Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Mar 30.
Published in final edited form as: Aquaculture. 2019 Nov 22;519:734766. doi: 10.1016/j.aquaculture.2019.734766

Sex, salinity and sampling period dependent patterns of growth hormone mRNA expression in Mozambique tilapia

Andre P Seale a,b,*, K Keano Pavlosky b,c, Fritzie T Celino-Brady a, Darren T Lerner d
PMCID: PMC7451021  NIHMSID: NIHMS1544575  PMID: 32863453

Abstract

Tilapias comprise the second most aquacultured finfish group in the world. Such popularity stems in part from their tolerance to a wide range of environmental conditions and their sexually dimorphic nature, where males grow larger than females. As in other vertebrates, growth in tilapia is regulated by the growth hormone/ insulin like growth factor (GH/IGF) system. Moreover, environmental salinity has previously been shown to directly modulate growth in tilapia. Less is known, however, regarding how salinity may modulate sexually dimorphic growth. Utilizing a species of tilapia of high salinity tolerance, the Mozambique tilapia, Oreochromis mossambicus, we compared gh expression from the pituitary of male and female adults reared in fresh water (FW), seawater (SW), and a tidal regime (TR) characterized by dynamically changing salinities between FW and SW every six hours, over a 24 h period. We found significant effects of sex, salinity regime and whether fish were sampled during daylight or dark hours. In both sexes, gh expression was greater in fish reared in SW and TR compared with those in FW, and greater in fish sampled during dark hours, compared with those sampled in daylight hours. Pituitary gh expression was greater in males than in females reared in SW and TR, but not in FW. These results provide insight on the sex-specific modulation of gh expression by environmental factors in Mozambique tilapia.

Keywords: Tilapia, growth, growth hormone, sex specific, salinity, tidal cycle, photoperiod

1. Introduction

Growth Hormone (GH) has been widely used as a biomarker for growth in species of relevance for aquaculture. Secreted by the pituitary gland, GH is involved in the regulation of most major physiological processes, such as growth, osmoregulation, metabolism, reproduction, development, immunity, and feeding behavior in fish (Bergan-Roller, Sheridan, 2018; Bern, 1983; Leung, et al., 1991; Mancera, McCormick, 1998; McCormick, 1996; McLean, Donaldson, 1993; Sakamoto, et al., 1997; Shepherd, et al., 2006; Shepherd, et al., 1997b; Yada, 2007). Growth in vertebrates is largely controlled through the coordinated activities of the growth hormone (GH)/insulin-like growth factor (IGF) axis. In the liver and muscle, GH stimulates cell division and differentiation among other functions, and initiates the production and release of IGF-I and IGF-II, which in turn stimulate a variety of growth-promoting actions in most tissues (Butler, Le Roith, 2001; Duan, et al., 2010; Le Roith, 2003; Wood, et al., 2005). Reflective of its key functions in the dynamic regulation of growth and metabolism, multiple endpoints of the GH/IGF system in various teleosts have been shown to be stimulated in response to a number of stimuli, including photoperiod, salinity, feeding, nutrient and sex steroid supplementation, and domestication (Ayson, Takemura, 2006; Ayson, et al., 2007; Bertucci, et al., 2019; Bjornsson, et al., 1995; Cleveland, Weber, 2015; Ma, et al., 2016; Magdeldin, et al., 2007; Peterson, et al., 2009; Tymchuk, et al., 2009; Velez, et al., 2016).

The tilapia, like many teleost fishes, exhibits a sexually dimorphic pattern of growth. This sexual dimorphism has led to a number of widespread strategies to produce and rear monosex populations (Singh, 2013). The basis for male tilapia growing faster and larger than females involves the differential actions of androgens and estrogens and their interplay with the GH/IGF-1 axis (Kuwaye, et al., 1993; Riley, et al., 2002b; Ron, et al., 1995; Shepherd, et al., 1997b; Sparks, et al., 2003). Studies indicate that the accelerated growth achieved by tilapia treated with 17α-methyltestosterone (MT) (Kuwaye, et al., 1993), a synthetic androgen, is due at least in part to the stimulation of growth factors (Riley, et al., 2002b). Together, these results suggest that largely through activation of the GH/IGF system, male tilapia are optimized for somatic growth.

The use of tilapia species that are tolerant to wide excursions in salinity, such as the Mozambique tilapia, Oreochromis mossambicus, has provided a suitable model to investigate the interplay of sexual determination of growth and its modulation by environmental salinity. Regardless of sex, tilapia raised in seawater (SW) grow significantly faster than those in fresh water (FW) (Kuwaye, et al., 1993; Morgan, Iwama, 1991; Riley, et al., 2002b; Ron, et al., 1995; Shepherd, et al., 1997a; Sparks, et al., 2003). Evidence suggests that faster growth of SW tilapia is tied, at least partly, to the activation of the GH/IGF system. Both circulating and pituitary GH increase following transfer from FW to SW, while GH release in vitro has been found to increase in response to increases in extracellular osmolality (Borski, et al., 1994; Breves, et al., 2010b; Helms, et al., 1987; Pierce, et al., 2007; Seale, et al., 2006; Seale, et al., 2002). Plasma IGF-1 is also higher in SW fish than in FW fish (Magdeldin, et al., 2007). Nevertheless, evidence suggests that pituitary gh mRNA expression may be a better indicator of growth than circulating GH and IGF-1 levels (Riley, et al., 2002b).

