Hydrogenosomal tail-anchored proteins are targeted to both mitochondria and ER upon their expression in yeast cells

Andrè Ferdigg; Kai S Dimmer; Doron Rapaport; Daniela G Vitali

doi:10.1371/journal.pone.0237982

. 2020 Aug 20;15(8):e0237982. doi: 10.1371/journal.pone.0237982

Hydrogenosomal tail-anchored proteins are targeted to both mitochondria and ER upon their expression in yeast cells

Andrè Ferdigg ¹, Kai S Dimmer ¹, Doron Rapaport ^1,^*, Daniela G Vitali ^1,^¤,^*

Editor: David Chau²

PMCID: PMC7446849 PMID: 32817700

Abstract

Some organisms, like Trichomonas vaginalis, contain mitochondria-related hydrogen-producing organelles, called hydrogenosomes. The protein targeting into these organelles is proposed to be similar to the well-studied mitochondria import. Indeed, S. cerevisiae mitochondria and T. vaginalis hydrogenosomes share some components of protein import complexes. However, it is still unknown whether targeting signals directing substrate proteins to hydrogenosomes can support in other eukaryotes specific mitochondrial localization. To address this issue, we investigated the intracellular localization of three hydrogenosomal tail-anchored proteins expressed in yeast cells. We observed that these proteins were targeted to both mitochondria and ER with a variable dependency on the mitochondrial MIM complex. Our results suggest that the targeting signal of TA proteins are only partially conserved between hydrogenosomes and yeast mitochondria.

Introduction

Mitochondria are essential organelles that evolved from the endosymbiosis of α-proteobacteria and ancestral archaea cells [1]. One of their main function is to produce ATP using oxygen as final electron acceptor. Under oxygen-restricted conditions, these organelles evolved to mitochondria-related organelles, such as hydrogenosomes, which produce ATP and hydrogen via fermentation [2, 3]. The most studied organism containing hydrogenosomes is the parasitic protist Trichomonas vaginalis that inhabits the human urogenital tract [4]. Like mitochondria, hydrogenosomes are surrounded by two membranes and import proteins post-translationally from the cytosol [5]. Interestingly, some key components of the mitochondria import machineries, such as subunits of the translocases of the outer and inner membranes (TOM and TIM complexes, respectively), are conserved between S. cerevisiae and T. vaginalis, although the two organisms belong to evolutionary very distant supergroups (Opistokonta and Excavata, respectively) [6, 7]. This observation underlies the relation in the evolution of both organelles [2, 7]. Despite such similarities, it is not clear whether the protein targeting signals are conserved between mitochondria and hydrogenosomes.

Proteomic analysis identified 70 putative hydrogenosomal membrane proteins in T. vaginalis, including 12 putative tail-anchored (TA) proteins [7, 8]. TA proteins are single span membrane proteins with a transmembrane segment (TMS) localized close to the C-terminus of the polypeptide. These proteins can be inserted into ER, mitochondrial, or peroxisomal membrane, and expose the large soluble domain towards the cytosol. Since the TMS, which contains the targeting information, is the last portion of the polypeptide to be released from the ribosome, TA proteins can be imported only post-translationally [9]. The physicochemical properties of the TMS and its flanking regions seem to dictate the target organelle for these proteins. ER TA proteins generally have longer and more hydrophobic TMS, while mitochondrial proteins are characterized by shorter and less hydrophobic TMS, flanked by positively charged residues on both sides. Finally, low hydrophobicity of the TMS, coupled with basic residues at the C-terminal element (CTE) directs TA proteins to peroxisomes [9, 10]. An additional feature, which seems to influence the targeting of TA proteins, is the helical content. The TMSs of mitochondrial and peroxisomal TA proteins tend to have lower helical content than those targeted to ER [11].

TA proteins follow different pathways of integration into the mitochondrial outer membrane (MOM) [12–14]. Fis1, for example, does not require any of the known import machineries and seems to be inserted in an unassisted manner that depends on the membrane lipid composition [14–16]. On the other hand, other TA proteins, like Gem1, Tom6, or Tom7 follow a route that partially involves the MIM complex [15, 17].

To study the conservation of the targeting information of TA proteins between hydrogenosomes and mitochondria, we expressed three T. vaginalis TA proteins in S. cerevisiae cells and assessed their subcellular localization. We observed that the hydrogenosomal TA proteins did not target only to mitochondria but also, to different extents, to the ER and peroxisomes. These findings suggest that the targeting signal of such proteins evolved independently in these two organelles.

Materials and methods

Yeast strains and growth conditions

Yeast strains used in this study were isogenic to Saccharomyces cerevisiae strains W303a/α or YPH499. Standard genetic techniques were used for growth and manipulation of yeast strains. Yeast cells were grown in synthetic medium S (0.67% [w/v] bacto-yeast nitrogen base without amino acids) with glucose (2% [w/v], D), galactose (2% [w/v], Gal), sucrose (2% [w/v], Suc), or glycerol (3% [w/v], G) as carbon source. Transformation of yeast cells was performed by the lithium acetate method. Table 1 includes a list of strains used in this study.

Table 1. Yeast strains used in this study.

Name	Mating type	Genetic background	Source or reference
fis1Δ	MATa	YPH499, ura3-52 lys2-801_amber ade2-101 _ochre trp1-D63 his3-D200 leu2-D1, fis1Δ::His3	[18]
W303a	MATa	ade2-1 can1-100 his3-11 leu2 3_112 trp1Δ2 ura3-52	Lab stock
mim1Δ	MATa	W303a, mim1Δ::His3	[19]
W303α	MATα	ade2-1 can1-100 his3-11 leu2 3_112 trp1Δ2 ura3-52	Lab stock
gem1Δ	MATα	W303α, gem1Δ::His3	This study

Open in a new tab

Drop dilution assay

Cells were grown in a liquid selective medium to logarithmic phase, harvested, resuspended in water to OD₆₀₀ = 1 and diluted fivefold in water. Subsequently, 5 μl of each cell suspension were spotted on solid media and the plates were incubated at the indicated temperature for 3 to 8 days.

Recombinant DNA techniques

The cDNAs of TA4 and TA10 were amplified by PCR with primers containing NcoI and SalI restriction sites, using pVagTag-2HA-TA4 and pVagTag-2HA-TA10 [8], respectively, as templates. The obtained DNA fragments were inserted downstream of the 3xHA tag into the yeast expression vector pYX142, digested with the same restriction enzymes. To construct the pYX142-3HA-TA7 plasmid, the coding sequence for TA7 was amplified by PCR from pTagVag-2HA-TA7 [8], using primers containing the restriction sites for EcoRI and NheI. This DNA fragment was inserted downstream of the 3xHA tag of the plasmid pRS316-FIS1pr-3HA-Fis1(cyt)-FIS1ter [15], which was digested with the same restriction enzymes. Finally, the DNA fragment coding for 3xHA-TA7 was subcloned into the pYX142 vector using XmaI and NheI restriction sites. The plasmids pYX142-eGFP-TA4, pYX142-eGFP-TA7, and pYX142-eGFP-TA10 were obtained by amplifying the coding sequences of TA4, TA7, and TA10 from pYX142-3HA-TA4, pYX142-3HA-TA7, and pYX142-3HA-TA10, respectively, with primers containing BamHI and SalI restriction sites, and inserting them into the pYX142-eGFP plasmid, downstream the eGFP coding sequence.

The plasmids pRS316-FIS1pr-3HA-Gem1(cyt)-TA7(TMS)-FIS1ter and pRS316-FIS1pr-3HA-Gem1(cyt)-TA10(TMS)-FIS1ter were obtained by replacing the sequence coding for Fis1(TMS) of the pRS316-FIS1pr-3HA-Gem1(cyt)-Fis1(TMS)-FIS1ter [15] with the sequences encoding for the TMS, including part of the N-terminal element (NTE) and the whole CTE, of either TA7 or TA10 amplified from the plasmids pYX142-3HA-TA7 and pYX142-3HA-TA10, respectively. Primers containing SalI and HindIII restriction sites were used. To clone the pRS316-FIS1pr-3HA-Gem1(cyt)-TA4(TMS)-FIS1ter plasmid, the sequence encoding the TMS and its flanking regions was amplified from the plasmid pYX142-3HA-TA4, with primers harbouring SalI and XhoI restriction sites and inserted in-frame into the pRS316-FIS1pr-3HA-Gem1(cyt) plasmid lacking the STOP codon. Subsequently, the Fis1 terminator was amplified by PCR from pRS316-FIS1pr-3HA-Gem1(cyt)-Fis1(TMS)-FIS1ter [15] with primers containing XhoI and KpnI restriction sites and inserted into the pRS316-FIS1pr-3HA-Gem1(cyt)-TA4(TMS) plasmid.

The plasmid pRS316-FIS1pr-3HA-Gem1(cyt)-FIS1ter was obtained by amplifying from the pRS316-FIS1pr-3HA-Gem1(cyt)-TA4(TMS)-FIS1ter plasmid the sequence corresponding to the portion of Gem1(cyt), downstream the NheI cutting site (present in GEM1 gene), with primers containing NheI and HindIII restriction sites. To remove the sequence encoding the TA4(TMS) sequence, the PCR product was inserted into the pRS316-FIS1pr-3HA-Gem1(cyt)-TA4(TMS)-FIS1ter plasmid, digested with the same restriction enzymes. Tables 2 and 3 contain lists of the plasmids and primers, respectively, used in this study.

Table 2. Plasmids used in this study.

Plasmids	Promoter	Coding sequence (aa)	Markers	Source or reference
pYX142-3HA-TA4	TPI	3HA-TA4 full lengh	LEU2, Amp^R	This study
pYX142-3HA-TA7	TPI	3HA-TA7 full lengh	LEU2, Amp^R	This study
pYX142-3HA-TA10	TPI	3HA-TA10 full lengh	LEU2, Amp^R	This study
pYX132-Fis1(TMC)	TPI	Fis1 with a single Cys in the TMS	TRP1, Amp^R	[16]
pYX142-eGFP-TA4	TPI	GFP-TA4 full lengh	LEU2, Amp^R	This study
pYX142-eGFP-TA7	TPI	GFP-TA7 full lengh	LEU2, Amp^R	This study
pYX142-eGFP-TA10	TPI	GFP-TA10 full lengh	LEU2, Amp^R	This study
pRS426-mt-RFP	TPI	Mt-RFP	URA3, Amp^R	Lab stock
pRS416-HDEL-dsRed	-	HDEL-dsRed	URA3, Amp^R	Lab of Maya Schuldiner
RFP-PTS1	-	RFP-PTS1	URA3, Amp^R	Lab of Maya Schuldiner
pRS316-3HA-Gem1	FIS1pr	3HA-Gem1 full lengh	URA3, Amp^R	[15]
pRS316-3HA-Gem1(cyt)-TA4(TMS)	FIS1pr	3HA-Gem1(1–634) + TA4(393–434)	URA3, Amp^R	This study
pRS316-3HA-Gem1(cyt)-TA7(TMS)	FIS1pr	3HA-Gem1(1–634) + TA7(288–323)	URA3, Amp^R	This study
pRS316-3HA-Gem1(cyt)-TA10(TMS)	FIS1pr	3HA-Gem1(1–634) + TA10(156–188)	URA3, Amp^R	This study
pRS316-3HA-Gem1(cyt)	FIS1pr	3HA-Gem1(1–634)	URA3, Amp^R	This study

Open in a new tab

Table 3. Primers used in this study.

