Skip to main content
NCBI home page
Cytotechnology logoLink to Cytotechnology
. 2020 Jul 4;72(4):589–602. doi: 10.1007/s10616-020-00409-4

IL-4 and IL-10 promotes phagocytic activity of microglia by up-regulation of TREM2

Saini Yi 1, Xue Jiang 2, Xiaofang Tang 1, Yahui Li 1, Chenghong Xiao 1, Jinqiang Zhang 1, Tao Zhou 1,✉
PMCID: PMC7450013  PMID: 32623621

Abstract

Triggering receptor expressed on myeloid cells-2 (TREM2) is an innate immune receptor that promotes phagocytosis by microglia. However, whether TREM2 is related to the stimulus-dependent phagocytic activity of microglia is unclear. In this study, the primary cultured microglia were stimulated with interferon (IFN)-γ, interleukin (IL)-4, and interleukin (IL)-10, respectively, and their phagocytic activity against microbeads and apoptotic neural stem cells (NSCs) was measured. TREM2 of microglia was detected by qPCR and western blotting. The TREM2 signal was blocked in microglia using the siRNA technique. The results showed that IL-4 or IL-10 treatment significantly increased the number of microglia gathered around the apoptotic neurosphere. IL-4 and IL-10 treatment also promoted phagocytosis of microbeads and apoptotic NSCs by primary cultured microglia. The TREM2 expression was up-regulated in IL-4- or IL-10- treated microglia. TREM2 siRNA treatment blocked the phagocytic activity of IL-4- or IL-10-treated microglia. In conclusion, these results indicated that IL-4 and IL-10 promote the phagocytic activity of microglia by the up-regulation of TREM2, which suggested a new potential therapeutic target for neurodegenerative disease.

Keywords: Microglia, Phagocytosis, IL-4, IL-10, TREM2

Introduction

Microglia are the resident immune cells of the central nervous system (CNS) that play an immunoregulatory role by phagocytosis of protein aggregates and cell fragments, thus maintaining the stability of the central nervous system (Loane and Kumar 2016). Impaired microglial functions are thought to be involved in the onset and progression of various neurodevelopmental and neurodegenerative diseases (Walker and Lue 2015). Studies have shown that microglia exhibit clear stimulation-dependent phenotypic and functional consequences (Hanisch 2002). The pro-inflammatory cytokines (IFN-γ, IL-β, TNF-α) polarize microglia cells toward the M1 phenotype, and consequently aggravates neuropathology and accelerates pathological process (Gordon and Taylor 2005). The anti-inflammatory cytokines (IL-4, IL-10) polarize microglia cells toward the M2 phenotype which plays a key role in neuroprotection and tissue repair (Gensel and Zhang 2015; Orihuela et al. 2016; Schulz et al. 2019). The phagocytic activity of microglia is also regulated by cytokines. The phagocytic function of microglia plays an important role in neurological diseases such as Alzheimer’s disease, multiple sclerosis, Parkinson’s disease, traumatic brain injury, ischemic and other brain diseases (Kaminska et al. 2016; Lee and Landreth 2010). Therefore, modulating the phagocytic activity of microglia is an appealing neurotherapeutics (Du et al. 2017).

The triggering receptor expressed on myeloid cells 2 (TREM2) is a microglial innate immune receptor associated with a lethal form of early and progressive dementia, and an increased risk of Alzheimer’s disease (AD) (Yeh et al. 2017; Zhong and Chen 2019). TREM2 is uniquely expressed on microglia, functioning as a modulator of microglial functions including phagocytosis and inflammatory response (Nugent et al. 2019). Microglial defects in phagocytosis of toxic aggregates or apoptotic membranes were proposed to be at the origin of the pathological processes in the presence of Trem2 inactivating mutations (Fan et al. 2019). TREM2 deficiency reduces the phagocytosis efficacy of microglia. Conversely, upregulating the Trem2 expression significantly increased the phagocytic activity of microglia and alleviated AD pathology (Kim et al. 2017).

Neuroinflammation and TREM2 might be the potential therapeutic target for AD. However, the role of TREM2 in the phagocytic function of inflammatory cytokines mediated microglia is unclear (Dean et al. 2019; Meilandt et al. 2020). In this study, we compared the phagocytic activity of IFN-γ-, IL-4-, and IL-10-treated microglia, and identified the role of TREM2 in the phagocytic function of inflammatory cytokines mediated microglia.

Materials and methods

Animals

C57BL/6J mice were purchased from the Biotechnology Centre (Chang Sha, China). Male mice born in the same litter were used in an independent experiment. The postnatal day (P) 0–1 C57BL/6J mice were used for primary microglial culture, and adult mice were used to culture neural stem cells (NSCs). All animal experiments were carried out by the China code for the care and use of animals for scientific purposes at Guizhou University of Traditional Chinese Medicine, Guiyang, China, with local animal ethics committee approval.

Primary microglial culture

Primary mixed glial cell cultures were prepared from the cortices of P0–P1 C57BL/6J mice, as previously described (Jordan and Thomas 1987). After removing the meninges, brains were mechanically minced and dissociated with 0.25% trypsin. After trypsin inactivation, the tissue suspension was passed through a 70 µm nylon cell strainer. Cell pellets were harvested and resuspended in DMEM supplemented with 10% heat-inactivated FBS and plated on poly-l-lysine pre-coated culture flasks. 3 days later, the medium was changed, containing 25 ng/mL GM-CSF and 10% FBS. Primary microglia were harvested by shaking (200 rpm, 20 min) after 10–12 days in culture. Enriched microglia were plated in 24-well plates at 1 × 105 for phagocytosis experiment and immunocytochemistry. Enriched microglia were plated in 6-well plates at 5 × 105 for a quantitative reverse transcription-polymerase chain reaction analysis (qRT-PCR) and western blotting (WB). The resultant single-cell was cultured with DMEM (Gibco, USA) containing 10% FBS (Gibco, USA) at 37 °C, 5% CO2.