As a euryhaline species native to estuarine waters off the southeast coast of Africa (Trewavas, 1983), the Mozambique tilapia is capable of surviving in salinities equivalent to FW through double-strength SW (Fiess, et al., 2007; Stickney, 1986), and salinities that dynamically change between FW and SW (Moorman, et al., 2015). Recently, we have described the distinct osmoregulatory profile that Mozambique tilapia reared under tidally-changing salinities acquire relative to fish reared in steady-state FW or SW since the yolk-sac fry stage (Moorman, et al., 2015; Moorman, et al., 2014; Seale, et al., 2019) and after becoming adults (Pavlosky, et al., 2019). We have also found that rearing tilapia in water that varies in a tidal pattern between FW and SW increases growth by 4 months, while increasing GH levels in circulation, and pituitary gh mRNA expression (Moorman, et al., 2016). This same study also showed that, compared with GH and IGF-1 in circulation and igf-1 and gh receptor (ghr) expression in muscle and liver, pituitary gh expression had the strongest positive correlation with body weight across all rearing salinities. It is unknown, however, whether the modulation of gh by rearing salinity regime varies with sex and natural photoperiod. By analyzing the interaction of natural factors otherwise known to individually modulate growth, we provide a new perspective on the nuanced and complex endocrine regulation of growth in fishes.

2. Materials and Methods

2.1. Fish rearing

Mozambique tilapia (O. mossambicus) yolk-sac larvae were collected from stocks maintained in outdoor FW (0.1 ± 0.1‰) tanks at the Hawai’i Institute of Marine Biology. The rearing protocol and sampling of fish for this study has been recently reported (Seale, et al., 2019). Briefly, 24 days post-collection, the yolk sacs were fully absorbed, and the fry were seeded to 700 L outdoor tanks filled with 140 L of FW, at a density of 120 fish per tank. Fry were fed ground trout chow pellets (Skretting, Tooele, UT) ad libitum daily. Water temperature was maintained at 27 ± 2 °C and fish were held under natural photoperiod. Two days after seeding, tanks were transitioned to brackish water (BW) of 10‰ by the addition of SW (34 ± 1‰; Kaneohe Bay, Oahu, HI). Five days after seeding, the salinity was further increased to 18 ± 2‰, and then eight days after seeding, two BW tanks were transitioned back to FW, two were transitioned to SW, and the remaining four tanks put under a tidal regime (TR). Tanks subjected to the tidally changing salinity alternated between FW and SW every six hours, yielding a complete salinity transfer within two hours. The fish were maintained in either FW, SW or TR for two years prior to sampling. Following their initial transition to FW, SW or TR, fish were provided fixed rations of 18% mean body weight divided over two daily feedings. Rations were decreased by four percent every 21–25 days until they were equivalent to four percent mean body weight. The fish were reared under these conditions until the time of sampling. Fish were fasted during the 24 h sampling period; the final feeding of all treatment groups occurred immediately prior to the first sampling time point.

2.2. Treatments and sampling

Fish were sampled every three hours during a 24 h period, beginning at 0945 (nine forty-five AM) and ending at 0945 the following day. Five sampling periods occurred during daylight hours (0945, 1300, 1545, 0700 and 0945) and four during dark hours (1900, 2145, 0100, 0345). Four male and four female fish reared under the TR were sampled at the end of the FW and SW phases of the tidal cycle, as well as at the mid-point of each phase. For each time point at which TR fish were sampled, corresponding FW- and SW-control groups were also sampled. Fish were collected at each time point from across all of the replicate tanks for the FW, SW and TR treatments. There were two tanks each for FW and SW fish and four tanks for TR fish. Salinity was measured hourly in all tanks over the course of the 24 h sampling period (Fig. 2A and 2B). Salinity ranged between 0.1 and 0.2 ‰ in FW-control tanks, 34.5–35.2 ‰ in SW-control tanks, and 0.2–35.2‰ in TR tanks. At the time of sampling, fish were netted and lethally anesthetized with 2-phenoxyethanol (0.3 ml/l). After fish were weighed, blood was collected with a needle and syringe coated with sodium heparin (200 U/ml, Sigma-Aldrich, St. Louis, MO). Plasma was separated by centrifugation and stored at −20°C until further analyses. Pituitaries were collected, frozen in liquid nitrogen, and stored at −80°C. All experiments were conducted in accordance with the principles and procedures approved by the Institutional Animal Care and Use Committee, University of Hawai’i.

Fig. 2.

Fig. 2.

