Abstract
Ruminal cellulolytic bacteria could be a diagnostic tool for determining the subacute rumen acidosis (SARA) risk in individual ruminants; however, a limited number of studies have investigated the effects of the abundance of ruminal cellulolytic bacteria on the fatty acid (FA) composition of the rumen digesta and the muscle of sheep. Thus, the objective of this study was to evaluate the effect of the variation of rumen cellulolytic bacteria on the rumen fermentation, rumen digesta, and muscle FA composition of fattening lambs fed an identical diet. Forty-eight lambs were reared in individual units and fed a high-concentrate diet consisting of 20% forage and 80% concentrate. All lambs were adapted to diets and facilities for 14 d, and sampling was for 63 d. At the end of the experiment, the rumen fluid, rumen digesta, and longissimus dorsi were collected after slaughter for the measurement of volatile fatty acids, ruminal bacterial DNA, rumen digesta, and muscle FAs. The lambs were classified into the lower cellulolytic bacteria (LCB, n = 10) group and the higher cellulolytic bacteria (HCB, n = 10) group according to the abundance of pH-sensitive cellulolytic bacteria (Ruminococcus albus, Ruminococcus flavefaciens, Fibrobacter succinogenes, and Butyrivibrio fibrisolvens) in the rumen. Ruminal acetate concentration was positively correlated with the number of R. flavefaciens, F. Succinogenes, and B. fibrisolvens (P < 0.05, r > 0.296), whereas propionate and valerate concentrations were negatively correlated with the amount of F. succinogenes and B. fibrisolvens (P < 0.05, r > 0.348). Compared with the LCB group, the acetate (P = 0.018) as well as acetate to propionate ratio (P = 0.012) in the HCB group was higher, but the valerate ratio was lower (P = 0.002). The proportions of even-chain FAs and odd- and branched-chain fatty acid in the rumen digesta of lambs with the HCB were higher (P < 0.05), while the polyunsaturated fatty acids decreased than those in the LCB lambs (P < 0.05), but those FA proportions in the meat were similar between the two groups. The proportion of C17:0 in the meat of lambs in the HCB group was lower than that of lambs in the LCB group (P = 0.033). The proportions of conjugated linoleic acid in rumen digesta and meat were both higher in the HCB group than that in the LCB group (P = 0.046). These results indicated that the ruminal cellulolytic bacteria can alter the FA compositions in rumen digesta and further influenced the FA compositions in the meat of sheep.
Keywords: bacterial community, cellulolytic bacteria, muscle fatty acids, rumen acidosis, sheep
Introduction
Subacute rumen acidosis (SARA) is a nutritional metabolic disease mainly caused by an excessive intake of easily fermentable carbohydrates, and SARA commonly occurs in high-yielding dairy cows and fattening sheep (Gao and Oba, 2014; Kent-Dennis et al., 2019). SARA usually increases the risk of liver abscess (Wiese et al., 2017), diarrhea, and laminitis (Khafipour et al., 2009a), leading to substantial economic losses. Previous studies indicated that the risk of SARA among lactating dairy cows (Gao and Oba, 2016) and fattening lambs (Li et al., 2017) was different, although they were fed an identical diet. Li et al. (2017) found that lambs with higher SARA risk (HSR) showed lower ruminal pH and higher concentrations of propionate compared with lambs with lower SARA risk (LSR), although all lambs were fed the same diet throughout the experiment. The results in the study of Nasrollahi et al. (2017) suggested that the ruminal pH values ranged from 4.78 to 6.08, although all cows (n = 78) were fed the same 65% concentrate diet. In addition, a high-concentrate diet would alter the abundances of bacteria in the rumen due to the decreased pH of the rumen, and cellulolytic bacteria (Ruminococcus albus, Ruminococcus flavefaciens, Fibrobacter succinogenes, and Butyrivibrio fibrisolvens) are usually sensitive to rumen pH (Mickdam et al., 2016). Li et al. (2017) showed that ruminal cellulolytic bacteria could be used as a potential biomarker of SARA risk in sheep herds.
Earlier studies reported that different rumen bacterial species could synthesize unique odd- and branched-chain fatty acid (OBCFA); cellulolytic bacteria synthesized more iso FAs (e.g., iso C14:0 and iso C15:0), whereas amylolytic bacteria were rich in anteiso and linear odd-chain FAs (e.g., anteiso C15:0, C15:0; Fievez et al., 2012; Baumann et al., 2016). The OBCFA absorbed from bacteria could be taken up by the mammary gland, which could reflect the abundances of rumen microbial species and rumen pH. Baumann et al. (2016) performed multiple regression analysis and found that the content of iso C14:0, iso C15:0, and C22:0 in milk could be used to predict the rumen pH.
In addition, several studies have shown that high-concentrate diets altered the hydrogenation pathway of unsaturated fatty acids (UFAs) by altering the number of B. fibrisolvens, which was important for improving hydrogenation (Enjalbert et al., 2017; Santos-Silva et al., 2019). The shift in the hydrogenation pathway of C18:2 n-6 in the rumen digesta away from cis-9, trans-11 C18:2, and trans-11 C18:1 toward trans-10, cis-12 C18:2, and trans-10 C18:1 was common when cows and goats were fed the high-concentrate diet (Vlaeminck, 2006b; Zened et al., 2013; Honkanen et al., 2016). These results indicated that rumen cellulolytic bacteria could affect the fatty acid (FA) composition of the rumen content (biohydrogenation, isomerization, and bacterial OBCFA), which could change the FAs in the muscle of sheep (Li et al., 2020).
Therefore, we hypothesize that the abundance of cellulolytic bacteria in rumen could alter the FAs in the tissue of sheep, which could also lead to the variation in FA compositions when the sheep fed an identical diet. The aim of the present study was to investigate the variation in cellulolytic bacteria in the rumen and the fermentation, bacterial community, and muscle FAs of fattening sheep fed a common diet.
Materials and Methods
All procedures in the prevent experiment were approved by the Biological Studies Animal Care and Use Committee of Gansu Province, China (2005 to 2012).
Animals and diets
A total of 48 male Hu lambs with similar body weights (BW; 30 ± 1.68 kg) and ages (approximately 4 mo) were used in the present study. The lambs were raised in individual units (0.75 × 1.5 × 1.0 m) and fed a total mixed ration that contained 80% concentrate and 20% roughage (Table 1). All lambs were fed twice per day at 0800 and 1800 hours and had free access to water. The experiment consisted of a 14-d adaption period and a 63-d data collection period. All animals were weighed on day 1 and day 63 between 0600 and 0800 hours before morning feeding during the data collection period. The amounts of feed offered on dry matter base (5% of BW) and orts were recorded daily for the calculation of dry matter intake (DMI) and average daily growth (ADG) throughout the experiment. At the end of the experiment, all of the sheep were euthanized to collect ruminal and muscle samples.