Cytokines treatment

IL-4, IL-10, and IFN-γ were purchased from the Peprotech system (Germany) and diluted in germfree PBS. The primary microglia were treated by IL-4 (20 ng/mL), IL-10 (20 ng/mL) and IFN-γ (50 ng/mL) for 1 h, 2 h, 3 h, 6 h, 12 h, and 24 h. Morphological analysis, phagocytosis studies and gene expression analyses of microglia were performed at the above time-points.

Neural stem cells (NSCs) culture

Young mice (6–8 week) were sacrificed and sterilized in 75% alcohol. The entire subventricular zone (SVZ) was dissociated from sagittally cut brains, minced, and digested for 10 min using 0.25% papain (Gibco, USA). The digested tissue was separated into single cells by pipetting, and DMEM/F12 + GlutaMax medium (Gibco, USA) was added. The mixture was centrifuged twice, and a 20 mL of NSPC proliferation medium (DMEM/F12-containing × 200 B27 supplement, × 100 N2, 20 ng/mL FGF2, and 20 ng/mL EGF) was added. DMEM/F12, B27 supplement and N2 reagents were purchased from Gibco LTD (USA). FGF2 and EGF reagents were purchased from Peprotech system (Germany). The cells were then incubated at 37 °C, 5% CO2 for 7 days. Neurospheres were isolated by centrifugation (600g, 5 min), enzymatically dissociated to a single cell suspension using 0.25% papain (Gibco, USA), and plated at a density of 5 × 104 cells/cm2 in the proliferation medium. To permit serial cell passages, this pancreatin-dissociation process was repeated every 3 to 4 days.

Lentivirus transfection and apoptosis induction of NSCs

Neurospheres were enzymatically dissociated to a single-cell suspension using 0.25% papain (Gibco, USA). The resultant single-cell was cultured in above neural stem cells medium with Lentivirus-CMV-GFP reporter reagent (Multiplicities of infection: 10, Thermo Fisher, USA) encoded a green fluorescent protein (GFP). These cells were incubated at 37 °C, 5% CO2. Half the fresh medium was changed every 24 h, and the culture continued for 5 days. The infection efficiency of the vector was evaluated by immunocytochemistry. The GFP-labeled NSCs were subjected to ultraviolet-irradiation (UV) irradiation for 15 min to induce apoptosis. Most apoptotic NSCs were labeled with GFP. These apoptotic NSCs were used for phagocytosis of microglia cells.

TREM2-siRNA treatment

We performed in vitro siRNA transfection in primary microglia according to the siRNA transfection protocol of TREM-2 siRNA (m) (sc-45369, a pool of 3 target-specific 19–25 nt siRNAs; Santa Cruz Biotechnology, Inc, USA) or control siRNA (sc-37007, Santa Cruz Biotechnology, Inc, USA). Briefly, for each transfection, 5 µL of siRNA and 5 µL of siRNA Transfection Reagent (sc-29528, Santa Cruz Biotechnology, Inc, USA) were diluted into 100 µL siRNA Transfection Medium (sc-36868, Santa Cruz Biotechnology, Inc, USA), respectively. The siRNA duplex solution was added directly into the dilute Transfection Reagent using a pipette, mixed gently, and incubated for 15 min at room temperature. The cells were then washed once with 2 mL of siRNA Transfection Medium. For each transfection, 0.8 mL siRNA Transfection Medium was added into each tube containing the siRNA Transfection Reagent mixture, mixed gently and overlaid on the washed cells. The cells were incubated in a CO2 incubator for 5 h at 37 °C. The medium was aspirated and replaced with fresh 1× normal growth medium. The cells were assayed using the appropriate protocol 24 h after the addition of fresh medium in the step above. Cell mortality was calculated to ensure the reliability of the transfection data. We found that under the transfection condition, the mortality rate of the cells was less than 10%, which could satisfy the subsequent experimental study. The interference efficiency of TREM2-siRNA reagent on Trem2 was confirmed by western blotting.

Microglial phagocytosis assay

For phagocytosis of microbeads, a piece of microbeads (diameter: 0.2 µm, Bio-rad, USA) was incubated with microglia at 2 × 106, and then the microbeads were taken out, washed in PBS for 15 min, and fixed by PFA. Microglia were stained with an anti-Iba1 (1:400, Wako, Japan) antibody, and the uptake of the fluorescent microbeads was assessed under a fluorescence microscope. For phagocytosis of apoptotic NSCs, the GFP-labeled NSCs were subjected to ultraviolet-irradiation (UV) irradiation for 15 min to induce apoptosis. These apoptotic NSCs were dissociated to a single-cell suspension and incubated with microglia at 1 × 105 for 24 h at 37 °C, 5% CO2. The apoptotic neurospheres were incubated with microglia at 1 × 104 for 24 h at 37 °C, 5% CO2.

Immunocytochemistry

Microglial activation and phagocytosis were examined with immunofluorescence staining for the control group, IFN-γ group, IL-4 group, and IL-10 group. The cells were fixed by 4% paraformaldehyde (PFA). To analysis cell morphology, each group was selected and permeabilized with 0.5% Triton X-100 in PBS for 15 min. The cells were blocked in 10% donkey serum for 1.5 h, incubated with primary antibodies, microglial activation was incubated with goat anti-Iba1 (1:400, Wako, Japan) and rabbit anti-CD68 (1:400, Cell Signaling Technology, USA) overnight at 4 °C. NSCs were incubated with goat anti-Nestin antibody (1:400, Cell Signaling Technology, USA) overnight at 4 °C. And then these cells were incubated with AlexaFluor-488 (1:400, Invitrogen, USA) and 549-conjugate fluorescent antibody (1:300; Jackson ImmunoResearch, USA) for 2 h at room temperature. Cells were imaged using a fluorescence microscopy (Olympus BX51, Japan).