Primer name	Sequence (5’-3’)	Note
NcoITA4F	`GGGGGCCATGGATGGATATTGAGCATTCCGTGC`	Amplification of TA4, NcoI restriction site at 5’
BamHITA4F	`GGGGGGGATCCATGGATATTGAGCATTCCGTGC`	Amplification of TA4, BamHI restriction site at 5’
SalITA4R	`CCCCCGTCGACTTATTCTTTCTTCTTTGCTACTTTTGTG`	Amplification of TA4, SalI restriction site at 5’
EcoRITA7F	`GGGGGGAATTCATGGAGAACGCATTTTTGATGACTC`	Amplification of TA7, EcoRI restriction site at 5’
NheITA7R	`CCCCCGCTAGCTTATTTATGATTCATGAAGCGCTTAATACC`	Amplification of TA7, NheI restriction site at 5’
BamHITA7F	`GGGGGGGATCCATGGAGAACGCATTTTTGATGACTC`	Amplification of TA7, BamHI restriction site at 5’
SalITA7F	`GGGGGGTCGACATGGAGAACGCATTTTTGATGACTC`	Amplification of TA7, SalI restriction site at 5’
NcoITA10F	`GGGGGCCATGGATGGAAGCTGCTAAAGAGGCTG`	Amplification of TA10, NcoI restriction site at 5’
BamHITA10F	`GGGGGGGATCCATGGAAGCTGCTAAAGAGGCTG`	Amplification of TA10, BamHI restriction site at 5’
SalITA10R	`CCCCCGTCGACTTATTTTTTCTCATCTTTGCAGAATATGATAAC`	Amplification of TA10, SalI restriction site at 5’
EcoRIGFPF2	`GGGGGGAATTCATGAGTAAGGGTGAAGAAC`	Amplification of eGFP, EcoRI restriction site at 5’
BamHIGFPR	`CCCCCGGATCCTTTGTATAGTTCATCCATGC`	Amplification of eGFP, BamHI restriction site at 5’
SalITA4TMDF	`GGGGGGTCGACTACAGACAAACGGCTTACGGTGAACCTAAGCCAAC`	Amplification of TMD of TA4, SalI restriction site at 5’
XhoITA4R	`CCCCCCTCGAGTTATTCTTTCTTCTTTGCTACTTTTGTG`	Amplification of TMD of TA4, XhoI restriction site at 5’
XhoIFis1TerF	`GGGGGCTCGAGATAAAAAATCAGCACATACGTACATACATAAGAATG`	Amplification of Fis1 terminator, XhoI restriction site at 5’
KpnIFis1TerR	`CCCCCGGTACCATCTCACAATACAGTATTACGATTTAACAATAGACTATTG`	Amplification of Fis1 terminator, KpnI restriction site at 5’
SalITA7TMDF	`GGGGGGTCGACTACAGACAAACGGCTAATCTTTCTAAAGTTGGAATTTC`	Amplification of TMD of TA7, SalI restriction site at 5’
HindIIITA7R	`CCCCCAAGCTTTTATTTATGATTCATGAAGCGCTTAATACC`	Amplification of TMD of TA7, HindIII restriction site at 5’
SalITA410MDF	`GGGGGGTCGACTACAGACAAACGGCTCAAGAAAAACTTAACTCATTC`	Amplification of TMD of TA10, SalI restriction site at 5’
HindIIITA10R	`CCCCCAAGCTTTTATTTTTTCTCATCTTTGCAGAATATGATAAC`	Amplification of TMD of TA10, HindIII restriction site at 5’
Gem1for2NheI	`GGGGGCTAGCACAATGGAGTATGACG`	Amplification of Gem1(cyt), NheI restriction site at 5’
Gem1rev2	`GGGAAGCTTTCAAGCCGTTTGTCTGTAGTCGAC`	Amplification of TMD of TA10, HindIII restriction site at 5’

Open in a new tab

Subcellular fractionation

Isolation of mitochondria from yeast cells was performed by differential centrifugation, as previously described [20]. To obtain highly pure mitochondria, isolated organelles were layered on top of a Percoll gradient and isolated according to a published procedure [21]. The post-mitochondrial fraction was clarified at 18000 x g for 15 min at 2°C and subsequently subjected to ultracentrifugation at 200000 x g for 1 h at 2°C. A sample of the supernatant was collected as cytosolic fraction. To isolate the microsomes, the pellet was resuspended in 3 ml of SEM buffer (250 mM sucrose, 1 mM EDTA, 10 mM MOPS, pH 7.2) with 2 mM phenylmethylsulfonyl fluoride (PMSF), homogenised with a douncer homogenizer and clarified at 18000 x g for 20 min at 4°C. Fractions corresponding to the cytosol, microsomes, and the whole cell lysate were precipitated with chloroform and methanol and resuspended in 2x sample buffer, heated for 10 min at 95°C, and analysed by SDS-PAGE and immunoblotting.

Crude mitochondria preparation

Cells were grown in liquid media to logarithmic phase, harvested, and resuspended in SEM buffer with 2 mM PMSF. The cells were ruptured with glass beads (Ø 0.25–0.5 mm) using FastPrep-24 5G (MP Biomedicals) for 40 sec, 6.0 m/sec. To remove glass beads and cell debris, the samples were clarified (1000 x g, 3 min, 4°C). The supernatant was then centrifuged (13200 x g, 10 min, 4°C) and the pellet, corresponding to the crude mitochondrial fraction, was resuspended in a 2x sample solution, heated at 95°C for 10 min, and analysed by SDS-PAGE and immunoblotting.

In other cases, like for the fractionations described in Fig 4B, cells were grown to logarithmic phase, harvested, and resuspended in resuspension buffer (100 mM Tris, 10 mM DTT). After harvesting the cells, they were resuspended in spheroblasting buffer (1.2 M Sorbitol, 20 mM KPI, pH 7.2) containing zymolyase (4.5 g/ml) and incubated at 30°C for 1 h. Spheroblasted cells were then resuspended in homogenization buffer (0.6 M Sorbitol, 10 mM Tris pH 7.4, 1 mM EDTA, 0.2% fatty acid free BSA, 1 mM PMSF, 1x cOmplete protease inhibitor) and homogenized with a douncer. After a clarifying spin (600 x g, 5 min, 4°C), crude mitochondria were isolated by centrifugation (18000 x g, 10 min, 4°C). Whole cell lysate and cytosolic fractions were precipitated with chloroform and methanol, resuspended with 2x sample buffer, heated for 10 min at 95°C, and analysed by SDS-PAGE and immunoblotting.

Western blotting and immunodecoration

Protein samples for immunodecoration were analyzed by either 10% or 12.5% SDS-PAGE and subsequently transferred onto nitrocellulose membranes by semi-dry Western blotting. Proteins were detected by blocking the membrane with 5% skim milk and subsequently incubating them first with primary antibodies and then with horseradish peroxidase-conjugates of goat anti-rabbit or goat anti-rat secondary antibodies. Band intensities were quantified with the AIDA software (Raytest). Table 4 contains a list of the antibodies used in this study.

Table 4. Antibodies used in this study.

Antibodies	Dilution	Source
polyclonal rat anti-HA	1 : 1000	11867423001 (Roche)
polyclonal rabbit anti-Fis1	1 : 1000	Lab stocks
polyclonal rabbit anti-Bmh1	1 : 1500	Lab stocks
polyclonal rabbit anti-Erv2	1 : 2000	Lab of Roland Lill
polyclonal rabbit anti-Pdi1	1 : 3000	Lab of Blanche Schwappach
polyclonal rabbit anti-Tom20	1 : 5000	Lab stocks
polyclonal rabbit anti-Aco1	1 : 7000	Lab stocks
polyclonal rabbit anti-Mcr1	1 : 2000	Lab of Carla Koehler
polyclonal rabbit anti-Tom70	1 : 5000	Lab stocks
polyclonal rabbit anti-Hep1	1 : 3000	Lab of Kai Hell
polyclonal rabbit anti-Por1	1 : 3000	Lab stocks
polyclonal rabbit anti-Tom40	1 : 4000	Lab stocks
Horseradish peroxidase coupled goat-ant-rabbit	1 : 10000	1721019 (Bio-rad)
Horseradish peroxidase coupled goat-ant-rat	1 : 3000	1721011 (Bio-rad)

Open in a new tab

Protease protection assay

A sample (50 or 100 μg) of either mitochondria or microsomes was resuspended in 100 μl of SEM buffer in the presence or absence of 1% Triton X-100. The samples were supplemented with Proteinase K (50 μg/ml) and incubated on ice for 30 min. The proteolytic reaction was stopped with 5 mM PMSF. The samples were then precipitated with trichloroacetic acid (TCA) and resuspended in 40 μl of 2x sample buffer, heated for 10 min at 95°C, and analyzed by SDS-PAGE and immunoblotting.

Alkaline extraction

Mitochondria or microsomes fractions (50 or 100 μg) were resuspended in 100 μl of buffer containing 10 mM HEPES-KOH, 100 mM Na₂CO₃, pH 11.5, and incubated for 30 min on ice. The membrane fraction was pelleted by centrifugation (76000 x g, 30 min, 2°C) and the supernatant was precipitated with TCA. Both fractions were resuspended in 40 μl of 2x sample buffer, heated for 10 min at 95°C, and analysed by SDS-PAGE and immunoblotting.

Glycosylation assay

To test for glycosylation of proteins, 50 or 100 μg of microsomes fraction were resuspended in 10 μl glycoprotein denaturing buffer (0.5% SDS, 40 mM DTT) and incubated for 10 min at 95°C. Then, the samples were supplemented with 500 units of either Endoglycosidase H (EndoH) or Peptide:N-Glycosidase F (PNGase) (New England BioLabs) in the respective buffer (according to the manufacturer’s instructions) and incubated for 1 h at 37°C. At the end of the incubation period, the samples were precipitated with TCA, resuspended in 40 μl of 2x sample buffer, heated for 10 min at 95°C, and analysed by SDS-PAGE and immunoblotting.

Fluorescence microscopy

Yeast cultures were grown to logarithmic phase in galactose-containing media and mixed on a glass slide in a 1:1 (v/v) ratio with 1% low melting point agarose. Fluorescence images were acquired with spinning disk microscope Zeiss Axio Examiner Z1 equipped with a CSU-X1 real-time confocal system (Visitron), VS-Laser system, and SPOT Flex CCD camera (Visitron Systems). Images were analysed with VisiView software (Visitron).