Open in a new tab

Pituitary gene expression of gh in male (A) and female (B) Mozambique tilapia reared in FW (black dashed), SW (black dotted) and a TR (solid black) and sampled over 24 h. Data are normalized by ef1α, Values represent means ± S.E.M. (n= 3–5). Shading denotes dark hours. Black lines and symbols denote pituitary gh expression (left y-axis). Grey lines and symbols denote mean water salinity measured hourly in FW, SW, and TR tanks (right y-axis).

2.3. Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from pituitary samples using TRI Reagent according to the manufacturer’s instructions (Molecular Research Center, Cincinnati, OH). Using a High Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Waltham, MA), 30 ng of pituitary total RNA were reverse transcribed into cDNA. Quantitative real-time PCR (qRT-PCR) assays were set up as previously described (Pierce, et al., 2007), using the StepOnePlus real-time PCR system (Applied Biosystems, Carlsbad, CA). The PCR mixture (15 uL) contained Power SYBR Green PCR Master Mix (Applied Biosystems), 200 nM of each primer, and 1 μl of cDNA (equivalent to 1.5 ng total RNA). PCR cycling parameters were 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The mRNA levels of reference and target genes were determined by a relative quantification standard curve. Elongation factor 1α (ef1α) was used as a reference gene to normalize the mRNA levels of target genes. Primer pairs employed and their efficiencies are listed in Table 1.

Table 1.

Primers used for qPCR

Gene Name Primer Sequence (5′–3′) R2 % Efficiency Reference Accession Number
ef1α Forward AGCAAGTACTACGTGACCATCATTG
Reverse AGTCAGCCTGGGAGGTACCA		 0.999 90.5 Breves et al., 2010 AB075952
gh Forward TTACATCATCAGCCCGATCG
Reverse AGATCGACAGCAGCTTCAGGA		 0.999 96.4 Magdeldin et al., 2007 AF033806
Open in a new tab

EF1α: Elongation Factor 1α; GH: Growth Hormone.

2.5. Statistical analyses

Statistical analysis of weight and length was conducted by linear regression of log-transformed data. Analyses of gh mRNA levels was conducted by three-way analysis of variance (ANOVA) with sex, sampling period (daylight and dark hours) and salinity treatments (FW-controls, SW-controls, and TR fish) as main effects. Significant main and interaction effects (P<0.05) were followed up with Fisher’s Protected Least Significant Difference (LSD) test. Data are expressed as means ± S.E.M. Statistical analyses were performed using Prism 8.0 software (GraphPad, La Jolla, CA).

3. Results

3.1. Sexually dimorphic growth

The relationship between total length and weight of male and female tilapia used in this study is shown in Fig. 1. All fish were sourced from the same cohort of yolk-sac fry. The inset depicts the natural log transformed total length versus weight of females and males, with linear regression equations of (Y= 3.23*X-2.03) and (Y= 3.25*X-2.08), respectively, and R2= 0.93 and 0.79, respectively. While it is apparent that males had greater weight and length than females of the same age, the slopes of the log transformed length versus weight linear regressions were not significantly different between the two sexes. These data indicate that the length-weight relationship between male and female Mozambique tilapia are similar, despite their marked sexually dimorphic growth patterns.

Fig. 1.

Fig. 1.

Open in a new tab

Total length versus body weight in two year old male (dark circles) and female (light circles) Mozambique tilapia depicting sexual dimorphism. Inset represents log transformed length versus log transformed weight. The slope of the log transformed weight-length was not different between males and females.

3.2. Pituitary gh gene expression

To assess whether gh mRNA expression in male and female Mozambique tilapia may be differentially affected by salinity regime and natural photoperiod, we sampled adult (two years post-hatch) Mozambique tilapia of both sexes every three hours (h) over the course of 24 h. We compared gh mRNA expression levels from male fish with those of females reared in FW, SW or TR and sampled during daylight and dark hours, in a three-way factorial design.

Pituitary gh mRNA levels from male and female tilapia reared in FW, SW and a TR were measured every 3 h throughout a 24 h sampling period that encompassed approximately 12 h of daylight (between 0945 and 1730, and 0545 and 1000) and approximately 12 h of dark (between 1730 and 0545) (Fig. 2A and 2B). Pituitary gh expression over time was generally higher in fish reared in SW and TR; this pattern was more evident in males (Fig. 2A) than in females (Fig. 2B). Moreover, gh expression in fish acclimated to all salinity regimens gradually rose during dark hours, with the onset of the rise occurring earlier in fish reared in SW or TR (2130) than those reared in FW (0100), especially in males (Fig. 2A). For statistical analysis, means were combined and parsed by sex (male and female), salinity (FW, SW and TR) and natural photoperiod (daylight and dark hours). A three-way ANOVA revealed single main effects of sex, salinity and sampling period (P < 0.001) and an interaction effect of salinity and sampling period (P < 0.05) (Fig. 3).

Fig. 3.

Fig. 3.

Open in a new tab

Pituitary gene expression of gh in male (black bars) and female (white bars) Mozambique tilapia reared in FW, SW and TR, and sampled during light and dark hours. Data are normalized by ef1α. Values represent means ± S.E. M (n = 13). Sex, salinity and sampling period effects were analyzed by three-way ANOVA, followed by Fisher’s protected LSD test when main or interaction effects were detected. **Significantly different from males at P < 0.01. †, ††† Significantly different from FW period at P < 0.05 and 0.001, respectively. §§, §§§ Significantly different from the daylight sampling period at P < 0.01 and 0.001, respectively.

