added into the wells and the reaction was finally stopped after 15 minutes by adding 50 µL of 1N H2SO4. Our study was approved by the ethical committee of Khoy University of Medical Sciences (ETHICAL code no., IR.KHOY.REC.1397.005).
Results
Gene cloning and expression
In the present study, the lytA gene was successfully amplified and its gel electrophoresis is shown at Fig. 1. Following doubledigestion of lytA gene and pET28a vector with Xho1 and Nde1 restriction enzymes, the digested insert and vector were ligated successfully.
Fig. 1. Gel electrophoresis of extracted plasmid and lytA amplicon. Lane pet, pPET28a; lane M, DNA ladder 100–10,000 bp; lane lytA, lytA amplicon; C, negative control.
Recombinant protein expression and purification
The lytA gene was highly expressed in E. coli BL21 host and noticeable amount of recombinant protein yielded (approximately 35 kDa) after 4 hours induction with 0.1 mM IPTG. The purification of recombinant protein carried out using nickel-nitrilotriacetic acid affinity chromatography system and highly pure recombinant protein eluted (Fig. 2).
Fig. 2. Polyacrylamide gel electrophoresis of samples collected from protein production and purification. M, protein marker; T0, E. coli BL21 before induction; T4, E. coli BL21 after 4 hours induction with IPTG (isopropyl-β-D-thiogalactopyranoside); B, unbounded proteins in flow-through fraction from binding step; DWB, flow-through fraction following washing column with denature wash buffer; W1–W5, flow-through fractions following washing column; NWB, flow-through fraction after washing with native wash buffer; E1–E2, sample from eluted proteins. E. coli, Escherichia coli.
Western blotting
Western blot analysis using anti-His tag antibody confirmed the recombinant lytA recombinant protein, which is presented in Fig. 3.
Fig. 3. Western blot analysis of lytA recombinant protein.
Enzyme-linked immunosorbent assay
Five dilutions of human sera ranging from 1:10 to 1:160 were used for determining the titer of anti-recombinant lytA antibody. The results of the Tukey test analysis showed that there was no significant difference among the age groups considering 10 antibody titer. However, significant differences were observed comparing the other sera as shown in Table 1.
Table 1. Compering the sera titers among different age groups.
Titer | Age comparison (y) | p-value | |
---|---|---|---|
10 | 0–2 | 2–40 | 0.087 |
40–90 | 0.360 | ||
2–40 | 40–90 | 0.716 | |
20 | 0–2 | 2–40 | 0.000 |
40–90 | 0.002 | ||
2–40 | 40–90 | 0.614 | |
40 | 0–2 | 2–40 | 0.000 |
40–90 | 0.000 | ||
2–40 | 40–90 | 0.375 | |
80 | 0–2 | 2–40 | 0.000 |
40–90 | 0.000 | ||
2–40 | 40–90 | 0.179 | |
160 | 0–2 | 2–40 | 0.000 |
40–90 | 0.003 | ||
2–40 | 40–90 | 0.024 |
Discussion
S. pneumoniae is a common cause of serious infectious diseases such as meningitis, sepsis, and pneumonia. In the recent years, there have been attempts to identify a reliable protein to develop efficient vaccines against pneumococcal diseases [8,9]. Vaccination has been particularly effective in inducing nasopharyngeal immunization and limiting pneumococci colonization [10]. CBPs are a family of pneumococcal surface exposed proteins that have structural and physiological functions.
CBPs are a family of pneumococcal surface proteins with wide-range structural and physiological functions. Antibodies against these proteins are increased during life suggesting these proteins as potential candidates for developing vaccines against pneumococcal infections. In our study, the presence of IgG antibodies against lytA pneumococcal protein, a member of surface-exposed CBPs, was investigated in the sera of 60 healthy individuals at different age groups. There were no significance differences among the assessed age groups (i.e., <2, 2–40, and 60–90 years old) regarding the antibody titer of 1:10. Considering the titer of 1:160, however, significant differences were observed comparing the first versus second (p<0.05); first versus third (p=0.003), and second vs. third (p=0.024) age groups.
The high titer of antibodies against lytA protein can be related to immune responses against the bacteria colonizing in the nasopharynx or other sites and also the detection of the protein by mucosal immune cells [11]. The lytA is a highly conserved gene in S. pneumoniae with the highest intra-species similarity being related to the lytA gene of S. mitis B6 strain with only 20% dissimilarity in their sequences [12].
Mitis group streptococci are genetically similar species and include S. mitis, S. pneumoniae, S. australis, S. peroris, S. cristatus, S. gordonii, S. infantis, S. oligofermentans, S. oralis, S. parasanguinis, S. pseudopneumoniae, S. tigurinus, and S. sanguinis [13]. These species are colonized into oral cavity and stimulate mucosal immunity permanently. In a study by Gosink et al. [14], the degree of similarity between choline binding domains of choline binding protein A and other CBPs calculated to be 30% to 60%. The presence of these domains in all of the CBPs can cause cross reaction immunity, justifying the high antibody titers against all CBPs. In another study, the similarity among CBPs has been also reported [15]. On the bacterium surface, it can effectively trigger immune system leading to a high titer of anti-lytA antibody in individuals who have a history of pneumococcal infections or those who are carriers of nasopharyngeal non-capsulated pneumococcal strains [16].
In the present study, the highest antibody titer against lytA protein was observed in the 2–40-year-old age group with decreasing trends in children <2 years and elders >60 years old. This pattern probably reflects the function of immune system against pneumococcal and other infections in lifetime. In fact, this observation may partly explain the higher rates of pneumococcal infections in children and elder [17,18].
In conclusion, the high titer of anti-lytA antibody in midlife may be a result of either stimulation of immune system by non-pneumococcal proteins with similar structures to pneumococcal lytA or prior nasopharyngeal colonization of pneumococci in healthy individuals. Overall, lytA protein presents appropriate immunogenicity properties and beside other pneumococcal immunogenic proteins it can be applied in pneumococcal new vaccines.
Footnotes
No potential conflict of interest relevant to this article was reported.
The authors would like to acknowledge the staffs of Department of Microbiology and Virology, Zanjan University of Medical Sciences for their kind supports. The study was financially supported by Khoy University of Medical Sciences (project code no., 38096).
References
- 1.Cai FY, Fussell T, Cobey S, Lipsitch M. Use of an individual-based model of pneumococcal carriage for planning a randomized trial of a whole-cell vaccine. PLoS Comput Biol. 2018;14:e1006333. doi: 10.1371/journal.pcbi.1006333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Daniels CC, Rogers PD, Shelton CM. A review of pneumococcal vaccines: current polysaccharide vaccine recommendations and future protein antigens. J Pediatr Pharmacol Ther. 2016;21:27–35. doi: 10.5863/1551-6776-21.1.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Martens P, Worm SW, Lundgren B, Konradsen HB, Benfield T. Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited. BMC Infect Dis. 2004;4:21. doi: 10.1186/1471-2334-4-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Feldman C, Anderson R. Review: current and new generation pneumococcal vaccines. J Infect. 2014;69:309–325. doi: 10.1016/j.jinf.2014.06.006. [DOI] [PubMed] [Google Scholar]
- 5.Bergmann S, Hammerschmidt S. Versatility of pneumococcal surface proteins. Microbiology. 2006;152(Pt 2):295–303. doi: 10.1099/mic.0.28610-0. [DOI] [PubMed] [Google Scholar]
- 6.Whatmore AM, Dowson CG. The autolysin-encoding gene (lytA) of Streptococcus pneumoniae displays restricted allelic variation despite localized recombination events with genes of pneumococcal bacteriophage encoding cell wall lytic enzymes. Infect Immun. 1999;67:4551–4556. doi: 10.1128/iai.67.9.4551-4556.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Kazemian H, Afshar D, Garcia E, et al. CbpM and CbpG of Streptococcus pneumoniae elicit a high protection in mice challenged with a serotype 19F pneumococcus. Iran J Allergy Asthma Immunol. 2018;17:574–585. [PubMed] [Google Scholar]
- 8.Kye YC, Park SM, Shim BS, et al. Intranasal immunization with pneumococcal surface protein A in the presence of nanoparticle forming polysorbitol transporter adjuvant induces protective immunity against the Streptococcus pneumoniae infection. Acta Biomater. 2019;90:362–372. doi: 10.1016/j.actbio.2019.03.049. [DOI] [PubMed] [Google Scholar]
- 9.Yu J, Chen X, Li B, et al. A pneumococcal vaccine combination with two proteins containing PspA families 1 and 2 can potentially protect against a wide range of Streptococcus pneumoniae strains. Immunol Res. 2018;66:528–536. doi: 10.1007/s12026-018-9016-5. [DOI] [PubMed] [Google Scholar]
- 10.Bogaert D, De Groot R, Hermans PW. Streptococcus pneumoniae colonisation: the key to pneumococcal disease. Lancet Infect Dis. 2004;4:144–154. doi: 10.1016/S1473-3099(04)00938-7. [DOI] [PubMed] [Google Scholar]
- 11.Gensollen T, Iyer SS, Kasper DL, Blumberg RS. How colonization by microbiota in early life shapes the immune system. Science. 2016;352:539–544. doi: 10.1126/science.aad9378. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Denapaite D, Bruckner R, Nuhn M, et al. The genome of Streptococcus mitis B6: what is a commensal? PLoS One. 2010;5:e9426. doi: 10.1371/journal.pone.0009426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zheng W, Tan TK, Paterson IC, et al. StreptoBase: an oral Streptococcus mitis group genomic resource and analysis platform. PLoS One. 2016;11:e0151908. doi: 10.1371/journal.pone.0151908. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Gosink KK, Mann ER, Guglielmo C, Tuomanen EI, Masure HR. Role of novel choline binding proteins in virulence of Streptococcus pneumoniae. Infect Immun. 2000;68:5690–5695. doi: 10.1128/iai.68.10.5690-5695.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Llull D, Lopez R, Garcia E. Skl, a novel choline-binding N-acetylmuramoyl-L-alanine amidase of Streptococcus mitis SK137 containing a CHAP domain. FEBS Lett. 2006;580:1959–1964. doi: 10.1016/j.febslet.2006.02.060. [DOI] [PubMed] [Google Scholar]
- 16.Kayhty H, Auranen K, Nohynek H, Dagan R, Makela H. Nasopharyngeal colonization: a target for pneumococcal vaccination. Expert Rev Vaccines. 2006;5:651–667. doi: 10.1586/14760584.5.5.651. [DOI] [PubMed] [Google Scholar]
- 17.Butler JC, Schuchat A. Epidemiology of pneumococcal infections in the elderly. Drugs Aging. 1999;15 Suppl 1:11–19. doi: 10.2165/00002512-199915001-00002. [DOI] [PubMed] [Google Scholar]
- 18.Tan TQ. Pediatric invasive pneumococcal disease in the United States in the era of pneumococcal conjugate vaccines. Clin Microbiol Rev. 2012;25:409–419. doi: 10.1128/CMR.00018-12. [DOI] [PMC free article] [PubMed] [Google Scholar]