Results and discussion

In yeast cell TA4 localizes to the ER with an inverted topology

Recently, several putative tail-anchored proteins residing in the hydrogenosomes of T. vaginalis were identified [8]. To study the conservation of the targeting of TA proteins between T. vaginalis and S. cerevisiae, we expressed in yeast cells out of the five newly identified hydrogenosomal proteins the three proteins that have less hydrophobic TMS, a typical characteristic of mitochondrial TA proteins, and investigated their localization and topology. Since we do not have antibodies against these proteins, we N-terminally tagged them with three hemagglutinin epitopes (3xHA).

First, we analysed TA4 and either a plasmid expressing this protein, or an empty plasmid as a control, were transformed into yeast wild-type (WT) cells. Surprisingly, when the subcellular localization of TA4 was monitored, we observed that this protein was mainly enriched in the ER (microsomes) fraction and only a minor portion was found in mitochondria (Fig 1A). Absence of a signal for cells harbouring an empty plasmid confirmed specificity. To confirm the successful separation of the cellular compartments, the mitochondrial TA protein Fis1, the ER protein Erv2, and the cytosolic protein Bmh1, were detected, as expected, in their respective fractions.

Fig 1 — (A) Fractions corresponding to whole cell lysate (WCL), cytosol (cyt), microsomes (micro), and mitochondria (mito) were isolated from WT cells transformed with either an empty plasmid (Ø) or a plasmid expressing 3HA-TA4. The same amount of each fraction was analysed by Western blot and immunodecoration with the indicated antibodies. The mitochondrial protein Fis1, the cytosolic protein Bmh1, and the ER protein Erv2 were used as markers. (B) WCL, cytosol, microsomes and mitochondria fractions were isolated from *fis1Δ* cells overexpressing Fis1(TMC), analysed by Western blot, and immunodecorated with the indicated antibodies. Tom40 is a mitochondrial marker. (C) Representative fluorescence microscopy images of WT cells co-transformed with plasmids encoding GFP-TA4 and a plasmid encoding mitochondrial marker (mt-RFP), ER marker (HDEL-RFP), or peroxisomal one (RFP-PTS1). (D) Alkaline extraction of microsomal fraction isolated from WT cells expressing 3HA-TA4. Pellet (P) and supernatant (S) fractions were analysed by Western botting and immunodecoration with the indicated antibodies. Erv2, ER membrane protein; Pdi1, soluble ER protein. (E) Microsomes isolated from WT cells were treated with PK in the presence or absence of TritonX-100 (TX) and analysed by Western blot and immunodecoration with the indicated antibodies. (F) Microsomes isolated from cells expressing 3HA-TA4 were treated with the enzymes EndoH or PNGase and analysed by Western blot and immunodecoration. The glycosylated protein Pdi1 was used as a control. (G) Mitochondria isolated as in (A) were treated with PK as described in (E) or were subjected to alkaline extraction as described in (D). Samples were analysed by Western blot and immunodecoration with the indicated antibodies. Tom20 is a MOM protein facing the cytosol, while Aconitase is a soluble matrix protein. (H) Top panel. Crude mitochondria isolated from WT and *mim1Δ* cells expressing 3HA-TA4 were analysed by Western blot. The MOM proteins Tom20, Fis1, and Por1 were used as controls. Tom20 is a known MIM substrate. Bottom panel. The steady state levels of 3HA-TA4 and Tom20 were quantified, normalized with PonceauS staining, and presented as percentage of their levels in WT cells. The values represent the average of at least three independent experiments and error bars the standard deviation (SD). **** P ≤ 0.0001.

Given that the hydrogenosomal proteins were expressed under a strong promoter (TPIpr), it is possible that their ER localization is caused by the high protein levels. To exclude this possibility, we expressed under the same promoter the mitochondrial TA protein Fis1 in a strain deleted for the endogenous protein (fis1Δ). As shown in Fig 1B, despite its overexpression, Fis1 is found solely in the mitochondrial fraction suggesting that the ER location of the hydrogenosomal protein TA4 cannot be explained solely by its high expression levels.

Detecting the subcellular localization of GFP-tagged TA4 by fluorescence microscopy confirmed that the protein was targeted to ER and mitochondria, as shown by co-localization with an ER (HDEL-RFP) and a mitochondrial targeted RFP (mt-RFP) (Fig 1C). Although TA proteins can be targeted also to peroxisomes, the absence of co-localization with a peroxisomal targeted RFP (RFP-PTS1) indicates that TA4 is not targeted to these organelles (Fig 1C). Additionally, we observed a large amount of the GFP signal in the vacuole, suggesting that a subpopulation of the protein was degraded in the vacuole. We concluded that, in yeast cells, HA-TA4 is mainly localized to the ER and only partially to mitochondria, contrary to the situation in T. vaginalis where it was found exclusively in hydrogenosomes [8]. This implies that the targeting signals and their decoding are not completely conserved between T. vaginalis and S. cerevisiae.

Subsequently, we investigated the topology of HA-TA4 in the ER. Employing alkaline extraction of microsomes isolated from cells expressing HA-TA4, we could confirm that the protein is embedded in the ER membrane. TA4 was detected in the pellet, as the membrane protein Erv2, while the soluble protein Pdi1 was found in the supernatant (Fig 1D). Additionally, upon treatment of isolated microsomes with proteinase K (PK), we noted that the protein is protected, similar to the ER luminal protein Erv2 (Fig 1E). The addition of the detergent Triton-X to the reaction allowed the protease to degrade both proteins, confirming that they were protected by the membrane. These observations strongly suggested that TA4 is inserted into the ER membrane such that its soluble domain is exposed to the ER lumen. This phenomenon is not surprizing, since we observed previously that heterologous mitochondrial TA proteins, like the rat cytochrome b5-RR, expressed in yeast cells can be partially localised to the ER, with an inverted topology [22].

Interestingly, we detected a higher molecular weight species of HA-TA4, mostly in the ER fraction (Fig 1A). We hypothesized that this slower migrating species could result from post-translational modification, possibly glycosylation. To test this idea, microsomes harbouring HA-TA4 were treated with Endoglycosidase H (EndoH) or Peptide:N-Glycosidase F (PNGase). As expected, we observed a shift in the migration of the known glycosylated protein Pdi1, while Erv2 was not affected by the treatment (Fig 1F). Interestingly, both bands corresponding to HA-TA4 were detected also after the enzymatic treatment, indicating that this protein is not glycosylated and the shift in the migration is probably the consequence of another posttranslational modification.

Next, we investigated the topology of TA4 in the mitochondrial fraction. Also in this case, the HA signal was not affected by PK treatment, unless Triton-X was present, and the protein was found in the pellet fraction of the alkaline extraction assay (Fig 1G). As controls, we used the MOM protein Tom20, which is exposed to the cytosol and the matrix soluble protein Aconitase. These results suggest that in yeast cells, HA-TA4 assumes in both ER and mitochondria a topology with the N-terminal soluble domain facing the lumen or the IMS, respectively.

Recently, it has been observed that the MIM complex is required for the insertion of single-span proteins, including the TA protein Gem1, into the MOM [15, 17]. Therefore, we tested whether the deletion of Mim1, the central component of the MIM complex, affects the mitochondrial levels of HA-TA4. We isolated crude mitochondria from either WT or mim1Δ cells expressing HA-TA4 and analysed the steady state levels of this protein. As expected, the levels of the known MIM-substrate Tom20 were significantly reduced in the deletion strain, while Fis1 (a MIM-independent TA protein) was not affected (Fig 1H). Interestingly, the steady state levels of HA-TA4 were unaltered in the absence of Mim1, suggesting that the small portion of this hydrogenosomal TA protein, which is inserted into the MOM, does not require the assistance of the MIM complex. Indeed, it is possible for TA proteins to insert into the MOM in an unassisted way. A well-studied example is Fis1, which does not require any know import machinery and its targeting depends on the ergosterol content of the membrane [14–16].

In conclusion, TA4 is recognized in yeast cells mainly as an ER protein, while it can insert also into the MOM in a MIM-independent way. Notably, TA4 inserts with an inverted topology into the membrane of both organelles.

TA7 behaves like a mitochondrial TA protein

We then turned to TA7 and observed by subcellular fractionation that once expressed in yeast cells it is found mainly in mitochondria, with a minor fraction in the ER (Fig 2A). As controls for the purity of the isolated fractions, we used the mitochondrial protein Tom70, the ER protein Erv2, and the cytosolic protein Hexokinase. The localization of TA7 in yeast mitochondria was confirmed by fluorescence microscopy and co-localization of a GFP-tagged version of the protein with mt-RFP but not with HDEL-RFP (Fig 2B). Interestingly, TA7 was also found in peroxisomes (Fig 2B). These observations suggest that the targeting signal of the hydrogenosomal protein TA7 is recognized by mitochondrial and peroxisomal targeting machineries, while it is not a substrate of the ER system. The dual targeting of TA proteins to mitochondria and peroxisomes has been observed previously for the endogenous yeast proteins Fis1 and Gem1 [23] and is not surprising, since the targeting information for both organelles is a short, moderately hydrophobic TMS flanked by positive charges. Indeed, TA7 has a TMS with low hydrophobicity, moderate helical content, and positively charged CTE (Table 5). These characteristics explain the dual targeting of this protein to both mitochondria and peroxisomes.

Fig 2 — (A) Subcellular fractionation of WT cells transformed with either an empty plasmid (Ø) or a plasmid encoding 3HA-TA7 was performed as described in Fig 1A. Tom70 and Hexokinase are mitochondrial and cytosolic proteins, respectively. (B) Representative fluorescence microscopy images of WT cells co-transformed with plasmids encoding GFP-TA7 and mt-RFP, HDEL-RFP, or RFP-PTS1. (C) Alkaline extraction of microsomal fractions isolated from WT cells expressing 3HA-TA7 was performed and analysed as described in Fig 1D. (D) Microsomes isolated from WT cells expressing 3HA-TA7 were treated and analysed as described in Fig 1E. (E) Mitochondria isolated as in (A) were treated and analysed as described in Fig 1G. Hep1 is a soluble matrix protein. (F) Top panel. Whole cell lysate (WCL), cytosol (cyt) and crude mitochondria (mito) were isolated from WT and *mim1Δ* cells expressing 3HA-TA7 and analysed by Western blot and immunodecoration. Bottom panel. The intensity of the bands corresponding to 3HA-TA7 and Tom20 in crude mitochondria from at least three independent experiments as in the top panel were quantified and normalized with PonceauS staining. The values are presented as percentage of their levels in WT cells. Error bars represent ±SD. ** P ≤ 0.01; **** P ≤ 0.0001.

Table 5. Physicochemical features of hydrogenosomal and mitochondrial TA proteins.