In fish sampled in daylight hours, pituitary mRNA expression of gh was 2.5-fold higher in males reared in SW and TR versus those reared in FW (Fig. 3). By contrast, gh mRNA expression in female fish sampled in daylight hours was only 1.5-fold higher in fish reared in SW and TR compared with those reared in FW. There were no sex differences in gh expression in fish reared in FW, regardless of the period in which they were sampled (Fig. 3). During daylight hours, sex differences in gh expression were observed in fish reared in SW and TR but not in FW. During dark hours, however, only fish reared in TR showed sex differences in gh expression. Males reared in all salinities increased gh expression during dark hours, whereas only females reared in SW and TR showed a similar pattern (Fig. 3).

4. Discussion

The objective of this experiment was to determine the effects of sex, salinity and sampling period on pituitary gh expression in adult Mozambique tilapia. This is the first study to describe a temporal profile in gh expression for adult male and female Mozambique tilapia reared for two years under three distinct salinity regimens, including cyclically changing salinity, which simulates some of the habitats to which this species is native. In light of the indication that pituitary gh expression is a reliable predictor of growth compared with other endpoints of the GH/IGF system (Moorman, et al., 2016; Riley, et al., 2002a) and recent findings showing that tilapia exposed to changing salinities grow faster through the activation of the GH/IGF system (Moorman, et al., 2016), our study focused on examining the nuances of environmental regulation of pituitary gh in males and females of the same cohort. By comparing two-year old adult tilapia reared in steady-state FW and SW with fish reared under TR, our findings support the notion that salinity and time of day modulate sex-dependent patterns in the transcriptional regulation of gh. Specifically, the findings of this study indicate that transcript levels of gh in Mozambique tilapia acclimated to SW and TR are higher than those in FW. Moreover, the salinity-dependent induction of gh transcripts was more accentuated in males than in females, and elevated during dark hours compared with daylight hours.

Sexually dimorphic growth is a common phenomenon in fish. Based on their sex-dependent growth patterns, tilapia culture is frequently conducted with monosex populations, with males being favored due to their faster growth rates (Singh, 2013). Juvenile tilapia of undifferentiated sex can be induced to become phenotypic males by exposure to MT (Pandian, Sheela, 1995). Consequently, Mozambique tilapia treated with MT have been shown to grow faster than untreated controls (Kuwaye, et al., 1993; Ron, et al., 1995; Sparks, et al., 2003). Hence, it was not surprising to find a clear sexually-dimorphic pattern in the distribution of weight and length of adult Mozambique tilapia of the same age (Fig. 1).

Environmental factors, such as salinity, play a major role in controlling growth in fishes (Boeuf, Payan, 2001). Several studies have characterized the effects of salinity on growth and the GH/IGF system in tilapia (Shepherd, et al., 2006). Regardless of sex, tilapia raised in SW grow faster than those in FW (Kuwaye, et al., 1993; Morgan, et al., 1997; Riley, et al., 2002b; Ron, et al., 1995; Shepherd, et al., 1997a; Sparks, et al., 2003). In tilapia reared under TR, growth rates are even more pronounced than those of fish reared in SW (Moorman, et al., 2016). Circulating GH and IGF-1, pituitary gh mRNA and hepatic igf-1 mRNA are generally higher in SW fish than in FW fish, though salinity-dependent patterns in circulating hormones are not as clear as their transcripts (Breves, et al., 2010a; Breves, et al., 2010b; Magdeldin, et al., 2007; Moorman, et al., 2016; Riley, et al., 2002b). In fish reared in TR, both plasma GH and pituitary gh mRNA were elevated relative to levels observed in SW and FW fish (Moorman, et al., 2016). Despite ample evidence indicating the activation of multiple endpoints of the GH/IGF system in conditions that stimulate growth, the notion that gh mRNA is a suitable indicator of growth in tilapia (Riley, et al., 2002b) was corroborated by Moorman and co-workers (Moorman, et al., 2016) who reported that body weight correlated the strongest with gh mRNA compared with other GH/IGF system endpoints. In the present study, gh mRNA levels were higher in fish acclimated to SW and TR fish, compared with those in FW. Moreover, the salinity-induced elevation in gh mRNA was more pronounced in males than in females. Inasmuch as gh levels are generally reflective of body weight, our findings revealed a pattern consistent with that observed in the growth rates of tilapia treated with MT in SW and FW, where MT-treated fish in SW grew faster than MT-treated fish in FW and those that were untreated (Ron, et al., 1995; Sparks, et al., 2003).

