Characterizing the transport and utilization of the neurotransmitter GABA in the bacterial pathogen Brucella abortus

James A Budnick; Lauren M Sheehan; Angela H Benton; Joshua E Pitzer; Lin Kang; Pawel Michalak; R Martin Roop, II; Clayton C Caswell

doi:10.1371/journal.pone.0237371

. 2020 Aug 26;15(8):e0237371. doi: 10.1371/journal.pone.0237371

Characterizing the transport and utilization of the neurotransmitter GABA in the bacterial pathogen Brucella abortus

James A Budnick ^1,², Lauren M Sheehan ^1,², Angela H Benton ^1,², Joshua E Pitzer ³, Lin Kang ^2,⁴, Pawel Michalak ^2,^4,⁵, R Martin Roop II ³, Clayton C Caswell ^1,^2,^*

Editor: Axel Cloeckaert⁶

PMCID: PMC7449393 PMID: 32845904

Abstract

The neurotransmitter gamma-aminobutyric acid (GABA) is the most abundant inhibitory neurotransmitter in the human brain; however, it is becoming more evident that this non-proteinogenic amino acid plays multiple physiological roles in biology. In the present study, the transport and function of GABA is studied in the highly infectious intracellular bacterium Brucella abortus. The data show that ³H-GABA is imported by B. abortus under nutrient limiting conditions and that the small RNAs AbcR1 and AbcR2 negatively regulate this transport. A specific transport system, gts, is responsible for the transport of GABA as determined by measuring ³H-GABA transport in isogenic deletion strains of known AbcR1/2 regulatory targets; however, this locus is unnecessary for Brucella infection in BALB/c mice. Similar assays revealed that ³H-GABA transport is uninhibited by the 20 standard proteinogenic amino acids, representing preference for the transport of ³H-GABA. Metabolic studies did not show any potential metabolic utilization of GABA by B. abortus as a carbon or nitrogen source, and RNA sequencing analysis revealed limited transcriptional differences between B. abortus 2308 with or without exposure to GABA. While this study provides evidence for GABA transport by B. abortus, questions remain as to why and when this transport is utilized during Brucella pathogenesis.

Introduction

Gamma-aminobutyric acid (GABA) is a non-proteinogenic amino acid that is a common and important inhibitory neurotransmitter in the vertebrate brain [1]. However, our understanding of the biological function of GABA has expanded over the years to include neurobiology, immunology, and bacteriology. With regards to metabolism, the GABA shunt is utilized by both prokaryotes and eukaryotes to metabolize GABA to succinate, which can then be supplied into the TCA cycle [2, 3]. This is achieved by transport of exogenous GABA or conversion of endogenous glutamate to GABA by the enzyme glutamate decarboxylase (GAD). GAD is an important enzyme for both the production of GABA and deacidification of the intracellular environment. If the pH of the cell becomes unfavorably low, GAD can convert glutamate to GABA with the attachment of a proton, then export it out of the cell, which will result in increased intracellular pH [4, 5].

In plants, several studies have revealed the necessity for GABA during metabolism and developmental growth [6–8], but GABA is also an important modulator of immunity against pathogenic organisms, including insects, fungi, and bacteria. Upon plant cell damage, the pH of the plant intracellular environment will decrease, activating the GAD system, producing an excess of secreted GABA surrounding the damaged area of the plant [3]. In insects, increased environmental GABA concentrations have been shown to lead to decreased larvae growth rate, survival, and feeding by pests on tobacco plants [9–11]. Exogenous GABA also has a negative effect on bacterial pathogenesis of plants. A deletion of the GABA transaminase, responsible for the conversion of GABA to succinic semialdehyde in the GABA shunt, in Pseudomonas syringae led to decreased expression of a type III secretion system required for full virulence of the bacterium [12]. This deletion strain displayed significant reductions in virulence in planta when compared to the parental strain, which was attributed to the decreased expression of the type III secretion system [12]. Decreased virulence by exogenous GABA has also been shown in the bacterial plant pathogen Agrobacterium tumefaciens. A. tumefaciens encodes two ABC transport systems, Bra and Gts, that import exogenous GABA [13, 14]. Once GABA is transported into A. tumefaciens, it is catabolized via the GABA shunt and byproducts of the shunt induce the expression of AttM, a lactonase [15]. This lactonase will quench quorum signaling molecules expressed by A. tumefaciens leading to a decrease in the expression of virulence related genes [13, 14]. By increasing the expression of GAD and secretion of GABA by plants, studies have shown that tobacco plant susceptibility to A. tumefaciens can be decreased. Mutating the GAD system in a plant, however, led to increased T-DNA transfer, a major virulence factor, from A. tumefaciens to a tomato plant model [15, 16]. Alternatively, increasing GABA transaminase activity in A. tumefaciens, causing a decrease in intracellular GABA concentrations, led to higher rates of T-DNA transfer and transformation of tomato plants, further emphasizing the inhibitory role of GABA in A. tumefaciens virulence [16].

More recently, GABA has been observed to be an immunomodulator in mammalian systems, and several studies have shown that GABA activates immune cells and plays a role in the antimicrobial activity of macrophages. Bhat et al. demonstrated that immune cells (dendritic cells and macrophages) can synthesize and catabolize GABA, and the presence of GABAergic agents led to a decrease in inflammation [17]. The authors hypothesize that GABA could potentially be utilized as a signaling molecule between immune cells to modulate inflammation. Interestingly, GABAergic signaling has also been shown to enhance phagosomal maturation in macrophages, and inhibition of this signaling led to increased intracellular concentrations of bacteria within a macrophage [18]. These studies reinforce that further understanding of the role GABA plays in eukaryotic immunology is necessary.

Brucella spp. are pathogenic intracellular bacteria within the Order Rhizobiales in the Class Alphaproteobacteria. The brucellae infect a variety of mammalian species, both wild and domesticated, in which brucellosis primarily affects reproductive health in these animals, and chronic infection can lead to multiple organ complications [19, 20]. Several Brucella spp. also have the capacity to cause infection in humans via direct contact with contaminated animal products, and brucellosis is one of the most prevalent zoonoses worldwide [21]. Human brucellosis primarily presents as flu-like symptoms including an undulating fever and chronic infection can also cause damage to multiple organs [22, 23]. Brucella spp. are stealth pathogens that contain few classical virulence factors and primarily evade the host immune system by adaptation to the harsh intracellular environment and formation of a replicative niche within primary immune cells (dendritic cells and macrophages) of the host [24, 25].

Small regulatory RNAs (sRNAs) are understudied virulence factors of the brucellae, and importantly, sRNAs can swiftly regulate gene function post-transcriptionally to adapt to changing environmental conditions [26]. While characterizing the role of the sRNAs AbcR1 and AbcR2 (AbcR1/2) in B. abortus pathogenesis, it was demonstrated that these small RNAs primarily function as negative regulators of several ABC type transport systems in B. abortus [27]. Two loci regulated by AbcR1/2 have previously been studied with regards to GABA transport in other Alphaproteobacteria [28, 29]. One putative transport system, a locus including bab1_1792-bab1_1799 (bab_rs24455-bab_rs24485), encodes proteins with high amino acid sequence identity to one of the GABA ABC transport systems, Bra, mentioned above in Agrobacterium tumefaciens (Fig 1A). It should be noted that the B. abortus genome has recently been reannotated, and while the old nomenclature will be utilized throughout this manuscript, new gene designations (bab_rs#####) will follow the old designation after the initial mention in the manuscript for reference. Similar to B. abortus, the homologous transport system in A. tumefaciens has also been shown to be negatively regulated by AbcR1 [28]. The second putative transport system, a locus including bab2_0876-bab2_0879 (bab_rs30470-bab_rs30485), encodes proteins with low amino acid sequence identity to the GABA Transport System, Gts, in Rhizobium leguminosarum and A. tumefaciens (Fig 1B) [29].

Fig 1 — A. Genetic organization of *bab1_1972-bab1_1799* located on chromosome I of *Brucella melitensis* biovar Abortus 2308. Putative functions for each gene and percent amino acid identity to *bra* genes in related organisms are located below the gene. Proteins encoded from this locus exhibit high amino acid identity to the *bra* locus in *Agrobacterium tumefaciens* str. C58. B. Genetic organization of *bab2_0876-bab2_0879* located on chromosome II of *Brucella melitensis* biovar Abortus 2308. Putative functions for each gene and percent amino acid identity to *gts* genes in related organisms are located below the gene. Proteins encoded from this locus exhibit moderate amino acid identity to the *gts* locus in R. *leguminosarum* bv. viciae 3841.

No previous studies have explored the function of GABA within the brucellae, with the exception of the GAD system [30]. Interestingly, the functionality of the GAD system differs between species of Brucella. The “classical” species of Brucella (B. melitensis, B. abortus, B. suis, B. canis, B. neotomae, and B. ovis) do not possess a functional GAD system due to point or frame-shift mutations in gadB and gadC genes [30]. Thus, the potential role for GABA utilization by the “classical” species of Brucella is unknown. The following study will focus on characterizing the potential import of GABA into B. abortus and elucidate the functional role of GABA in Brucella pathogenesis. The results reveal that GABA is transported under nutrient limiting conditions, and GABA transport is regulated by AbcR1 and AbcR2 in B. abortus. The data also showed minimal metabolic or regulatory potential for GABA by B. abortus in vitro under the conditions tested.

Results

B. abortus can import ³H-GABA, and this transport is inhibited by the presence of glutamate

GMM is a commonly used minimal medium in which to grow Brucella to mimic a nutrient-limiting environment [31]. Brucella growth is sustained in this medium but will not reach high concentrations compared to growth in nutrient rich medium, such as brucella broth. GMM specifically contains the amino acid glutamate as a carbon and nitrogen source. We hypothesized that if Brucella could transport GABA, it would most likely occur in growth of limited nutrient concentrations when transport system expression is increased. A GABA transport study was utilized to determine 1) if B. abortus could import ³H-GABA in GMM and 2) if glutamate in the medium would inhibit the uptake of ³H-GABA. The experiment was conducted with GMM containing glutamate (GMM) and GMM without the addition of glutamate (GMM-Glu).

Briefly, B. abortus strains were grown on SBA plates for 48 hours, and then cultures of B. abortus were incubated for 20 minutes in either GMM or GMM-Glu. Subsequently, the cultures were inoculated with ³H-GABA and incubated for an additional 20 minutes. Cultures were then collected via filtration through a syringe filter (see methods). The radioactivity of the filter was measured to quantify the amount of radiation imported by the brucellae collected. If ³H-GABA is imported by B. abortus, then the filter will measure high radioactivity above background; however, if ³H-GABA is not imported by B. abortus, then the ³H-GABA will pass through the filter and the filter will not measure high radioactivity above background. As a control, 1000-fold excess non-radiolabeled GABA was added to the cultures simultaneously to out-compete ³H-GABA import and show specificity for GABA.

The assay revealed that B. abortus 2308 imported ³H-GABA in both GMM and GMM-Glu and this transport was specific for GABA as the addition of excess non-radiolabeled GABA in both culture media significantly decreased 3H-GABA import (Fig 2). However, when glutamate was present in the culture medium, the amount of ³H-GABA imported by B. abortus 2308 decreased by over 95%. These data indicate that transport of ³H-GABA is increased under nutrient limitation.

Fig 2 — ³H-GABA uptake by B. *abortus* 2308 was assessed in minimal medium with (GMM) and without (-Glu) the addition of glutamate to the medium. Data is normalized to GMM(-Glu) at 100%. Controls include the addition of excess nonradiolabled GABA to competitively inhibit ³H-GABA uptake. The asterisks denote a statistically significant difference (** P<0.005, *** P<0.0005; Student’s t test) in uptake.

The presence of proteinogenic amino acids does not considerably inhibit the import of ³H-GABA into B. abortus

The above ³H-GABA transport assay was again utilized to assess whether proteinogenic amino acids could competitively inhibit ³H-GABA import in B. abortus. The same assay was utilized, except that B. abortus 2308 was incubated in GMM-Glu (as glutamate inhibited ³H-GABA transport in Fig 2) throughout the experiment. After the initial incubation period, the cultures were inoculated with ³H-GABA and the addition of no inhibitor or 100 μM individual amino acids, resulting in a ratio of 1:1,000 ³H-GABA:nonradiolabeled amino acid. The cultures were filtered and measured for radioactivity. The control group showed ³H-GABA uptake was almost completely inhibited by the presence of 1,000-fold excess nonradiolabeled GABA (Fig 3). The import of ³H-GABA was not significantly changed by the presence of most other nonradiolabled amino acids. However, 1,000-fold excess lysine or methionine significantly decreased ³H-GABA import and 1,000-fold excess asparagine, cysteine, tryptophan, or valine significantly increased ³H-GABA import. It should be noted, however, that these difference are small, implying a preference for ³H-GABA import over all proteinogenic amino acids under these conditions.

Fig 3 — ³H-GABA uptake by B. *abortus* 2308 was assessed uninhibited and in the presence of 1,000-fold excess GABA or 20 proteinogenic amino acids. Data is normalized to the absence of inhibitor at 100%. The asterisk denotes a statistically significant difference (* P<0.05, ** P<0.005, *** P<0.0005; Student’s t test) in uptake of ³H-GABA between B. *abortus* 2308 uninhibited (no inhibitor) and in the presence of excess nonradiolabled GABA, asparagine, cysteine, lysine, methionine, and tryptophan.

Combined with the previous experiment, these results suggest that glutamate does not competitively inhibit the transport of GABA via interactions with the putative transport system, but rather the expression of the GABA transporter may be induced in the absence of glutamate. This experiment also indicates that the mechanism responsible for the transport of GABA would preferentially transport GABA prior to the transport of other amino acids; if this mechanism can transport other amino acids at all.

³H-GABA import is inhibited by the sRNAs AbcR1 and AbcR2

The regulation of GABA transport is mediated by the sRNA AbcR1 in A. tumefaciens, and a deletion of abcR1 results in increased import of radiolabeled GABA in A. tumefaciens [28]. B. abortus 2308 encodes the sRNAs AbcR1 and AbcR2, homologs of AbcR1 in A. tumefaciens, which regulate ABC-type transport systems, including the homologous GABA transport in A. tumefaciens [27]. Therefore, we hypothesized that a deletion of abcR1 and abcR2 in B. abortus would result in increased GABA transport.

To test this hypothesis, the above mentioned ³H-GABA transport assay was utilized to assess the import of ³H-GABA by B. abortus 2308 (2308) or B. abortus 2308::ΔabcR1ΔabcR2 (ΔabcR1/2) (Fig 4). The results indicated that ³H-GABA import was increased by almost 50% in ΔabcR1/2 compared to the parental strain. 1,000-fold excess nonradiolabled GABA was added to cultures as a control, which inhibited ³H-GABA import in both 2308 and ΔabcR1/2. This indicated that GABA transport was negatively regulated by the sRNAs AbcR1 and AbcR2, similarly to what has been observed in A. tumefaciens.

bab2_0879 is necessary for the transport of ³H-GABA in B. abortus

Due to the negative regulation of ³H-GABA transport by AbcR1/2 (Fig 4), it was hypothesized that one or more of the transport systems negatively regulated by AbcR1/2 is responsible for the transport of ³H-GABA. To test this hypothesis, the above ³H-GABA transport assay was repeated to measure ³H-GABA uptake in B. abortus 2308, as well as several strains carrying isogenic deletion of genes encoding putative periplasmic binding proteins of transporter systems that are significantly negatively regulated by AbcR1 and AbcR2 [27, 32]. These deletion strains include Δbab2_0612 (bab_rs29240), Δbab2_0879, and Δbab1_1792-bab1_1794 (Fig 5). The isogenic deletion strains of bab2_0612 and bab2_0879 were constructed previously [32], and the combined bab1_1792–1794 deletion strain was generated in the present study. The transport of ³H-GABA only decreased by ~20% in Δbab2_0612 and Δbab1_1792-bab1_1794 when compared to the parental strain, B. abortus 2308, indicating that they may partially be involved in GABA transport. However, the transport of ³H-GABA by Δbab2_0879 decreased by ~97% when compared to B. abortus 2308, implicating bab2_0879 as a component of the main transporter of GABA in B. abortus (Fig 5A). Reconstruction of bab2_0879 on the B. abortus 2308:: Δbab2_0879 genome complemented ³H-GABA import (Fig 5B). These data clearly show that bab2_0879 is involved in GABA transport and should be annotated as gtsA based on homology and function.

Fig 5 — A. ³H-GABA uptake by B. *abortus* 2308, Δ*bab2_0612*, Δ*bab2_0879*, Δ*bab1_1792*Δ*bab1_1794*, and Δ*bab2_0879* in assessed in minimal medium, GMM(-Glu). Data is normalized to 2308 at 100%. Asterisks denote a statistically significant difference (* P<0.05, *** P<0.0005; Student’s t test) in uptake between B. *abortus* 2308 and deletion strains. B. ³H-GABA uptake by B. *abortus* 2308, Δ*bab2_0879*, and Δ*bab2_0879*-RCbab2_0879 in minimal medium, GMM(-Glu). Data is normalized to 2308 at 100%. Asterisks denote a statistically significant difference (*** P<0.0005; Student’s t test) in uptake between strains.

bab2_0879 is not necessary for survival and replication in peritoneal derived macrophages nor chronic infection of a mouse model of brucellosis via the oral route of infection

It was reported previously that a deletion of bab2_0879 did not affect the ability of B. abortus to colonize the spleen of a mouse infected intraperitoneally [32]. Therefore, this strain was further tested for its ability to survive and replicate within peritoneally derived macrophages in vitro and to colonize the spleens of mice infected orally in vivo.

A gentamycin protection assay was utilized to assess the survival and replication of B. abortus strains within macrophages. Naïve macrophages were isolated from the peritoneal cavity and infected with either B. abortus 2308 or B. abortus 2308:: Δbab2_0879 (Δbab2_0879) at an MOI of 100. Infected macrophages were lysed 2, 24, and 48 hours post-infection and serial diluted to calculate CFU brucellae/well. A deletion of bab2_0879 did not affect the ability of B. abortus to survive and replicate within macrophages when compared to the parental strain B. abortus 2308 (Fig 6A).

Fig 6 — A. Macrophage survival and replication experiments. Cultured peritoneal macrophages from BALB/c mice were infected with B. *abortus* 2308 and the isogenic *bab2_0879* deletion strain (Δ*bab2_0879*). At the indicated times post-infection, macrophages were lysed, and the number of intracellular brucellae present in these phagocytes was determined by serial dilution and plating on agar medium. B. Oral mouse infection experiments. BALB/c mice (6 per strain) were infected intraperitoneally with B. *abortus* 2308 and Δ*bab2_0879*. Mice were sacrificed 1, 2, and 4 weeks post-infection, and Log₁₀ brucellae/spleen were calculated. The data are presented as average numbers of brucellae ± standard deviations of results from the 6 mice (3 male and 3 female mice) colonized with a specific *Brucella* strain at each time point.

BALB/c mice were infected orally with 10⁹ CFU of B. abortus 2308 or Δbab2_0879 and infection was monitored 1, 2, and 4 weeks post-infection. After 1, 2, or 4 weeks, the mice were sacrificed, spleens removed and homogenized, and homogenates were serial diluted to determine CFU brucellae/spleen (Fig 6B). Under the conditions tested, the ability of the B. abortus Δbab2_0879 strain to colonize the spleen was not significantly changed when compared to the parental strain.

GABA is not utilized as a nitrogen or carbon source by Brucella

To elucidate the biological role of GABA in the brucellae, two situations were considered: GABA is either acting as a source of carbon and/or nitrogen, or GABA functions as a signaling molecule to induce changes in gene expression. The hypothesis that GABA is a metabolite was first examined. As mentioned before, GMM is often utilized as a defined medium to mimic a nutrient-limiting environment. This medium was developed in 1958 by Philipp Gerhardt and contains several sources of carbon; including lactic acid, glycerol, and glutamate; and glutamate as the sole nitrogen source [31]. Growth curves were utilized to test the ability for GABA to be utilized as a nitrogen source for the brucellae via replacement of glutamate. B. abortus 2308 was grown overnight in brucella broth to late exponential phase, pelleted and washed, and then used to inoculate GMM with glutamate (GMM), GMM without glutamate (GMM-Glu), or GMM without glutamate but supplemented with GABA (0.15%) (GMM-Glu+GABA). Growth of the bacterium was measured in each culture for 175 hours (Fig 7A). Initially, all cultures showed growth, most likely due to residual nutrients from the nutrient rich brucella broth. However, B. abortus 2308 grown in GMM-Glu and GMM-Glu+GABA revealed a decrease in bacterial concentration in comparison to B. abortus 2308 in GMM over time. This indicated that GABA is likely not utilized as a nitrogen source in place of glutamate for sustained B. abortus growth.

Fig 7 — A. Growth of B. *abortus* 2308 in minimal medium (GMM), minimal medium lacking glutamate (GMM-Glu), and minimal medium lacking glutamate with the addition of GABA (0.15%) (GMM-Glu+GABA). The asterisk denotes a statistically significant difference (* P<0.05; Student’s t test) in uptake between B. *abortus* 2308 grown in GMM compared to B. *abortus* 2308 grown in either GMM-Glu or GMM-Glu+GABA. B. Oxygen consumption by B. *abortus* 2308 grown in TSB with the addition of either GABA, glutamate, or erythritol 300 seconds after inoculation measured via oxygraph machine.

A respirometry assay was utilized to assess GABA as a potential carbon source utilized by B. abortus. Oxygen concentrations of B. abortus cultures were measured via oxygraph machine to calculate respiration in response to different carbon sources. The carbon sources tested included GABA, glutamate, or erythritol. The metabolic role of glutamate is discussed above. Erythritol is a sugar alcohol found in the reproductive tracts of animals susceptible to brucellosis and has been shown to be a preferred carbon source for brucellae growth as well as an inducer of virulence related genes [33, 34]. Oxygen is consumed during aerobic respiration, thus if the bacterium is actively utilizing the supplied carbon source, then respiration will increase and oxygen concentrations of the culture medium will decrease. In the presence of erythritol, a preferred carbon source of B. abortus, respiration occurred at a high rate and oxygen levels decreased rapidly (Fig 7B). In the presence of glutamate, a suitable carbon and nitrogen source for B. abortus, but not preferred over erythritol, respiration occurred at a slower rate compared to erythritol, but oxygen consumption still occurred. In the presence of GABA, however, the change in oxygen concentration over time was negligible, indicating that GABA was not utilized as a carbon source by B. abortus (Fig 7B).

Minimal transcriptional changes were observed in B. abortus 2308 exposed to exogenous GABA

RNAseq analysis was performed to assess the potential role of GABA as a signaling molecule. RNA was isolated from cultures of B. abortus 2308 grown aerobically in GMM in the presence or absence of 1 mM GABA and analyzed via RNA-seq analysis. Only one gene, the putative transposase BAB_RS29595, was downregulated 2.26 fold in the culture treated with 1 mM GABA.

Discussion

In this study, the transport and biological function of GABA was analyzed in the intracellular pathogen B. abortus. The data presented revealed that ³H-GABA is transported under nutrient limiting conditions, transport was regulated by the sRNAs AbcR1 and AbcR2, and transport occurred via an ABC-transport system homologous to the gts system in Rhizobium leguminosarum and A. tumefaciens. Because of these results, we have annotated bab2_0876-bab2_0879 as gtsC, gtsB, gtsD, gtsA for GABA transport system, respectively (Fig 1B).

The observation that the Gts system transports GABA preferentially over proteinogenic amino acids is intriguing, because this is not what is observed in A. tumefaciens. In A. tumefaciens, ³H-GABA uptake was competitively inhibited by short lateral chain amino acids, as well as proline [13]. Dissimilar from A. tumefaciens, ³H-GABA transport in B. abortus was uninhibited by the presence of other amino acids (Fig 3). This is a significant divergence between the two related organisms with regards to GABA transport and can be explained by a difference in the number of transporters between the two organisms. A. tumefaciens contains two GABA transport systems, Bra which is responsible for the transport of several amino acids and Gts which solely transports GABA [35]. As stated previously, B. abortus encodes two putative GABA transporters, bab1_1794 which is homologous to the periplasmic binding protein of Bra and bab2_0879 which is homologous to the periplasmic binding protein of Gts. Our results clearly show GABA transport in B. abortus is primarily mediated by gts (Fig 5). This result was surprising due to the low amino acid sequence identity of BAB2_0876-BAB2_0879 to the Gts GABA transporter in R. leguminosarum and A. tumefaciens (<40%) compared to the high amino acid sequence identity of BAB1_1794-BAB1_1799 compared to the Bra GABA transport system in A. tumefaciens (>70%) (Fig 1). In B. abortus, the Bra system (i.e., BAB1_1792–1799) does not appear to be a specific GABA transporter, and this reveals a deviation within the Rhizobiales with regards to amino acid transport, which may explain why GABA transport was unaffected by the presence of other amino acids. Nonetheless, it is important to note that deletion of bab2_0612 and bab1_1792–1794 also lead to significant decreases in GABA transport (Fig 5), and therefore, while these systems may not be primary GABA transporters, it is clear that BAB2_0612 and BAB1_1792–1794 have the ability to support moderate GABA import by B. abortus.

We were unable to clearly define the biological role of GABA transport in B. abortus, despite metabolic and transcriptomic analyses. There are several potential reasons for this, including the potential for the identified transporter to also be able to transport other molecules. While the amino acid competition assay showed preference for GABA transport over proteinogenic amino acids, this does not discount the possibility that the Gts system is also able to transport other non-proteinogenic amino acids. The National Center for Biotechnology Information (NCBI) has gtsA annotated as a “spermidine/putrescine ABC transporter substrate-binding protein” in B. abortus. It has recently come to light that polyamines, such as spermidine and putrescine, are important for the persistence of B. abortus during chronic infection [36]. Therefore, further analyses of Gts in B. abortus may be necessary to characterize the potential for transport of both proteinogenic amino acids and polyamines.

Understanding the processing of imported GABA in other organisms can lead to important insights into the biological role of GABA; the Brucella genome may provide clues to this processing. The GABA shunt can be utilized to form succinate, a substrate utilized during the TCA cycle [2, 3]. This process occurs by converting GABA to succinic semialdehyde by the enzyme GABA-transaminase (GabT), followed by the conversion from succinic semialdehyde to succinate by succinic semialdehyde dehydrogenase (SSDH) [2]. Although the metabolic studies presented here do not reveal any metabolic utilization of GABA by B. abortus, the Brucella genome does contain genes encoding putative GabT (BAB2_0285) and SSDH (GabD, BAB1_1655). The function of these genes has not been characterized, but if functional, one or both could be important in the conversion of GABA to a utilizable carbon substrate. It is possible that mass spectrometry analyses of imported radiolabeled GABA could identify if and how GABA is processed by B. abortus and could lead to the formation of new hypotheses regarding the processing of this molecule by the brucellae. In the end, while we did not observe GABA utilization under the specific experimental conditions shown here, it is possible that Brucella catabolizes GABA under another condition or set of conditions that are encountered by the bacteria during infection.

This study and previous work from our lab has shown that deletion of gtsA (bab2_0879) did not change the ability of B. abortus to survival and replicate in peritoneally derived macrophage nor in a mouse model of infection via IP injection or oral route in BALB/c mice [32]. Interestingly, several studies identified gtsA as a potential virulence factor via different in vitro and in vivo screens. Firstly, the expression of gtsA has been shown to be increased in a quorum sensing mutant (ΔbabR) and in the B. melitensis Rev. 1 vaccine strain when compared to the parental strain B. melitensis 16M [37, 38]. Genomic analysis revealed a nonsynonymous mutation in gtsA in the B. melitensis vaccine strain M5 when compared to B. melitensis 16M [39]. Delrue et al. published a list of attenuated Brucella mutants in large-scale in vitro and in vivo screens [40]. They reported that a mutation in BMEII0923 (a homolog of gtsA in B. melitensis) and BRA0326 (a homolog of gtsA in B. suis) was attenuated in a mouse model. Importantly, BAB2_0879, BMEII0923, and BRA0326 are 100% identical at the amino acid level. The type of mutation and mouse model utilized in this screen was not described, but this finding is intriguing and leads to further questions about whether gtsA has homologous functions in different Brucella species and whether the mouse model utilized in our study versus the Delrue study could lead to different observations in virulence [41]. Despite our results showing no difference in infection between ΔgtsA compared to B. abortus 2308, these studies highlight the potential role for gtsA in B. abortus virulence and further analysis may be warranted. There are several possibilities for these differences, including differences in mouse strains (e.g., BALB/c vs. C57BL/6) and routes of infection (e.g., oral vs. intraperitoneal vs. aerosol) employed and moreover, while the gts system is dispensable for the infection of mice, it is possible that the Gts system is important for infection in natural host animals. Brucellosis also presents as a neurological disease in humans and marine mammals and recent evidence has shown that B. abortus can traverse the blood brain barrier [41–43]. Since GABA is an important and abundant neurotransmitter in the brain, it is possible that gts plays a significant and specific role in neurobrucellosis pathology.

Overall, this study characterizes the transport of the ubiquitous non-proteinogenic amino acid GABA by the intracellular bacterial pathogen B. abortus. While transport assays provided novel insights into the transport of this molecule by B. abortus, the data revealed limited metabolic, transcriptional, or virulence phenotypes in a deletion strain of this transporter. However, evidence found throughout scientific literature continues to add to the hypothesis that GABA and the Gts system are important for the pathogenesis of Brucella, warranting further studies to understand the biological role of GABA.

Materials and methods

Bacterial strains and growth conditions

B. abortus 2308 and derivative strains were routinely grown on Schaedler blood agar (SBA), which is composed of Schaedler agar (BD, Franklin Lakes, NJ) containing 5% defibrinated bovine blood (Quad Five, Ryegate, MT). Cultures were routinely grown in brucella broth (BD), tryptic soy broth (TSB), or in Gerhardt’s Minimal Medium (GMM) [31]. For cloning, Escherichia coli strain DH5α was grown on tryptic soy agar (BD) or in Luria-Bertani (LB) broth. When appropriate, growth media were supplemented with kanamycin (45 μg/ml).

Ethics statement

The experiments involving animals were carried out in strict accordance to the regulations set forth by Virginia Tech, as well as in accordance with all federal regulations. These experiments were approved by the Institutional Animal Care and Use Committee (IACUC) under Virginia Tech IACUC protocol 19–052. Additionally, these experiments were performed at Virginia Tech’s VA-MD College of Veterinary Medicine, which is accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care (AAALAC).

Construction of B. abortus deletion strains

B. abortus strains containing isogenic, unmarked, nonpolar deletions of bab2_0879 and bab2_0612 were constructed for a previous study [32]. A single strain containing a deletion of the bab1_1794 and bab1_1792 locus in B. abortus 2308 was constructed using a nonpolar, unmarked gene excision strategy as described previously [44]. Briefly, an approximately 1-kb fragment of the upstream region of bab1_1794 extending to the second codon of the coding region was amplified by PCR using primers bab1_1794-Up-For and bab1_1794-Up-Rev and genomic DNA from B. abortus 2308 as a template. Similarly, a fragment containing the last two codons of the coding region and extending to approximately 1 kb downstream of the bab1_1792 open reading frame (ORF) was amplified with primers bab1_1792-Down-For and bab1_1792-Down-Rev. The sequences of all oligonucleotide primers used in this study can be found in Table 1, and the plasmids used in the study are listed in Table 2. The upstream fragment was digested with BamHI, the downstream fragment was digested with PstI, and both fragments were treated with polynucleotide kinase in the presence of ATP. Both of the DNA fragments were included in a single ligation mix with BamHI/PstI-digested pNTPS138 (M.R.K. Alley, unpublished data) and T4 DNA ligase (Monserate Biotechnology Group, San Diego, CA). The resulting plasmid (pΔbab1_1794Δbab1_1792) was introduced into B. abortus 2308, and merodiploid transformants were obtained by selection on SBA plus kanamycin. A single kanamycin-resistant clone was grown for >6 h in brucella broth and then plated onto SBA containing 10% sucrose. Genomic DNA was isolated from sucrose resistant, kanamycin-sensitive colonies and screened by PCR for loss of the bab1_1794-bab1_1792 locus.

Table 1. Oligonucleotide primers used in this study.

Primer name	Sequence (5'->3’)
bab1_1794-Up-For	`TAGGATCCTGTTCCCGCGTCTGAAGGAGC`
bab1_1794-Up-Rev	`GAAGGCGATGACTGCAGCAAGAG`
bab1_1792-Down-For	`TACTTCCAGAAGTAAATTGCC`
bab1_1792-Down-Rev	`GACTGCAGACGCTCAAAAAGATGGACCG`

Open in a new tab

*Underlined sequences depict a restriction endonuclease recognition site.

Table 2. Plasmids used in this study.

Plasmid name	Description	Reference
pNPTS138	Cloning vector; contains sacB; Kan^R	(M.R.K. Alley, unpublished)
pΔbab1_1794Δbab1_1792	In-frame deletion of bab1_1794 and bab1_1792 locus plus 1 kb of each flanking region in pNPTS138	This study

Open in a new tab

³H-GABA uptake assays

A radiolabeled transport assay was utilized to assess the ability of B. abortus strains to import tritium labelled GABA (³H-GABA) grown under several growth conditions. Gerhardt’s Minimal Media (GMM) was inoculated with Brucella strains at a concentration of 10⁹ CFU brucellae/ml and incubated for 20 minutes at 37°C with shaking. The cultures were then inoculated with ³H-GABA at a final concentration of 100 nM and incubated for another 20 minutes at 37°C with shaking. The bacteria were collected via filtration through a filter (0.45 μm), washed three times with GMM, and the radioactivity of the filter was measured to quantify the amount of radiation imported by the brucellae collected on the filter by scintillation counter. If ³H-GABA is imported by B. abortus, then the filter will measure high radioactivity above background; however, if ³H-GABA is not imported by B. abortus, then the ³H-GABA will pass through the filter and the filter will not measure high radioactivity above background.

Respirometry assay

Culture tubes of 5 mL of TSB were inoculated with B. abortus 2308 at a final concentration of 10⁷ CFU/mL and either 10 mM erythritol, glutamic acid, or GABA. The cultures were grown overnight at 37°C with shaking. The following day, the brucellae were pelleted, supernatant removed, and pellet resuspended in PBS at a final concentration of 10² CFU/mL. Samples were then loaded into an oxygraph and oxygen concentrations were subsequently measured. After 300 seconds, erythritol, glutamic acid, or GABA were added to the corresponding culture tube at a final concentration of 100 mM and culture oxygen concentrations were measured for 2000 seconds.

RNA sampling of GABA treated cultures

Brucella broth was inoculated with B. abortus 2308 and incubated at 37°C with shaking for ~24 hours until the cultured obtained an O.D. 600 nm of 0.15. Cells were then washed with PBS and cells were used to inoculate either GMM or GMM with the addition of 1 mM L-GABA at a concentration of 10⁹ CFU/mL. Cultures were incubated for 20 minutes at 37°C with shaking. Following incubation, an equal volume of 1:1 ethanol:acetone was added to each culture and cultures were frozen at -80°C until RNA isolation. This was performed in triplicate for each condition. RNA was isolated from each culture and DNase treated prior to submission for RNAseq analysis.

Stranded RNA library construction for prokaryotic RNA-seq

1 μg of total RNA with RIN ≥ 8.0 was depleted of rRNA using Illumina's Ribo-Zero rRNA Removal Kit (Gram-Positive and Gram-Negative Bacteria) (P/N MRZB12424, Illumina, CA). The depleted RNA is fragmented and converted to first strand cDNA using reverse transcriptase and random primers using Illumina’s TruSeq Stranded mRNA HT Sample Prep Kit (Illumina, RS-122-2103). This is followed by second strand synthesis using polymerase I and RNAse H, and dNTPs that contain dUTP instead of dTTP. The cDNA fragments then go through end repair, addition of a single ‘A’ base, and then ligation of adapters and indexed individually. The products are then purified and the second strand digested with N-Glycosylase, thus resulting in stranded template. The template molecules with the adapters are enriched by 10 cycles of PCR to create the final cDNA library. The library generated is validated using Agilent 2100 Bioanalyzer and quantitated using Quant-iT dsDNA HS Kit (Invitrogen) and qPCR. A total of 12 individually indexed cDNA libraries were pooled and sequenced on Illumina NextSeq.

Illumina NextSeq sequencing

The libraries are clustered and sequenced using, NextSeq 500/550 High Output kit V2 (150 cycles) (P/N FC-404-2002) to 2 x 75 cycles to generate paired end reads. The Illumina NextSeq Control Software v2.1.0.32 with Real Time Analysis RTA v2.4.11.0 was used to provide the management and execution of the NextSeq 500 and to generate BCL files. The BCL files were converted to FASTQ files and demultiplexed using bcl2fastq Conversion Software v2.20.

RNA-Seq data processing and analysis

The B. abortus 2308 gene and genome sequences, as well as corresponding annotations from NCBI (https://www.ncbi.nlm.nih.gov/) were used as the reference. Raw reads were quality-controlled and filtered with FastqMcf [45], resulting in an average of 1,821 Mbp (1,672 to 2,061 Mbp) nucleotides. The remaining reads were mapped to the gene reference using BWA (Li & Durbin, 2009) with default parameters. Differential expression of genes was calculated using the edgeR [46] package in R software (http://www.r-project.org/), with Benjamini–Hochberg adjusted P-values of 0.05 considered to be significant. The NCBI Sequence Read Archive (SRA) accession number for the RNA-seq data is PRJNA629010.

Virulence of Brucella strains in cultured murine macrophages and experimentally infected mice

Experiments to test the virulence of Brucella strains in primary murine peritoneal macrophages were carried out as described previously [47]. Briefly, resident peritoneal macrophages were isolated from BALB/c mice and seeded in 96-well plates in Dulbecco’s modified Eagle’s medium with 5% fetal bovine serum. The following day, Brucella strains were opsonized by incubating the strains with serum (1:1000 dilution) from previously infected mice (8 weeks post-infection) and the seeded macrophages were infected with brucellae at an MOI of 100:1. After 2 h of infection, extracellular bacteria were killed by treatment with gentamicin (50 μg/ml). For the 2-h time point, the macrophages were then lysed with 0.1% deoxycholate–PBS, and serial dilutions were plated on Schaedler blood agar (SBA). For the 24- and 48-h time points, the cells were washed with PBS following gentamicin treatment, and fresh cell culture medium containing gentamicin (20 μg/ml) was added to the monolayer. At the indicated time point, the macrophages were lysed, and serial dilutions were plated on SBA. Triplicate wells were used for each Brucella strain tested. Infection and colonization of mice by Brucella strains were measured by oral route of infection. BALB/c mice (6 mice per Brucella strain, 3 male and 3 female) were infected orally with 10⁹ CFU of each Brucella strain in sterile PBS. The animals were housed in microisolator cages in the ABSL3 laboratory, and the mice were subjected to 12-hour light– 12-hour dark cycles. Additionally, the mice were given access to pellet-style food and water ad libitum. The animals were monitored daily for signs of distress and pain in accordance with the guidelines of NIH’s Animal Research Advisory Committee (https://oacu.oir.nih.gov/animal-research-advisory-committee-guidelines). The mice were sacrificed at 1, 2, and 4 weeks post-infection, and serial dilutions of spleen homogenates were plated on SBA to determine CFU counts of brucellae/spleen.

Acknowledgments

We would like to thank the Teaching & Research Animal Care Support Service (TRACSS) at the VA-MD College of Veterinary Medicine for their rigorous and meticulous care of the animals used in this work.

Data Availability

All RNA-seq files are available from the NCBI Sequence Read Archive (SRA) database (accession number PRJNA629010)

Funding Statement

C.C.C. AI125958 National Institute of Allergy and Infectious Diseases (NIAID) https://www.niaid.nih.gov/ The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Mittal R, Debs LH, Patel AP, Nguyen D, Patel K, O'Connor G, et al. Neurotransmitters: The Critical Modulators Regulating Gut-Brain Axis. J Cell Physiol. 2017;232(9):2359–72. 10.1002/jcp.25518 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Feehily C, Karatzas KA. Role of glutamate metabolism in bacterial responses towards acid and other stresses. J Appl Microbiol. 2013;114(1):11–24. 10.1111/j.1365-2672.2012.05434.x . [DOI] [PubMed] [Google Scholar]
3.Shelp BJ, Bown AW, McLean MD. Metabolism and functions of gamma-aminobutyric acid. Trends Plant Sci. 1999;4(11):446–52. 10.1016/s1360-1385(99)01486-7 . [DOI] [PubMed] [Google Scholar]
4.Pennacchietti E, D'Alonzo C, Freddi L, Occhialini A, De Biase D. The Glutaminase-Dependent Acid Resistance System: Qualitative and Quantitative Assays and Analysis of Its Distribution in Enteric Bacteria. Frontiers in microbiology. 2018;9:2869 10.3389/fmicb.2018.02869 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.De Biase D, Pennacchietti E. Glutamate decarboxylase-dependent acid resistance in orally acquired bacteria: function, distribution and biomedical implications of the gadBC operon. Mol Microbiol. 2012;86(4):770–86. 10.1111/mmi.12020 . [DOI] [PubMed] [Google Scholar]
6.Palanivelu R, Brass L, Edlund AF, Preuss D. Pollen tube growth and guidance is regulated by POP2, an Arabidopsis gene that controls GABA levels. Cell. 2003;114(1):47–59. 10.1016/s0092-8674(03)00479-3 . [DOI] [PubMed] [Google Scholar]
7.Bown AW, Shelp BJ. Plant GABA: Not Just a Metabolite. Trends Plant Sci. 2016;21(10):811–3. 10.1016/j.tplants.2016.08.001 . [DOI] [PubMed] [Google Scholar]
8.Michaeli S, Fromm H. Closing the loop on the GABA shunt in plants: are GABA metabolism and signaling entwined? Front Plant Sci. 2015;6:419 10.3389/fpls.2015.00419 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Ramputh AI, Bown AW. Rapid [gamma]-Aminobutyric Acid Synthesis and the Inhibition of the Growth and Development of Oblique-Banded Leaf-Roller Larvae. Plant Physiol. 1996;111(4):1349–52. 10.1104/pp.111.4.1349 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Shelp BJ, Bown AW, Faure D. Extracellular gamma-aminobutyrate mediates communication between plants and other organisms. Plant Physiol. 2006;142(4):1350–2. 10.1104/pp.106.088955 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.MacGregor KB, Shelp BJ, Peiris S, Bown AW. Overexpression of glutamate decarboxylase in transgenic tobacco plants deters feeding by phytophagous insect larvae. J Chem Ecol. 2003;29(9):2177–82. 10.1023/a:1025650914947 . [DOI] [PubMed] [Google Scholar]
12.Park DH, Mirabella R, Bronstein PA, Preston GM, Haring MA, Lim CK, et al. Mutations in gamma-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence. Plant J. 2010;64(2):318–30. 10.1111/j.1365-313X.2010.04327.x . [DOI] [PubMed] [Google Scholar]
13.Planamente S, Vigouroux A, Mondy S, Nicaise M, Faure D, Morera S. A conserved mechanism of GABA binding and antagonism is revealed by structure-function analysis of the periplasmic binding protein Atu2422 in Agrobacterium tumefaciens. J Biol Chem. 2010;285(39):30294–303. 10.1074/jbc.M110.140715 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Planamente S, Morera S, Faure D. In planta fitness-cost of the Atu4232-regulon encoding for a selective GABA-binding sensor in Agrobacterium. Commun Integr Biol. 2013;6(3):e23692 10.4161/cib.23692 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Chevrot R, Rosen R, Haudecoeur E, Cirou A, Shelp BJ, Ron E, et al. GABA controls the level of quorum-sensing signal in Agrobacterium tumefaciens. Proc Natl Acad Sci U S A. 2006;103(19):7460–4. 10.1073/pnas.0600313103 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Nonaka S, Someya T, Zhou S, Takayama M, Nakamura K, Ezura H. An Agrobacterium tumefaciens Strain with Gamma-Aminobutyric Acid Transaminase Activity Shows an Enhanced Genetic Transformation Ability in Plants. Sci Rep. 2017;7:42649 10.1038/srep42649 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Bhat R, Axtell R, Mitra A, Miranda M, Lock C, Tsien RW, et al. Inhibitory role for GABA in autoimmune inflammation. Proc Natl Acad Sci U S A. 2010;107(6):2580–5. 10.1073/pnas.0915139107 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Kim JK, Kim YS, Lee HM, Jin HS, Neupane C, Kim S, et al. GABAergic signaling linked to autophagy enhances host protection against intracellular bacterial infections. Nat Commun. 2018;9(1):4184 10.1038/s41467-018-06487-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Hull NC, Schumaker BA. Comparisons of brucellosis between human and veterinary medicine. Infect Ecol Epidemiol. 2018;8(1):1500846 10.1080/20008686.2018.1500846 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.von Bargen K, Gorvel JP, Salcedo SP. Internal affairs: investigating the Brucella intracellular lifestyle. FEMS Microbiol Rev. 2012;36(3):533–62. 10.1111/j.1574-6976.2012.00334.x . [DOI] [PubMed] [Google Scholar]
21.Pappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos EV. The new global map of human brucellosis. The Lancet Infectious diseases. 2006;6(2):91–9. Epub 2006/01/28. 10.1016/S1473-3099(06)70382-6 . [DOI] [PubMed] [Google Scholar]
22.de Figueiredo P, Ficht TA, Rice-Ficht A, Rossetti CA, Adams LG. Pathogenesis and immunobiology of brucellosis: review of Brucella-host interactions. Am J Pathol. 2015;185(6):1505–17. 10.1016/j.ajpath.2015.03.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Dean AS, Crump L, Greter H, Hattendorf J, Schelling E, Zinsstag J. Clinical manifestations of human brucellosis: a systematic review and meta-analysis. PLoS Negl Trop Dis. 2012;6(12):e1929 10.1371/journal.pntd.0001929 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Roop RM 2nd, Gaines JM, Anderson ES, Caswell CC, Martin DW. Survival of the fittest: how Brucella strains adapt to their intracellular niche in the host. Med Microbiol Immunol. 2009;198(4):221–38. 10.1007/s00430-009-0123-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.He Y. Analyses of Brucella pathogenesis, host immunity, and vaccine targets using systems biology and bioinformatics. Front Cell Infect Microbiol. 2012;2:2 10.3389/fcimb.2012.00002 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Waters LS, Storz G. Regulatory RNAs in bacteria. Cell. 2009;136(4):615–28. 10.1016/j.cell.2009.01.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Caswell CC, Gaines JM, Ciborowski P, Smith D, Borchers CH, Roux CM, et al. Identification of two small regulatory RNAs linked to virulence in Brucella abortus 2308. Mol Microbiol. 2012;85(2):345–60. 10.1111/j.1365-2958.2012.08117.x [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Wilms I, Voss B, Hess WR, Leichert LI, Narberhaus F. Small RNA-mediated control of the Agrobacterium tumefaciens GABA binding protein. Mol Microbiol. 2011;80(2):492–506. 10.1111/j.1365-2958.2011.07589.x . [DOI] [PubMed] [Google Scholar]
29.White JP, Prell J, Ramachandran VK, Poole PS. Characterization of a {gamma}-aminobutyric acid transport system of Rhizobium leguminosarum bv. viciae 3841. J Bacteriol. 2009;191(5):1547–55. 10.1128/JB.00926-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Damiano MA, Bastianelli D, Al Dahouk S, Kohler S, Cloeckaert A, De Biase D, et al. Glutamate decarboxylase-dependent acid resistance in Brucella spp.: distribution and contribution to fitness under extremely acidic conditions. Appl Environ Microbiol. 2015;81(2):578–86. 10.1128/AEM.02928-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Gerhardt P. The nutrition of brucellae. Bacteriol Rev. 1958;22(2):81–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Sheehan LM, Caswell CC. A 6-Nucleotide Regulatory Motif within the AbcR Small RNAs of Brucella abortus Mediates Host-Pathogen Interactions. mBio. 2017;8(3). 10.1128/mBio.00473-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Keppie J, Williams AE, Witt K, Smith H. The Role of Erythritol in the Tissue Localization of the Brucellae. Br J Exp Pathol. 1965;46:104–8. [PMC free article] [PubMed] [Google Scholar]
34.Petersen E, Rajashekara G, Sanakkayala N, Eskra L, Harms J, Splitter G. Erythritol triggers expression of virulence traits in Brucella melitensis. Microbes Infect. 2013;15(6–7):440–9. 10.1016/j.micinf.2013.02.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Lang J, Gonzalez-Mula A, Taconnat L, Clement G, Faure D. The plant GABA signaling downregulates horizontal transfer of the Agrobacterium tumefaciens virulence plasmid. New Phytol. 2016;210(3):974–83. 10.1111/nph.13813 . [DOI] [PubMed] [Google Scholar]
36.Kerrinnes T, Winter MG, Young BM, Diaz-Ochoa VE, Winter SE, Tsolis RM. Utilization of Host Polyamines in Alternatively Activated Macrophages Promotes Chronic Infection by Brucella abortus. Infect Immun. 2018;86(3). 10.1128/IAI.00458-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Uzureau S, Lemaire J, Delaive E, Dieu M, Gaigneaux A, Raes M, et al. Global analysis of quorum sensing targets in the intracellular pathogen Brucella melitensis 16 M. J Proteome Res. 2010;9(6):3200–17. 10.1021/pr100068p [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Salmon-Divon M, Zahavi T, Kornspan D. Transcriptomic Analysis of the Brucella melitensis Rev.1 Vaccine Strain in an Acidic Environment: Insights Into Virulence Attenuation. Front Microbiol. 2019;10:250 10.3389/fmicb.2019.00250 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Jiang H, Du P, Zhang W, Wang H, Zhao H, Piao D, et al. Comparative genomic analysis of Brucella melitensis vaccine strain M5 provides insights into virulence attenuation. PLoS One. 2013;8(8):e70852 10.1371/journal.pone.0070852 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Delrue RM, Lestrate P, Tibor A, Letesson JJ, De Bolle X. Brucella pathogenesis, genes identified from random large-scale screens. FEMS Microbiol Lett. 2004;231(1):1–12. 10.1016/S0378-1097(03)00963-7 . [DOI] [PubMed] [Google Scholar]
41.Miraglia MC, Rodriguez AM, Barrionuevo P, Rodriguez J, Kim KS, Dennis VA, et al. Brucella abortus Traverses Brain Microvascular Endothelial Cells Using Infected Monocytes as a Trojan Horse. Front Cell Infect Microbiol. 2018;8:200 10.3389/fcimb.2018.00200 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Rodriguez AM, Delpino MV, Miraglia MC, Giambartolomei GH. Immune Mediators of Pathology in Neurobrucellosis: From Blood to Central Nervous System. Neuroscience. 2019;410:264–73. 10.1016/j.neuroscience.2019.05.018 . [DOI] [PubMed] [Google Scholar]
43.Bahemuka M, Shemena AR, Panayiotopoulos CP, al-Aska AK, Obeid T, Daif AK. Neurological syndromes of brucellosis. J Neurol Neurosurg Psychiatry. 1988;51(8):1017–21. 10.1136/jnnp.51.8.1017 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Budnick JA, Sheehan LM, Colquhoun JM, Dunman PM, Walker GC, Roop RM 2nd, et al. Endoribonuclease YbeY Is Linked to Proper Cellular Morphology and Virulence in Brucella abortus. J Bacteriol. 2018;200(12). 10.1128/JB.00105-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Aronesty E. Comparison of Sequencing Utility Programs. The Open Bioinformatics Journal. 2013;7:1–8. [Google Scholar]
46.Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40. 10.1093/bioinformatics/btp616 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Gee JM, Valderas MW, Kovach ME, Grippe VK, Robertson GT, Ng WL, et al. The Brucella abortus Cu,Zn superoxide dismutase is required for optimal resistance to oxidative killing by murine macrophages and wild-type virulence in experimentally infected mice. Infect Immun. 2005;73(5):2873–80. 10.1128/IAI.73.5.2873-2880.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0237371.r001

Decision Letter 0

Axel Cloeckaert

5 Jun 2020

PONE-D-20-12100

Characterizing the transport and utilization of the neurotransmitter GABA in the bacterial pathogen <brucella abortus="">

PLOS ONE

Dear Dr. Caswell,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.</brucella>

Please consider the comments of the reviewers to improve the manuscript.

Please submit your revised manuscript by Jul 20 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Axel Cloeckaert

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods, please include full details of animal care and housing, including details of the monitoring of animals for adverse clinical signs.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript submitted by Budnick et al describes the efforts to characterized the putative role in GABA transport of two of the target transporter systems of sRNAs AbcR1/2, found previously by Dr. Caswell's group. By measuring accumulation of radioactive H3-GABA, the authors are able to provide some evidence of the role of one of them as a GABA transporter.

A drawing of the BAB1_1792-BAB1_1799 and BAB2_0876-BAB2_0879 transport systems, or a description of the role of its different components would be helpful to understand the experiments. Are the deleted proteins structural, crucial components, or just accessory ones? Similarly, a map of both locus would be helpful to know if the authors have deleted two or three genes, as it is not unusual in Brucella genomes to have non consecutive numbering. Figure 7 shows the locus bab2_0876-bab2_0879 along with the putative role of each protein, but this is too late in the manuscript and I think the reader would benefit from having this (or at least some of this) information up front, and included in the body of the manuscript.

Mention more clearly which strains were constructed for this work, as in page 11 is stated “Deletion strains of bab2_0612, bab1_1792-bab1_1794, and bab2_0879 were either constructed or utilized from previous studies”. As only deletion strains bab1_1792 and bab1_1794 are described in M&M, we have to assume that the other two strains were constructed in a previous study that should be referenced. This brings us to a shocking point, why have the authors mutated bab2_0612?? They do not mention anything about this strain, however it shows a 20% decrease in GABA transport.. Is it controlled by any of these sRNAs? Is it a control transporter? Without this information it’s impossible to understand its role, nor the role of the second transporter that also shows another 20% decrease in GABA transport. Regarding the deletion, and going back to the first comment, the reader does not get any information about the size or content of the region deleted, or the function of the affected proteins, until line 370, in the Discussion section, where the homology of one of the proteins is mentioned.

The 3H-GABA uptake assays is normalized to the observed level in GMM(-Glu). This should be explained in M&M, or in the Figure legend, rather than at the y axis of Figure 1. Same applies for Figure 2.

Regarding the physiological role of GABA transport, the authors observe that GABA is not used as a nitrogen or carbon source, and the transcriptional changes observed are anecdotal. Nor do they observe any change in virulence either in peritoneal macrophages or in the oral infection mouse model, reinforcing previous results from the group that these mutants do not show a different virulence levels in the intraperitoneal infection mouse model. But then they engaged in a not very convincing discussion about the possible role of these systems in virulence in B. abortus, citing some work done in B. melitensis and B. suis. It’s difficult with the data provided by the authors to gauge if this information is anything more than anecdotal. For example, how many nonsynonymous mutations are between the 16M and M5 B. melitensis strains? There are extensive areas of insertion and deletion between these two strains as to point out this particular change as important for the virulence. As for the attenuated phenotype reported by Delrue, the authors do not know the nature of the mutations described, and whether they could induce (for example) downstream effects. The authors should ponder if the level of evidence gathered so far merits further study of the putative role of gtsA in B. abortus, something that for this reviewer is in this moment doubtful.

The nomenclature bab_rs30470 is mentioned for the first time in page 16, without any explanation. The same way the authors mention that Agrobacterium fabrum was formerly known as Agrobacterium tumefaciens in page 4 (by the way, a reference to the change would be handy), the authors should use the old or the new nomenclature for the genes, or explain it at least the origin of this change.

Consistent nomenclature: The authors use B. abortus 2308, and Brucella melitensis biovar abortus 2308. This could be confusing for general readers outside the Brucella field, so please use consistent nomenclature.

Line 373. The results from Figure 4 merit a more extensive discussion. To say that GABA transport is mediated only by bab2_0879 is not correct. First, it should be mentioned the whole transporter, nor just the mutated gene that interrupts the system. And also the 20% (statistically significant, by the way) decrease in GABA transport observed when either bab2_0612 or bab1_1792-bab1_1794 are mutated should be considered and discussed.

Have the authors tested if B. abortus 2308 AbcR1 or AbcR2 single mutants show an inhibited GABA transport (just to see if in any occasion these sRNAs are not redundant…)

Minor points

Use B. abortus after the first time Brucella abortus is used

First three letters of restriction enzymes in italics

Keywords: amino

Reviewer #2: This manuscript describes the transport of GABA in the class III pathogen Brucella abortus. The transporter is identified and shown to be specific to GABA compared to 20 aminoacids. First investigations on the possible function of this transport system and the impact of GABA transport on the transcriptiome are reported here. This is an interesting, rigorous and well controlled study.

I only have (very) minor comments.

- line 76 : it seems that reference should be [16] and not [15]

- line 108 : "by adaptation" to what? intracellular conditions? [25] maybe specify

- line 126 : add one or more references after "GAD system"

- line 130 : why does the absence of a functional GAD excludes the possibility of GABA utilization? It seems that GabT and GabD would be sufficient to utilize GABA, if they are active of course.

- lines 187-191 : the authors comment on Cys and Lys but not the other aminoacids (Asn, Met,Trp and Val) that are also significantly different from the control. I agree that differences are very small and probably negligible

- line 235 : add a reference after "regulated by AbcR1 and AbcR2"

- line 243 : since a function is found for BAB2_0879, I would suggest to add a sentence to rename BAB2_0879 as gtsA at this place of the manuscript

- line 268-270 : the gtsA mutation does not impact the ability to survive and replicate in macrophages, but if glutamate is present in the culture medium of the macrophages, it is normal that the GABA transport system is not active (according to data in Fig. 1). If it is correct, this should be discussed

- lines 337-343 : if it is allowed by the journal, I would provide the mRNA quantification per gene as supplementary data

- line 359 : in the legend of Figure 7, I would clearly indicate which operon (bra or gts) is used for calculating the percentages of identity (from the text, it seems to be gts)

- since it is reported that gad gene may be inactivated by point or frame-shift mutations, it could be interesting to analyse the conservation of the gts, gabT and gabD genes in the different Brucella species.

- line 427 : for the information to these authors, the Delrue/Letesson lab and A. Dricot in particular were using exclusively the BALB/c mice, intraperiotoneal infections and CFU countings in the spleen (at 1, 4 or 8 weeks post-infection). Since it is not published (A. Dricot never finished her PhD thesis), I would leave the text as it is.

-line 434 : mouse strain is important but the route of infection is also crucial and should be mentionned here

- line 468 : if I understand correctly a single deletion strain is generated, in which ORFs bab1_1794 to bab1_1792 are deleted. Thus the sentence should be clarified. Also, a reference should be given for the deletion strains of bab2_0612 and bab2_0879 (and indicate if they are also unmarked and nonpolar deletion strains).

- line 501 : how was radioactivity of the filter measured?

- line 521 : is it L-GABA? I did not see an asymmetrical carbon the GABA structure

- line 548 : remove the sentence starting with "The FASTQ files"?

- line 567 : how were brucellae opsonized?

- Discussion : is there any comment to make, related to neurobrucellosis?

Reviewer #3: The paper by Budnick et. al. describes the identification of a GABA transporter in the zoonotic pathogen Brucella abortus. The authors show that B. abortus is able to transport GABA, that this transport is not inhibited by the presence of other amino acids and that GABA is not used neither as a nitrogen nor as a carbon source. The authors additionally demonstrate that the small RNAs AbcR1 and AbcR2 negatively regulate the transport of GABA and identify the transporter (Bab2_0879) as the responsible for the transport. A null mutation in this gene did not affect the intracellular replication in macrophages or the virulence in mice indicating that the transport is not necessary for the pathogenesis of the bacterium.

The paper is clear and the data supports the conclusions that are, mainly, negative: transport of GABA is not inhibited by other amino acids, it is not utilized as a carbon or nitrogen source, it is not required for virulence and does not affect the transcriptome of the bacterium. Despite this, the data presented clearly demonstrate that GABA is transported and that the transported is Bab2_0879.

The only criticisms I have is that in the discussion (lines 438 to 449) the authors argue that it could be that the transport of GABA could work as a way to mask the induction of GABA in the macrophages altering the maturation of the phagosome. If this would be the case a difference in macrophage survival should have been observed in the Bab2_0879 mutant. I recommend this speculation should be deleted.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Aug 26;15(8):e0237371. doi: 10.1371/journal.pone.0237371.r002

Author response to Decision Letter 0

16 Jul 2020

This point is well taken, and we appreciate the suggestion. We agree completely with this comment, and as such, we have developed a new Fig 1 for the revised manuscript that depicts both the bab1_1792-1799 and bab2_0876-0879 loci.

Mention more clearly which strains were constructed for this work, as in page 11 is stated “Deletion strains of bab2_0612, bab1_1792-bab1_1794, and bab2_0879 were either constructed or utilized from previous studies”. As only deletion strains bab1_1792 and bab1_1794 are described in M&M, we have to assume that the other two strains were constructed in a previous study that should be referenced. This brings us to a shocking point, why have the authors mutated bab2_0612?? They do not mention anything about this strain, however it shows a 20% decrease in GABA transport. Is it controlled by any of these sRNAs? Is it a control transporter? Without this information it’s impossible to understand its role, nor the role of the second transporter that also shows another 20% decrease in GABA transport. Regarding the deletion, and going back to the first comment, the reader does not get any information about the size or content of the region deleted, or the function of the affected proteins, until line 370, in the Discussion section, where the homology of one of the proteins is mentioned.

This too is a great point, and we apologize for the lack of information regarding these strains. The specific genes of interest were analyzed due to their significant dysregulation in the abcR1/abcR2 deletion stain [Ref 27]. Due to the significant increase in GABA transport observed in the abcR1/abcR2 deletion strain (Fig 4), we hypothesized that one of the ABC-type transport systems regulated by AbcR1/AbcR2 was functioning as a GABA transporter, and to test this hypothesis, we utilized deletion strains of the AbcR-regulation ABC transporter periplasmic-binding proteins BAB2_0612, BAB2_0879, and BAB1_1792-1794. The deletion strains of bab2_0612 and bab2_0879 were constructed previously (Ref. 32), and we have now noted this in the revised version of the manuscript. Bab1_1792 encodes a putative periplasmic-binding protein; bab1_1793 encodes a small hypothetical protein of 43 amino acids; bab1_1794 encodes a putative periplasmic-binding protein. Therefore, we decided to delete both genes encoding periplasmic-binding proteins (i.e., bab1_1792 and bab1_1794) in addition to the gene encoding the small hypothetical protein (i.e., bab1_1793) in order to determine if either of these proteins was involved in GABA transport by the ABC-type transporter that is encoded nearby on the chromosome. In the end, there was a slight reduction in GABA transport in both the bab2_0612 and bab1_1792-1794 deletion strains, but the most significant decrease in GABA uptake was observed for the bab2_0879 deletion strain. We have included more informaiton about the strains in the Results section of the revised manuscript (Lines 257-262).

The 3H-GABA uptake assays is normalized to the observed level in GMM(-Glu). This should be explained in M&M, or in the Figure legend, rather than at the y axis of Figure 1. Same applies for Figure 2.

Thank you for this suggestion, and we have included this information in the figure legend of the figures of the revised manuscript. Please note these figures are now Fig 2 and Fig 3 in the revised manuscript.

These points are very well taken, and we appreciate the careful review of our data and the current literature. We agree that the virulence data from our work with B. abortus and others’ work with other Brucella strains are variable, and in fact, we are only trying to convey to readers that these differences have been observed. Many researchers in the Brucella field utilize mice as a model, but we all agree that the mouse is not an appropriate model for the natural hosts (e.g., cattle, goats, ect.). As such, we have attempted to underscore the differences that our group and others have observed with the mouse model as it relates to the Gts system. The Reviewer is correct that we do not know all of the details about the experiments reported by Delrue and colleagues, and we have included additional discussion to this point. It is possible that differences in mouse strains and/or route of infection have played a role in the observed differences, and we have noted this in the revised version of the manuscript on lines 454-461.

Also, to the point about differences in GtsA between B. abortus, B. melitensis, and B. suis, we have noted in the revised version of the manuscript that GtsA is 100% identical at the amino acid levels between these strains (lines 448-449).

Finally, we also agree that we used strong language expressing that the Gts systems should be studied further based on our data and the data of others. As such, we now suggest that the Gts system “may” be something that warrants further investigation (line 456). We believe this is an accurate reflection of the situation, particularly since the Gts system has not been evaluated in natural hosts.

These are great points, and we agree with the Reviewer 100% about the ambiguity of both the locus tags in Brucella and the Agrobacterium nomenclature. We will first discuss the Agrobacterium issue. We have learned from our research that the suggested change from A. tumefaciens to A. fabrum is not well supported in the literature, and as such, we have removed all references to A. fabrum from the revised version of the manuscript. We now refer only to A. tumefaciens.

Regarding the Brucella abortus 2308, it is admittedly convoluted; however, we are trying our best to inform the readers of exactly what strain we are referring to in our studies. Several years ago, it was suggested that many Brucella strains are in fact the same species, Brucella melitensis, and that what was previously used as other species names (e.g., abortus) were actually biovars. During this time, the genome sequence and annotation for the reference strain was published, and the name given to it was “Brucella melitensis biovar Abortus 2308.” This species/biovar decision was later reversed, but the “Brucella melitensis biovar Abortus 2308” designation has remained in NCBI to this day. To make the situation more confusing, there is another genome sequence for a strain designated “Brucella abortus S2308,” which is slightly different from the “Brucella melitensis biovar Abortus 2308” that many labs use. Therefore, in order to direct readers to the appropriate genome, we have in certain places (e.g., regarding the RNA-seq data) referred to “Brucella melitensis biovar Abortus 2308,” but overall, those in the field know this strain as “Brucella abortus 2308.”

There are similar issues with the locus tags of “Brucella melitensis biovar Abortus 2308,” as the Reviewer aptly pointed out. The original locus tags were “BAB1_####” and “BAB2_####,” where 1 and 2 refer to chromosome 1 or 2, and the # was the order of the gene on the chromosome. About 6-7 years ago, the genomes were re-annotated and genes given the “BAB_RS#####” designation. Unfortunately, there is no link between BAB and BAB_RS locus tags. Therefore, we, and many others in the field, have adopted a practice of including both the BAB and BAB_RS designations when first discussing a particular gene in the literature, as this allows researcher to use both current or more dated databases and papers to analyze the data. To the Reviewer’s specific point, we have now made sure that we introduce the BAB and BAB_RS nomenclature at the same time, and then only refer to the BAB designations subsequently. In terms of bab_rs30470, it is now introduced in the revised version of the manuscript in line 128.

Thank you for this really insightful point, and we agree with the Reviewer on this point. Firstly, it was incorrect for us to say that BAB2_0879 is the “only” transporter for GABA, as our data clearly show this is not the case. We have revised this language to say that the Gts system is the “primary” GABA transporter in B. abortus 2308 (line 392). Secondly, we fully agree that more discussion about the role of BAB2_0612 and BAB1_1792-1794 in GABA import is warranted, and we have added more discussion in the revised manuscript (lines 400-404).

Have the authors tested if B. abortus 2308 AbcR1 or AbcR2 single mutants show an inhibited GABA transport (just to see if in any occasion these sRNAs are not redundant…)

This is a great suggestion, but unfortunately, we have not been able to test GABA transport in the abcR1 and abcR2 single deletion strains. However, we have shown previously that gtsA (i.e., bab2_0879 is very effectively regulated by either AbcR1 or AbcR2, and bab1_1794 and bab2_0612 are likewise regulated by either AbcR1 or AbcR2 [Ref 32]. As such, it is likely that GABA transport will not be significantly affected by single deletion of abcR1 or abcR2.

Minor points

Use B. abortus after the first time Brucella abortus is used

First three letters of restriction enzymes in italics

Thank you for pointing these things out, and we have corrected these issues. We now use “B. abortus” after the first introduction of “Brucella abortus.” Additionally, we have formatted the enzyme designations accordingly.

Keywords: amino

We appreciate the discovery of this mistake, and we have corrected it.

I only have (very) minor comments.

- line 76 : it seems that reference should be [16] and not [15]

Thank you very much for catching our mistake. We have corrected this.

- line 108 : "by adaptation" to what? intracellular conditions? [25] maybe specify

This point is well taken, and we have revised the statement accordingly. “Adaptation” was meant to refer to the harsh intracellular environment that the brucellae encounter following their uptake by host cells, and we have added this to our description of adaptation in the revised manuscript (lines 108-109).

- line 126 : add one or more references after "GAD system"

We appreciate this suggestion, and we have now added a reference for the GAD system.

- line 130 : why does the absence of a functional GAD excludes the possibility of GABA utilization? It seems that GabT and GabD would be sufficient to utilize GABA, if they are active of course.

This is a great point, and we agree that the absence of GAD does not exclude the possible utilization of GABA. Therefore, in the Introduction, we now state that the “potential role of GABA utilization…is unknown” (lines 149-150). We further elaborate on the possibility that GABA is utilized using GabT and GabD in the Discussion of the revised manuscript (lines 418-435).

Thank you for pointing out this omission. The Reviewer is entirely correct, and we have added discussion of these other amino acids in the Results section (lines 206-212).

- line 235 : add a reference after "regulated by AbcR1 and AbcR2"

This is a great suggestion, and we have now added the appropriate citations.

- line 243 : since a function is found for BAB2_0879, I would suggest to add a sentence to rename BAB2_0879 as gtsA at this place of the manuscript

Thank you for this great suggestion, and have defined BAB2_0879 as GtsA at this point in the revised manuscript (lines 269-271).

This too is a really great point, and we have further investigated the composition of our medium. For the macrophage phage experiments, we utilize Dulbecco’s modified Eagle’s medium, and while DMEM contains a variety of amino acids, it does not contain glutamate. Nonetheless, it is possible that expression and/or activation of the Gts system is affected during these assays, but the presence of glutamate is likely not the reason.

- lines 337-343 : if it is allowed by the journal, I would provide the mRNA quantification per gene as supplementary data

Thank you for this suggestion. Given that only one gene was differentially expressed in response to GABA, we did not feel it was justified to include supplemental data for all of the reads from the RNA-seq experiment. However, we have deposited all of the RNA-seq data, and it is freely available to the community. The accession number is PRJNA629010 (line 579).

- line 359 : in the legend of Figure 7, I would clearly indicate which operon (bra or gts) is used for calculating the percentages of identity (from the text, it seems to be gts)

This is a great point, and we have developed a new figure to show the identity of both systems to the corresponding systems in B. abortus. Please note that the new figure is now Fig 1, as it was suggested by another Reviewer that this information would be helpful if presented earlier in the manuscript.

Thank you for this suggestion, and we agree that this analysis is quite interesting. We have accessed the GtsA orthologs in B. abortus 2308 (i.e., BAB2_0879), B. melitensis 16M (i.e., BMEII0923), and B. suis 1330 (i.e., BRA0326), and interestingly, these proteins are 100% identical at the amino acid level. We have included this information in the Discussion section of the revised manuscript (lines 448-449).

Thank you very much for sharing this information with us, and as the Reviewer suggested, given that the information is unpublished, we did not alter the text from the original submission.

-line 434 : mouse strain is important but the route of infection is also crucial and should be mentionned here

This is a fantastic point, and we have included a discussion of the infection route in the revised manuscript (lines 458-459).

We appreciate these suggestions, and we have further clarified these points. It was noted by another Reviewer that this information should be included in the Results section as well. Therefore, we have clarified the strain construction along with citations in the revised manuscript (lines 257-262 and in lines 484-488).

- line 501 : how was radioactivity of the filter measured?

We apologize for this omission, and we are grateful to the Reviewer for catching our mistake. The radioactivity was measured using a scintillation counter, and this is now described in line 522.

- line 521 : is it L-GABA? I did not see an asymmetrical carbon the GABA structure

This was an oversight on our part, and we thank the Reviewer for pointing out this issue. All of the amino acids were used in the study for competition assays were L-form amino acids. However, GABA does not exist in L- and D-forms, and as such, we have corrected any mention of “L-GABA” in the revised manuscript.

- line 548 : remove the sentence starting with "The FASTQ files"?

Thank you for this suggestion. We have removed the sentence.

- line 567 : how were brucellae opsonized?

This is a great question, and the bacteria were opsonized with serum from mice previously infected with B. abortus 2308. We have included this information in the Materials and Methods section of the revised manuscript (lines 586-588).

- Discussion : is there any comment to make, related to neurobrucellosis?

This is a wonderful question, and we agree with the Reviewer that this is an interesting subject. As such, we have included a discussion of neurobrucellosis in the Discussion section of the revised manuscript (lines 461-465).

We are very grateful to the Reviewer for their comments and suggestions. We agree that it may be premature to speculate on the potential masking of GABA in macrophages, and as such, we have removed this paragraph from the Discussion section of the revised manuscript.

Attachment

Submitted filename: Response to Reviewers Comments.docx

Click here for additional data file.^{(25.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0237371.r003

Decision Letter 1

Axel Cloeckaert

5 Aug 2020

Characterizing the transport and utilization of the neurotransmitter GABA in the bacterial pathogen <brucella abortus="">

PONE-D-20-12100R1</brucella>

Dear Dr. Caswell,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Axel Cloeckaert

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0237371.r004

Acceptance letter

Axel Cloeckaert

5 Aug 2020

PONE-D-20-12100R1

Characterizing the transport and utilization of the neurotransmitter GABA in the bacterial pathogen <Brucella abortus>

Dear Dr. Caswell:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Axel Cloeckaert

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Attachment

Submitted filename: Response to Reviewers Comments.docx

Click here for additional data file.^{(25.9KB, docx)}

Data Availability Statement

All RNA-seq files are available from the NCBI Sequence Read Archive (SRA) database (accession number PRJNA629010)

[pone.0237371.ref001] 1.Mittal R, Debs LH, Patel AP, Nguyen D, Patel K, O'Connor G, et al. Neurotransmitters: The Critical Modulators Regulating Gut-Brain Axis. J Cell Physiol. 2017;232(9):2359–72. 10.1002/jcp.25518 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref002] 2.Feehily C, Karatzas KA. Role of glutamate metabolism in bacterial responses towards acid and other stresses. J Appl Microbiol. 2013;114(1):11–24. 10.1111/j.1365-2672.2012.05434.x . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref003] 3.Shelp BJ, Bown AW, McLean MD. Metabolism and functions of gamma-aminobutyric acid. Trends Plant Sci. 1999;4(11):446–52. 10.1016/s1360-1385(99)01486-7 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref004] 4.Pennacchietti E, D'Alonzo C, Freddi L, Occhialini A, De Biase D. The Glutaminase-Dependent Acid Resistance System: Qualitative and Quantitative Assays and Analysis of Its Distribution in Enteric Bacteria. Frontiers in microbiology. 2018;9:2869 10.3389/fmicb.2018.02869 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref005] 5.De Biase D, Pennacchietti E. Glutamate decarboxylase-dependent acid resistance in orally acquired bacteria: function, distribution and biomedical implications of the gadBC operon. Mol Microbiol. 2012;86(4):770–86. 10.1111/mmi.12020 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref006] 6.Palanivelu R, Brass L, Edlund AF, Preuss D. Pollen tube growth and guidance is regulated by POP2, an Arabidopsis gene that controls GABA levels. Cell. 2003;114(1):47–59. 10.1016/s0092-8674(03)00479-3 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref007] 7.Bown AW, Shelp BJ. Plant GABA: Not Just a Metabolite. Trends Plant Sci. 2016;21(10):811–3. 10.1016/j.tplants.2016.08.001 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref008] 8.Michaeli S, Fromm H. Closing the loop on the GABA shunt in plants: are GABA metabolism and signaling entwined? Front Plant Sci. 2015;6:419 10.3389/fpls.2015.00419 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref009] 9.Ramputh AI, Bown AW. Rapid [gamma]-Aminobutyric Acid Synthesis and the Inhibition of the Growth and Development of Oblique-Banded Leaf-Roller Larvae. Plant Physiol. 1996;111(4):1349–52. 10.1104/pp.111.4.1349 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref010] 10.Shelp BJ, Bown AW, Faure D. Extracellular gamma-aminobutyrate mediates communication between plants and other organisms. Plant Physiol. 2006;142(4):1350–2. 10.1104/pp.106.088955 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref011] 11.MacGregor KB, Shelp BJ, Peiris S, Bown AW. Overexpression of glutamate decarboxylase in transgenic tobacco plants deters feeding by phytophagous insect larvae. J Chem Ecol. 2003;29(9):2177–82. 10.1023/a:1025650914947 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref012] 12.Park DH, Mirabella R, Bronstein PA, Preston GM, Haring MA, Lim CK, et al. Mutations in gamma-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence. Plant J. 2010;64(2):318–30. 10.1111/j.1365-313X.2010.04327.x . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref013] 13.Planamente S, Vigouroux A, Mondy S, Nicaise M, Faure D, Morera S. A conserved mechanism of GABA binding and antagonism is revealed by structure-function analysis of the periplasmic binding protein Atu2422 in Agrobacterium tumefaciens. J Biol Chem. 2010;285(39):30294–303. 10.1074/jbc.M110.140715 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref014] 14.Planamente S, Morera S, Faure D. In planta fitness-cost of the Atu4232-regulon encoding for a selective GABA-binding sensor in Agrobacterium. Commun Integr Biol. 2013;6(3):e23692 10.4161/cib.23692 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref015] 15.Chevrot R, Rosen R, Haudecoeur E, Cirou A, Shelp BJ, Ron E, et al. GABA controls the level of quorum-sensing signal in Agrobacterium tumefaciens. Proc Natl Acad Sci U S A. 2006;103(19):7460–4. 10.1073/pnas.0600313103 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref016] 16.Nonaka S, Someya T, Zhou S, Takayama M, Nakamura K, Ezura H. An Agrobacterium tumefaciens Strain with Gamma-Aminobutyric Acid Transaminase Activity Shows an Enhanced Genetic Transformation Ability in Plants. Sci Rep. 2017;7:42649 10.1038/srep42649 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref017] 17.Bhat R, Axtell R, Mitra A, Miranda M, Lock C, Tsien RW, et al. Inhibitory role for GABA in autoimmune inflammation. Proc Natl Acad Sci U S A. 2010;107(6):2580–5. 10.1073/pnas.0915139107 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref018] 18.Kim JK, Kim YS, Lee HM, Jin HS, Neupane C, Kim S, et al. GABAergic signaling linked to autophagy enhances host protection against intracellular bacterial infections. Nat Commun. 2018;9(1):4184 10.1038/s41467-018-06487-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref019] 19.Hull NC, Schumaker BA. Comparisons of brucellosis between human and veterinary medicine. Infect Ecol Epidemiol. 2018;8(1):1500846 10.1080/20008686.2018.1500846 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref020] 20.von Bargen K, Gorvel JP, Salcedo SP. Internal affairs: investigating the Brucella intracellular lifestyle. FEMS Microbiol Rev. 2012;36(3):533–62. 10.1111/j.1574-6976.2012.00334.x . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref021] 21.Pappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos EV. The new global map of human brucellosis. The Lancet Infectious diseases. 2006;6(2):91–9. Epub 2006/01/28. 10.1016/S1473-3099(06)70382-6 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref022] 22.de Figueiredo P, Ficht TA, Rice-Ficht A, Rossetti CA, Adams LG. Pathogenesis and immunobiology of brucellosis: review of Brucella-host interactions. Am J Pathol. 2015;185(6):1505–17. 10.1016/j.ajpath.2015.03.003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref023] 23.Dean AS, Crump L, Greter H, Hattendorf J, Schelling E, Zinsstag J. Clinical manifestations of human brucellosis: a systematic review and meta-analysis. PLoS Negl Trop Dis. 2012;6(12):e1929 10.1371/journal.pntd.0001929 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref024] 24.Roop RM 2nd, Gaines JM, Anderson ES, Caswell CC, Martin DW. Survival of the fittest: how Brucella strains adapt to their intracellular niche in the host. Med Microbiol Immunol. 2009;198(4):221–38. 10.1007/s00430-009-0123-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref025] 25.He Y. Analyses of Brucella pathogenesis, host immunity, and vaccine targets using systems biology and bioinformatics. Front Cell Infect Microbiol. 2012;2:2 10.3389/fcimb.2012.00002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref026] 26.Waters LS, Storz G. Regulatory RNAs in bacteria. Cell. 2009;136(4):615–28. 10.1016/j.cell.2009.01.043 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref027] 27.Caswell CC, Gaines JM, Ciborowski P, Smith D, Borchers CH, Roux CM, et al. Identification of two small regulatory RNAs linked to virulence in Brucella abortus 2308. Mol Microbiol. 2012;85(2):345–60. 10.1111/j.1365-2958.2012.08117.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref028] 28.Wilms I, Voss B, Hess WR, Leichert LI, Narberhaus F. Small RNA-mediated control of the Agrobacterium tumefaciens GABA binding protein. Mol Microbiol. 2011;80(2):492–506. 10.1111/j.1365-2958.2011.07589.x . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref029] 29.White JP, Prell J, Ramachandran VK, Poole PS. Characterization of a {gamma}-aminobutyric acid transport system of Rhizobium leguminosarum bv. viciae 3841. J Bacteriol. 2009;191(5):1547–55. 10.1128/JB.00926-08 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref030] 30.Damiano MA, Bastianelli D, Al Dahouk S, Kohler S, Cloeckaert A, De Biase D, et al. Glutamate decarboxylase-dependent acid resistance in Brucella spp.: distribution and contribution to fitness under extremely acidic conditions. Appl Environ Microbiol. 2015;81(2):578–86. 10.1128/AEM.02928-14 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref031] 31.Gerhardt P. The nutrition of brucellae. Bacteriol Rev. 1958;22(2):81–98. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref032] 32.Sheehan LM, Caswell CC. A 6-Nucleotide Regulatory Motif within the AbcR Small RNAs of Brucella abortus Mediates Host-Pathogen Interactions. mBio. 2017;8(3). 10.1128/mBio.00473-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref033] 33.Keppie J, Williams AE, Witt K, Smith H. The Role of Erythritol in the Tissue Localization of the Brucellae. Br J Exp Pathol. 1965;46:104–8. [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref034] 34.Petersen E, Rajashekara G, Sanakkayala N, Eskra L, Harms J, Splitter G. Erythritol triggers expression of virulence traits in Brucella melitensis. Microbes Infect. 2013;15(6–7):440–9. 10.1016/j.micinf.2013.02.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref035] 35.Lang J, Gonzalez-Mula A, Taconnat L, Clement G, Faure D. The plant GABA signaling downregulates horizontal transfer of the Agrobacterium tumefaciens virulence plasmid. New Phytol. 2016;210(3):974–83. 10.1111/nph.13813 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref036] 36.Kerrinnes T, Winter MG, Young BM, Diaz-Ochoa VE, Winter SE, Tsolis RM. Utilization of Host Polyamines in Alternatively Activated Macrophages Promotes Chronic Infection by Brucella abortus. Infect Immun. 2018;86(3). 10.1128/IAI.00458-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref037] 37.Uzureau S, Lemaire J, Delaive E, Dieu M, Gaigneaux A, Raes M, et al. Global analysis of quorum sensing targets in the intracellular pathogen Brucella melitensis 16 M. J Proteome Res. 2010;9(6):3200–17. 10.1021/pr100068p [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref038] 38.Salmon-Divon M, Zahavi T, Kornspan D. Transcriptomic Analysis of the Brucella melitensis Rev.1 Vaccine Strain in an Acidic Environment: Insights Into Virulence Attenuation. Front Microbiol. 2019;10:250 10.3389/fmicb.2019.00250 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref039] 39.Jiang H, Du P, Zhang W, Wang H, Zhao H, Piao D, et al. Comparative genomic analysis of Brucella melitensis vaccine strain M5 provides insights into virulence attenuation. PLoS One. 2013;8(8):e70852 10.1371/journal.pone.0070852 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref040] 40.Delrue RM, Lestrate P, Tibor A, Letesson JJ, De Bolle X. Brucella pathogenesis, genes identified from random large-scale screens. FEMS Microbiol Lett. 2004;231(1):1–12. 10.1016/S0378-1097(03)00963-7 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref041] 41.Miraglia MC, Rodriguez AM, Barrionuevo P, Rodriguez J, Kim KS, Dennis VA, et al. Brucella abortus Traverses Brain Microvascular Endothelial Cells Using Infected Monocytes as a Trojan Horse. Front Cell Infect Microbiol. 2018;8:200 10.3389/fcimb.2018.00200 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref042] 42.Rodriguez AM, Delpino MV, Miraglia MC, Giambartolomei GH. Immune Mediators of Pathology in Neurobrucellosis: From Blood to Central Nervous System. Neuroscience. 2019;410:264–73. 10.1016/j.neuroscience.2019.05.018 . [DOI] [PubMed] [Google Scholar]

[pone.0237371.ref043] 43.Bahemuka M, Shemena AR, Panayiotopoulos CP, al-Aska AK, Obeid T, Daif AK. Neurological syndromes of brucellosis. J Neurol Neurosurg Psychiatry. 1988;51(8):1017–21. 10.1136/jnnp.51.8.1017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref044] 44.Budnick JA, Sheehan LM, Colquhoun JM, Dunman PM, Walker GC, Roop RM 2nd, et al. Endoribonuclease YbeY Is Linked to Proper Cellular Morphology and Virulence in Brucella abortus. J Bacteriol. 2018;200(12). 10.1128/JB.00105-18 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref045] 45.Aronesty E. Comparison of Sequencing Utility Programs. The Open Bioinformatics Journal. 2013;7:1–8. [Google Scholar]

[pone.0237371.ref046] 46.Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40. 10.1093/bioinformatics/btp616 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0237371.ref047] 47.Gee JM, Valderas MW, Kovach ME, Grippe VK, Robertson GT, Ng WL, et al. The Brucella abortus Cu,Zn superoxide dismutase is required for optimal resistance to oxidative killing by murine macrophages and wild-type virulence in experimentally infected mice. Infect Immun. 2005;73(5):2873–80. 10.1128/IAI.73.5.2873-2880.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Characterizing the transport and utilization of the neurotransmitter GABA in the bacterial pathogen Brucella abortus

James A Budnick

Lauren M Sheehan

Angela H Benton

Joshua E Pitzer

Lin Kang

Pawel Michalak

R Martin Roop II

Clayton C Caswell

Roles

Abstract

Introduction

Fig 1. Organization of putative GABA ABC-type transport systems in B. abortus 2308 and homology to the GABA transport systems in Rhizobium leguminosarum bv. viciae 3841 and Agrobacterium tumefaciens str. C58.

Results

B. abortus can import 3H-GABA, and this transport is inhibited by the presence of glutamate

Fig 2. 3H-GABA import is induced under nutrient limiting conditions.

The presence of proteinogenic amino acids does not considerably inhibit the import of 3H-GABA into B. abortus

Fig 3. 3H-GABA import by B. abortus 2308 is not greatly inhibited by the presence of other amino acids in vitro.

3H-GABA import is inhibited by the sRNAs AbcR1 and AbcR2

Fig 4. 3H-GABA import is negatively regulated by the sRNAs AbcR1 and AbcR2 in B.

bab2_0879 is necessary for the transport of 3H-GABA in B. abortus

Fig 5. Transport of 3H-GABA transport in B. abortus 2308 by AbcR regulated systems.

bab2_0879 is not necessary for survival and replication in peritoneal derived macrophages nor chronic infection of a mouse model of brucellosis via the oral route of infection

Fig 6. Virulence of B. abortus 2308 and Δbab2_0879 in peritoneally derived macrophages and BALB/c mice.

GABA is not utilized as a nitrogen or carbon source by Brucella

Fig 7. GABA is not utilized as a metabolite by B. abortus 2308 in vitro.

Minimal transcriptional changes were observed in B. abortus 2308 exposed to exogenous GABA

Discussion

Materials and methods

Bacterial strains and growth conditions

Ethics statement

Construction of B. abortus deletion strains

Table 1. Oligonucleotide primers used in this study.

Table 2. Plasmids used in this study.

3H-GABA uptake assays

Respirometry assay

RNA sampling of GABA treated cultures

Stranded RNA library construction for prokaryotic RNA-seq

Illumina NextSeq sequencing

RNA-Seq data processing and analysis

Virulence of Brucella strains in cultured murine macrophages and experimentally infected mice

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Axel Cloeckaert

Roles

Author response to Decision Letter 0

Decision Letter 1

Axel Cloeckaert

Roles

Acceptance letter

Axel Cloeckaert

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

B. abortus can import ³H-GABA, and this transport is inhibited by the presence of glutamate

Fig 2. ³H-GABA import is induced under nutrient limiting conditions.

The presence of proteinogenic amino acids does not considerably inhibit the import of ³H-GABA into B. abortus

Fig 3. ³H-GABA import by B. abortus 2308 is not greatly inhibited by the presence of other amino acids in vitro.

³H-GABA import is inhibited by the sRNAs AbcR1 and AbcR2

Fig 4. ³H-GABA import is negatively regulated by the sRNAs AbcR1 and AbcR2 in B.

bab2_0879 is necessary for the transport of ³H-GABA in B. abortus

Fig 5. Transport of ³H-GABA transport in B. abortus 2308 by AbcR regulated systems.

³H-GABA uptake assays