	Hydrogenosomal proteins			Mitochondrial proteins
	TA4	TA7	TA10	Fis1	Gem1
Sequence TMS^a	FIGTMVAIGVGA, GLATHWLI	GISKPLIVGGAV, IAAGFLLYKGI	FYNKFWGIFSVV, AFFGVIIF	GVVVAGGVLAGA, VAVASFFL	TALIFGSTVGFV, ALCSFTLMKLF
Position of TMS (a.a.)^a	403–422	293–315	162–181	131–150	633–655
TMS length (a.a.)^a	20	23	20	20	23
GRAVY of TMS^b	1.63	1.41	1.68	2.25	1.69
Agadir score of TMS^c1	0.23	0.58	0.24	0.30	0.40
Agadir score of TMS^c2	0.21	0.54	0.22	0.27	0.35
Sequence CTE^d	KLITKVAKKKE	KRFMNHK	CKDEKK	RNKRR	KSSKFSK
CTE length (a.a.)^d	11	7	6	5	7
Net charge of CTE^d	+4	+3	+1	+4	+3
Sequence NTE (10 a.a.)^e	YGEPKPTDWK	HGIPFNLSKV	NEQNQEKLNS	EDKIQKETLK	TAAKDVDYRQ
Net charge of NTE^e	0	+1	-1	0	0

Open in a new tab

^a, TMS predicted according to TMHMM Server v. 2.0 (www.cbs.dtu.dk/services/TMHMM/)

^b, GRAVY, grand average of hydropathy (www.gravy-calculator.de)

^c1, Agadir score, % helical content was calculated at pH 7.5, 298 K, ionic strength 0.15 M using the Agadir prediction algorithm (http://agadir.crg.es) [24–27]

^c2, Agadir score, % helical content was calculated at pH 7.3, 303 K, ionic strength 0.15 M using the Agadir prediction algorithm (http://agadir.crg.es) [24–27]

^d, CTE, C-terminal element

^e, NTE, N-terminal element

Subsequently, we investigated the topology of this protein in mitochondria and ER. Alkaline extraction of the microsomal fraction confirmed that HA-TA7, as Erv2, is a membrane associated protein, while the soluble protein Pdi1 was found in the soluble fraction (Fig 2C). Additionally, when we treated the ER fraction with PK, we could observe that the HA signal completely disappeared, indicating that the N-terminal domain of TA7 is facing the cytosol, as in a canonical TA protein (Fig 2D). As expected, Erv2 was protease-resistant and its band disappeared only after treatment with Triton-X and PK. Analogous experiments with isolated mitochondria revealed that also in this organelle HA-TA7 adopts a classical TA topology. It was sensitive to PK, as the control protein Tom20, while the matrix protein Hep1 was protected from the protease, unless Triton-X was added (Fig 2E). Moreover, HA-TA7 was found in the pellet fraction after alkaline extraction, suggesting that it is a membrane-embedded protein (Fig 2E). In conclusion, TA7 behaves in yeast cells as a classical mitochondrial TA protein, suggesting that its targeting signal resembles that of a yeast mitochondrial TA protein. Of note, this signal is not highly specific, as a small fraction of TA7 is targeted also to both ER and peroxisomes.

To further investigate the insertion of TA7 into the MOM, we isolated crude mitochondria from WT and mim1Δ cells expressing HA-TA7 and analysed the steady state levels of the protein. Interestingly, we could observe a significant reduction (about 40%) of the amounts of HA-TA7 in the deletion strain, suggesting a role for the MIM complex in the insertion of TA7 into the MOM (Fig 2F). This finding substantiates a role for the MIM complex in the biogenesis of some mitochondrial TA proteins and its ability to also recognize T. vaginalis proteins. This result further suggests that, although the MIM complex is conserved only in fungi, it is able to recognize and process substrates from organisms that do not contain a homologous machinery. Despite recent efforts to identify the hydrogenosomal protein import machineries, no MIM complex has been identified yet [2, 7]. Therefore, most likely a protein or a protein complex, performing the same functions of the MIM complex evolved independently in T. vaginalis, as a result of convergent evolution. Support for this hypothesis came from our recent findings that the parasitic kinetoplastid T. brucei has a functional MIM orthologue, pATOM36, which does not share any sequence similarities with the two subunits of the MIM complex [28].

TA10 is equally distributed between ER and mitochondria

The TMS of TA10 has similar hydrophobicity, helical content, and length as that of TA4, although it has a shorter and less charged CTE (Table 5). Hence, we were interested to study whether these proteins are targeted to the same organelles in yeast. The subcellular fractionation of cells expressing HA-TA10 revealed that this protein is equally distributed between ER and mitochondria (Fig 3A). Of note, the mitochondrial protein Por1 and the ER protein Erv2, which served as control marker proteins, were detected only in their respective compartment. Surprisingly, we observed that the signal corresponding to HA-TA10 migrated at an apparent molecular weight of approximately 38 kDa although the expected one was 25 kDa. We re-analysed our construct and currently cannot explain this difference. The localisation of TA10 in both ER and mitochondria was further confirmed by fluorescence microscopy where co-localization of GFP-TA10 with both mitochondrial and ER markers was observed (Fig 3B). Of note, this hydrogenosomal protein did not show any localization to peroxisomes (Fig 3B).

Next, we investigated the topology of HA-TA10 in the ER membrane and observed that the protein is membrane-embedded and protected from the PK treatment, suggesting that the N-terminal domain is facing the lumen of the organelle (Fig 3C). Moreover, we noticed that the protein molecules localized in the ER had an apparent molecular weight higher than those detected in mitochondria (Fig 3A), suggesting a posttranslational modification in the ER. Indeed, we could demonstrate that HA-TA10 is glycosylated in the ER in yeast. Treatment with either EndoH or PNGase resulted in a migration shift, comparable to the one observed for the control glycosylated protein Pdi1 (Fig 3D). Given that the N-terminus of the protein is facing the lumen of the ER (Fig 3C), it is likely that this large soluble domain is glycosylated. However, the analysis of the sequence of TA10 with NetNGlyc 1.0 Server did not reveal any predicted glycosylation site.

Surprisingly, PK treatment of the mitochondrial fraction caused a reduction but not a complete loss of the HA-TA10 signal (Fig 3E). Additionally, the protein was detected in both the pellet and the supernatant fractions after alkaline extraction (Fig 3E). These findings suggest that about half of the mitochondrial-associated HA-TA10 molecules were not completely embedded in the membrane and that a small portion was inserted with a conformation that allows the protein to be protease-resistant due to either folding or a topology with the soluble domain facing the IMS. Taken together, these findings indicate that, similarly to TA4, TA10 can be targeted in yeast to both ER and mitochondria, where it can acquire an inverted topology.

We then investigated the effect of the loss of the MIM complex on the targeting of this hydrogenosomal protein to mitochondria. Interestingly, we could not observe a significant reduction of the levels of TA10 in crude mitochondria isolated from mim1Δ strain (Fig 3F), suggesting that the fraction of the protein that is inserted into the MOM, follow a MIM-independent pathway.

The TMSs of the hydrogenosomal proteins can functionally replace the TMS of the mitochondrial TA protein Gem1

To confirm the potential of the hydrogenosomal proteins to correctly insert into the MOM, we tested the capacity of their TMSs to functionally replace the TMS of the mitochondrial TA protein Gem1. We investigated by serial dilutions the ability of these constructs to rescue the growth defect of a strain deleted for GEM1. WT or gem1Δ cells transformed with an empty plasmid, a vector encoding native Gem1, or the hybrid proteins, were spotted on a medium containing glycerol as carbon source, a condition that requires functional mitochondria. As expected, gem1Δ cells displayed a growth defect on non-fermentable carbon source at higher temperatures (Fig 4A, SG-Ura, 37°C) [29]. Of note, the hybrid proteins containing the TMS from the hydrogenosomal TA proteins rescued this phenotype as well as a plasmid-encoded native Gem1 (Fig 4A), suggesting that the TMS of those proteins is sufficient for the correct insertion of the hybrid protein into the MOM. To substantiate the contribution of the TMS for the complementation of the growth defect, we verified that a protein that contains only the cytosolic domain of Gem1 was unable to rescue the growth phenotype of gem1Δ cells (Fig 4B). Although the TMS-containing chimeras were detected at rather lower levels compared to Gem1, they were enriched in crude mitochondria, suggesting that the targeting of Gem1 was not altered by the exchange of the TMS (Fig 4C). Nevertheless, since the isolated crude mitochondria contain ER contaminations, as shown by the presence of Erv2, we cannot test whether a portion of the chimeras was mis-localised to the ER.

It is rather surprising that the TMS of TA4 and TA10 could support the rescue of the loss of Gem1, since sub-populations of these proteins are either mis-localised to the ER (Figs 1A, 1C, 3A and 3B), or inserted into the MOM with the soluble domain mainly facing the IMS (Figs 1G and 3E), while Gem1 is a classical TA protein, exposed to the cytosol. This observation suggests that a small portion of the TMS of TA4 or TA10 correctly inserted into the MOM is sufficient to support function. These chimeras are expressed under the control of the promoter of Fis1, a protein about 20 fold more abundant than Gem1 [30]. Therefore, it is sufficient that a minor fraction of these chimeras inserts into MOM to provide physiological like amounts of Gem1 at the MOM. Alternatively, it might be possible that the soluble domain of Gem1 contributes to the canonical TA-like orientation of the hybrid protein.

Conclusions

This work revealed that the targeting signal of hydrogenosomal TA proteins is not completely conserved in yeast. In fact, all the three tested proteins are targeted in S. cerevisiae, to different extents, to ER, mitochondria, and peroxisomes. This is surprising since their TMSs have a low helical content and a very moderate hydrophobicity, hallmarks of mitochondrial TA proteins, and their hydrophobicity is even lower than that of the TMSs of Fis1 and Gem1 (Table 5). Elevated hydrophobicity and high helical content of the TMS in turn are considered to be characteristics of ER tail-anchored proteins [10, 11]. The only protein behaving in yeast as a mitochondrial TA protein is TA7. Its TMS has very low hydrophobicity and its CTE has net positive charge. Surprisingly, the helical content of TA7 is relatively high, even compared to the yeast TA proteins. The low hydrophobicity coupled with moderate helical content and positive CTE are a typical targeting signal for peroxisomal TA proteins. Indeed, TA7 is the only hydrogenosomal TA protein localised upon its expression in yeast also in peroxisomes. Given the absence of peroxisomes in T. vaginalis [31], it is possible that in this organism no specific protein targeting signal for avoiding peroxisomes, evolved. Therefore, in yeast cells, the targeting information of TA7 could be ambiguous and be recognized both as a mitochondrial and a peroxisomal signal. Similarly to Gem1 [15, 17], TA7 is the only T. vaginalis protein requiring the MIM complex for its insertion. Since an orthologue of such a complex has not been identified yet in hydrogenosomes, most probably a complex without sequence similarity to the Mim proteins mediates the integration of TA7 to the hydrogenosomes membrane. Nevertheless, the absence of the MIM complex only partially affects the mitochondrial fraction of the hydrogenosomal protein, suggesting the presence of at least one additional redundant pathway, or the ability of these proteins to insert into the lipid bilayer in an unassisted manner, similar to Fis1.