It is well established that photoperiod influences growth in fish (Bjornsson, et al., 2011; Boeuf, Bail, 1999). Extended light hours have been shown to increase growth rates in several species, including red sea bream (Pagrus major), gilthead sea bream (Sparus aurata), Atlantic salmon (Salmo salar), rainbow trout (Oncorhyncus mykiss) and Nile tilapia (Oreochromis niloticus) (Biswas, et al., 2005; Johnsson, Bjornsson, 1994; Kissil, et al., 2001; Oppedal, et al., 1999; Rad, et al., 2006). In salmonids, day length speeds up the parr-smolt transformation and associated growth, and increases plasma GH (Bjornsson, et al., 1995; Bjornsson, et al., 1989; McCormick, et al., 1995). In crussian carp (Carassius auratus) gh expression in muscle was shown to oscillate, with peaks during dark hours in fish fasted for no longer than the duration of one light-dark cycle (Wu, et al., 2018). In rabbitfish (Siganus guttatus), gh mRNA expression was significantly higher in the dark phase than in the light phase, suggesting a diurnal rhythm of expression (Ayson, Takemura, 2006). Consistent with the patterns observed in other teleosts, pituitary gh mRNA peaked during dark hours in Mozambique tilapia (Figs. 2 and 3). These nocturnal peaks in gh expression were further modulated with respect to sex and rearing salinity, indicating that multiple environmental factors are at play to produce a complex and nuanced pattern of pituitary gh regulation.

In this study, we have provided novel insights into the integrated regulation of gh in Mozambique tilapia by sex, salinity regimen and sampling period. Together with our previous study, in which it was found that fish reared in TR for four months grew faster than those reared in steady-state FW or SW (Moorman, et al., 2016), our current findings may lead to applications in aquaculture, where daylight and salinity can be adjusted to optimize sex-specific production practices. Moreover, the use of the TR rearing paradigm shall continue to bring forward novel physiological insights on the multi-factorial regulation of growth in tilapia and other euryhaline fish.

Growth in Mozambique tilapia is sexually dimorphic

Pituitary gh expression is affected by sex, salinity and daylight period

Sex-specific patterns of gh expression are dependent on salinity and daylight period.

Acknowledgements

There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported. This work was funded in part by grants from the National Science Foundation (IOS-1755016), and the National Oceanic and Atmospheric Administration (NA18OAR4170347 to D.T.L. and A.P.S. and NA14OAR4170071, which is sponsored by the University of Hawai’i Sea Grant College Program projects R/SS-12 and R/SB-18 to A.P.S.), the National Institutes of Diabetes and Digestive and Kidney Diseases 1R21DK111775–01 from the National Institutes of Health to A.P.S., and the National Institute of Food and Agriculture Hatch no. HAW02051-H to A.P.S. The views expressed herein are those of the authors and do not necessarily reflect the views of the aforementioned granting agencies. University of Hawai’i Sea Grant publication number UNIHI-SEAGRANT-JC-14–66. We are grateful to Mr. Julian Leon for laboratory assistance and Dr. Lucia A. Seale and Ms. Amanda Reyes for sampling assistance.

Footnotes

Declaration of interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Ayson FG, Takemura A, 2006. Daily expression patterns for mRNAs of GH, PRL, SL, IGF-I and IGF-II in juvenile rabbitfish, Siganus guttatus, during 24-h light and dark cycles. Gen. Comp. Endocrinol 149, 261–268. [DOI] [PubMed] [Google Scholar]
  2. Ayson FG, de Jesus-Ayson EG, Takemura A, 2007. mRNA expression patterns for GH, PRL, SL, IGF-I and IGF-II during altered feeding status in rabbitfish, Siganus guttatus. Gen. Comp. Endocrinol 150, 196–204. [DOI] [PubMed] [Google Scholar]
  3. Bergan-Roller HE, Sheridan MA, 2018. The growth hormone signaling system: Insights into coordinating the anabolic and catabolic actions of growth hormone. Gen. Comp. Endocrinol 258, 119–133. [DOI] [PubMed] [Google Scholar]
  4. Bern HA, 1983. Functional Evolution of Prolactin and Growth Hormone in Lower Vertebrates. Amer. Zool 23, 663–671. [Google Scholar]
  5. Bertucci JI, Blanco AM, Sundarrajan L, Rajeswari JJ, Velasco C, Unniappan S, 2019. Nutrient Regulation of Endocrine Factors Influencing Feeding and Growth in Fish. Front. Endocrinol. (Lausanne) 10, 83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Biswas AK, Seoka M, Inoue Y, Takii K, Kumai H, 2005. Photoperiod influences the growth, food intake, feed efficiency and digestibility of red sea bream (Pagrus major). Aquaculture. 250, 666–673. [Google Scholar]
  7. Bjornsson BT, Stefansson SO, Hansen T, 1995. Photoperiod regulation of plasma growth hormone levels during parr-smolt transformation of Atlantic salmon: implications for hypoosmoregulatory ability and growth. Gen. Comp. Endocrinol 100, 73–82. [DOI] [PubMed] [Google Scholar]
  8. Bjornsson BT, Stefansson SO, McCormick SD, 2011. Environmental endocrinology of salmon smoltification. Gen. Comp. Endocrinol 170, 290–298. [DOI] [PubMed] [Google Scholar]
  9. Bjornsson BT, Thorarensen H, Hirano T, Ogasawara T, Kristinsson JB, 1989. Photoperiod and temperature affect plasma growth hormone levels, growth, condition factor and hypoosmoregulatory ability of juvenile Atlantic salmon Salmo salar during parr–smolt transformation. Aquaculture. 82, 77–91. [Google Scholar]
  10. Boeuf G, Bail PYL, 1999. Does light have an influence on fish growth? Aquaculture. 177, 129–152. [Google Scholar]
  11. Boeuf G, Payan P, 2001. How should salinity influence fish growth? Comp. Biochem. Physiol 130, 411–423. [DOI] [PubMed] [Google Scholar]
  12. Borski RJ, Yoshikawa JS, Madsen SS, Nishioka RS, Zabetian C, Bern HA, Grau EG, 1994. Effects of environmental salinity on pituitary growth hormone content and cell activity in the euryhaline tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol 95, 483–494. [DOI] [PubMed] [Google Scholar]
  13. Breves JP, Hirano T, Grau EG, 2010a. Ionoregulatory and endocrine responses to disturbed salt and water balance in Mozambique tilapia exposed to confinement and handling stress. Comp. Biochem. Physiol 155, 294–300. [DOI] [PubMed] [Google Scholar]
  14. Breves JP, Hasegawa S, Yoshioka M, Fox BK, Davis LK, Lerner DT, Takei Y, Hirano T, Grau EG, 2010b. Acute salinity challenges in Mozambique and Nile tilapia: differential responses of plasma prolactin, growth hormone and branchial expression of ion transporters. Gen. Comp. Endocrinol 167, 135–142. [DOI] [PubMed] [Google Scholar]
  15. Butler AA, Le Roith D, 2001. Control of growth by the somatropic axis: growth hormone and the insulin-like growth factors have related and independent roles. Annu. Rev. Physiol 63, 141–164. [DOI] [PubMed] [Google Scholar]
  16. Cleveland BM, Weber GM, 2015. Effects of sex steroids on expression of genes regulating growth-related mechanisms in rainbow trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol 216, 103–115. [DOI] [PubMed] [Google Scholar]
  17. Duan C, Ren H, Gao S, 2010. Insulin-like growth factors (IGFs), IGF receptors, and IGF-binding proteins: roles in skeletal muscle growth and differentiation. Gen. Comp. Endocrinol 167, 344–351. [DOI] [PubMed] [Google Scholar]
  18. Fiess JC, Kunkel-Patterson A, Mathias L, Riley LG, Yancey PH, Hirano T, Grau EG, 2007. Effects of environmental salinity and temperature on osmoregulatory ability, organic osmolytes, and plasma hormone profiles in the Mozambique tilapia (Oreochromis mossambicus). Gen. Comp. Endocrinol 146, 252–264. [DOI] [PubMed] [Google Scholar]
  19. Helms LM, Grau EG, Shimoda SK, Nishioka RS, Bern HA, 1987. Studies on the regulation of growth hormone release from the proximal pars distalis of male tilapia, Oreochromis mossambicus, in vitro. Gen. Comp. Endocrinol 65, 48–55. [DOI] [PubMed] [Google Scholar]
  20. Johnsson JI, Bjornsson BT, 1994. Growth hormone increases growth rate, appetite and dominance in juvenile rainbow trout, Oncorhyncus mykiss. Animal Behav.. 48, 177–186. [Google Scholar]
  21. Kissil GW, Lupatsh I, Elizur A, Zohar Y, 2001. Long photoperiod delayed spawning and increased somatic growth in gilthead seabream (Sparus aurata). Aquaculture. 200, 363–379. [Google Scholar]
  22. Kuwaye TT, Okimoto DK, Shimoda SK, Howerton RD, Lin HR, Pang PKT, Grau EG, 1993. Effect of 17 alpha -methyltestosterone on the growth of the euryhaline tilapia, Oreochromis mossambicus, in fresh water and in sea water. Aquaculture. 113, 137–152. [Google Scholar]
  23. Le Roith D, 2003. The insulin-like growth factor system. Exp. Diabesity Res 4, 205–212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Leung TC, Ng TB, Woo NY, 1991. Metabolic effects of bovine growth hormone in the tilapia Oreochromis mossambicus. Comp. Biochem. Physiol 99, 633–636. [DOI] [PubMed] [Google Scholar]
  25. Ma W, Wu J, Zhang J, He Y, Gui J, Mei J, 2016. Sex differences in the expression of GH/IGF axis genes underlie sexual size dimorphism in the yellow catfish (Pelteobagrus fulvidraco). Sci. China Life Sci. 59, 431–433. [DOI] [PubMed] [Google Scholar]
  26. Magdeldin S, Uchida K, Hirano T, Grau EG, Abdelfattah A, Nozaki M, 2007. Effects of environmental salinity on somatic growth and growth hormone/insulin-like growth factor-I axis in juvenile tilapia, Oreochromis mossambicus. Fish. Sci 73, 1023–1032. [Google Scholar]
  27. Mancera JM, McCormick SD, 1998. Evidence for growth hormone/insulin-like growth factor I axis regulation of seawater acclimation in the euryhaline teleost Fundulus heteroclitus. Gen. Comp. Endocrinol 111, 103–112. [DOI] [PubMed] [Google Scholar]
  28. McCormick SD, 1996. Effects of growth hormone and insulin-like growth factor I on salinity tolerance and gill Na+, K+-ATPase in Atlantic salmon (Salmo salar): interaction with cortisol. Gen. Comp. Endocrinol 101, 3–11. [DOI] [PubMed] [Google Scholar]
  29. McCormick SD, Bjornsson BT, Sheridan MA, Eilertson C, Carey JB, O’Dea M, 1995. Increased daylength stimulates plasma growth hormone and gill Na+, K+-ATPase in Atlantic salmon Salmo salar. J. Comp. Physiol 165, 245–254. [Google Scholar]
  30. McLean E, Donaldson EM, 1993. The role of growth hormone in the growth of poikilotherms in: Shreibman MP, Scanes CG, Pang PKT (Eds.), The Endocrinology of Growth Development and Metabolism in Vertebrates Academic Press, New York, pp. 43–68. [Google Scholar]
  31. Moorman BP, Lerner DT, Grau EG, Seale AP, 2015. The effects of acute salinity challenges on osmoregulation in Mozambique tilapia reared in a tidally changing salinity. J. Exp. Biol 218, 731–739. [DOI] [PubMed] [Google Scholar]
  32. Moorman BP, Yamaguchi Y, Lerner DT, Grau EG, Seale AP, 2016. Rearing Mozambique tilapia in tidally-changing salinities: Effects on growth and the growth hormone/insulin-like growth factor I axis. Comp. Biochem. Physiol 198, 8–14. [DOI] [PubMed] [Google Scholar]
  33. Moorman BP, Inokuchi M, Yamaguchi Y, Lerner DT, Grau EG, Seale AP, 2014. The osmoregulatory effects of rearing Mozambique tilapia in a tidally changing salinity. Gen. Comp. Endocrinol 207, 94–102. [DOI] [PubMed] [Google Scholar]
  34. Morgan JD, Iwama GK, 1991. Effects of salinity on growth, metabolism, and ion regulation in juvenile rainbow and steelhead trout (Oncorhynchus mykiss) and fall chinook salmon (Oncorhynchus tshawytscha). Can. J. Fish Aquat. Sci 48, 2083–2094. [Google Scholar]
  35. Morgan JD, Sakamoto T, Grau EG, Iwama GK, 1997. Physiological and respiratory responses of the Mozambique tilapia (Oreochromis mossambicus) to salinity acclimation. Comp. Biochem. Physiol 117A, 392–398. [Google Scholar]
  36. Oppedal F, Taranger GL, Juell J-E, Hansen T, 1999. Growth, osmoregulation and sexual maturation of underyearling Atlantic salmon smolt Salmo salar L. exposed to different intensities of continuous light in sea cages. Aquacul. Res 30, 491–499. [Google Scholar]
  37. Pandian TJ, Sheela SG, 1995. Hormonal induction of sex reversal in fish. Aquaculture. 138, 1–22. [Google Scholar]
  38. Pavlosky KK, Yamaguchi Y, Lerner DT, Seale AP, 2019. The effects of transfer from steady-state to tidally-changing salinities on plasma and branchial osmoregulatory variables in adult Mozambique tilapia. Comp. Biochem. Physiol 227, 134–145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Peterson BC, Bilodeau-Bourgeois AL, Small BC, 2009. Response of the somatotropic axis to alterations in feed intake of channel catfish (Ictaluruspunctatus). Comp. Biochem. Physiol 153, 457–463. [DOI] [PubMed] [Google Scholar]
  40. Pierce AL, Fox BK, Davis LK, Visitacion N, Kitahashi T, Hirano T, Grau EG, 2007. Prolactin receptor, growth hormone receptor, and putative somatolactin receptor in Mozambique tilapia: tissue specific expression and differential regulation by salinity and fasting. Gen. Comp. Endocrinol 154, 31–40. [DOI] [PubMed] [Google Scholar]
  41. Rad F, Bozaoglu S, Gozukara SE, Karahan A, Kurt G, 2006. Effects of different long-day photoperiods on somatic growth and gonadal development in Nile tilapia (Oreochromis niloticus L.). Aquaculture. 255, 292–300. [Google Scholar]
  42. Riley LG, Hirano T, Grau EG, 2002a. Disparate effects of gonadal steroid hormones on plasma and liver mRNA levels of insulin-like growth factor-I and vitellogenin in the tilapia, Oreochromis mossambicus. Fish Physiol. Biochem. 26, 223–230. [Google Scholar]
  43. Riley LG, Richman NH, Hirano T, Grau EG, 2002b. Activation of the growth hormone/insulin-like growth factor axis by treatment with 17 alpha-methyltestosterone and seawater rearing in the tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol 127, 285–292. [DOI] [PubMed] [Google Scholar]
  44. Ron B, Shimoda SK, Iwama GK, Grau EG, 1995. Relationships among ration, salinity, 17 alpha-methyltestosterone and growth in the euryhaline tilapia, Oreochromis mossambicus. Aquaculture. 135, 185–193. [Google Scholar]
  45. Sakamoto T, Shepherd BS, Madsen SS, Nishioka RS, Siharath K, Richman NH 3rd, Bern HA, Grau EG, 1997. Osmoregulatory actions of growth hormone and prolactin in an advanced teleost. Gen. Comp. Endocrinol 106, 95–101. [DOI] [PubMed] [Google Scholar]
  46. Seale AP, Fiess JC, Hirano T, Cooke IM, Grau EG, 2006. Disparate release of prolactin and growth hormone from the tilapia pituitary in response to osmotic stimulation. Gen. Comp. Endocrinol 145, 222–231. [DOI] [PubMed] [Google Scholar]
  47. Seale AP, Pavlosky KK, Celino-Brady FT, Yamaguchi Y, Breves JP, Lerner DT, 2019. Systemic versus tissue-level prolactin signaling in a teleost during a tidal cycle. J. Comp. Physiol 189, 581–594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Seale AP, Riley LG, Leedom TA, Kajimura S, Dores RM, Hirano T, Grau EG, 2002. Effects of environmental osmolality on release of prolactin, growth hormone and ACTH from the tilapia pituitary. Gen. Comp. Endocrinol 128, 91–101. [DOI] [PubMed] [Google Scholar]
  49. Shepherd BS, Ron B, Burch A, Sparks R, Richman NHI, Shimoda SK, Stetson MH, Lim C, Grau EG, 1997a. Effects of salinity, dietary level of protein and 17 alpha - methyltestosterone on growth hormone (GH) and prolactin (tPRL177 and tPRL188) levels in the tilapia, Oreochromis mossambicus. Fish Physiol. Biochem 17, 279–288. [Google Scholar]
  50. Shepherd BS, Weber GM, Vijayan M, Seale AP, Riley LG, Rodriguez M, Richman III NH, Hirano T, Grau EG, 2006. Control of Growth in Tilapia: Developments and Prospects in: Webster CD, Lim CE (Eds.), Tilapias: Culture, Nutrition, and Feeding. Haworth Press, pp. 73–137. [Google Scholar]
  51. Shepherd BS, Sakamoto T, Nishioka RS, Richman NH, Mori I, Madsen SS, Chen TT, Hirano T, Bern HA, Grau EG, 1997b. Somatotropic actions of the homologous growth hormone and prolactins in the euryhaline teleost, the tilapia, Oreochromis mossambicus. Proc. Natl. Acad. Sci. U.S.A 94, 2068–2072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Singh AK, 2013. Introduction of modern endocrine techniques for the production of monosex population of fishes. Gen. Comp. Endocrinol 181, 146–155. [DOI] [PubMed] [Google Scholar]
  53. Sparks RT, Shepherd BS, Ron B, Richman NH, Riley LG, Iwama GK, Hirano T, Grau EG, 2003. Effects of environmental salinity and 17 alpha-methyltestosterone on growth and oxygen consumption in the tilapia, Oreochromis mossambicus. Comp. Biochem. Physiol 136, 657–665. [DOI] [PubMed] [Google Scholar]
  54. Stickney R, 1986. Tilapia tolerance of saline waters - a review. Prog. Fish-Cult 48, 161–167. [Google Scholar]
  55. Trewavas E, 1983. Tilapiine fishes of the genera Sarotherodon, Oreochromis and Danakilia, British Museum (Natural History) Publication number 878. Cornell University Press, Ithaca, NY. [Google Scholar]
  56. Tymchuk WE, Beckman B, Devlin RH, 2009. Altered expression of growth hormone/insulin-like growth factor I axis hormones in domesticated fish. Endocrinology. 150, 1809–1816. [DOI] [PubMed] [Google Scholar]
  57. Velez EJ, Azizi S, Millan-Cubillo A, Fernandez-Borras J, Blasco J, Chan SJ, Calduch-Giner JA, Perez-Sanchez J, Navarro I, Capilla E, Gutierrez J, 2016. Effects of sustained exercise on GH-IGFs axis in gilthead sea bream (Sparus aurata). Am. J. Physiol 310, R313–322. [DOI] [PubMed] [Google Scholar]
  58. Wood AW, Duan C, Bern HA, 2005. Insulin-like growth factor signaling in fish. Int. Rev. Cytol 243, 215–285. [DOI] [PubMed] [Google Scholar]
  59. Wu P, Bao L, Zhang R, Li Y, Liu L, Wu Y, Zhang J, He Z, Chu W, 2018. Impact of Short-Term Fasting on The Rhythmic Expression of the Core Circadian Clock and Clock-Controlled Genes in Skeletal Muscle of Crucian Carp (Carassius auratus). Genes (Basel). 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Yada T, 2007. Growth hormone and fish immune system. Gen. Comp. Endocrinol 152, 353–358. [DOI] [PubMed] [Google Scholar]

RESOURCES