Table 1.
Composition and nutrient levels of the experimental diets (DM1 basis)
| Items | Proportion, % |
|---|---|
| Corn cob | 8.00 |
| Corn stover | 12.00 |
| Corn | 38.00 |
| Molasses | 4.00 |
| Soybean meal | 6.00 |
| Cottonseed meal | 5.00 |
| Corn germ feed | 15.50 |
| Corn bran | 6.50 |
| Limestone | 0.80 |
| Calcium sulfate | 0.80 |
| Salt | 0.70 |
| Expanded urea | 0.70 |
| Permix2 | 1.00 |
| Bentonite Nutritional levels | 1.00 |
| DM | 90.62 |
| CP, %DM | 13.47 |
| Neutral detergent fiber, %DM | 32.46 |
| Acid detergent fiber, %DM | 13.73 |
| C16:0, mg/g | 3.81 |
| C18:0, mg/g | 0.54 |
| C18:1 c-9, mg/g | 5.43 |
| C18:2 n-6, mg/g | 8.72 |
| C18:3 n-3, mg/g | 0.06 |
| SFA, mg/g | 4.49 |
| Monounsaturated fatty acids, mg/g | 5.90 |
| PUFA, mg/g | 8.91 |
1DM, dry matter.
2The premix provided the following per kg of diets: Fe 25 mg, Mn 40 mg, Zn 40 mg, Cu 8 mg, I 0.3 mg, Se 0.2 mg, Co 0.1 mg, A VA 940 IU, D VD 111 IU, and E VE 20 IU.
Sample collection and analysis
Before slaughter, all sheep were fasted for 18 to 24 h. The rumen contents, including the solid and liquid phases, were collected and stored at −20 °C for extraction of bacterial DNA. The rumen fluid was mixed thoroughly and filtered through four layers of cheesecloth, and 5 mL of filtered liquid was acidified with 2 mL of 25% meta-phosphoric acid; the resulting fluid was stored at −20 °C until volatile fatty acids (VFA) analyses.
Extraction of bacterial DNA
The total genomic DNA was extracted from approximately 200 mg of rumen content by using an E.Z.N.A. Stool DNA kit (Omega Bio-Tek, Inc., Norcross, GA, USA), following the manufacturer’s instructions. Quantitative analysis of the microorganisms in the rumen was performed with a Bio-Rad CFX96 Real-Time System (Bio-Rad Laboratories, Hercules, CA, USA). According to the method described by Li et al. (2014), the reaction was carried out in a 96-well plate with a total volume of 20 μL, including 10 μL of SYBR Green II (Omega Bio-Tek, Norcross, GA, USA), 1 μL of rumen microbial DNA, 0.6 μL of forward and reverse primers, and 7.8 μL of double distilled H2O. All bacterial DNA was amplified using the following procedure: predenaturation at 94 °C for 3 min, denaturation at 94 °C for 15 s, annealing at 60 °C for 30 s, and extension at 72 °C for 20 s for 40 cycles; specific quantitative 16S rDNA standards were used for all bacteria. The primer sets used for bacterial polymerase chain reaction (PCR) amplification are presented in Table 2.
Table 2.
Rumen microorganisms quantitative real time-PCR amplification primer
| Species | Primer sequence(5′-3′) | References |
|---|---|---|
| Fibrobacter succinogenes | F1: GGTATGGGATGAGCTTGC | Koike and Kobayashi (2001) |
| R2: GCCTGCCCCTGAACTATC | ||
| Ruminococcus albus | F: TGTTAACAGAGGGAAGCAAAGCA | Koike and Kobayashi (2001) |
| R: TGCAGCCTACAATCCGAACTAA | ||
| Ruminococcus flavefaciens | F: CGAACGGAGATAATTTGAGTTTACTTAGG | Koike and Kobayashi (2001) |
| R: CGGTCTCTGTATGTTATGAGGTATTACC | ||
| Butyrivibrio fibrisolvens | F: GCCTCAGCGTCAGTAATCG | Zhang et al. (2015) |
| R: GGAGCGTAGGCGGTTTTAC | ||
| Streptococcus bovis | F: TTCCTAGAGATAGGAAGTTTCTTCGG | Khafipour et al. (2009b) |
| R: ATGATGGCAACTAACAATAGGGGT | ||
| Prevotella brevis | F: GGTTCTGAGAGGAAGGTCCCC | Stevenson and Weimer (2009) |
| R: TCCTGCACGCTACTTGGCTG | ||
| Selenomonas ruminantium | F: CAATAAGCATTCCGCCTGGG | Benchaar et al. (2012) |
| R: TTCACTCAATGTCAAGCCCTGG |
1F means forward primers; 2R means reverse primers.
Previous studies have confirmed that cellulolytic bacteria, including R. albus, R. flavefaciens, F. Succinogenes, and B. fibrisolvens, are relatively more sensitive to rumen pH (Nagaraja and Titgemeyer, 2007; Li et al., 2017; Plaizier et al., 2017), which can be used as biomarkers to determine the risk of SARA in ruminants. Therefore, in our study, according to the number of main cellulolytic bacteria in the rumen (expressed as log10 copy number of 16S rRNA gene copies per gram of rumen digesta), the 48 sheep were classified into two groups of extreme individuals: the higher cellulolytic bacteria (HCB, n = 10) group and the lower cellulolytic bacteria (LCB, n = 10) group.
Rumen fermentation used in this experiment
After the rumen fluid was separated from the rumen digesta, the pH was immediately determined using a portable pH meter (PHB-4, Shanghai Hongyi Instrument Limited, Shanghai, China). The VFAs of acidified ruminal liquid by meta-phosphoric acid (25% wt/vol) were separated and quantified by using a gas chromatograph (Thermo Fisher Scientific, Milano, Italy) with a DB-FFAP capillary column (DB-FFAP, 30 m × 0.32 mm × 0.25 µm, Agilent Technologies Co., Ltd., Santa Clara, USA). The VFAs were separated by the measurement conditions described by Li et al. (2017); the crotonic acid (1% wt/vol) was used as the internal standard.
Rumen content and muscle FA extraction
The lipids in the freeze-dried rumen digesta (0.5 g) and longissimus dorsi (0.3 g) were determined using the method of Li et al. (2014). The FAME was analyzed by an HP-88 capillary column (HP-88, 100 m × 0.25 mm × 0.20 μm; Agilent Technologies, Co., Ltd., Santa Clara, USA). The measurement conditions were as follows: an injection volume of 1 μL, split ratio of 50:1, inlet temperature of 240 °C, detector temperature of 250 °C, hydrogen flow rate of 40 mL/min, air flow rate of 400 mL/min, and carrier gas (N2) flow rate of 20 mL/min; the initial temperature was set at 50 °C, maintained for 4 min, then increased to 175 °C at 13 °C/min for 27 min. The fatty acid methyl ester (FAME) standards (37 FAME standards, Supelco, USA) and the OBCFA standards (BR2 and BR3; Larodan Fine Chemicals, Malmö, Sweden) were used to identify the FA profiles of the samples by the method of Li et al. (2020).
Statistical analysis
The rumen fermentation parameters, rumen bacterial abundances, and proportions of rumen content and muscle FA were analyzed by using SPSS 21 software (SPSS, Chicago, IL, USA). Pearson correlation analysis was used to analyze the correlation among VFA, pH, and rumen microbial content. An independent sample t-test was used to calculate the differences in the results in this study between the lambs in the HCB group or the LCB group. Significance was declared at P < 0.05, and trends were declared at 0.05 < P < 0.10.
Results
The correlation between the number of cellulolytic bacteria and the VFA is shown in Table 3. The abundances of F. succinogenes, R. flavefaciens, R. albus, and B. fibrisolvens were positively correlated with each other (P < 0.01, r > 0.380). Acetate in the rumen was positively correlated with R. flavefaciens, F. Succinogenes, and B. fibrisolvens, while propionate was negatively correlated with F. succinogenes and B. fibrisolvens (P < 0.05, r > 0.348).
Table 3.
Correlation analysis of cellulolytic bacteria and rumen fermentation parameters (n = 48)
| Items1 | TVFA | Ac. | Pr. | Bu. | Va. | Ac.: Pr. | Rf. | Ra. | Fs. | Bf. | pH |
|---|---|---|---|---|---|---|---|---|---|---|---|
| TVFA | 1 | ||||||||||
| Ac. | −0.111 | 1 | |||||||||
| Pr. | 0.272 | −0.465** | 1 | ||||||||
| Bu. | −0.129 | −0.709** | −0.269 | 1 | |||||||
| Va. | 0.285 | −0.433** | 0.566** | −0.094 | 1 | ||||||
| Ac.: Pr. | −0.190 | 0.663** | −0.940** | 0.015 | −0.623** | 1 | |||||
| Rf. | 0.003 | 0.391** | −0.266 | −0.183 | −0.300* | 0.309* | 1 | ||||
| Ra. | 0.053 | 0.243 | −0.100 | −0.167 | −0.228 | 0.138 | 0.655** | 1 | |||
| Fs. | 0.057 | 0.373* | −0.348* | −0.142 | −0.403** | 0.401** | 0.380** | 0.517** | 1 | ||
| Bf. | 0.096 | 0.296* | −0.390** | −0.009 | −0.396** | 0.425** | 0.619** | 0.693** | 0.529** | 1 | |
| pH | −0.018 | 0.127 | −0.217 | 0.027 | −0.180 | 0.239 | −0.058 | −0.107 | 0.191 | 0.110 | 1 |
1TVFA means total volatile fatty acid; Ac. means Acetate; Pr. means propionate; Bu. means butyrate; Va. means valerate; Rf. means Ruminococcus flavefaciens; Ra. means Ruminococcus albus; Fs. means Fibrobacter succinogenes; Bf. means Butyrivibrio fibrisolvens.
**It is Significant correlated at 0.01 level.
*It is Significant correlated at 0.05 level.
The initial BW (P = 0.428), final BW (P = 0.370), and DMI (P = 0.597) were similar between the lambs in the HCB and LCB groups (Table 4). The ratio of DMI to ADG tended to be higher in the LCB group than in the HCB group (P = 0.053), while the ADG in lambs in the HCB group tended to be lower compared with the lambs in the LCB group (P = 0.095).
Table 4.
Performance in lambs with the least and most cellulolytic bacteria in the rumen
| Item | LCB | HCB | SEM | P-value |
|---|---|---|---|---|
| Initial BW, kg | 29.75 | 30.46 | 0.433 | 0.428 |
| Final BW, kg | 47.62 | 46.16 | 0.790 | 0.370 |
| DMI, kg/d | 1.59 | 1.55 | 0.041 | 0.597 |
| ADG, kg/d | 0.28 | 0.25 | 0.010 | 0.095 |
| DMI/ADG | 5.67 | 6.33 | 0.113 | 0.053 |
The abundances of F. succinogenes, R. flavefaciens, R. albus, and B. fibrisolvens were higher in the HCB group than those in the LCB group, but the abundances of Selenomonas ruminantium and Prevotella brevis were higher in the HCB group than in the LCB group (P < 0.001; Table 5).
Table 5.
Bacteria abundances in lambs with the least or most cellulolytic bacteria in the rumen
| Item | LCB | HCB | SEM | P-value |
|---|---|---|---|---|
| Bacteria, log10,16S rRNA copy number/g rumen content | ||||
| Fibrobacter succinogenes | 8.54 | 10.58 | 0.237 | <0.001 |
| Butyrivibrio fibrisolvens | 8.38 | 10.32 | 0.251 | <0.001 |
| Ruminococcus flavefaciens | 7.74 | 9.87 | 0.341 | <0.001 |
| Ruminococcus albus | 8.49 | 9.91 | 0.187 | <0.001 |
| Prevotella brevis | 11.36 | 11.79 | 0.062 | <0.001 |
| Selenomonas ruminantium | 10.65 | 11.88 | 0.137 | <0.001 |
| Streptococcus bovis | 6.54 | 6.79 | 0.143 | 0.436 |
| Total bacteria | 15.55 | 15.92 | 0.062 | 0.001 |
| % in the total bacteria × 10–4 | ||||
| Fibrobacter succinogenes | 10.09 | 0.27 | 1.563 | <0.001 |
| Butyrivibrio fibrisolvens | 10.75 | 0.14 | 1.897 | 0.002 |
| Ruminococcus flavefaciens | 3.01 | 0.10 | 0.670 | 0.026 |
| Ruminococcus albus | 2.43 | 0.22 | 0.402 | 0.003 |
| Prevotella brevis | 152.50 | 88.36 | 12.491 | 0.006 |
| Selenomonas ruminantium | 133.50 | 26.16 | 20.302 | 0.004 |
| Streptococcus bovis | 0.002 | 0.012 | 0.0055 | 0.387 |
The number of cellulolytic bacteria had no effect on the total VFA (P = 0.844), the proportions of butyrate (P = 0.139), and isovalerate (P = 0.226; Table 6). Compared with the lambs in the LCB group, the acetate (P = 0.018) and acetate to propionate ratio (P = 0.012) was higher, but propionate ratio tended to be lower in the HCB group (P = 0.066).
Table 6.
Rumen fermentation parameters in lambs with the least or most cellulolytic bacteria in the rumen
| Item | LCB | HCB | SEM | P-value |
|---|---|---|---|---|
| TVFA1, mmol | 127.69 | 129.96 | 5.543 | 0.844 |
| Acetate, % | 60.93 | 66.43 | 1.210 | 0.018 |
| Propiotate, % | 25.34 | 22.22 | 0.800 | 0.066 |
| Isobutyrate, % | 0.44 | 0.64 | 0.073 | 0.099 |
| Butyrate, % | 10.53 | 8.08 | 0.815 | 0.139 |
| Isovalerate, % | 0.87 | 1.22 | 0.144 | 0.226 |
| Valerate, % | 1.88 | 1.42 | 0.076 | 0.002 |
| Acetate:Propiotate | 2.45 | 3.08 | 0.131 | 0.012 |
| pH | 5.65 | 5. 97 | 0.084 | 0.054 |
1TVFA means total volatile fatty acids.
The FA compositions in the rumen content are displayed in Table 7. No differences were observed in total FAs (P = 0.766) between the LCB and HCB groups. The proportions of even-chain saturated fatty acids (SFA), including C12:0, C14:0, and C16:0, were higher in the HCB group than in the LCB group (P < 0.05). The proportions of anteiso C14:0, C14:1 cis-9, iso C15:0, anteiso C15:0, anteiso C17:0, and conjugated linoleic acid (CLA) in the LCB group were lower than those in the HCB group (P < 0.05). The proportions of C18:1 cis-9, C18:2 cis-9, trans-13, C18:2 n-6, cis-9, cis-12, C18:3 n-3, cis-6, cis-9, and cis-12 in the LCB group were higher than those in the HCB group (P < 0.05). There were no differences in total SFA and total monounsaturated fatty acid between the two groups of lambs (P > 0.05), but there was a tendency for a lower ratio of total SFA in the LCB group compared with the HCB group (60.45% vs. 66.24%, P = 0.071). In this study, the total polyunsaturated fatty acids (PUFA) in the LCB group was higher than that in the LSR group (11.87% vs. 9.40%, P = 0.017).
Table 7.
Effect of cellulolytic bacteria on FA composition (g/100 g of total identified FA methyl esters) of rumen digesta in fattening sheep
| Item1 | LCB | HCB | SEM | P-value |
|---|---|---|---|---|
| TFA, mg/100g | 2,081.2 | 2,118.1 | 59.45 | 0.766 |
| C4:0 | 2.13 | 2.03 | 0.153 | 0.749 |
| C6:0 | 0.28 | 0.23 | 0.037 | 0.353 |
| C8:0 | 0.03 | 0.02 | 0.002 | 0.008 |
| C11:0 | 0.02 | 0.02 | 0.002 | 0.456 |
| C12:0 | 0.27 | 0.35 | 0.017 | 0.014 |
| C13:0 | 0.09 | 0.09 | 0.006 | 0.998 |
| C14:0 | 1.87 | 1.02 | 0.036 | 0.035 |
| isoC14:0 | 0.16 | 0.24 | 0.010 | <0.001 |
| C14:1 | 0.17 | 0.34 | 0.041 | <0.001 |
| C15:0 | 0.55 | 0.97 | 0.058 | <0.001 |
| isoC15:0 | 1.30 | 1.51 | 0.060 | 0.016 |
| anteisoC15:0 | 0.20 | 0.39 | 0.032 | <0.001 |
| C16:0 | 13.33 | 14.16 | 0.219 | 0.050 |
| isoC16:0 | 0.18 | 0.23 | 0.015 | 0.123 |
| C16:1 t-9 | 0.17 | 0.20 | 0.009 | 0.296 |
| C16:1 c-9 | 0.12 | 0.13 | 0.005 | 0.121 |
| C17:0 | 0.99 | 0.98 | 0.035 | 0.897 |
| anteisoC17:0 | 0.09 | 0.13 | 0.013 | 0.029 |
| isoC17:0 | 0.85 | 0.85 | 0.036 | 0.975 |
| C18:0 | 36.44 | 41.62 | 1.610 | 0.110 |
| anteisoC18:0 | 1.31 | 1.25 | 0.054 | 0.591 |
| C18:1 t-9 | 0.19 | 0.22 | 0.009 | 0.231 |
| C18:1 t-10+ C18:1 t-11 | 16.24 | 13.41 | 1.071 | 0.169 |
| C18:1 c-9 | 8.44 | 7.11 | 0.310 | 0.032 |
| C18:1 c-11 | 1.14 | 0.98 | 0.069 | 0.234 |
| C18:1 c-12 | 0.43 | 0.33 | 0.029 | 0.096 |
| C18:1 c-13 | 0.25 | 0.25 | 0.017 | 0.962 |
| C18:2 t-9,t-12 n-6 | 0.27 | 0.23 | 0.012 | 0.104 |
| C18:2 c-9,t-13 n-6 | 0.04 | 0.03 | 0.004 | 0.008 |
| C18:2 t-8,c-13 n-6 | 0.12 | 0.11 | 0.004 | 0.182 |
| C18:2 t-10,c-15, t-12,c-15 n-6 | 0.14 | 0.10 | 0.010 | 0.100 |
| C18:2 c-9,c-12 n-6 | 10.36 | 7.04 | 0.560 | 0.001 |
| CLA | 0.12 | 0.29 | 0.030 | 0.011 |
| C18:3 c-6,c-9,c-12 n-3 | 0.36 | 0.26 | 0.022 | 0.010 |
| C20:0 | 0.61 | 0.63 | 0.007 | 0.145 |
| C20:1 | 0.14 | 0.12 | 0.011 | 0.169 |
| C20:2 n-6 | 0.11 | 0.14 | 0.009 | 0.030 |
| C20:4 n-6 | 0.32 | 0.28 | 0.015 | 0.167 |
| C20:5 n-3 | 0.46 | 0.47 | 0.009 | 0.922 |
| C22:0 | 0.40 | 0.39 | 0.008 | 0.620 |
| C22:5 n-3 | 0.29 | 0.22 | 0.020 | 0.085 |
| C22:6 n-3 | 0.13 | 0.09 | 0.011 | 0.066 |
| C24:1 | 0.41 | 0.42 | 0.020 | 0.880 |
| ∑SFA | 60.45 | 66.24 | 1.610 | 0.071 |
| ∑MUFA | 28.57 | 24.37 | 1.340 | 0.119 |
| ∑PUFA | 11.87 | 9.40 | 0.536 | 0.017 |
| ∑OCFA | 2.58 | 2.91 | 0.079 | 0.027 |
| ∑BCFA | 3.25 | 3.77 | 0.103 | 0.008 |
| ∑OBCFA | 5.83 | 6.68 | 0.173 | 0.010 |
1TFA, total fatty acids; ∑SFA, total saturated fatty acid; ∑MUFA, total monounsaturated fatty acid; ∑PUFA, total polyunsaturated fatty acid; ∑OCFA, total odd-chain fatty acids; ∑BCFA, total branched-chain fatty acids; ∑OBCFA, total odd- and branched-chain fatty acids.
The FA compositions in the muscle are presented in Table 8. The proportions of C17:0 and C18:3 n-3 in the HCB group were lower than those in the LCB group (1.55% vs. 1.75%, P = 0.033), and the CLA in the HCB group was higher than that in the LCB group (0.39% vs. 0.29%, P = 0.046). The proportion of C18:1 cis-12 in the HCB group showed an increased trend compared with that in the LCB group (0.19% vs. 0.17%, P = 0.053).
Table 8.
Effect of cellulolytic bacteria on FA composition (g/100 g of total identified FA methyl esters) in the muscle of fattening sheep
| Item1 | LCB | HCB | SEM | P-value |
|---|---|---|---|---|
| TFA, mg/100g | 12,264.3 | 12,819.5 | 589.65 | 0.650 |
| C10:0 | 0.10 | 0.12 | 0.004 | 0.156 |
| C12:0 | 0.12 | 0.10 | 0.008 | 0.241 |
| C14:0 | 2.36 | 2.29 | 0.077 | 0.586 |
| C14:1 | 0.11 | 0.10 | 0.008 | 0.529 |
| C15:0 | 0.35 | 0.38 | 0.031 | 0.548 |
| anteisoC15:0 | 0.10 | 0.11 | 0.007 | 0.233 |
| C15:1 | 0.10 | 0.09 | 0.006 | 0.851 |
| C16:0 | 23.61 | 24.08 | 0.323 | 0.482 |
| isoC16:0 | 0.11 | 0.12 | 0.007 | 0.527 |
| C16:1 | 1.76 | 1.71 | 0.060 | 0.707 |
| C17:0 | 1.75 | 1.55 | 0.064 | 0.033 |
| antisoC17:0 | 0.51 | 0.52 | 0.024 | 0.857 |
| C17:1 | 0.95 | 0.91 | 0.029 | 0.600 |
| C18:0 | 12.66 | 12.84 | 0.319 | 0.741 |
| isoC18:0 | 0.13 | 0.14 | 0.007 | 0.526 |
| C18:1t-10+ C18:1t-11 | 4.62 | 4.59 | 0.222 | 0.950 |
| C18:1 c-9 | 37.68 | 36.75 | 0.407 | 0.294 |
| C18:1 c-11 | 1.30 | 1.29 | 0.032 | 0.885 |
| C18:1 c-12 | 0.17 | 0.19 | 0.007 | 0.053 |
| C18:1 c-13 | 0.08 | 0.07 | 0.003 | 0.364 |
| C18:2 n-6t | 0.16 | 0.17 | 0.008 | 0.814 |
| C18:2 n-6c | 7.19 | 6.85 | 0.230 | 0.480 |
| CLA | 0.29 | 0.39 | 0.022 | 0.046 |
| C18:3 n-6 | 0.09 | 0.07 | 0.010 | 0.373 |
| C18:3 n-3 | 0.25 | 0.22 | 0.015 | 0.205 |
| C20:0 | 0.06 | 0.06 | 0.002 | 0.648 |
| C20:1 | 0.08 | 0.07 | 0.002 | 0.096 |
| C20:2 | 0.10 | 0.06 | 0.023 | 0.278 |
| C20:3 n-6 | 0.26 | 0.23 | 0.017 | 0.329 |
| C20:3 n-3 | 2.72 | 2.59 | 0.140 | 0.670 |
| C22:0 | 0.03 | 0.03 | 0.002 | 0.620 |
| C24:0 | 0.07 | 0.23 | 0.055 | 0.158 |
| ∑SFA | 42.06 | 42.77 | 0.461 | 0.447 |
| ∑MUFA | 45.93 | 46.44 | 0.275 | 0.384 |
| ∑PUFA | 11.30 | 12.21 | 0.440 | 0.322 |
| ∑OCFA | 3.16 | 3.12 | 0.098 | 0.829 |
| ∑BCFA | 0.86 | 0.92 | 0.036 | 0.364 |
| ∑OBCFA | 4.02 | 3.78 | 0.106 | 0.286 |
1TFA, total fatty acids; ∑SFA, total saturated fatty acid; ∑MUFA, total monounsaturated fatty acid; ∑PUFA, total polyunsaturated fatty acid; ∑OCFA, total odd-chain fatty acids; ∑BCFA, total branched-chain fatty acids; ∑OBCFA, total odd- and branched-chain fatty acids.
Discussion
In this study, the DMI of the lambs in the LCB and HCB groups was similar, which was in accordance with the earlier study. Li et al. (2017) showed that the SARA risk of lambs was independent of DMI and dietary composition, which might be due to the similar BW and the rumen volume of the LSR group (with the most cellulolytic bacteria) and the HSR group (with least cellulolytic bacteria) as well as the identical diet in the experiment.
In our study, the proportions of the acetate in rumen and acetate to propionate ratio in the lambs in the LCB group were lower than those in the lambs in the HCB group, but the propionate proportion tended to increase in the LCB group compared with the HCB group. The cellulolytic bacteria in rumen mainly decompose the fiber part of feed, promoting acetate production (Hua et al., 2017). The abundance of major cellulolytic bacteria (R. albus, R. flavefaciens, F. Succinogenes, and B. fibrisolvens) in the rumen of lambs in the HCB group was higher than that in the lambs in the LCB group, leading to an increase in the production of acetate in lambs in the HCB group. A previous study suggested that lactate in the rumen would decompose to valerate when ruminants were fed high-concentration diets (Nasrollahi et al., 2017). We found that the proportion of valerate in the LCB group was higher than that in the HCB group, which might be due to more lactate decomposing to valerate in the LCB group compared with the HCB group. Furthermore, the study of Fernando et al. (2010) indicated that the proportion of valerate was positively correlated with SARA risk, and the rumen pH < 5.8 is the threshold for judging SARA. In the present study, the lambs in the LCB group showed an HSR than the lambs in the HCB group due to the fewer number of cellulolytic bacteria and lower ruminal pH (5.65 vs. 5.97), which increased the concentration of valerate in the rumen.
In the present study, there were differences (P < 0.01) in the abundance of cellulolytic bacteria between the groups of lambs, and the abundance of cellulolytic bacteria in the HCB was approximately 100 times greater than that of the LCB group (Table 5). Brown et al. (2006) found that the proliferation of cellulolytic bacteria would decrease when the time with a rumen pH below 6.0 exceeded 330 min/d. Nagaraja and Titgemeyer (2007) also found that R. albus, R. flavefaciens, F. Succinogenes, and B. fibrisolvens were sensitive to rumen pH. In this study, the quantity of cellulolytic bacteria in the LCB group was lower, which might be due to the lower pH values in the rumen of lambs in the LCB group. Studies on cows and goats have shown that the number of cellulolytic bacteria is reduced when animals experience grain-induced SARA (Li et al., 2014; Plaizier et al., 2017). These results indicated that changes in the abundance of these bacteria could reflect the dynamic rumen pH and SARA risk of ruminants.
The proportions of even-chain FA including C12:0, C14:0, and C16:0 in rumen contents were lower in the lambs in the LCB group compared with the lambs in the HCB group; this result might be attributed to the higher ruminal acetate ratio in the HCB group. Studies have shown that the prolonged presence of propionate and valerate could form linear odd-chain FA, whereas the prolonged presence of acetate could result in an increase in even-chain FA (Vlaeminck et al., 2006a; Li et al., 2020). The ratio of acetate in the rumen of lambs in the HCB group was higher than that in lambs in the LCB group, increasing the precursors of even-chain FA in the rumen content. The proportions of anteiso C14:0, iso C15:0, anteiso C15:0, C14:1 cis-9, and anteiso C17:0 in the HCB group were higher than those in the LCB group. Vlaeminck et al. (2006a) found that the ratio of ruminal propionate was negatively correlated with iso C14:0, iso C15:0, and iso C17:0 in milk, while the ratio of acetate was positively correlated with iso C14:0, iso C15:0, anteiso C15:0, and anteiso C17:0 in milk. In addition, the study of Vargas et al. (2020) showed that the compositions of FAs in bacteria species in the rumen were different, the cellulolytic bacteria were rich in isomeric FA, and the proportions of linear odd-chain FA and trans-isomeric FA were higher in the amylolytic bacteria compared with cellulolytic bacteria. In this experiment, the amounts of cellulolytic bacteria (R. albus, R. flavefaciens, F. Succinogenes, and B. fibrisolvens) and the main amylolytic bacteria (P. brevis, S. ruminantium, and Streptococcus bovis) were higher in lambs in the HCB group compared with lambs in the LCB group, which contributed to the increase in the iso and anteiso FAs ratio in the lambs in the HCB group.
The proportions of C18:2 cis-9, trans-13, C18:2 n-6, cis-9, cis-12, C18:3 n-3, cis-6, cis-9, and cis-12 in the ruminal content of lambs in the LCB group were higher than those in the lambs in the HCB group. It is well known that B. fibrisolvens is a key bacteria involved in rumen biohydrogenation and is mainly responsible for converting UFA in the rumen into SFA. In the present study, the amount of B. fibrisolvens in the rumen digesta of the lambs in the HCB group was higher than that in the lambs in the LCB group, resulting in a higher conversion of PUFA into SFA through biohydrogenation in the HCB group. In this experiment, we found that the proportion of the overall OBCFA in the rumen content of lambs in the HCB group was higher than that in lambs in the LCB group. Because the OBCFA in rumen mainly originated from ruminal bacteria (Fievez et al., 2012; Vargas et al., 2020), the amounts of cellulolytic and amylolytic bacteria in lambs in the HCB group were higher than those in the lambs in the LCB group, which was in favor of the production of OBCFA in the rumen content.
In this study, the proportion of C17:0 in the muscle of lambs in the LCB group was higher than that in the HCB group (1.75% vs. 1.55%, P = 0.033), which was possibly due to the high amount of P. brevis and S. ruminantium in the lambs in the LCB group compared with the lambs in the HCB group. In addition, propionate is involved in the synthesis of odd-chain FA in the tissues of ruminants (Berthelot et al., 2001, Lourenço et al., 2010). In this experiment, the propionate ratio in the rumen in the LCB group was higher than that in the HCB group, which might lead to a higher proportion of C17:0 in the muscle of lambs in the LCB group compared with the lambs in the HCB group. The proportion of CLA was reduced in the muscle of lambs in the HCB group compared with that in the LCB group. Previous studies have shown that biohydrogenation in the rumen was the basis for the production of CLA, and B. fibrisolvens was the dominant bacteria for biohydrogenation (Fuke and Nornberg, 2017; Yang et al., 2019). In this study, the abundance of B. fibrisolvens in the LCB group was lower than that in the HCB group, which made it possible to produce more CLA in the HCB group. C18:1 c-12 is one of the important substrates for the synthesis of c-9, t-11CLA in the muscle (Fiorentini et al., 2018). In our study, it was shown that the ratio of C18:1 c-12 in the LCB group tended to be lower than that in the HCB group, which may result in a higher proportion of CLAs in the LSR group. No differences were found in OBCFA of muscle between lambs in the HCB and LCB groups, which differed from the results of the FAs in the rumen content. Earlier study found that de novo synthesis of branched-chain FAs from branched short-chain FAs, chain elongation of branched-chain FAs, and FA oxidation can lead to the difference of FA composition in the rumen and muscle (Vlaeminck et al., 2015). Liu et al. (2020) found that different lipids in plasma have different selectivity for OBCFA, and cholesterol ester and triglyceride have more isomers and trans-isomers, while the linear odd FAs are higher in free FAs than cholesterol esters and triglycerides, which can also make the composition of OBCFA in the rumen and muscle have a certain difference.
Conclusions
This study showed that the proportion of OBCFA (especially iso FAs) in the rumen content of lambs in the HCB group was higher than that in lambs in the LCB, while the ratio of PUFAs decreased in the lambs in the LCB. The proportion of C17:0 in the muscle of lambs in the HCB group was lower compared with that of the lambs in the LCB group, which would due to the lower ratio of the synthetic precursors propionate and valerate in the rumen. These results indicated that rumen cellulolytic bacteria could affect the FA composition of the rumen content (biohydrogenation, isomerization, and bacterial OBCFA), which could finally lead to the variation in FA compositions in rumen content and muscle tissue when sheep are fed an identical diet.
Acknowledgments
This research was financially supported by the National Key Research and Development Program of China (2018YFD0502103) and the Fundamental Research Funds for the Central Universities (lzujbky-2019-38).
Glossary
Abbreviations
- ADG
average daily growth
- CLA
conjugated linoleic acid
- DM
dry matter
- DMI
dry matter intake
- FA
fatty acid
- HCB
higher cellulolytic bacteria
- HSR
higher SARA risk
- LCB
lower cellulolytic bacteria
- LSR
lower SARA risk
- OBCFA
odd- and branched-chain fatty acid
- PUFA
polyunsaturated fatty acids
- SARA
subacute rumen acidosis
- SFA
saturated fatty acid
- UFA
unsaturated fatty acids
- VFA
volatile fatty acids
Conflict of interest statement
We declare that we have no financial and personal relationships with other people or organizations.
Literature Cited
- Baumann E., Chouinard P. Y., Lebeuf Y., Rico D. E., and Gervais R... 2016. Effect of lipid supplementation on milk odd- and branched-chain fatty acids in dairy cows. J. Dairy Sci. 99:6311–6323. doi: 10.3168/jds.2015-10746 [DOI] [PubMed] [Google Scholar]
- Benchaar C., Lettat A., Hassanat F., Yang W. Z., Forster R. J., Petit H. V., and Chouinard P. Y... 2012. Eugenol for dairy cows fed low or high concentrate diets: effects on digestion, ruminal fermentation characteristics, rumen microbial populations and milk fatty acid profile. Anim. Feed Sci. Technol. 178:139–150. doi: 10.1016/j.anifeedsci.2012.10.005 [DOI] [Google Scholar]
- Berthelot V., Bas P., Schmidely P., and Duvaux-Ponter C... 2001. Effect of dietary propionate on intake patterns and fatty acid composition of adipose tissues in lambs. Small Rumin. Res. 40:29–39. doi: 10.1016/s0921-4488(00)00217-0 [DOI] [PubMed] [Google Scholar]
- Brown M. S., Ponce C. H., and Pulikanti R... 2006. Adaptation of beef cattle to high-concentrate diets: performance and ruminal metabolism. J. Anim. Sci. 84:E25–E33. doi: 10.2527/2006.8413_supple25x [DOI] [PubMed] [Google Scholar]
- Enjalbert F., Combes S., Zened A., and Meynadier A... 2017. Rumen microbiota and dietary fat: a mutual shaping. J. Appl. Microbiol. 123:782–797. doi: 10.1111/jam.13501 [DOI] [PubMed] [Google Scholar]
- Fernando S. C., Purvis H. T. 2nd, Najar F. Z., Sukharnikov L. O., Krehbiel C. R., Nagaraja T. G., Roe B. A., and Desilva U... 2010. Rumen microbial population dynamics during adaptation to a high-grain diet. Appl. Environ. Microbiol. 76:7482–7490. doi: 10.1128/AEM.00388-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fievez V., Colman E., Castro-Montoya J. M., Stefanov I., and Vlaeminck B... 2012. Milk odd- and branched-chain fatty acids as biomarkers of rumen function – an update. Anim. Feed Sci. Technol. 172:51–65. doi: 10.1016/j.anifeedsci.2011.12.008 [DOI] [Google Scholar]
- Fiorentini G., Santana M. O., Messana J. D., Valente A. L. S., Harter C. J., Rabelo C. H. S., Barbero R. P., Lanna D. P. D., Reis R. A., and Berchielli T. T... 2018. Effect of lipid sources on fatty acid profiles of meat from pasture- and feedlot-finished Nellore bulls. Livest. Sci. 211:52–60. doi: 10.1016/j.livsci.2018.03.006 [DOI] [Google Scholar]
- Fuke G., and Nornberg J. L... 2017. Systematic evaluation on the effectiveness of conjugated linoleic acid in human health. Crit. Rev. Food Sci. Nutr. 57:1–7. doi: 10.1080/10408398.2012.716800 [DOI] [PubMed] [Google Scholar]
- Gao X., and Oba M... 2014. Relationship of severity of subacute ruminal acidosis to rumen fermentation, chewing activities, sorting behavior, and milk production in lactating dairy cows fed a high-grain diet. J. Dairy Sci. 97:3006–3016. doi: 10.3168/jds.2013-7472 [DOI] [PubMed] [Google Scholar]
- Gao X., and Oba M... 2016. Characteristics of dairy cows with a greater or lower risk of subacute ruminal acidosis: volatile fatty acid absorption, rumen digestion, and expression of genes in rumen epithelial cells. J. Dairy Sci. 99:8733–8745. doi: 10.3168/jds.2016-11570 [DOI] [PubMed] [Google Scholar]
- Honkanen A. M., Leskinen H., Toivonen V., McKain N., Wallace R. J., and Shingfield K. J... 2016. Metabolism of α-linolenic acid during incubations with strained bovine rumen contents: products and mechanisms. Br. J. Nutr. 115:2093–2105. doi: 10.1017/S0007114516001446 [DOI] [PubMed] [Google Scholar]
- Hua C. F., Tian J., Tian P., Cong R. H., Luo Y. W., Geng Y. L., Tao S. Y., Ni Y. D., and Zhao R. Q... 2017. Feeding a high concentration diet induces unhealthy alterations in the composition and metabolism of ruminal microbiota and host response in a goat model. Front. Microbiol. 8:138. doi: 10.3389/fmicb.2017.00138 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kent-Dennis C., Pasternak A., Plaizier J. C., and Penner G. B... 2019. Potential for a localized immune response by the ruminal epithelium in nonpregnant heifers following a short-term subacute ruminal acidosis challenge. J. Dairy Sci. 102:7556–7569. doi: 10.3168/jds.2019-16294 [DOI] [PubMed] [Google Scholar]
- Khafipour E., Krause D. O., and Plaizier J. C... 2009a. Alfalfa pellet-induced subacute ruminal acidosis in dairy cows increases bacterial endotoxin in the rumen without causing inflammation. J. Dairy Sci. 92:1712–1724. doi: 10.3168/jds.2008-1656 [DOI] [PubMed] [Google Scholar]
- Khafipour E., Li S., Plaizier J. C., and Krause D. O... 2009b. Rumen microbiome composition determined using two nutritional models of subacute ruminal acidosis. Appl. Environ. Microbiol. 75:7115–7124. doi: 10.1128/AEM.00739-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Koike S., and Kobayashi Y... 2001. Development and use of competitive PCR assays for the rumen cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus flavefaciens. FEMS Microbiol. Lett. 204:361–366. doi: 10.1111/j.1574-6968.2001.tb10911.x [DOI] [PubMed] [Google Scholar]
- Li F., Wang Z. L., Dong C. X., Li F. D., Wang W. M., Yuan Z. H., Mo F. T., and Weng X. X... 2017. Rumen bacteria communities and performances of fattening lambs with a lower or greater subacute ruminal acidosis risk. Front. Microbiol. 8:2506. doi: 10.3389/fmicb.2017.02506 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li F., Yang X. J., Cao Y. C., Li S. X., Yao J. H., Li Z. J., and Sun F. F... 2014. Effects of dietary effective fiber to rumen degradable starch ratios on the risk of sub-acute ruminal acidosis and rumen content fatty acids composition in dairy goat. Anim. Feed Sci. Technol. 189:54–62. doi: 10.1016/j.anifeedsci.2013.12.011 [DOI] [Google Scholar]
- Li F., Zhang Z. A., Li X. Y., Zhu B. Z., Guo L., Li F. D., Weng X. X... 2020. Effect of duration of linseed diet supplementation before slaughter on the performances, meat fatty acid composition and rumen bacterial community of fattening lambs. Anim. Feed Sci. Technol. 263:114457. doi: 10.1016/j.anifeedsci.2020.114457 [DOI] [Google Scholar]
- Liu K. Y., Li Y., Luo G. B., Xin H. S., Zhang Y. G., and Li G. Y... 2020. The relationships of dairy ruminal odd- and branched- chain fatty acids to the duodenal bacterial nitrogen flow and volatile fatty acids. Livest. Sci. 233:103971 doi: 10.1016/j.livsci.2020.103971 [DOI] [Google Scholar]
- Lourenço M., Ramos-Morales E., and Wallace R. J... 2010. The role of microbes in rumen lipolysis and biohydrogenation and their manipulation. Animal 4:1008–1023. doi: 10.1017/S175173111000042X [DOI] [PubMed] [Google Scholar]
- Mickdam E., Khiaosa-Ard R., Metzler-Zebeli B. U., Klevenhusen F., Chizzola R., and Zebeli Q... 2016. Rumen microbial abundance and fermentation profile during severe subacute ruminal acidosis and its modulation by plant derived alkaloids in vitro. Anaerobe 39:4–13. doi: 10.1016/j.anaerobe.2016.02.002 [DOI] [PubMed] [Google Scholar]
- Nagaraja T. G., and Titgemeyer E. C... 2007. Ruminal acidosis in beef cattle: the current microbiological and nutritional outlook. J. Dairy Sci. 90:E17–E38. doi: 10.3168/jds.2006-478 [DOI] [PubMed] [Google Scholar]
- Nasrollahi S. M., Zali A., Ghorbani G. R., Moradi Shahrbabak M., and Heydari Soltan Abadi M... 2017. Variability in susceptibility to acidosis among high producing mid-lactation dairy cows is associated with rumen pH, fermentation, feed intake, sorting activity, and milk fat percentage. Anim. Feed Sci. Technol. 228:72–82. doi: 10.1016/j.anifeedsci.2017.03.007 [DOI] [Google Scholar]
- Plaizier J. C., Li S., Tun H. M., and Khafipour E... 2017. Nutritional models of experimentally-induced subacute ruminal acidosis (SARA) differ in their impact on rumen and hindgut bacterial communities in dairy cows. Front. Microbiol. 7:2128. doi: 10.3389/fmicb.2016.02128 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Santos-Silva J., Francisco A., Alves S. P., Portugal P., Dentinho T., Almeida J., Soldado D., Jerónimo E., and Bessa R. J. B... 2019. Effect of dietary neutral detergent fibre source on lambs growth, meat quality and biohydrogenation intermediates. Meat Sci. 147:28–36. doi: 10.1016/j.meatsci.2018.08.015 [DOI] [PubMed] [Google Scholar]
- Stevenson D. M., and Weimer P. J... 2009. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl. Microbiol. Biotechnol. 83:987–988. doi: 10.1007/s00253-009-2033-5 [DOI] [PubMed] [Google Scholar]
- Vargas J. E., Andrés S., López-Ferreras L., and López S... 2020. Effects of supplemental plant oils on rumen bacterial community profile and digesta fatty acid composition in a continuous culture system (RUSITEC). Anaerobe 61:102143. doi: 10.1016/j.anaerobe.2019.102143 [DOI] [PubMed] [Google Scholar]
- Vlaeminck B., Fievez V., Canbrita A. R. J., Fonseca A. J. M., Dewhurst R. J... 2006a. Factors affecting odd- and branched-chain fatty acids in milk: a review. Anim. Feed Sci. Technol. 131:389–417. doi: 10.1016/j.anifeedsci.2006.06.017 [DOI] [Google Scholar]
- Vlaeminck B., Fievez V., Tamminga S., Dewhurst R. J., van Vuuren A., De Brabander D., and Demeyer D... 2006b. Milk odd- and branched-chain fatty acids in relation to the rumen fermentation pattern. J. Dairy Sci. 89:3954–3964. doi: 10.3168/jds.S0022-0302(06)72437-7 [DOI] [PubMed] [Google Scholar]
- Vlaeminck B., Gervais R., Rahman M. M., Gadeyne F., Gorniak M., Doreau M., and Fievez V... 2015. Postruminal synthesis modifies the odd- and branched-chain fatty acid profile from the duodenum to milk. J. Dairy Sci. 98:4829–4840. doi: 10.3168/jds.2014-9207 [DOI] [PubMed] [Google Scholar]
- Wiese B. I., Hendrick S., Campbell J. G., McKinnon J. J., Beauchemin K. A., McAllister T. A., and Penner G. B... 2017. Defining risk for low reticuloruminal pH during the diet transition period in a commercial feedlot in western Canada. J. Anim. Sci. 95:420–435. doi: 10.2527/jas.2016.0969 [DOI] [PubMed] [Google Scholar]
- Yang C., McKain N., McCartney C. A., and Wallace R. J... 2019. Consequences of inhibiting methanogenesis on the biohydrogenation of fatty acids in bovine ruminal digesta. Anim. Feed Sci. Technol. 254;114189. doi: 10.1016/j.anifeedsci.2019.05.012 [DOI] [Google Scholar]
- Zened A., Enjalbert F., Nicot M. C., and Troegeler-Meynadier A... 2013. Starch plus sunflower oil addition to the diet of dry dairy cows results in a trans-11 to trans-10 shift of biohydrogenation. J. Dairy Sci. 96:451–459. doi: 10.3168/jds.2012-5690 [DOI] [PubMed] [Google Scholar]
- Zhang T. T., Zhao G. Y., Zheng W. S., Niu W. J., Wei C., and Lin S. X... 2015. Effects of rare earth element lanthanum on rumen methane and volatile fatty acid production and microbial flora in vitro. J. Anim. Physiol. Anim. Nutr. (Berl). 99:442–448. doi: 10.1111/jpn.12251 [DOI] [PubMed] [Google Scholar]