It remains elusive why, despite their rather moderate hydrophobic TMS and low helical content, both TA4 and TA10 are not targeted exclusively to mitochondria. As shown in Table 5, the TMSs of these hydrogenosomal proteins do have similar length and hydrophobicity as those of the mitochondrial TA proteins Gem1. Likewise, also other parameters such as the charge and the length of the C- or N-terminal elements are not much different from those of the mitochondrial proteins. Of note, the apparent mistargeting of these hydrogenosomal proteins to the ER is in line with previous observations regarding the targeting of mammalian TA proteins expressed in yeast cells. For example, the cytochrome b5-RR variant, which is solely mitochondrial in mammal cells, was found also in the ER fraction upon its expression in yeast cells [22]. Similar difference between targeting in mammalian cells to that in yeast were also reported for protein tyrosine phosphatase (PTP)1B and Bcl-2. Both proteins are localized to the ER and mitochondria in mammalian cells but were detected, once expressed in yeast cells, exclusively in the ER [32, 33]. Thus, it appears that those traits that secure proper targeting in mammalian cells do not function correctly in yeast cells.

In summary, our results underline that our understanding of the targeting signals, which dictate the final location of TA proteins, is still limited. It is clear that there is a general, widely studied, trend concerning the physicochemical features of signals directing various TA proteins to specific organelles [9–11]. However, it is also obvious that these characteristics are somewhat redundant and are not sufficient for a direct correlation to a single target organelle. Further studies are required to unravel the tight regulation of the specificity of TA proteins localization. It will be interesting to verify in future studies whether such variations are correlated with altered lipid composition of the outer membrane of hydrogenosomes as compared to the MOM.

Supporting information

S1 Raw images

(PDF)

Click here for additional data file.^{(11.6MB, pdf)}

Acknowledgments

We thank E. Kracker for excellent technical assistance and Dr. Tachezy and Prof. Schuldiner for plasmids.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was supported by the Deutsche Forschungsgemeinschaft (RA 1028/7-2 and RA 1028/10-1 to D.R.).

References

1.Gray MW. Mitochondrial evolution. Cold Spring Harb Perspect Biol. 2012;4(9):a011403 Epub 2012/09/07. 10.1101/cshperspect.a011403 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Makiuchi T, Nozaki T. Highly divergent mitochondrion-related organelles in anaerobic parasitic protozoa. Biochimie. 2014;100:3–17. Epub 2013/12/10. 10.1016/j.biochi.2013.11.018 [DOI] [PubMed] [Google Scholar]
3.Dyall SD, Johnson PJ. Origins of hydrogenosomes and mitochondria: evolution and organelle biogenesis. Curr Opin Microbiol. 2000;3(4):404–11. Epub 2000/09/06. 10.1016/s1369-5274(00)00112-0 [DOI] [PubMed] [Google Scholar]
4.Van Gerwen OT, Muzny CA. Recent advances in the epidemiology, diagnosis, and management of Trichomonas vaginalis infection. F1000Res. 2019;8 Epub 2019/10/05. 10.12688/f1000research.19972.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Bradley PJ, Lahti CJ, Plumper E, Johnson PJ. Targeting and translocation of proteins into the hydrogenosome of the protist Trichomonas: similarities with mitochondrial protein import. EMBO J. 1997;16(12):3484–93. Epub 1997/06/01. 10.1093/emboj/16.12.3484 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Garg S, Stolting J, Zimorski V, Rada P, Tachezy J, Martin WF, et al. Conservation of Transit Peptide-Independent Protein Import into the Mitochondrial and Hydrogenosomal Matrix. Genome Biol Evol. 2015;7(9):2716–26. Epub 2015/09/05. 10.1093/gbe/evv175 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Rada P, Dolezal P, Jedelsky PL, Bursac D, Perry AJ, Sedinova M, et al. The core components of organelle biogenesis and membrane transport in the hydrogenosomes of Trichomonas vaginalis. PLoS One. 2011;6(9):e24428 Epub 2011/09/22. 10.1371/journal.pone.0024428 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Rada P, Makki A, Zarsky V, Tachezy J. Targeting of tail-anchored proteins to Trichomonas vaginalis hydrogenosomes. Mol Microbiol. 2019;111(3):588–603. Epub 2018/12/07. 10.1111/mmi.14175 [DOI] [PubMed] [Google Scholar]
9.Borgese N, Coy-Vergara J, Colombo SF, Schwappach B. The Ways of Tails: the GET Pathway and more. Protein J. 2019;38(3):289–305. Epub 2019/06/17. 10.1007/s10930-019-09845-4 [DOI] [PubMed] [Google Scholar]
10.Chio US, Cho H, Shan SO. Mechanisms of Tail-Anchored Membrane Protein Targeting and Insertion. Annu Rev Cell Dev Biol. 2017;33:417–38. Epub 2017/10/11. 10.1146/annurev-cellbio-100616-060839 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Rao M, Okreglak V, Chio US, Cho H, Walter P, Shan SO. Multiple selection filters ensure accurate tail-anchored membrane protein targeting. Elife. 2016;5 Epub 2016/12/08. 10.7554/eLife.21301 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Setoguchi K, Otera H, Mihara K. Cytosolic factor- and TOM-independent import of C-tail-anchored mitochondrial outer membrane proteins. EMBO J. 2006;25(24):5635–47. Epub 2006/11/18. 10.1038/sj.emboj.7601438 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Colombo SF, Longhi R, Borgese N. The role of cytosolic proteins in the insertion of tail-anchored proteins into phospholipid bilayers. J Cell Sci. 2009;122(Pt 14):2383–92. Epub 2009/06/18. 10.1242/jcs.049460 [DOI] [PubMed] [Google Scholar]
14.Krumpe K, Frumkin I, Herzig Y, Rimon N, Ozbalci C, Brugger B, et al. Ergosterol content specifies targeting of tail-anchored proteins to mitochondrial outer membranes. Mol Biol Cell. 2012;23(20):3927–35. Epub 2012/08/25. 10.1091/mbc.E11-12-0994 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Vitali DG, Drwesh L, Cichocki BA, Kolb A, Rapaport D. The Biogenesis of Mitochondrial Outer Membrane Proteins Show Variable Dependence on Import Factors. iScience. 2020;23(1):100779 Epub 2020/01/17. 10.1016/j.isci.2019.100779 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Kemper C, Habib SJ, Engl G, Heckmeyer P, Dimmer KS, Rapaport D. Integration of tail-anchored proteins into the mitochondrial outer membrane does not require any known import components. J Cell Sci. 2008;121(Pt 12):1990–8. Epub 2008/05/23. 10.1242/jcs.024034 [DOI] [PubMed] [Google Scholar]
17.Doan KN, Grevel A, Martensson CU, Ellenrieder L, Thornton N, Wenz LS, et al. The Mitochondrial Import Complex MIM Functions as Main Translocase for alpha-Helical Outer Membrane Proteins. Cell Rep. 2020;31(4):107567 Epub 2020/04/30. 10.1016/j.celrep.2020.107567 [DOI] [PubMed] [Google Scholar]
18.Mozdy AD, McCaffery JM, Shaw JM. Dnm1p GTPase-mediated mitochondrial fission is a multi-step process requiring the novel integral membrane component Fis1p. J Cell Biol. 2000;151(2):367–80. Epub 2000/10/19. 10.1083/jcb.151.2.367 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Dimmer KS, Papic D, Schumann B, Sperl D, Krumpe K, Walther DM, et al. A crucial role for Mim2 in the biogenesis of mitochondrial outer membrane proteins. J Cell Sci. 2012;125(Pt 14):3464–73. Epub 2012/04/03. 10.1242/jcs.103804 [DOI] [PubMed] [Google Scholar]
20.Daum G, Böhni PC, Schatz G. Import of proteins into mitochondria: cytochrome b2 and cytochrome c peroxidase are located in the intermembrane space of yeast mitochondria. J Biol Chem. 1982;257(21):13028–33. [PubMed] [Google Scholar]
21.Graham JM. Isolation of mitochondria from tissues and cells by differential centrifugation. Current protocols in cell biology. 2001;Chapter 3:Unit 3 10.1002/0471143030.cb0303s04 [DOI] [PubMed] [Google Scholar]
22.Vitali DG, Sinzel M, Bulthuis EP, Kolb A, Zabel S, Mehlhorn DG, et al. The GET pathway can increase the risk of mitochondrial outer membrane proteins to be mistargeted to the ER. J Cell Sci. 2018;131(10). Epub 2018/04/18. 10.1242/jcs.211110 [DOI] [PubMed] [Google Scholar]
23.Cichocki BA, Krumpe K, Vitali DG, Rapaport D. Pex19 is involved in importing dually targeted tail-anchored proteins to both mitochondria and peroxisomes. Traffic. 2018;19(10):770–85. Epub 2018/07/24. 10.1111/tra.12604 [DOI] [PubMed] [Google Scholar]
24.Lacroix E, Viguera AR, Serrano L. Elucidating the folding problem of alpha-helices: local motifs, long-range electrostatics, ionic-strength dependence and prediction of NMR parameters. J Mol Biol. 1998;284(1):173–91. Epub 1998/11/13. 10.1006/jmbi.1998.2145 [DOI] [PubMed] [Google Scholar]
25.Munoz V, Serrano L. Elucidating the folding problem of helical peptides using empirical parameters. II. Helix macrodipole effects and rational modification of the helical content of natural peptides. J Mol Biol. 1995;245(3):275–96. Epub 1995/01/20. 10.1006/jmbi.1994.0023 [DOI] [PubMed] [Google Scholar]
26.Munoz V, Serrano L. Elucidating the folding problem of helical peptides using empirical parameters. III. Temperature and pH dependence. J Mol Biol. 1995;245(3):297–308. Epub 1995/01/20. 10.1006/jmbi.1994.0024 [DOI] [PubMed] [Google Scholar]
27.Munoz V, Serrano L. Elucidating the folding problem of helical peptides using empirical parameters. Nat Struct Biol. 1994;1(6):399–409. Epub 1994/06/01. 10.1038/nsb0694-399 [DOI] [PubMed] [Google Scholar]
28.Vitali DG, Kaser S, Kolb A, Dimmer KS, Schneider A, Rapaport D. Independent evolution of functionally exchangeable mitochondrial outer membrane import complexes. Elife. 2018;7 Epub 2018/06/21. 10.7554/eLife.34488 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Frederick RL, McCaffery JM, Cunningham KW, Okamoto K, Shaw JM. Yeast Miro GTPase, Gem1p, regulates mitochondrial morphology via a novel pathway. J Cell Biol. 2004;167(1):87–98. Epub 2004/10/14. 10.1083/jcb.200405100 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Morgenstern M, Stiller SB, Lubbert P, Peikert CD, Dannenmaier S, Drepper F, et al. Definition of a High-Confidence Mitochondrial Proteome at Quantitative Scale. Cell Rep. 2017;19(13):2836–52. Epub 2017/06/29. 10.1016/j.celrep.2017.06.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Schluter A, Fourcade S, Ripp R, Mandel JL, Poch O, Pujol A. The evolutionary origin of peroxisomes: an ER-peroxisome connection. Mol Biol Evol. 2006;23(4):838–45. Epub 2006/02/03. 10.1093/molbev/msj103 [DOI] [PubMed] [Google Scholar]
32.Egan B, Beilharz T, George R, Isenmann S, Gratzer S, Wattenberg B, et al. Targeting of tail-anchored proteins to yeast mitochondria in vivo. FEBS Lett. 1999;451(3):243–8. Epub 1999/06/17. 10.1016/s0014-5793(99)00581-5 [DOI] [PubMed] [Google Scholar]
33.Fueller J, Egorov MV, Walther KA, Sabet O, Mallah J, Grabenbauer M, et al. Subcellular Partitioning of Protein Tyrosine Phosphatase 1B to the Endoplasmic Reticulum and Mitochondria Depends Sensitively on the Composition of Its Tail Anchor. PLoS One. 2015;10(10):e0139429 Epub 2015/10/03. 10.1371/journal.pone.0139429 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0237982.r001