RNA isolation and gene expression analysis

RNA was isolated from microglia using the Trizol (Invitrogen Life Technologies, USA) and chloroform extraction method, then purified with the Qiagen RNeasy kit (Takara, Japan). cDNA reverse transcription was performed using a high-capacity cDNA conversion kit (Takara, Japan). Quantitative RT-PCR (Bio-Rad CFX 96, USA) was performed, and the threshold amplification cycle number (Ct) was determined for each reaction in the linear phase of the amplification plot. Each sample was tested in triplicate. Changes in gene expression were determined by the − ΔΔCt method. The values were normalized to β-actin. Primer sequences used for RT-PCR were retrieved from NCBI database. Primer sequences were listed in Table 1.

Table 1.

Primers of RT-PCR

Gene Forward (5′-3′) Reverse (5′-3′)
TNF-α TACTGAACTTCGGGGTGATTGGTCC CAGCCTTGTCCCTTGAAGAGAACC
Arg-1 AGACAGCAGAGGAGGTGAAGAG CGAAGCAAGCCAAGGTTAAAGC
TGF-β GACCGCAACAACGCCATCTA GGCGTATCAGTGGGGGTCAG
CD206 AGTTGGGTTCTCCTGTAGCCCAA ACTACTACCTGAGCCCACACCTGCT
TREM2 CAGCACCTCCAGGAATCAAGA GAGAAGAATGGAGGTGGGTGG
β-actin CCGTGAAAAGATGACCCAGATC CACAGCCTGGATGGCTACGT
Open in a new tab

Western blotting

Microglia were sonicated in RIPA-buffer containing protease inhibitors. Protein samples were run on 12% Tris-glycine SDS-PAGE gels, transferred to PVDF membrane (0.2 or 0.45 μm), and blotted with antibodies (Abcam, UK) against TREM2 (1:1000), and β-actin (1:20,000). The primary antibody was incubated overnight at 4 °C, and secondary antibodies (1:10,000, Abcam, UK) were incubated for 2 h at room temperature. Signals were developed using the ECL-Plus kit (Millipore, USA). Densitometry was performed to quantify signal intensity using ImageJ software (version 1.45J; National Institutes of Health, Bethesda, MD, USA).

Images analysis

Images were analyzed with Image J software (version 1.45J; National Institutes of Health, Bethesda, MD, USA). A threshold for positive staining was determined to exclude background staining. The average percent of the area that was positively stained was used for evaluating morphological changes in microglia.

Statistical tests

Data were plotted using GraphPad Prism 7.0. The statistical analyses were performed using the SPSS statistical software package (SPSS Inc, Chicago, USA). Shapiro–Wilk test was used to analyze normal distribution of the values. P values > 0.05, the data is considered to be normally distributed. Potential differences between the mean values were evaluated using one- or two-way analysis of variance (ANOVA), followed by the least significant difference (LSD) test for post hoc comparisons assuming equal variances. Independent-samples t-tests were used to compare the differences between two groups unless otherwise specified. Asterisks were used to indicate significance: *P < 0.05, **P < 0.01, and ***P < 0.001. Values > 0.05 were considered not significant (n.s.).

Results

IFN-γ, IL-4 and IL-10 induced morphological and phenotypic changes of microglia

When microglial cells were stimulated by IFN-γ, IL-4 or IL-10 for 24 h, their morphology and phenotype changed significantly. The cell bodies of IFN-γ-treated microglia were small and had multiple filamentous pseudopodia. IL-4-stimulated microglia were characterized by irregular cell bodies and several lamellipodia. IL-10-treated microglia were amoeboid without branches (Fig. 1a). The area and perimeter of IFN-γ-, IL-4- and IL-10-stimulated microglia were increased significantly when compared with control microglia (Fig. 1b, c).

Fig. 1.

Fig. 1

Open in a new tab

Morphological and phenotypic changes of microglia under IFN-γ, IL-4 and IL-10 intervention conditions. a The morphological micrograph for microglia when exposed in PBS, IFN-γ, IL-4 or IL-10 for 24 h. The microglia were stained Iba1 (red) using immunocytochemical staining and the nucleus was stained by DAPI (blue). Scale bar is 50 μm. b Quantification of area of each microglia when exposed in PBS, IFN-γ, IL-4 or IL-10 for 24 h. Five samples for each group, and five pictures (40×) for each sample. All the cells in each picture were measured. The mean value of each sample was used for statistical analysis. c Quantification of perimeter of each microglia when exposed in PBS, IFN-γ, IL-4 or IL-10 for 24 h. Five samples for each group, and five pictures (40×) for each sample. All the cells in each picture were measured. The mean value of each sample was used for statistical analysis. d TNF-α, Arg-1 and TGF-β mRNA expression in the microglia when exposed in IFN-γ, IL-4 or IL-10 for 24 h. Fold changes were normalized to control group. Four samples for each group, and each sample was repeated three times. The average value of each sample was used for statistical analysis. Data are showed Mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.005 vs control group (two-way ANOVA)

The M1 phenotypic marker (TNF-α) was significantly up-regulated in IFN-γ-stimulated microglia and down-regulated in IL-10-stimulated microglia. The M2 phenotypic markers (Arg-1 and TGF-β) were significantly up-regulated in IL-4- and IL-10-stimulated microglia. Among them, IL-4-stimulated microglia expressed more Arg-1 and fewer TGF-β than IL-10-treated microglia (Fig. 1d).

Microglial phagocytosis were differentially regulated by IFN-γ, IL-4, and IL-10

The phagocytic activity of IFN-γ-, IL-4- and IL-10-treated microglia was evaluated over time. The results showed that IL-4 or IL-10 treatment significantly promoted phagocytosis of microbeads by microglia. However, IFN-γ treatment inhibited phagocytosis of microbeads by microglia (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Effects of IFN-γ, IL-4 and IL-10 on phagocytosis of microbeads by microglia. a The micrograph for microglia phagocytosis fluorescent microbeads when exposed in IFN-γ, IL-4 or IL-10 for 1 h, 2 h, 3 h, 6 h, 12 h and 24 h. The microglia were stained Iba1 (red) using immunocytochemical staining, containing phagocytosed fluorescent microbeads (green) and the nucleus was stained by DAPI (blue). Scale bar is 10 μm. b Quantification of the number of engulfed microbeads by each microglia when exposed in IFN-γ, IL-4 or IL-10 for 1 h, 2 h, 3 h, 6 h, 12 h and 24 h. Three samples for each group, and five pictures (40×) for each sample. All the cells in each picture were measured. Data are showed individually (n = 28–37), **P < 0.01, ***P < 0.005 vs control group, ##P < 0.01, ###P < 0.005 vs IFN-γ group (two-way ANOVA)

Multi-sample correlation analysis showed a significant positive correlation between the number of engulfed microbeads and the area of microglia (Fig. 3a). We speculated that the phagocytosis of microbeads by microglia might be related to the capacity of phagocytic lysosomes. Next, we examined the changes in the phagocytic lysosomes (CD68+) of microglia after stimulated by IFN-γ, IL-4 or IL-10 at a series of time-points. The results showed that the volume of phagocytic lysosomes of microglia gradually increased after IL-4 or IL-10 stimulation (Fig. 3b, c). Multi-sample correlation analysis showed a significant positive correlation between the area of each CD68+ staining and the area of microglia (Fig. 3d).

Fig. 3.

Fig. 3

Open in a new tab

Effects of IFN-γ, IL-4 and IL-10 on phagolysosome of microglia. a Correlation analysis between the number of engulfed microbeads and microglial area. There are 583 microglia cells from control group, IFN-γ-treated group, IL-4-treated group and IL-10-treated group at 1 h, 2 h, 3 h, 6 h, 12 h and 24 h. r2 = 0.4580, P = 0.0001. b Micrograph showed the phagolysosome expression of the microglia when exposed in IFN-γ, IL-4 or IL-10 for 24 h. The microglia were stained Iba1 (red), phagolysosome were stained CD68 (green) and the nucleus was stained by DAPI (blue). Scale bar is 50 μm. c Quantification of the CD68 positive staining area of the microglia when exposed in IFN-γ, IL-4 or IL-10 for 1 h, 2 h, 3 h, 6 h, 12 h and 24 h. Five samples for each group, and five pictures (40×) for each sample. All the cells in each picture were measured. The mean value of each sample was used for statistical analysis. Data are showed individually (n = 6), *P < 0.05, **P < 0.01, ***P < 0.005 vs control group, #P < 0.01, ##P < 0.01, ###P < 0.005 vs IFN-γ group (two-way ANOVA). d Correlation analysis between the area of CD68 positive staining and microglial area. There are 144 simples from control group, IFN-γ-treated group, IL-4-treated group and IL-10-treated group at 1 h, 2 h, 3 h, 6 h, 12 h and 24 h. r2 = 0.1877, P = 0.0001

Considering the differences between microbeads and apoptotic cells, we further examined the phagocytosis of apoptotic NSPCs by microglia treated IFN-γ, IL-4 or IL-10. The adult NSPCs were isolated from the subependymal ventricular zone (SVZ) and cultured in vitro. After several generations, these adult NSCs were transfected with lentiviruses that carry green fluorescent proteins (GFP). After 5 days, these lentiviral transfected neurospheres were labeled with GFP (Fig. 4a). The GFP-labeled neurospheres were induced to apoptosis by ultraviolet-irradiation (UV) treatment. And the apoptotic neurospheres were incubated with IFN-γ-, IL-4- or IL-10-treated microglia for 24 h. The results showed that microglia gathered around the apoptotic neurosphere. It is interesting that IL-4 or IL-10 treatment significantly increased the number of microglia gathered around the apoptotic neurosphere. But IFN-γ treatment decreased the number of microglia gathered around the apoptotic neurosphere (Fig. 4b, c).

Fig. 4.

Fig. 4

Open in a new tab

Effects of IFN-γ, IL-4 and IL-10 on number of microglia towards apoptotic NSCs. a The morphological micrograph for adult NSCs was transfected with lentiviruses that carry green fluorescent proteins (GFP). The NSPCs were stained Nestin (red) using immunocytochemical staining, apoptotic cells labeled with GFP (green) and the nucleus was stained by DAPI (blue). Scale bar is 50 μm. b The morphological micrograph for the GFP-labeled apoptotic NSCs and recruited microglia. The microglia were stained Iba1 (red) using immunocytochemical staining, apoptotic cells labeled with GFP (green) and the nucleus was stained by DAPI (blue). Scale bar is 100 μm. c, d Quantification of the number of recruited microglia by each apoptotic neurosphere when exposed in IFN-γ, IL-4 or IL-10 for 12 h (c) or 24 h (d). Three samples for each group, and five pictures (40×) for each sample. All the recruited microglia by each apoptotic neurosphere was measured. Data are showed individually (n = 26–30), ***P < 0.005 vs control group, ###P < 0.005 vs IFN-γ group (two-way ANOVA)

The GFP-labeled apoptotic NSCs were dissociated into individual cells and incubated with IFN-γ-, IL-4- or IL-10-treated microglia for 24 h. The results showed that microglia could recognize, engulf and internalize the apoptotic NSCs in vitro (Fig. 5a). The engulfing microglia (including recognition, phagocytosis, and internalization) were quantified. The results showed that the L-4 or IL-10 treatment significantly increased the percentage of engulfing microglia when compared with the control group (Fig. 5b, c). The number of strong phagocytes (one microglia simultaneously engulfs more than one apoptotic cell) was quantified. The results showed that there was no significant difference in the percentage of strong phagocytes among control microglia, IFN-γ-, IL-4- and IL-10-treated microglia (Fig. 5d, e).

Fig. 5.

Fig. 5

Open in a new tab

Effects of IFN-γ, IL-4 and IL-10 on phagocytosis of apoptotic NSCs by microglia. a The micrograph for the processes that microglia engulfed the apoptotic bodies of NSPCs is captured by a fluorescence microscope, including identification, encapsulation, endocytosis and internalization. The microglia were stained Iba1 (red) using immunocytochemical staining, apoptotic NSCs labeled with GFP (green) and the nucleus was stained by DAPI (blue). Scale bar is 20 μm. b The micrograph for microglia engulfed apoptotic bodies when exposed in IFN-γ, IL-4 or IL-10. Scale bar is 100 μm. c Quantification of the percentage of engulfing microglia (including recognition, phagocytosis and internalization) when exposed in IFN-γ, IL-4 or IL-10 for 2 h, 3 h, 6 h, 12 h and 24 h. Six samples for each group, and five pictures (40×) for each sample. The average value of each sample was used for statistical analysis. Data are showed individually (n = 6), **P < 0.01, ***P < 0.005 vs control group, #P < 0.05, ##P < 0.01, ###P < 0.005 vs IFN-γ group (two-way ANOVA). d The morphological micrograph for strong phagocytes (one microglia simultaneously engulfs more than one apoptotic cell) when exposed in IFN-γ, IL-4 or IL-10. Scale bar is 20 μm. e Quantification of the percentage of strong phagocytes when exposed in IFN-γ, IL-4 or IL-10 for 2 h, 3 h, 6 h, 12 h and 24 h. Six samples for each group, and five pictures (40×) for each sample. The average value of each sample was used for statistical analysis. Data are showed individually (n = 6)

IL-4 and IL-10 promotes the phagocytic activity of microglia by up-regulation of TREM2

To reveal the molecular mechanism by which IL-4 and IL-10 regulate microglia phagocytosis, we examined the expression of signaling molecules associated with phagocytosis. We found that the macrophage mannose receptor (CD206), a signaling molecule associated with monocyte migration, was increased in IL-4- and IL-10-treated microglia (Fig. 6a). TREM2, a microglial innate immune receptor, was increased in IL-4- and IL-10-treated microglia (Fig. 6b). The TREM2 was down-regulated by TREM2-siRNA treatment (Fig. 6c, d). Down-regulation of TREM2 blocked the increased phagocytosis of microbeads by IL-4- or IL-10-treated microglia (Fig. 6e, f).

Fig. 6.

Fig. 6

Open in a new tab

Effects of TREM2 siRNA on IL-4 and IL-10 promotes phagocytic activity of microglia by up-regulation of TREM2. a, b CD206 and TREM2 mRNA expression of the microglia when exposed IFN-γ, IL-4 or IL-10 for 2 h, 3 h, 6 h, 12 h and 24 h. Fold changes were normalized to control group. Four samples for each group, and each sample was repeated three times. The average value of each sample was used for statistical analysis. Data are showed individually (n = 4), *P < 0.05, **P < 0.01 (one-way ANOVA). c Western blotting detects TREM2 in microglia when treated control siRNA or TREM2 siRNA. d Quantification of TREM2 protein expression in microglia when treated control siRNA or TREM2 siRNA. Four samples for each group, and each sample was repeated three times. The average value of each sample was used for statistical analysis. Data are showed individually (n = 4) *P < 0.05, **P < 0.01, **P < 0.005 (two-way ANOVA). e The micrograph for microglia phagocytosis fluorescent microbeads when treated control siRNA or TREM2 siRNA at 24 h. The microglia were stained Iba1 (red) using immunocytochemical staining, containing fluorescent microbeads (green) and the nucleus was stained by DAPI (blue). Scale bar is 20 μm. f Quantification of the number of engulfed microbeads each microglia when treated control siRNA or TREM2 siRNA at 24 h. Three samples for each group, and five pictures (40×) for each sample. All the cells in each picture were measured. Data are showed individually (n = 28–31), ***P < 0.005 (two-way ANOVA)

Discussion

Phagocytosis is crucial for normal CNS development and maintenance, but it can be either beneficial or detrimental after injury or disease (Brown and Neher 2014). Microglia are the “professional” phagocytes of the CNS. TREM2 is uniquely expressed on microglia, functioning as a modulator of microglial functions including phagocytosis and inflammatory response. The present study demonstrated that IL-4 and IL-10 can promote the phagocytic activity of microglia by the up-regulation of TREM2.

Modern imaging techniques have shown that microglia are constantly in motion, surveying the surrounding environment (Mizee et al. 2017). Recent findings revealed that microglia play important roles in the elimination of apoptosis, myelin or Aβ, brain development, synaptic pruning, and improvements of neuronal circuitry and network connectivity (Nonaka and Nakanishi 2019). Cytoskeletal rearrangement is an important manner that microglia execute these function (Elmore et al. 2018). The morphological changes of microglia through cytoskeletal rearrangements to execute phagocytosis, migration and synaptic pruning (Yamamiya et al. 2019). Microglia have been reported to be activated with morphological changes in response to various stimulants, which contributes to the pathological process of neurodegenerative diseases (Shao et al. 2017). In this study, we found that the morphology of microglia changed significantly after IFN-γ, IL-4 or IL-10 treatment. The IFN-γ-activated microglia constantly extended multiple filopodia, which was associated with an immune alert (Browne et al. 2013). The IL-4-activated microglia extended several long-lamellipodium, which contributed to immunoregulation (Butovsky et al. 2007). And the IL-10-activated microglia retracted their processes and acquired an amoeboid morphology, which was related to immune inactivation and tissue repair (Gao et al. 2020).

Like macrophages, microglia have sufficient phagocytic ability to restore damaged tissue by eliminating hazardous substances, including cell debris, beta-amyloid, myelin, etc. (Lemke 2019). Hence, our data showed that primary cultured microglia exhibited significant phagocytic activity against rubber microbeads. IL-4 and IL-10 increased phagocytosis of microbeads by microglia. However, IFN-γ inhibited phagocytosis of microbeads by microglia. These data suggested that IFN-γ, as a pro-inflammatory cytokine, may disrupt the phagocytosis of microglia. And IL-4 and IL-10, as the anti-inflammatory cytokines, may promote neuroprotection and tissue repair (Lively and Schlichter 2018).

NSCs are present in the subgranular zone (SGZ) and subventricular zone (SVZ) in the mature brain. Most proliferated NSCs undergo apoptosis to maintain the number of brain cells. These apoptotic NSCs usually require microglial cells to clear them through phagocytosis in neurogenic regions (Sierra et al. 2013). Indeed, evidence showed that blocking microglial phagocytosis increased the number of apoptotic NPCs (Galloway et al. 2019). Our data showed that microglia migrated and gathered around the clustered apoptotic cells. It is interesting that IL-4 or IL-10 treatment significantly promoted the migration of microglia towards apoptotic cells. These results showed that anti-inflammatory activated microglia have stronger migration ability and apoptosis signal recognition ability. Efferocytosis is a remarkably efficient manner to clear apoptotic cells. Our data showed that primary cultured microglia showed significant phagocytic activity against apoptotic NPCs. IL-4 and IL-10 increased phagocytosis of apoptotic NPCs by microglia, suggesting anti-inflammatory signals can promote the phagocytosis of microglia to apoptotic cells.

The fluorescence microbeads used in the phagocytic study are polystyrene coated with streptococcus protein G (Jun et al. 2012; Somo et al. 2017). Protein G is a cell wall protein on the surface of streptococcus, having the function of binding a variety of antibodies, which is a super antigen (Jun et al. 2012; Omer et al. 2016). Microglia are natural immune cells with nonspecific immune functions (Kofler and Wiley 2011). As a result, microglia are able to recognize streptococcal protein G by pattern recognition receptors associated with danger signals and engulf these microbeads (Figarella et al. 2018). Therefore, the phagocytic activity of microglia to fluorescence microbeads mainly reflects the immune defense against bacteria and viruses. However, the recognition and phagocytosis of apoptotic cells by microglia are different from microbeads. After programmed death, neural stem cells usually form apoptotic bodies with cell membranes. Microglia rapidly recognize the “eat-me” signals on the apoptotic cells surface, the most fundamental of which is phosphatidylserine or P2Y12 signals (Blume et al. 2020; Neniskyte et al. 2011). Eat-me signals also trigger microglia to engulf infected or traumatized cells, and this “murder by phagocytosis” may be a common phenomenon (Neher et al. 2013). Several factors are considered to be involved in microglia-neural precursor interactions (Cunningham et al. 2013). These signaling substances include transforming growth factor β (TGF-β), TNF-α, vascular endothelial growth factor, fractalkine, insulin-like growth factor 1 (IGF1), and Toll-like receptor (TLR) (Jesus et al. 2013; Lobo-Silva et al. 2017). Our data demonstrated that TREM2 expression was increased in IL-4- and IL-10-treated microglia, which was consistent with changes in phagocytic activity. These data suggested that different stimuli may regulate the expression of TREM2 to affect the phagocytic function of microglia. Our results showed that down-regulation of TREM2 with siRNA decreased phagocytosis of microbeads by microglia, suggesting microglial TREM2 plays an important role in phagocytosis. Down-regulation of TREM2 with siRNA also blocked the increased phagocytosis of microbeads by IL-4- or IL-10-treated microglia, suggesting that anti-inflammatory signals promote the phagocytic activity of microglia by up-regulating TREM2 expression. Genetic deletion of the phagocytic receptor TREM2, which attenuates microglial phagocytosis, is associated with exacerbated tissue damage in the brain.

In conclusion, these results indicated that IL-4 and IL-10 promote the phagocytic activity of microglia by the up-regulation of TREM2. This study guides further studies on the exact mechanism of phagocytosis of microglia and exploits a potential therapeutic strategy for neurological diseases by modulating the microglial phagocytosis.

Acknowledgments

The authors thank Professor Lanping Guo at the Resource Center of the Chinese Academy of Traditional Chinese Medicine for giving us guidance on the experiment and writing. The authors are grateful to Professor Jun Yu for help in revising the manuscript.

Author contributions

YS, ZJ, and ZT designed the conceptual idea for this study and wrote the manuscript. YS, JX and LY performed the experiments. TX and XC analyzed these data. All the authors participated in the discussion and approved the manuscript as submitted.

Funding

This study was funded by the Department of Science and Technology of Guizhou High-level Innovative Talents ([2018]5638), Guizhou science and technology plan project ([2019]5611) and First-class Discipline Construction Projects of Guizhou Province of China [GNYL(2017)008].

Compliance with ethical standards

Conflict interests

The author declares that there is no conflict of interest in this research.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Blume ZI, Lambert JM, Lovel AG, Mitchell DM. Microglia in the developing retina couple phagocytosis with the progression of apoptosis via p2ry12 signaling. Dev Dyn. 2020 doi: 10.1002/dvdy.163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Brown GC, Neher JJ. MicrOoglial phagocytosis of live neurons. Nat Rev Neurosci. 2014;15:209–216. doi: 10.1038/nrn3710. [DOI] [PubMed] [Google Scholar]
  3. Browne TC, McQuillan K, McManus RM, O’Reilly JA, Mills KH, Lynch MA. IFN-gamma production by amyloid beta-specific th1 cells promotes microglial activation and increases plaque burden in a mouse model of Alzheimer’s disease. J Immunol. 2013;190:2241–2251. doi: 10.4049/jimmunol.1200947. [DOI] [PubMed] [Google Scholar]
  4. Butovsky O, Bukshpan S, Kunis G, Jung S, Schwartz M. Microglia can be induced by ifn-gamma or Il-4 to express neural or dendritic-like markers. Mol Cell Neurosci. 2007;35:490–500. doi: 10.1016/j.mcn.2007.04.009. [DOI] [PubMed] [Google Scholar]
  5. Cunningham CL, Martinez-Cerdeno V, Noctor SC. Microglia regulate the number of neural precursor cells in the developing cerebral cortex. J Neurosci. 2013;33:4216–4233. doi: 10.1523/jneurosci.3441-12.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dean HB, Roberson ED, Song Y. Neurodegenerative disease-associated variants in trem2 destabilize the apical ligand-binding region of the immunoglobulin domain. Front Neurol. 2019;10:1252. doi: 10.3389/fneur.2019.01252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Du L, Zhang Y, Chen Y, Zhu J, Yang Y, Zhang HL. Role of microglia in neurological disorders and their potentials as a therapeutic target. Mol Neurobiol. 2017;54:7567–7584. doi: 10.1007/s12035-016-0245-0. [DOI] [PubMed] [Google Scholar]
  8. Elmore MRP, et al. Replacement of microglia in the aged brain reverses cognitive, synaptic, and neuronal deficits in mice. Aging Cell. 2018;17:e12832. doi: 10.1111/acel.12832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Fan Y, Ma Y, Huang W, Cheng X, Gao N, Li G, Tian S. Up-regulation of trem2 accelerates the reduction of amyloid deposits and promotes neuronal regeneration in the hippocampus of amyloid beta1-42 injected mice. J Chem Neuroanat. 2019;97:71–79. doi: 10.1016/j.jchemneu.2019.02.002. [DOI] [PubMed] [Google Scholar]
  10. Figarella K, Uzcategui NL, Mogk S, Wild K, Fallier-Becker P, Neher JJ, Duszenko M. Morphological changes, nitric oxide production, and phagocytosis are triggered in vitro in microglia by bloodstream forms of Trypanosoma brucei. Sci Rep. 2018;8:15002. doi: 10.1038/s41598-018-33395-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Galloway DA, Phillips AEM, Owen DRJ, Moore CS. Corrigendum: phagocytosis in the brain: homeostasis and disease. Front Immunol. 2019;10:1575. doi: 10.3389/fimmu.2019.01575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gao Y, Tu D, Yang R, Chu CH. Through reducing ros production, il-10 suppresses caspase-1-dependent il-1beta maturation, thereby preventing chronic neuroinflammation and neurodegeneration. Int J Mol Sci. 2020 doi: 10.3390/ijms21020465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gensel JC, Zhang B. Macrophage activation and its role in repair and pathology after spinal cord injury. Brain Res. 2015;1619:1–11. doi: 10.1016/j.brainres.2014.12.045. [DOI] [PubMed] [Google Scholar]
  14. Gordon S, Taylor PR. Monocyte and macrophage heterogeneity. Nat Rev Immunol. 2005;5:953–964. doi: 10.1038/nri1733. [DOI] [PubMed] [Google Scholar]
  15. Hanisch UK. Microglia as a source and target of cytokines. Glia. 2002;40:140–155. doi: 10.1002/glia.10161. [DOI] [PubMed] [Google Scholar]
  16. Jesus EE, et al. Effects of ifn-gamma, tnf-alpha, il-10 and tgf-beta on neospora caninum Infection in rat glial cells. Exp Parasitol. 2013;133:269–274. doi: 10.1016/j.exppara.2012.11.016. [DOI] [PubMed] [Google Scholar]
  17. Jordan FL, Thomas WE. Identification of microglia in primary cultures of mixed cerebral cortical cells. Brain Res Bull. 1987;19:153–159. doi: 10.1016/0361-9230(87)90180-8. [DOI] [PubMed] [Google Scholar]
  18. Jun BH, Kang H, Lee YS, Jeong DH. Fluorescence-based multiplex protein detection using optically encoded microbeads. Molecules. 2012;17:2474–2490. doi: 10.3390/molecules17032474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kaminska B, Mota M, Pizzi M. Signal transduction and epigenetic mechanisms in the control of microglia activation during neuroinflammation. Biochem Biophys Acta. 2016;1862:339–351. doi: 10.1016/j.bbadis.2015.10.026. [DOI] [PubMed] [Google Scholar]
  20. Kim SM, et al. Trem2 promotes abeta phagocytosis by upregulating c/ebpalpha-dependent cd36 expression in microglia. Sci Rep. 2017;7:11118. doi: 10.1038/s41598-017-11634-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kofler J, Wiley CA. Microglia: key innate immune cells of the brain. Toxicol Pathol. 2011;39:103–114. doi: 10.1177/0192623310387619. [DOI] [PubMed] [Google Scholar]
  22. Lee CY, Landreth GE. The role of microglia in amyloid clearance from the ad brain. J Neural Transm (Vienna, Austria: 1996) 2010;117:949–960. doi: 10.1007/s00702-010-0433-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lemke G. How macrophages deal with death. Nat Rev Immunol. 2019;19:539–549. doi: 10.1038/s41577-019-0167-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lively S, Schlichter LC. Microglia responses to pro-inflammatory stimuli (lps, ifngamma + tnfalpha) and reprogramming by resolving cytokines (il-4, il-10) Front Cell Neurosci. 2018;12:215. doi: 10.3389/fncel.2018.00215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Loane DJ, Kumar A. Microglia in the tbi brain: the good, the bad, and the dysregulated. Exp Neurol. 2016;275:316–327. doi: 10.1016/j.expneurol.2015.08.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lobo-Silva D, Carriche GM, Castro AG, Roque S, Saraiva M. Interferon-beta regulates the production of il-10 by toll-like receptor-activated microglia. Glia. 2017;65:1439–1451. doi: 10.1002/glia.23172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Meilandt WJ, et al. Trem2 deletion reduces late-stage amyloid plaque accumulation, elevates the abeta42:abeta40 ratio, and exacerbates axonal dystrophy and dendritic spine loss in the ps2a pp Alzheimer’s mouse model. J Neurosci. 2020 doi: 10.1523/jneurosci.1871-19.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mizee MR, et al. Isolation of primary microglia from the human post-mortem brain: effects of ante- and post-mortem variables. Acta Neuropathol Commun. 2017;5:16. doi: 10.1186/s40478-017-0418-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Neher JJ, Emmrich JV, Fricker M, Mander PK, Thery C, Brown GC. Phagocytosis executes delayed neuronal death after focal brain ischemia. Proc Natl Acad Sci USA. 2013;110:E4098–E4107. doi: 10.1073/pnas.1308679110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Neniskyte U, Neher JJ, Brown GC. Neuronal death induced by nanomolar amyloid beta is mediated by primary phagocytosis of neurons by microglia. J Biol Chem. 2011;286:39904–39913. doi: 10.1074/jbc.M111.267583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nonaka S, Nakanishi H. Microglial clearance of focal apoptotic synapses. Neurosci Lett. 2019;707:134317. doi: 10.1016/j.neulet.2019.134317. [DOI] [PubMed] [Google Scholar]
  32. Nugent AA, et al. Trem2 regulates microglial cholesterol metabolism upon chronic phagocytic challenge. Neuron. 2019 doi: 10.1016/j.neuron.2019.12.007. [DOI] [PubMed] [Google Scholar]
  33. Omer AM, Tamer TM, Hassan MA, Rychter P, Mohy Eldin MS, Koseva N. Development of amphoteric alginate/aminated chitosan coated microbeads for oral protein delivery. Int J Biol Macromol. 2016;92:362–370. doi: 10.1016/j.ijbiomac.2016.07.019. [DOI] [PubMed] [Google Scholar]
  34. Orihuela R, McPherson CA, Harry GJ. Microglial m1/m2 polarization and metabolic states. Br J Pharmacol. 2016;173:649–665. doi: 10.1111/bph.13139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Schulz D, Severin Y, Zanotelli VRT, Bodenmiller B. In-depth characterization of monocyte-derived macrophages using a mass cytometry-based phagocytosis assay. Sci Rep. 2019;9:1925. doi: 10.1038/s41598-018-38127-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Shao QH, Zhang XL, Yang PF, Yuan YH, Chen NH. Amyloidogenic proteins associated with neurodegenerative diseases activate the nlrp3 inflammasome. Int Immunopharmacol. 2017;49:155–160. doi: 10.1016/j.intimp.2017.05.027. [DOI] [PubMed] [Google Scholar]
  37. Sierra A, Abiega O, Shahraz A, Neumann H. Janus-faced microglia: beneficial and detrimental consequences of microglial phagocytosis. Front Cell Neurosci. 2013;7:6. doi: 10.3389/fncel.2013.00006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Somo SI, Khanna O, Brey EM. Alginate microbeads for cell and protein delivery. Methods Mol Biol. 2017;1479:217–224. doi: 10.1007/978-1-4939-6364-5_17. [DOI] [PubMed] [Google Scholar]
  39. Walker DG, Lue LF. Immune phenotypes of microglia in human neurodegenerative disease: challenges to detecting microglial polarization in human brains. Alzheimer’s Res Ther. 2015;7:56. doi: 10.1186/s13195-015-0139-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yamamiya M, Tanabe S, Muramatsu R. Microglia promote the proliferation of neural precursor cells by secreting osteopontin. Biochem Biophys Res Commun. 2019;513:841–845. doi: 10.1016/j.bbrc.2019.04.076. [DOI] [PubMed] [Google Scholar]
  41. Yeh FL, Hansen DV, Sheng M. Trem2, microglia, and neurodegenerative diseases. Trends Mol Med. 2017;23:512–533. doi: 10.1016/j.molmed.2017.03.008. [DOI] [PubMed] [Google Scholar]
  42. Zhong L, Chen XF. The emerging roles and therapeutic potential of soluble trem2 in Alzheimer’s disease. Front Aging Neurosci. 2019;11:328. doi: 10.3389/fnagi.2019.00328. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cytotechnology are provided here courtesy of Springer Science+Business Media B.V.

RESOURCES