Decision Letter 0

David Chau

20 Apr 2020

PONE-D-20-08560

Hydrogenosomal tail-anchored proteins are targeted to both mitochondria and ER upon their expression in yeast cells

PLOS ONE

Dear Dr. Rapaport,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

specifically, major improvements are required following the comments made by Reviewer-1

We would appreciate receiving your revised manuscript by Jun 04 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

David Chau

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this study from Ferdigg et al the authors over-expressed 3 TA proteins from Trichomonas vaginalis, which in this organism are targeted to hydrogenosomes, in S. cerevisiae and looked at targeting. The rational was to assess if these two organisms have comparable targeting systems/signals. They found that one protein targeted the mitochondria as expected whilst the other two showed some ER targeting. Based on the sequence properties of the known TA protein targeting signal (the TMS and surrounding region) this could not be explained.

This study presents the results of original research, experimental work is performed to an acceptable standard, in particular the subcellular fractionation is convincing. Experiments are sufficiently well described and conclusions presented in an appropriate fashion in standard English which meets research integrity standards.

The work makes a very minor contribution to the scientific record but based on PLOS One criteria is acceptable for publication with some changes, including explaining some data analysis and adding some simple quantification. I also suggest a few points to be clarified or explained which I think could improve the manuscript.

The main obvious point for improvement would be to increase the number of TA proteins tested, ideally testing all the known Trichomonas vaginalis TA proteins. Failing that can the authors justify why they chose these 3 particular TA proteins and what the evidence is that they are really targeted to hydrogenosomes in Trichomonas vaginalis? Are they just found in the proteomic study?

All TA proteins used in the study are over-expressed, this is known to cause saturation of targeting signals and indeed the authors point this out. If you over-express the mitochondrial only yeast TA proteins to the extent described here (Fis1 and Gem1) do you also see exclusively mitochondrial targeting? How should we interpret this over-expression data?

Can the authors provide more explanation on why they think two of the TA proteins are not acting as standard TA proteins and are instead facing the ER lumen. Why do you think this is the case and what other proteins show this phenomena? Could it be that they are in fact not TA proteins and have an additional TMS or similar?

In the experiments replacing the TMS of Gem1 with the TMS of the other TA proteins, the growth assay is not hugely convincing, complemented growth looks similar for all 3 TA proteins. Have you checked the targeting of these construct or indeed the targeting of the TMS of the 3 TA proteins alone fused to GFP? This might be different to the full-length protein and thus alter your interpretation. Would be good to have a control with Gem1 lacking the TMS or with an ER targeting signal for comparison and/or a liquid growth assay here to back up this minor growth alteration.

As you mention peroxisomal proteins, and note that these show moderate hydrophobicity and basic residues at the CTE, have you also checked for any peroxisomal targeting of these proteins as this looks possible based on the sequence in the table?

Are there any other properties you could look at in terms of the targeting signals which might explain the differences you observe? For example, as you know Rao et al., 2016 (eLife 5:e21301) found a role for other physicochemical properties of the TMS such as helical content (Agadir) score. Is this worth looking at? Also how are the TMS length etc defined in the table?

More generally, I think it would be useful if the authors could put this study into a wider context and explain why it is important and what we really learn from this work and where this might lead us to moving forward?

Specific points:

Why are you using different control proteins every time in the fractionation experiments (1A, 2A, 3A)? Also , not clear if the same mass of protein added for each fraction, please specify.

Images in 1B, 2B, 3B, are much too small, suggest increase the size. It would also be good to have an ER marker to show ER targeting where appropriate.

Statistical analysis of graphs in 1F,2F,3F, is lacking. I can only assume because it is not significant.

Fig 2F – still get some mitochondrial insertion in absence of Mim1 (albeit reduced) – how, what are the Mim1-independent insertion routes? Also still get some Tom20 insertion without Mim1, but bigger decrease than TA7 – any comment why?

Minor:

Line 37: organelle(S)

Line 43: Which components are conserved, is the ER import machinery the same?

Line 51: peroxisomal membranes

Reviewer #2: The manuscript „Hydrogenosomal tail-anchored proteins are targeted to both mitochondria and ER upon their expression in yeast cells“ submitted by Ferdigg et al. (PONE-D-20-08560) convincingly shows that TA-proteins from Trichomonas vaginalis can have a bimodal distribution when expressed in yeast (S. cerevisiae). In conclusion, the authors hypothesize that targeting mechanisms of TA proteins may have evolved independently in different organism clades leading to partially overlapping membrane insertions. In general, the manuscript is technically sound and the experiments are well described and discussed. However, the results described in the last part of the manuscript (as the authors also mention) are not always straight forward to interpret and somewhat weaken the scientific significance of the study. Therefore, I would suggest including a few additional control experiments into the manuscript before final publication.

1) Expression of Gem1 hybrid proteins with TA4 TMS replacements, are interestingly shown rescue growth inhibition in Gem1-deficient yeast strains (Fig. 4), suggesting a correct translocation of the Gem1-hybrid protein into yeast mitochondria. However, as the authors also mention, it remains possible, that only a minor portion of the overexpressed protein is correctly targeted and sufficient for the rescue. Therefore, it is impossible to conclude if the TMS quality has a major impact on the TA targeting in the yeast unless additional subcellular co-localization data (IF or fractionation) is presented.

2) With regard to the observations with the Gem1-TA4-TMS-hybrid protein mentioned in (1), the authors suggest that other parts of the protein’s aa sequence influence the targeting or insertion process into yeast mitochondria. To substantiate this hypothesis it would be straight-forward to additionally analyze hybrid Gem1-proteins which contain either the N- or C-terminal flanking regions of the TA4 protein.

3) As a final conclusion of their observations, the authors state that “the targeting signal of TA proteins is only partially conserved between hydrogenosomes and mitochondria” (abstract) and “our results improve our understanding of the evolution of hydrogenosomes and mitochondria suggesting that together with the degeneration of mitochondria to hydrogenosomes their TA proteins were adopted to new characteristics of their target organell”. With regard to the fact that the targeting of Trichomonas TA proteins was only analyzed in S. cerevisiae and previous reports describe a comparable mistargeting of mammalian mitochondrial TA proteins in the same species such a statement is too general and should be substantiated by analyzing the targeting of the respective Trichomonas TA proteins in at least a second eukaryotic species. Alternatively, the authors should interpret their findings a bit more cautiously.

4) Table 5 should include the amino acid sequences of the respective described protein parts (TMS, CTE NTE segments). It is quite tedious for the reader to having to sort out this information from the databases.

Minor points:

• Table 4: For the apparently self-made antibodies (source Lab stocks) the author should cite the reference in which the antibodies were initially characterized.

• Page 3, line 51: “peroxisome/peroxisomal membranes” not “peroxisomes membrane”

• Page 7: “the pellet (microsomes) ... was resuspended ..., homogenized and clarified by ...”. It is unclear how an organelle suspension was homogenized. Which technology was used?

• Page 10, line 227: “experiments” not “experimets”

• Page 11, line 248: “species” not “specie”

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Aug 20;15(8):e0237982. doi: 10.1371/journal.pone.0237982.r002

Author response to Decision Letter 0

20 Jul 2020

Addressing the comments of the reviewers

Reviewer #1:

We thank the reviewer for his/her generally positive opinion on our contribution.

A proteomic and bioinformatic study in Trichomonas vaginalis identified 12 putative hydrogenosomal TA proteins (Rada et al., PLOS ONE, 2011). However, in the same report and in a later study in T. vaginalis, the targeting and topology of only five of those proteins have been confirmed by immunofluorescence and biochemical approaches (Rada et al., Mol Microbiol, 2019). Since the hydrophobicity of the tail-anchor of mitochondrial TA proteins is usually lower than that of the tail-anchor of ER TA proteins, we chose for our study out of those five proteins the three that had the transmembrane segment with the lowest hydrophobicity.

The reviewer raised here a valid point. The tested TA proteins are recombinant proteins expressed in a heterologous organism. Since there is no endogenous level of those proteins in S. cerevisiae, it is difficult to know whether they are actually over-expressed. Nevertheless, those proteins were expressed under a strong promoter (TPIpr), therefore it is important to test whether such high protein levels could cause mis-localization. To address this point, we investigated the subcellular localization of the mitochondrial yeast TA protein Fis1 encoded by a plasmid resulting in expression under the control of the same promotor. The new results, which are included in the revised Fig. 1B, demonstrate that the protein is clearly localized exclusively to the mitochondrial fraction. Hence, we added to the revised text a sentence stating that these findings suggest that such high protein levels are not sufficient to trigger mistargeting of a mitochondrial TA protein to the ER.

We could not perform similar experiments with overexpressed Gem1, because this protein in unstable and would be degraded during the long time required to perform a complete subcellular fractionation.

These are indeed puzzling findings that we cannot explain. We can only speculate that this inverted topology is caused by differences in the lipid composition of the target membranes and/or variations in the way these proteins are processed by import factors. Since we do not have information on the lipid composition of hydrogenosomes or their import of tail-anchored proteins, these are pure speculations that we prefer not to include in the manuscript.

In a previous study, we observed that the mammalian cytochrome b5-RR variant, which is targeted in mammalian cells solely to mitochondria, was partially targeted to the ER with an inverted topology upon its expression in yeast (Vitali et al., J Cell Sci, 2018). The description of this previous observation was expended in the revised version. The topology of the hydrogenosomal TA has been investigated in both aforementioned publications (Rada et al., PLOS ONE, 2011, Rada et al., Mol Microbiol, 2019), and revealed that those proteins have the typical TA protein topology. Furthermore, employing different prediction programs, we and the two previous studies could not find in these proteins additional putative TMSs.

As the reviewer suggested, we monitored the localization of the fusion proteins harbouring the cytosolic domain of Gem1. As shown in revised Fig. 4C, the constructs with Gem1 cytosolic domain fused to the TMS of the hydrogenosomal TA proteins are found in the crude mitochondria fractions. This observation, combined with the functional complementation, suggests that the TMS alone is sufficient for correct targeting, of at least a portion of the hybrid molecules, to mitochondria. However, since the isolated crude mitochondria fractions are contaminated by ER structures, it is not possible to certainly assess the percentage of the chimera proteins localized in mitochondria.

We could not perform full subcellular fractionation experiments with these constructs because the presence of the cytosolic domain of Gem1 makes them unstable and we observed that they are degraded during the long time required to perform a subcellular fractionation.

We optimized our growth assay and revised Fig. 4A shows a clearer effect on cell growth at 37°C on non-fermentable carbon source upon deletion of GEM1. We agree with the reviewer that all three hybrid TA proteins complement the growth to the same extent. We explain this similar effect by the fact that these hybrid proteins were expressed under the control of FIS1 promoter. A recent proteomic study (Morgenstern et al., Cell Reports, 2017) reported that Fis1 is 20-fold more abundant than Gem1. Thus, even if only 5% of the molecules of each hybrid protein were correctly integrated into the mitochondrial OM, the number of Gem1 molecules anchored at the OM would resemble its normal amount.

In addition, according to the reviewer’s proposal, we have tested the ability of a construct containing only the cytosolic domain of Gem1 to rescue the gem1Δ strain growth phenotype. As expected and as shown in revised Fig. 4B, such a construct was unable to rescue the moderate growth retardation of gem1Δ cells.

Following the reviewer suggestion, we also performed a liquid growth assay. However, we could not detect a significant retardation of the gem1Δ strain under these conditions. Thus, this approach was not followed further.

Following the comment of the reviewer, we investigated the targeting of the GFP-tagged hydrogenosomal TA proteins to peroxisomes by fluorescence microscopy using RFP tagged with PTS1 (RFP-PTS1) as a peroxisomal marker. GFP-TA4 and GFP-TA10 did not show any colocalization with peroxisomes (revised Figs. 1C and 3B), while GFP-TA7 was targeted, in addition to mitochondria, also to peroxisomes (revised Fig. 2B). We explain this observation by the higher helical content of the TMS of TA7 as compared to those of the other TA proteins (revised Table 5). Relatively high helical content is a feature that is typical for peroxisomal TA proteins. These new results are described and discussed in the revised text.

We followed the suggestion of the reviewer and in the revised Table 5 we included the helical content (Agadir) score, calculated both in the same conditions used by Rao et al., eLife, 2016 (pH 7.5, 25 °C, 0.15 M) and adjusted to yeast physiological conditions (pH 7.3, 30°C, 0.15 M). TA7 has a higher helical content than the yeast TA proteins, which is in line with its partial localization to peroxisomes. However, the very low helical contents of TA4 and TA10 is in contrast with their partial localization to the ER, which on average requires a higher helical content and a more hydrophobic TMS. Thus, it seems that rather than a single physicochemical parameter, a combination of several factors dictate the subcellular distribution of TA proteins. This point is discussed in the revised text.

Additionally, in the revised Table 5 we added details on how each parameter was defined.

In the Conclusion section of revised text we elaborated on the impact of our study in a wider context.

Specific points:

Why are you using different control proteins every time in the fractionation experiments (1A, 2A, 3A)? Also , not clear if the same mass of protein added for each fraction, please specify.

The tested hydrogenosomal TA proteins have different molecular weight. For the immunodecoration with different antibodies we wanted to use strips from the very same gel. Hence, we had to choose the marker proteins such that all the used antibodies could be used with one gel. To allow a direct comparison of the protein intensities in the various fractions, we loaded in every experiment the same mass of each fraction on the gel. We included this information in the revised figure legends.

Images in 1B, 2B, 3B, are much too small, suggest increase the size. It would also be good to have an ER marker to show ER targeting where appropriate.

As requested, the revised Fig. 1C, 2B, and 3B are larger and include mitochondria, ER, and peroxisomal markers.

Statistical analysis of graphs in 1F,2F,3F, is lacking. I can only assume because it is not significant.

The reviewer’s assumption is correct. Statistical analysis has been included only in case where differences were statistically significant. Accordingly, statistical analysis was added to the graphs of revised Figs. 1H, 2F and 3F.

The MIM complex is differentially required for the insertion of mitochondrial α-helical outer membrane proteins (Vitali et al., iScience, 2020 and Doan et al., Cell Rep. 2020). Accordingly, the loss of this import complex affects each substrate to a different extent. On one side of the spectrum, the mitochondrial TA protein Fis1 is inserted into the membrane in an unassisted, mainly MIM-independent, manner. On the other hand, Tom20 biogenesis is heavily dependent on the MIM complex and in the absence of the latter only a slow residual unassisted insertion of Tom20 can be observed. We propose that TA7 is in between these two examples; its membrane integration is normally facilitated by the MIM complex, but can take place also in an unassisted manner. We extended this point in the revised manuscript.

Minor:

Line 37: organelle(S)

Line 43: Which components are conserved, is the ER import machinery the same?

Line 51: peroxisomal membranes

Lines 37 and 51: These minor comments have been adjusted in the revised manuscript.

Line 43: We modified our text. To our knowledge no information is available concerning the ER import machinery in Trichomonas vaginalis.

Reviewer #2:

We thank the reviewer for his/her generally positive opinion on our contribution.

A similar point was raised also by reviewer #1. As the reviewer suggested, we monitored the localization of the fusion proteins harbouring the cytosolic domain of Gem1. As shown in revised Fig. 4C, the constructs with Gem1 cytosolic domain fused to the TMS of the hydrogenosomal TA proteins are found in the crude mitochondria fractions. This observation, combined with the functional complementation, suggests that the TMS alone is sufficient for correct targeting, of at least a portion of the hybrid molecules to mitochondria. However, since the isolated crude mitochondria fractions are contaminated by ER structures, it is not possible to certainly assess the percentage of the chimera proteins localized in mitochondria.

We think that additional regions from the TA proteins might affect their membrane topology rather than targeting or membrane integration per se. The hybrid proteins analysed in Fig. 4 already contain the flanking regions of the TMS of the hydrogenosomal TA proteins. In the Materials and Methods section of the revised manuscript we included the corresponding protein sequence of each construct.

We followed the recommendation of the reviewer and modified our statements in the Abstract and Conclusions sections of the revised manuscript to present more cautious interpretations.

As suggested, we have included the amino acid sequences of TMSs, CTEs, and NTEs in the revised Table 5.

Minor points:

• Table 4: For the apparently self-made antibodies (source Lab stocks) the author should cite the reference in which the antibodies were initially characterized.

Most of our antibodies are not commercially available and have not been generated in our laboratory. Instead, they have been collected for many years from different laboratories in the community. Although we cannot track the very first time these antibodies were characterized, all of them were used in many publications.

• Page 3, line 51: “peroxisome/peroxisomal membranes” not “peroxisomes membrane”

• Page 7: “the pellet (microsomes) ... was resuspended ..., homogenized and clarified by ...”. It is unclear how an organelle suspension was homogenized. Which technology was used?

• Page 10, line 227: “experiments” not “experimets”

• Page 11, line 248: “species” not “specie”

Page 3, 10, and 11: All these minor comments were addressed in the revised manuscript.

Page 7: The microsomes pellet was homogenized with a douncer, as described in the revised Materials and Methods section.

Attachment

Submitted filename: Ferdigg et al. - Response to reviewers.docx

Click here for additional data file.^{(25.4KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0237982.r003

Decision Letter 1

David Chau

4 Aug 2020

PONE-D-20-08560R1

Hydrogenosomal tail-anchored proteins are targeted to both mitochondria and ER upon their expression in yeast cells

PLOS ONE

Dear Dr. Vitali,

Please submit your revised manuscript by Sep 18 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

David Chau

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: (No Response)

Reviewer #2: The revised version of the manuscript PONE-D-20-08560R1 has improved substantially and the reviewer requests were generally properly fulfilled. There is just one last point of criticism regarding a conclusions of this study. On page 26, line 529-531 the authors conclude that their "study suggests that TA proteins might have evolved after mitochondria became hydrogenosomes". With regard to the results presented, such an assumption is not justified. As the authors cite in the manuscript, also mammalian mitochondrial TA-proteins have been found to mistarget to the ER in the same fashion as the Trichomonas TA proteins investigated. Thus, also mammals have developed a TA targeting system which differs substantially from the yeast system. However, they are evolutionary closer related to yeast than Trichomonas and contain normal mitochondria. In the light of these discrepancies the sentence should be removed from the manuscript.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Markus Islinger

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Aug 20;15(8):e0237982. doi: 10.1371/journal.pone.0237982.r004

Author response to Decision Letter 1

4 Aug 2020

Addressing the comments of the reviewers

Reviewer #2:

We thank the reviewer for his/her generally positive opinion on our contribution.

The revised version of the manuscript PONE-D-20-08560R1 has improved substantially and the reviewer requests were generally properly fulfilled. There is just one last point of criticism regarding a conclusions of this study. On page 26, line 529-531 the authors conclude that their "study suggests that TA proteins might have evolved after mitochondria became hydrogenosomes". With regard to the results presented, such an assumption is not justified. As the authors cite in the manuscript, also mammalian mitochondrial TA-proteins have been found to mistarget to the ER in the same fashion as the Trichomonas TA proteins investigated. Thus, also mammals have developed a TA targeting system which differs substantially from the yeast system. However, they are evolutionary closer related to yeast than Trichomonas and contain normal mitochondria. In the light of these discrepancies the sentence should be removed from the manuscript.

The reviewer raised a valid point and we agree that the conclusion that “TA proteins might have evolved after mitochondria became hydrogenosomes” is merely a speculation. Therefore, we removed that sentence from the revised manuscript.

Attachment

Submitted filename: Ferdigg et al. - Response to reviewers.docx

Click here for additional data file.^{(14.6KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0237982.r005

Decision Letter 2

David Chau

7 Aug 2020

Hydrogenosomal tail-anchored proteins are targeted to both mitochondria and ER upon their expression in yeast cells

PONE-D-20-08560R2

Dear Dr. Vitali,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

David Chau

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: Markus Islinger

PLoS One. doi: 10.1371/journal.pone.0237982.r006

Acceptance letter

David Chau

10 Aug 2020

PONE-D-20-08560R2

Hydrogenosomal tail-anchored proteins are targeted to both mitochondria and ER upon their expression in yeast cells

Dear Dr. Vitali:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. David Chau

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Raw images

(PDF)

Click here for additional data file.^{(11.6MB, pdf)}

Attachment

Submitted filename: Ferdigg et al. - Response to reviewers.docx

Click here for additional data file.^{(25.4KB, docx)}

Attachment

Submitted filename: Ferdigg et al. - Response to reviewers.docx

Click here for additional data file.^{(14.6KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0237982.ref001] 1.Gray MW. Mitochondrial evolution. Cold Spring Harb Perspect Biol. 2012;4(9):a011403 Epub 2012/09/07. 10.1101/cshperspect.a011403 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref002] 2.Makiuchi T, Nozaki T. Highly divergent mitochondrion-related organelles in anaerobic parasitic protozoa. Biochimie. 2014;100:3–17. Epub 2013/12/10. 10.1016/j.biochi.2013.11.018 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref003] 3.Dyall SD, Johnson PJ. Origins of hydrogenosomes and mitochondria: evolution and organelle biogenesis. Curr Opin Microbiol. 2000;3(4):404–11. Epub 2000/09/06. 10.1016/s1369-5274(00)00112-0 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref004] 4.Van Gerwen OT, Muzny CA. Recent advances in the epidemiology, diagnosis, and management of Trichomonas vaginalis infection. F1000Res. 2019;8 Epub 2019/10/05. 10.12688/f1000research.19972.1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref005] 5.Bradley PJ, Lahti CJ, Plumper E, Johnson PJ. Targeting and translocation of proteins into the hydrogenosome of the protist Trichomonas: similarities with mitochondrial protein import. EMBO J. 1997;16(12):3484–93. Epub 1997/06/01. 10.1093/emboj/16.12.3484 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref006] 6.Garg S, Stolting J, Zimorski V, Rada P, Tachezy J, Martin WF, et al. Conservation of Transit Peptide-Independent Protein Import into the Mitochondrial and Hydrogenosomal Matrix. Genome Biol Evol. 2015;7(9):2716–26. Epub 2015/09/05. 10.1093/gbe/evv175 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref007] 7.Rada P, Dolezal P, Jedelsky PL, Bursac D, Perry AJ, Sedinova M, et al. The core components of organelle biogenesis and membrane transport in the hydrogenosomes of Trichomonas vaginalis. PLoS One. 2011;6(9):e24428 Epub 2011/09/22. 10.1371/journal.pone.0024428 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref008] 8.Rada P, Makki A, Zarsky V, Tachezy J. Targeting of tail-anchored proteins to Trichomonas vaginalis hydrogenosomes. Mol Microbiol. 2019;111(3):588–603. Epub 2018/12/07. 10.1111/mmi.14175 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref009] 9.Borgese N, Coy-Vergara J, Colombo SF, Schwappach B. The Ways of Tails: the GET Pathway and more. Protein J. 2019;38(3):289–305. Epub 2019/06/17. 10.1007/s10930-019-09845-4 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref010] 10.Chio US, Cho H, Shan SO. Mechanisms of Tail-Anchored Membrane Protein Targeting and Insertion. Annu Rev Cell Dev Biol. 2017;33:417–38. Epub 2017/10/11. 10.1146/annurev-cellbio-100616-060839 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref011] 11.Rao M, Okreglak V, Chio US, Cho H, Walter P, Shan SO. Multiple selection filters ensure accurate tail-anchored membrane protein targeting. Elife. 2016;5 Epub 2016/12/08. 10.7554/eLife.21301 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref012] 12.Setoguchi K, Otera H, Mihara K. Cytosolic factor- and TOM-independent import of C-tail-anchored mitochondrial outer membrane proteins. EMBO J. 2006;25(24):5635–47. Epub 2006/11/18. 10.1038/sj.emboj.7601438 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref013] 13.Colombo SF, Longhi R, Borgese N. The role of cytosolic proteins in the insertion of tail-anchored proteins into phospholipid bilayers. J Cell Sci. 2009;122(Pt 14):2383–92. Epub 2009/06/18. 10.1242/jcs.049460 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref014] 14.Krumpe K, Frumkin I, Herzig Y, Rimon N, Ozbalci C, Brugger B, et al. Ergosterol content specifies targeting of tail-anchored proteins to mitochondrial outer membranes. Mol Biol Cell. 2012;23(20):3927–35. Epub 2012/08/25. 10.1091/mbc.E11-12-0994 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref015] 15.Vitali DG, Drwesh L, Cichocki BA, Kolb A, Rapaport D. The Biogenesis of Mitochondrial Outer Membrane Proteins Show Variable Dependence on Import Factors. iScience. 2020;23(1):100779 Epub 2020/01/17. 10.1016/j.isci.2019.100779 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref016] 16.Kemper C, Habib SJ, Engl G, Heckmeyer P, Dimmer KS, Rapaport D. Integration of tail-anchored proteins into the mitochondrial outer membrane does not require any known import components. J Cell Sci. 2008;121(Pt 12):1990–8. Epub 2008/05/23. 10.1242/jcs.024034 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref017] 17.Doan KN, Grevel A, Martensson CU, Ellenrieder L, Thornton N, Wenz LS, et al. The Mitochondrial Import Complex MIM Functions as Main Translocase for alpha-Helical Outer Membrane Proteins. Cell Rep. 2020;31(4):107567 Epub 2020/04/30. 10.1016/j.celrep.2020.107567 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref018] 18.Mozdy AD, McCaffery JM, Shaw JM. Dnm1p GTPase-mediated mitochondrial fission is a multi-step process requiring the novel integral membrane component Fis1p. J Cell Biol. 2000;151(2):367–80. Epub 2000/10/19. 10.1083/jcb.151.2.367 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref019] 19.Dimmer KS, Papic D, Schumann B, Sperl D, Krumpe K, Walther DM, et al. A crucial role for Mim2 in the biogenesis of mitochondrial outer membrane proteins. J Cell Sci. 2012;125(Pt 14):3464–73. Epub 2012/04/03. 10.1242/jcs.103804 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref020] 20.Daum G, Böhni PC, Schatz G. Import of proteins into mitochondria: cytochrome b2 and cytochrome c peroxidase are located in the intermembrane space of yeast mitochondria. J Biol Chem. 1982;257(21):13028–33. [PubMed] [Google Scholar]

[pone.0237982.ref021] 21.Graham JM. Isolation of mitochondria from tissues and cells by differential centrifugation. Current protocols in cell biology. 2001;Chapter 3:Unit 3 10.1002/0471143030.cb0303s04 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref022] 22.Vitali DG, Sinzel M, Bulthuis EP, Kolb A, Zabel S, Mehlhorn DG, et al. The GET pathway can increase the risk of mitochondrial outer membrane proteins to be mistargeted to the ER. J Cell Sci. 2018;131(10). Epub 2018/04/18. 10.1242/jcs.211110 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref023] 23.Cichocki BA, Krumpe K, Vitali DG, Rapaport D. Pex19 is involved in importing dually targeted tail-anchored proteins to both mitochondria and peroxisomes. Traffic. 2018;19(10):770–85. Epub 2018/07/24. 10.1111/tra.12604 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref024] 24.Lacroix E, Viguera AR, Serrano L. Elucidating the folding problem of alpha-helices: local motifs, long-range electrostatics, ionic-strength dependence and prediction of NMR parameters. J Mol Biol. 1998;284(1):173–91. Epub 1998/11/13. 10.1006/jmbi.1998.2145 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref025] 25.Munoz V, Serrano L. Elucidating the folding problem of helical peptides using empirical parameters. II. Helix macrodipole effects and rational modification of the helical content of natural peptides. J Mol Biol. 1995;245(3):275–96. Epub 1995/01/20. 10.1006/jmbi.1994.0023 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref026] 26.Munoz V, Serrano L. Elucidating the folding problem of helical peptides using empirical parameters. III. Temperature and pH dependence. J Mol Biol. 1995;245(3):297–308. Epub 1995/01/20. 10.1006/jmbi.1994.0024 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref027] 27.Munoz V, Serrano L. Elucidating the folding problem of helical peptides using empirical parameters. Nat Struct Biol. 1994;1(6):399–409. Epub 1994/06/01. 10.1038/nsb0694-399 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref028] 28.Vitali DG, Kaser S, Kolb A, Dimmer KS, Schneider A, Rapaport D. Independent evolution of functionally exchangeable mitochondrial outer membrane import complexes. Elife. 2018;7 Epub 2018/06/21. 10.7554/eLife.34488 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref029] 29.Frederick RL, McCaffery JM, Cunningham KW, Okamoto K, Shaw JM. Yeast Miro GTPase, Gem1p, regulates mitochondrial morphology via a novel pathway. J Cell Biol. 2004;167(1):87–98. Epub 2004/10/14. 10.1083/jcb.200405100 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref030] 30.Morgenstern M, Stiller SB, Lubbert P, Peikert CD, Dannenmaier S, Drepper F, et al. Definition of a High-Confidence Mitochondrial Proteome at Quantitative Scale. Cell Rep. 2017;19(13):2836–52. Epub 2017/06/29. 10.1016/j.celrep.2017.06.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237982.ref031] 31.Schluter A, Fourcade S, Ripp R, Mandel JL, Poch O, Pujol A. The evolutionary origin of peroxisomes: an ER-peroxisome connection. Mol Biol Evol. 2006;23(4):838–45. Epub 2006/02/03. 10.1093/molbev/msj103 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref032] 32.Egan B, Beilharz T, George R, Isenmann S, Gratzer S, Wattenberg B, et al. Targeting of tail-anchored proteins to yeast mitochondria in vivo. FEBS Lett. 1999;451(3):243–8. Epub 1999/06/17. 10.1016/s0014-5793(99)00581-5 [DOI] [PubMed] [Google Scholar]

[pone.0237982.ref033] 33.Fueller J, Egorov MV, Walther KA, Sabet O, Mallah J, Grabenbauer M, et al. Subcellular Partitioning of Protein Tyrosine Phosphatase 1B to the Endoplasmic Reticulum and Mitochondria Depends Sensitively on the Composition of Its Tail Anchor. PLoS One. 2015;10(10):e0139429 Epub 2015/10/03. 10.1371/journal.pone.0139429 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Hydrogenosomal tail-anchored proteins are targeted to both mitochondria and ER upon their expression in yeast cells

Andrè Ferdigg

Kai S Dimmer

Doron Rapaport

Daniela G Vitali

Roles

Abstract

Introduction

Materials and methods

Yeast strains and growth conditions

Table 1. Yeast strains used in this study.

Drop dilution assay

Recombinant DNA techniques

Table 2. Plasmids used in this study.

Table 3. Primers used in this study.

Subcellular fractionation

Crude mitochondria preparation

Fig 4. Hybrid proteins that contain the TMS of hydrogenosomal proteins can rescue the absence of Gem1.

Western blotting and immunodecoration

Table 4. Antibodies used in this study.

Protease protection assay

Alkaline extraction

Glycosylation assay

Fluorescence microscopy

Results and discussion

In yeast cell TA4 localizes to the ER with an inverted topology

Fig 1. TA4 is distributed between mitochondria and ER upon expression in yeast cells.

TA7 behaves like a mitochondrial TA protein

Fig 2. TA7 expressed in yeast cells is targeted mainly to mitochondria.

Table 5. Physicochemical features of hydrogenosomal and mitochondrial TA proteins.

TA10 is equally distributed between ER and mitochondria

Fig 3. TA10 is localized partially in the ER and is glycosylated there.

The TMSs of the hydrogenosomal proteins can functionally replace the TMS of the mitochondrial TA protein Gem1

Conclusions

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

David Chau

Roles

Author response to Decision Letter 0

Decision Letter 1

David Chau

Roles

Author response to Decision Letter 1

Decision Letter 2

David Chau

Roles

Acceptance letter

David Chau

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases