Slowly folding surface extension in the prototypic avian hepatitis B virus capsid governs stability

Abstract

Hepatitis B virus (HBV) is an important but difficult to study human pathogen. Most basics of the hepadnaviral life-cycle were unraveled using duck HBV (DHBV) as a model although DHBV has a capsid protein (CP) comprising ~260 rather than ~180 amino acids. Here we present high-resolution structures of several DHBV capsid-like particles (CLPs) determined by electron cryo-microscopy. As for HBV, DHBV CLPs consist of a dimeric α-helical frame-work with protruding spikes at the dimer interface. A fundamental new feature is a ~ 45 amino acid proline-rich extension in each monomer replacing the tip of the spikes in HBV CP. In vitro, folding of the extension takes months, implying a catalyzed process in vivo. DHBc variants lacking a folding-proficient extension produced regular CLPs in bacteria but failed to form stable nucleocapsids in hepatoma cells. We propose that the extension domain acts as a conformational switch with differential response options during viral infection.

Introduction

Hepadnaviruses (hepatotropic DNA viruses) are a family of small enveloped retrotranscribing DNA viruses. In humans, chronic infections with HBV cause ~800,000 deaths per year (Report, 2017). Current therapies can control but rarely cure infection (Fanning et al., 2019; Martinez et al., 2019; Nassal, 2015). Most fundamental aspects of the hepadnaviral lifecycle such as replication of the tiny ~3 kb DNA via reverse transcription of a pregenomic (pg) RNA (Summers and Mason, 1982), or the use of a covalently closed circular (ccc) DNA form (Tuttleman et al., 1986) as episomal persistence reservoir (Nassal, 2015), were uncovered using more tractable model viruses, mostly duck HBV (DHBV) (Schultz et al., 2004), prototype of the genus avihepadnaviridae.

Despite basal similarities in genome size, genetic organization and replication strategy the avian viruses exhibit characteristic differences to human and the other mammalian HBVs (genus orthohepadnaviridae). They lack an X protein, a regulator of cccDNA transcription (Livingston et al., 2017), and a medium sized (M) envelope or surface protein besides the small (S) and large (L) forms; in addition, the avian virus surface proteins are smaller, with only three predicted transmembrane helices versus four in the orthohepadnaviruses. Particularly striking is the much larger size (~260 amino acids) of their single capsid or core proteins (CPs) which in mammalian HBVs comprise only ~180 aa. Recently discovered HBV-like viruses in distant hosts (Lauber et al., 2017) maintain this division. Most employ the small type CP but amphibian and reptilian viruses, e.g. Tibetan frog HBV (Dill et al., 2016) and lizard HBVs (Lauber et al., 2017), encode the large type CP. As the small CPs can obviously perform all essential CP functions (see below, and Venkatakrishnan and Zlotnick, 2016) the biology behind the large type CPs is enigmatic. A key step would be knowledge of their structure but, ironically, here DHBV lags much behind HBV for which various structures are available for recombinant capsid-like particles (CLPs) (Böttcher and Nassal, 2018; Böttcher et al., 1997; Conway et al., 1997; Crowther et al., 1994; Wynne et al., 1999), serum-derived nucleocapsids (Roseman et al., 2005) and virions (Dryden et al., 2006; Seitz et al., 2007).

CPs are multifunctional (Zlotnick et al., 2015; Diab et al., 2018), making the HBV CP (HBc) a prime novel antiviral target (Lahlali et al., 2018; Schlicksup et al., 2018). Most obvious is their role as the building block of the icosahedral viral capsid. Production of progeny virions during infection involves transcription from nuclear cccDNA, translation in the cytoplasm of CP, polymerase and the other viral proteins, CP phosphorylation-regulated encapsidation of a complex of pgRNA and polymerase (Heger-Stevic et al., 2018b; Zhao et al., 2018), and reverse transcription of pgRNA into relaxed circular (RC plus some double-stranded linear (dsL)) DNA. Such nucleocapsids can interact with the surface proteins to be secreted as enveloped virions. Alternatively, they may interact with nuclear import receptors to be redirected into the nuclear pore where they disintegrate (Gallucci and Kann, 2017), releasing the rcDNA for conversion into cccDNA (Nassal, 2015; Schreiner and Nassal, 2017).

How hepadnaviral CPs integrate the different interaction cues to follow one path or the other is poorly understood but must somehow relate to their three-dimensional (3D) structure. Typical small type CPs comprise an N-terminal ~140 aa assembly domain (Birnbaum and Nassal, 1990) and an arginine-rich ~34 aa C-terminal domain (CTD) whose nucleic acid binding capacity is modulated by phosphorylation (Heger-Stevic et al., 2018b; Zhao et al., 2018). Both domains are connected by an ~10 aa linker (Watts et al., 2002).

The assembly domains feature five α-helices (Figure 1—figure supplement 1). α3 and α4 form an antiparallel hairpin providing the interface for dimerization with a second subunit. The resulting four-helix bundles protrude as spikes from the capsid surface. The helix α5 plus the downstream sequence (the ‘hand region’) provide the inter-dimer contacts, mostly arranged in T = 4 icosahedral symmetry which comprises 120 Cp dimers (the minor T = 3 class encompasses 90 dimers). The asymmetric unit is composed of two dimers in spatially different surroundings with four quasi-equivalent monomer conformations, A to D (Figure 1—figure supplement 1). The first residues of the CTD are capsid-internal (Zlotnick et al., 1997) but residues past position 150 usually lack sufficient order for visualization (Böttcher and Nassal, 2018).

Early cryo-EM reconstructions of DHBc suggested a T = 4 arrangement similar to HBc CLPs but with laterally widened spikes (Kenney et al., 1995). Extensive mutagenesis led to a DHBc model (Nassal et al., 2007; Vorreiter et al., 2007) predicting an HBc-like body of dimeric assembly domains comprising the N-terminal ~180 aa, an ~80 aa CTD with a more profound morphogenetic impact than in HBc, and a much extended ~45 aa proline-rich loop (residues 78–122) connecting helices α3 and α4. However, all attempts to directly verify this model by cryo-EM reconstructions fell short of sufficient resolution. The broader distribution of DHBc vs. HBc CLPs during sedimentation in sucrose gradients and native agarose gel electrophoresis (NAGE) suggested that morphological heterogeneity obscured the data. Some DHBc variants such as R124E produced more homogeneous CLPs (termed class2 Nassal et al., 2007) but did not yield better resolved cryo-EM reconstructions. In particular, the predicted loop at the spike tips remained invisible, in line with complete disorder.

Here we discovered that over several months of storage this loop, now termed extension domain, adopted a defined fold. This enabled us to determine the structure of whole DHBc CLPs at a resolution of 3.7 Å enabling de novo model building. Functional studies revealed that the extension domain´s ability to fold is dispensable for recombinant CLP assembly but correlates with capsid stability in hepatoma cells. We propose that plasticity of the extension domain represents a large-type CP-specific evolutionary adaptation.

Results

DHBV CP (DHBc) expressed in E. coli self-assembles into CLPs which package bacterial RNA (Kenney et al., 1995; Nassal et al., 2007). Here, improved expression was achieved using vectors (Heger-Stevic et al., 2018b) with an E. coli optimized DHBc gene encoding the DHBV16 CP sequence (Uniprot accession: P0C6J7.1). CLPs for cryo-EM analysis were enriched by two sequential ammonium sulfphate precipitations (Birnbaum and Nassal, 1990) followed by sucrose gradient sedimentation (Heger-Stevic et al., 2018a; Figure 1—figure supplement 2).

After two weeks of storage at 4°C we exchanged the sucrose-containing buffer against a cryo-EM compatible buffer with low solute concentration and vitrified the samples. Micrographs showed distinct particles of spherical shape, aggregates of such particles and some proteo-liposomes (Figure 1—figure supplement 2). 2D-class averages revealed particles with protruding spikes but also particles that lacked distinct spikes or were deformed (Figure 1—figure supplement 2), indicating that only a fraction of particles had assembled into regular icosahedral capsids. The resulting 3D-map had a nominal resolution of 6.1 Å and showed capsids with an arrangement of spikes and holes resembling that of HBc-capsids with T = 4 triangulation (Crowther et al., 1994) but with 15 Å broader and 5 Å longer spikes (Figure 1—figure supplement 3). The characteristic broad spikes of the DHBc CLPs were only visible at lower density thresholds but disappeared at higher density thresholds, suggesting a markedly higher structural variability in the extensions than in the core of the spikes.

To test this hypothesis, we analysed the individual asymmetric units by 3D-classification. The class averages (Figure 1—figure supplement 3) showed 42% of asymmetric units without proper spikes and lower average density consistent with dimers either being misfolded, largely displaced or completely missing. Another third of the asymmetric units grouped into classes in which both spikes were broad, suggesting that all extension domains in the asymmetric unit were folded. The remaining 25% of asymmetric units grouped into classes with one narrow and one broad spike, consistent with folded extension domains in the broad spikes and still unfolded or flexible ones in the narrow spikes. Furthermore, the radial position of the spikes in the CLPs varied by up to 7 Å, indicating local deformations of the capsid shell.

The analysis of the individual asymmetric units required accurate determination of the orientations of an ordered asymmetric unit of only some 80 kDa, which is at the lower size limit that can be confidently analysed. We speculated that our analysis might have been limited by the imaging conditions (integrating mode, exposure <40 e/Ų), which were chosen for entire capsids (Song et al., 2019) rather than for the individual asymmetric units. Therefore, we acquired another data set at a higher dose in counting mode (Table 1). For this we prepared new grids of the CLPs that had now been stored in sucrose at 4°C for 10 months.

Table 1. Summary of image reconstruction and model building.

Sample prepared @	DHBc 2 weeks	DHBc 10 months	DHBcR124EΔ 2 weeks	DHBc+FkpA 2 weeks		DHBcR124E 3 months
Magnification	75,000
Acquisition mode	integrating mode	counting mode	Counting mode	Counting mode	Integrating mode	Integrating mode
Total exposure	39 e-/Å2	77 e-/Å2	60 e-/Å2	60 e-/Å2	40 e-/Å2	40 e-/Å2
Exposure time	3.5 s	75 s	54 s	56.6 s	2.4 s	2.3 s
Pixel size	1.0635 Å
Beam diameter	1 µm
C2 aperture	70 µm
Objective aperture	100 µm
Spot size	5	9	9	9	5	5
Number of movies per hole	2	3	2	3	3	2
Number of fractions	20	47	40	40	40	20
Number of movies	3541	2473	1496	2425	4339	1226
Defocus range	700–2200 nm	500–2100 nm	500–1300 nm	500–1600 nm	600–1900 nm	500–2000 nm
Acquisition software	EPU
Frame alignment and dose weighting	MotionCor2
CTF estimation	CtfFind4.1
Processing software	RELION3
Number of selected capsids	91,445	89,241	74,760	129,522	161,596	35,820
Capsids in final map	41,117	20,251	44,498	24,854	44,374	23,384
Resolution capsid	6.1 Å	3.7 Å	3.0 Å	4.2 Å	4.0 Å	6.0 Å
EMDB		10800	10803		10801	10802
extracted asymmetric units	2,428,920	1,215,060	2,669,880	1,210,560	2,662,440	n/a
Extracted units in final map	561,731	919,612	516,257	n/a	383,200	n/a
Resolution asymmetric unit	5.4 Å	3.0 Å	3.0 Å	n/a	3.9 Å	n/a
Model building, refinement and validation	-	Coot, Phenix, Chimera	Coot, Phenix, Chimera	-	-	-

Much to our surprise 2D-class averages showed crisper projection averages (Figure 1—figure supplement 2) and the 3D-maps of the CLPs were better resolved than before. The 3D-map of the CLPs had a resolution of 3.7 Å (Figure 1, Figure 1—figure supplement 4), but more importantly, the extension domains were clearly visible at the same threshold as the core of the spikes, indicating that during long-term storage most extension domains had become folded. To investigate the folding of individual extension domains, we analysed the asymmetric units as described above. We observed three well resolved classes with broad spikes comprising 74% of the asymmetric units (Figure 1, Figure 1—figure supplement 4), one class with broad spikes and low resolution (9% of the asymmetric units), and one class with a very low average density (18% of the asymmetric units), in line with a still significant number of missing or grossly displaced asymmetric units in the capsids. The three well-resolved classes varied in their radial position by only 2 Å with no major structural differences. Local refinement of the orientations of these particles further improved the overall resolution of the asymmetric unit to a nominal resolution of 3 Å (Figure 1—figure supplement 4) with the extension domains still less well resolved than the rest of the asymmetric unit.

Figure 1. Image reconstruction of CLPs vitrified 10 months after purification.

(a) A segment of the capsid color-coded by the radial position. The length of the color key corresponds to 6 nm. For comparison, the capsid of human HBc is shown in Figure 1—figure supplement 1. A representative micrograph and class averages are shown in Figure 1—figure supplement 2. The same sample 2 weeks after purification was less well resolved (Figure 1—figure supplement 3). Conditions for imaging and image processing are summarized in Table 1. (b) An equatorial slice through the EM-density with spikes indicated by arrows (narrow sections: filled arrowheads; wide cross sections: open arrowheads). The diffuse shell of density at the capsid interior is highlighted by a white arch. The scale bar indicates 10 nm. (c) Surface representations of 3D-class averages from the classification of the asymmetric units without alignment. The two horizontal lines indicate the same radial position and are 6 nm apart. Class 1, 2 and 4 differ in their radial positions by up to 2 Å. Class five represents holes in the CLPs. Perpendicular views are shown in Figure 1—figure supplement 4. (d) Model of the asymmetric unit of DHBc fitted into the EM-map. Chain A is shown in blue, chain B in cyan, chain C in yellow and chain D in red. The model validation is summarized in Table 2. The model also fits with the map of DHBc co-expressed with FkpA two weeks after purification (Figure 1—figure supplement 5) (e,f) Perpendicular views of the map of the CD-dimer with the model of the CD-dimer fitted. Density accounted for by the extension domain (79-119) is colored white, the core of chain C in yellow and that of chain D in red. The density at the foot of the spikes (magenta) is neither accounted by the assembly domain of chain C nor of chain D and is modelled with the most C-terminal residues.

Figure 1—figure supplement 1. Organization of HBc.

(a) Surface representation of a segment of HBc CLPs (Böttcher and Nassal, 2018), with the subunits in one asymmetric unit highlighted in color (blue chain A, cyan chain B, yellow chain C, red chain D). (b) Representation of the AB-dimer of the asymmetric unit. The naming of the helices follows Wynne et al., 1999. Inter-dimer contacts are formed between the hand-regions. Inner dimer contacts in HBc can be stabilized by a disulfide-bridge between Cys61 in HBc. (c) PFAM alignment of HBc and DHBc. The alignment corresponds to Conserved Protein Domain Family pfam00906 Hepatitis_core, except that the primary sequences were adapted (lower case green letters) to match the isolate-specific DHBc and HBc proteins used here (Uniprot IDs: P0C6J7.1 and P03146.1, respectively). Identical residues are shown in red, lower case grey letters indicate non-aligning residues. Grey bars show the positions of HBc helices α1 to α5 as in pdb: 1QGT; HBc domain borders are indicated in dark green. DHBc sequence 62–134 (highlighted in yellow) is predicted to replace HBc sequence 71–89, i.e. the spike tip comprising the C terminal part of α3, the connecting loop (the c/e1 epitope) and the N terminal part of α4. DHBc sequence 78–122 (light-green box) represents the biochemically predicted and here directly confirmed extension domain at the spike tip. (d) Conservation of the extension domain sequence among hepadnaviral large type CPs: The indicated CP sequences with their Uniprot and/or NCBI accession numbers were aligned using Clustal Omega as implemented in SnapGene v. 5. Tibet Frog c refers to one of three published Tibetan Frog HBV sequences. Conservation is indicated by colored blocks, with dark blue indicating the lowest and dark red the highest conservation. Residues differing from the consensus are shown with green background. The avian HBV CP sequences are highly similar to each other, including in the extension domain (red box around DHBV16 CP aa V77-T122). The frog virus sequence only shares some interspersed key motifs; however, the sequence predicted to align with the DHBc extension domain is also exceptionally rich in proline residues (10 in 48 aa total) which also cluster mostly in the 5'- proximal part.

Figure 1—figure supplement 2. Sample preparation and 2D-image analysis of DHBc 2 weeks and 10 months after purification.

(a) Analysis of fractions obtained by step-gradient ultra-centrifugation with native agarose gel electrophoresis with 1% agarose in 2 x TAE buffer. The staining was done with SYBR Safe (Thermo Fisher Scientific) at a dilution of 1:5.000. The position of intact DHBc CLPs is indicated by an arrow. The sizes of the DNA standard are indicated in kilo base pair (kbp). Intact DHBc CLPs have an electrophoretic mobility comparable to DNA with a size of approximately 10 kbp in TAE buffer (fractions 17–18). In the following fractions (towards higher sucrose densities) all bands become gradually diffuse and shift towards lower mobility. Additionally, an increasing amount of proteins is aggregated and stuck in the wells of the agarose gel. (b) The same fractions were subjected to SDS-PAGE with 15% acrylamide and stained with Coomassie Brilliant Blue. The position of DHBc (30 kDa) is indicated by an arrow. (c, d) DHBc after 2 weeks storage. (c) A typical micrograph shows aggregated CLPs (some labelled with ‘A’) and lipid vesicles (some labelled with ‘L’). The scale bar indicates 100 nm. (d) Selected class averages of CLPs vitrified 2 weeks after purification. Most CLPs fall into one size class. Some class averages represent deformed CLPs (‘#”) and some are consistent with a smaller size class (‘*”). The scale bar in (d) indicates 10 nm. (e,f) Typical micrograph (e) and selected class averages (f) of DHBc after 10 months of storage. Class averages of particles vitrified 10 months after purification are better resolved than CLPs vitrified 2 weeks after purification and show projections of secondary structural elements in 2D-class averages. (g,h) Typical micrograph (g) and selected class averages of DHBc co-expressed with the peptidyl-prolyl cis-trans isomerase FkpA after 2 weeks of storage. The class averages are better resolved than DHBc CLPs without co-expressed FkpA after 2 weeks of storage. (i,j) Typical micrograph of DHBc-R124E-Δ i and typical class averages j. (k,l) Typical micrograph of DHBc-R124E (k) and typical class averages (l).

Figure 1—figure supplement 3. Reconstruction of CLPs vitrified 2 weeks after purification.

(a) Surface representation color-coded by the radius. The right front quarter of the CLP is not shown giving a view to the interior of the CLP at the left side. (b) Equatorial slice through the capsid. The scale bar indicates 10 nm. (c) Surface representations of 3D-classes of the asymmetric units of CLPs. The asymmetric units were classified without further alignment thus classes can also represent positional variability relative to the expected position in the capsid. The horizontal lines indicate the same radial position in the capsid. All surfaces were calculated at the same density threshold. The relative occupancies of the classes are indicated. Classes 1, 2, 6 and 8 show a weaker than expected density probably representing holes or grossly misplaced subunits. Classes 3 and 5 show one wide and one narrow spike. Classes 4 and 7 show two wide spikes.

Figure 1—figure supplement 4. Resolution of DHBc CLPs.

(a) Fourier shell correlation after gold standard refinement and masking for the asymmetric unit of DHBc prepared after 10 months (solid black line) and for the CLPs (dotted line). The FSC threshold of 0.143 for quoting the resolution is shown as thin black line. (b) Representation of selected side chain density of α4 in, at the N-terminus and in the extension domain highlighting the quality and local variation in resolution of the map. (c) Two perpendicular views of the 3D-map of the asymmetric unit after local orientational refinement of the particles of classes 1, 2 and 4 in (e). The color-coding represents the local resolution and is lowest in the extension domain. (d) Two perpendicular views of the model of the asymmetric unit of DHBc colored with the local B-factors calculated during Phenix ADP-refinement. The extension domains have the highest local B-factors, which matches the low local resolution in this region. The color key is given below. The absolute numbers for the B-factors are somewhat arbitrary and depend on the B-factor used for map-sharpening during post-processing in RELION. (e) Surface representations of 3D-class averages from the classification of the asymmetric units without alignment. Class 1, 2 and 4 show broad spikes. Class five represents holes in the CLPs. The views are perpendicular to those shown in Figure 1.

Figure 1—figure supplement 5. DHBc CLPs with co-expressed FkpA.

(a) Fourier Shell Correlation of maps of DHBc co-expressed with FkpA. The plots represent different maps of CLPs reconstructed from micrographs acquired from the same grid either in counting mode (magenta) or in linear mode (red and blue). Reconstructions in linear mode were calculated from the full data set (4039 movies, blue) or from the 1^st part of the data acquisition (2038 movies, red). Reconstructions in counting mode were calculated from 2425 movies and had the same overall resolution (4.2 Å, magenta) as data acquired in linear mode from the first part of the acquisition with a similar number of micrographs (for more details on imaging see Table 1). This comparison suggests that the resolution of the final maps was not limited by the image acquisition mode, similar as reported earlier for HBc (Song et al., 2019). Doubling the data by approximately a factor of two in linear mode increased the resolution only slightly from 4.2 Å to 4 Å. The best resolved 3D-map of the CLPs of DHBC+FkpA from all movies acquired in linear mode is shown as surface representation of the B-factor sharpened map in (b) and as equatorial slice of the none-sharpened map in (c). The surface representation in (b) is color-coded by the radius as indicated by the color key. The length of the color key corresponds to a length of 6 nm. In the equatorial slice in (c) the arch indicates the approximate position of diffuse density that is mainly attributed to RNA. The similar resolution and quality of the 3D-maps from counted and linear data indicated that the limited resolution of wt DHBc prepared after two weeks is most likely a property of the sample and not related to the imaging conditions (linear, 40 e^-Ų). (d-g) Analysis of the asymmetric unit of DHBc+FkpA for the counted data (classification shown in d and e) and for the linear data (best class shown in f and g). Both classification gave similar results. Surface representations calculated at the same threshold of the 3D-class averages of the counted data are shown in (d) and (e). The views in (d) and (e) are perpendicular to each other. Class1 and class 3 (38% of all asymmetric units, both 7.2 Å resolution) represented mainly holes or grossly displaced subunits. Class two was poorly resolved (15% of all asymmetric units, 6.2 Å resolution). Classes 4 and 5 (45% of all asymmetric units, 4.9 Å and 5.7 Å resolution respectively) were better resolved but had a relative radial displacement of 3 Å, which is larger than for the 10 months old DHBc CLPs (2 Å displacement) but significantly smaller than the 7 Å displacement of the 2 weeks old CLPs without co-expressed FkpA (Figure 1—figure supplement 3). Classes 4 and 5 both showed broad spikes indicating folding of the extension domain. We did not observe any classes showing consistently narrow spikes as we had observed for the 2 weeks old CLPs without co-expression of FkpA. For the best class of data acquired in linear mode, we locally refined the orientations of the asymmetric unit. The resulting 3D-map with the fitted model of the 10 months old DHBc is shown in (f and g) in two perpendicular views of the same map/model. This 3D-map has a resolution of 3.9 Å (see (a), green plot). In conclusion, data acquired in linear mode at a lower dose has a sufficient signal-to-noise-ratio to analyze the individual asymmetric units of the CLPs.

We were able to build a de novo model of DHBc’s assembly domain into the 3D-map of the asymmetric unit of DHBc (Figure 1, Figure 1—figure supplement 4, Table 2). All four subunits of the asymmetric unit had the same overall fold with adaptations to the different spatial surroundings close to the N-termini and in the C-terminal hand regions (Figure 2a–c). The core of the spikes was formed by four helices, with each DHBc monomer contributing an ascending helix (α3; residues 44–78, 35 aa) and a descending helix (α4; residues 120–157, 38 aa). The ascending helix α3 was kinked in the center between F60 and W61 and tilted away from the dimer axis in the upper part of the spike. The helices were considerably longer than in HBc (Figure 3 and Figure 3—figure supplement 1), where α3 is straight (25 aa) and α4 is kinked (31 aa). The four helices of the spike of HBc and DHBc had a very similar packing below the kink (Figure 3) but diverged above the kink with a different twist of the helices around each other (Figure 3). At the tips of the spikes the positions of the helices were dramatically different, basically swapping the positions of DHBc α3 with HBc α4 in the same subunit and of DHBc α4 with HBc α3 between different subunits of the dimer. Moreover, DHBc helices α3 and α4 were connected through a 41 aa long extension domain (residues 79–119, Figure 2g) whereas in HBc this connection is just a short loop of 3–4 aa. The extension with two short helical segments (αe1: 92–99; αe2: 103–117), was positioned at the side of the spike close to α4 of the same subunit and in contact with α3 of the other subunit (Figure 2e). As independently confirmed below, the packing of the extension domain to the flank of the spike was stabilized by a salt bridge between R124 in α4 of the core spike and E109 in αe2 of the extension domain (Figure 2—figure supplement 1).

Table 2. Validation of models.

	DHBc	DHBcR124E∆
Non-hydrogen atoms	6485	5122
Modelled residues	790	633
Average B factors (Å2) model	63	121
FSC0.5 Mapmasked vs Model	3.9 Å	3.1 Å
MolProbity score	1.44	1.24
Clashscore	7	5
Rotamer outliers (%)	0	0
RMSD Bond lengths (Å)	0.003	0.0028
RMSD Bond angles (°)	0.41	0.42
Ramachandran Outliers (%)	0	0
Ramachandran Allowed (%)	4	4
Ramachandran Favored (%)	96	96
PDB	6ygh	6ygi

Figure 2. Structural model of DHBc.

(a-c) Superposition of the four subunits in the asymmetric unit (chain A: blue, chain B: cyan, chain C: yellow, chain D red). The helices in the extension domain are labelled αe1 and αe2. All four subunits show the same overall fold with deviations in the hand-region (a); arrow) and at the N-terminus (c); arrow). (d) View of the CD-dimer perpendicular to the dimer axis, with the CD dimer. The C-terminus (250-262) is shown in magenta. The intra-dimer contact is stabilized by hydrophobic interactions between F60 and H52 in opposing CPs (Figure 2—figure supplement 2) (e) View of the CD-dimer along the dimer axis with the last resolved C-terminal residues of the dimer, the position of the N-termini and the position of the extension domain indicated. (f) Chain C with the extension domain in brown and the prolines in the extension domain in black. R124 and E109, forming the stabilizing salt bridge in the extension domain, are shown in ball representation (Figure 2—figure supplement 1 for a close-up of the salt-bridge together with the EM-map). (g) Extension domain of chain C (78-121). The eight prolines are highlighted in black and the side chains of the six glutamates are indicated.

Figure 2—figure supplement 1. Stabilizing Elements of Extension domain.

(a) R124 in α4 of the core spike and E109 in αe2 in the extension domain form a salt bridge, which is visible as continuous density in the EM-map of DHBc (wire representation). The close-up shows chain C. (b) H107 in αe2 forms a hydrophobic interaction with I99 in αe1 and thus stabilizes the fold of the lower part of the extension domain.

Figure 2—figure supplement 2. Intra-dimer contact (a) Close-up of the center of the CD-spike perpendicular to the dimer axis and (b) along the dimer axis.

The inner dimer contact is stabilized by stacking of Phe60 and His52 in α3 with the same residue of the opposite subunit. Chain C is shown in sallow and chain D in red.

Figure 3. C-terminus of DHBc CPs and the N-terminus of HBc occupy the same site.

(a) The AB-dimers of HBc (pdb: 6HTX Böttcher and Nassal, 2018) and b of DHBc in the same orientation. For clarity the extension domain (78-120) is not shown. Large-type and small-type CPs show a structurally conserved hand region and lower spike arrangement with an RMSD of 1.9 Å (Figure 3—figure supplement 1). Major differences are the packing of the four helices in the upper part of the spike and the site at the base of the spikes. This is occupied either by the 12 N-terminal residues of chain A of HBc or by the 12 C-terminal residues of DHBc (magenta). The protruding tip of the extension domain in one CP of DHBc provides a similar structural environment as the tips of the spikes in a CP dimer of HBc (Figure 3—figure supplement 2).

Figure 3—figure supplement 1. The fold of the lower part of HBc and DHBc CPs have an RMSD of 1.9 Å.

Chain C of HBc and DHBc were superposed with the match align tool of Chimera. The 113 matching amino acids (light blue for DHBc and light red for HBc) had an overall RMSD of 1.9 Å. The none-matching parts (red for HBc and blue for DHBc, RMSD >5 Å) cluster to the upper half of the spike and at the N-terminus. (a and b) show two different views which are related by 90° rotation around the vertical axis.

Figure 3—figure supplement 2. The extension domain of DHBc provides a similar structural environment as the tips of the spikes in HBc.

The tips of the AB-dimer of HBc (6HTX, residues 73–83 of chains A and B, blue and cyan) were fitted as rigid body to the two extension domains in a DHBc-dimer. The map is the same as shown for the asymmetric unit in Figure 1—figure supplement 4 but without B-factor sharpening. (a) Shows a view parallel to the dimer axis and (b) perpendicular to the dimer axis.

Analysis with Intersurf (Ray et al., 2005) showed that the extension domain increased the inter-dimer surface area from ~1,900 Ų to ~3,400 Ų, highlighting its important contribution to the intra-dimer contact. Nonetheless, the absence of folded extension domains from many spikes in freshly prepared CLPs implied that its contribution is not strictly required for capsid formation and stability, as directly addressed below.

In HBc which lacks an extension domain a disulphide-bridge between Cys61 on opposite monomers (Figure 1—figure supplement 1) can add to dimer stabilization (Nassal et al., 1992). DHBc lacks a homologous Cys residue; instead at a similar position in the spike Phe60 made a π-stacking interaction with Phe60 on the other monomer, and so did His52 with His52 (Figure 2—figure supplement 2). Another difference between HBc and DHBc was the position of the N-termini. In HBc the N-terminus is located at the dimer interface at the base of the spikes and contributes to the intra-dimer contact (Wynne et al., 1999). In DHBc the seven N-terminal residues pointed towards the lumen of the capsid, without contributing to the intra-dimer contact (Figure 2c). Interestingly, the two N-termini within one dimer had different orientations, with those of chains B and C directed towards the base of the spike and those of chains A and D pointing away (Figure 2).

The pockets at the base of the spikes close to the N-termini of chains A and D contained density that was not accounted for by the so far described model (Figure 1e,f magenta). This density resembled a short peptide and was modelled with the 13 very C-terminal residues 250–262. In the other two pockets similar albeit weaker density accounted for the 6 C-terminal residues (257-262). As the connecting residues to the assembly domain were unresolved the C-termini could not be assigned to a specific subunit. Overall, the C-termini appear to take a similar structural role in DHBc as the N-termini do in HBc (Figure 3).

While the intra-dimer contacts differed significantly between HBc and DHBc, the inter-dimer packing in the C-terminal hand-region was largely conserved. The last resolved residues in our model agreed well with the biochemically derived C-terminal border of the DHBc assembly domain around position 187 (Nassal et al., 2007). At the given resolution, the fold of the hand-region was similar to that of HBc (Figure 2d) as it maintained the length of the α5 helix and the distance to the adjacent extended stretch. Overall, the RMSD between HBc and DHBc of the hand-region and the part of the spike below the kink and the fulcrum is 1.9 Å, further highlighting the preservation of the whole shell-region of the capsids (Figure 3—figure supplement 1). Consistent with the preserved inter-dimer contacts, the radius of inner and outer surface of the protein shell and the distance to a diffuse density shell in the interior of the capsid that is attributed to RNA and unresolved parts of the CTDs (Figure 1b) was the same in DHBc and HBc.

Slow folding of the DHBc extension domain likely correlates with X-Pro bond isomerization

The unusually high proline content in the extension domain (Figure 2g, Figure 1—figure supplement 1c,d) suggested a cis-trans isomerization of one or more of the respective X-Pro bonds as a potentially rate-limiting step in folding of the extension domain, as it is in various proteins (Dunyak and Gestwicki, 2016). To test this hypothesis we co-expressed DHBc with a cytoplasmic version of the peptidyl-prolyl cis-trans isomerase FkpA, which catalyses cis-trans isomerization at prolines in E. coli. After 2 weeks of storage in sucrose at 4°C the respective CLPs were prepared for cryo-EM. These CLPs displayed similar overall heterogeneity as CLPs without co-expressed FkpA (Figure 1—figure supplement 2). However, image reconstruction revealed many CLPs with folded extension domains and better resolution (4 Å resolution, Figure 1—figure supplement 5, Table 1) than seen with the short-term stored CLPs expressed without FkpA (6.1 Å resolution). Analysis of the asymmetric unit did not yield any evidence for unfolded extension domains (Figure 1—figure supplement 5). These observations support our hypothesis that cis-trans isomerization of proline is at least one of the rate-limiting steps in the structural maturation of DHBc CLPs.

Order versus disorder in the DHBc spike tip is controlled by electrostatic interactions

The R124E mutation, like a few others, had previously been shown to increase CLP homogeneity in terms of sedimentation profile and NAGE mobility (Nassal et al., 2007) compared to wt DHBc CLPs; these biochemical phenotypes were referred to as class1 for wt DHBc and class2 for R124E. As the mutation reverses the sidechain charge from positive (R124) to negative (E124) an electrostatic interaction with a nearby acidic sidechain appeared plausible. Based on our structural model, R124E resides shortly after the start (P120) of helix α4 (Figure 2). The closest residues in space are E109 and E110 in the extension domain. When additional mutants at these positions were assessed for sedimentation and NAGE mobility (not shown) variant E109R produced a sharp R124E-like band while E110R, like R124K, showed a more WT-like fuzzy appearance. Furthermore, the double mutant E110R_R124E maintained the class 2 R124E phenotype but combining the two class2 mutations R124E and E109R in one protein (E109R_R124E) switched the profile to class1. No such switch was seen when R124E was combined with an unrelated class2 mutant, i95, which bears a five aa insertion at position 95. Together these data indicate that a salt-bridge between R124 in the spike core helix α4 and E109 in the extension domain helix eα2 is crucial for the WT-DHBc CLP phenotype. They also suggested that the more distinct behavior of the class2 CLPs relates to an inability of the mutated extension domains to properly fold.

The DHBc extension domain is dispensable for recombinant CLP assembly

The low folding propensity of the extension domain questioned a direct role in capsid assembly. We therefore replaced residues 78–122 by a short G₂SG₂ linker and evaluated the consequences on assembly and particle morphology. The corresponding protein, DHBc_Δ78–122, was virtually insoluble; however, solubility was drastically improved by the additional mutation R124E (DHBcR124EΔ). Sedimentation, NAGE and negative staining EM data all indicated the formation of orderly CLPs, prompting a closer look by cryo-EM image (Figure 1—figure supplement 2) reconstruction. The resulting density maps at 3 Å resolution (Figure 4, Figure 4—figure supplement 1, Figure 1—figure supplements 4 and 5) revealed the same architecture as in the wt DHBc particles, except that all spikes remained narrow as also confirmed by the asymmetric analysis (Figure 4—figure supplement 1). Also, the fold of the subunits in the asymmetric unit was nearly superimposable on that of the full length protein subunits with an RMSD of 0.6 Å, except for the missing sideward pointing density. This missing density was accounted for by the 45 amino acids of the deleted extension domain whereas the flexible G₂SG₂ linker was not resolved. Difference mapping confirmed that all density differences between full length and internal deletion variant localized to the extension domain which therefore behaves much like an independent internal appendix.

Figure 4. 3D-map of extension-less variant DHBc_Δ78–122 R124E (DHBcR124EΔ) in comparison to DHBc.

(a) Segment of the DHBcR124EΔ capsid colored by the radial position. The Fourier-Shell correlation and local resolution analysis is shown in Figure 4—figure supplement 1. (b) Equatorial slice through the EM-density of DHBcR124EΔ. All spikes show narrow cross sections (arrows). A shell of diffuse density underneath the protein shell is highlighted by a white arch. (c) Close-up along the two-fold symmetry axis of a surface representation of DHBcR124EΔ (left) and DHBc (right) color-coded with the differences between the two maps. The color key is given below. Positive densities (additional density in DHBc) are shown in red and negative densities in blue (additional density in DHBcR124EΔ. (d) Model of DHBc (grey) and DHBcR124EΔ in color: chain A blue, chain B cyan, chain C yellow, chain D red are superposed). The common cores of DHBc and DHBcR124EΔ are virtually indistinguishable with an overall RMSD of 0.6 Å. The G₂SG₂ linker that replaces the extension domain in DHBcR124EΔ is unresolved.

Figure 4—figure supplement 1. Structural characterization of DHBcR124E and DHBcR124EΔ.

(a) Fourier Shell correlation after gold standard refinement of DHBCR124E. The dashed, grey line indicates a Fourier-Shell Correlation of 0.143, which was used as threshold for determining the resolution of 6 Å. (b) Close-up of the surface representation of the image reconstruction of DHBcR124E showing narrow spikes. The surface is colored according to the radius as indicated by the color key. The length of the color key indicates 6 nm. (c) Equatorial slice of the image reconstruction in (b). There is no density visible for the extension domain indicating high flexibility. The scale bar indicates 10 nm. (d) Analysis of DHBcR124EΔ CLPs: Fourier Shell Correlation of CLPs of DHBcR124EΔ after gold standard refinement. The dashed line indicates a FSC of 0.143. The FSC-curve falls below the 0.143 threshold at a spatial frequency of 1/3 Å. (e) Selected areas of the map and model to highlight the quality of the side chain density. (f) Model of DHBcR124EΔ colored with the local B-factors from ADP-refine of Phenix. The color key is given below. The tips of the spikes have much higher B-factors than the rest of the subunit, suggesting high flexibility of the upper part of the helical bundle preceding the G₂SG₂ linker. (g) Surface representations of 3D-class averages from classification of the asymmetric units. All class averages are represented with the same density threshold. Class number and relative class occupancy are given below. At the chosen threshold Class5 shows no density and is indicative of holes at the respective regular positions in the capsids. Class1 (3.4 Å resolution) and class2 (3.3 Å resolution) are somewhat less dense than class3 (3.2 Å resolution) and class4 (2.9 Å resolution). The radial displacement between the four classes is less than 1 Å.

Folding competence of the DHBc extension domain is critical for capsid stability in eukaryotic cells and hence viral replication

To reveal a potential virological relevance of the extension domain we examined the impact of extension domain-affecting mutations on capsid expression, viral nucleic acid packaging and reverse transcription in transfected LMH cells, an avian hepatoma line supporting formation of infectious DHBV (Condreay et al., 1990; Dallmeier et al., 2008). Most variants, including the additional mutant R124Q, were tested by trans-complementation of a cloned CP-deficient DHBV16 genome (pCD16_core^-) with the respective DHBc protein expressed from a separate plasmid vector. This excludes inadvertent effects on the virus genome. Mutant E109R_R124E was also tested in the cis-context. Controls included the non-complemented core^- genome and a variant with a mutated YMDD motif in the polymerase active site (pCD16_YMhD), allowing pgRNA encapsidation but not reverse transcription (Radziwill et al., 1990). By NAGE assay of cytoplasmic lysates and subsequent anti-DHBc immunoblotting (Figure 5a) the pCD16 constructs wt, YMhD and E109R_R124E, but not the core-deficient vector, produced similarly intense capsid signals whose mobilities matched those of the recombinant CLPs (lanes 16–19). Comparable signals were generated in the trans-format yet only with wt DHBc and mutants R124K, E109R_R124E and E110R. Variants R124Q, E109R, R124E and i95 gave very weak or no signals at all. Intriguingly, all these variants had exhibited the more homogeneous class2 phenotype when expressed in bacteria. Of the extension-less variants only Δ78–122_R124E produced specific though weak signals (Figure 5—figure supplement 1). To get more insight into the low or lacking capsid signals we repeated the pCD16_core^- cotransfections with variants R124E, Δ78–122_R124E, and E109R_R124E (including at a five-fold reduced plasmid amount) versus wt-DHBc, which reproduced the previously seen NAGE blot data for capsids and capsid-borne DNA (Figure 5—figure supplement 2a,b). This time, however, we additionally addressed non-assembled CP subunits, employing immunoprecipitation (IP) with a polyclonal anti-DHBc antiserum (12/99, Vorreiter et al., 2007) to enrich DHBc-related proteins from lysates of the transfected cells, followed by SDS-PAGE separation of the immunopellets and immunoblotting, again with the polyclonal antiserum; lysate from cells transfected with a GFP expression vector served as control. All DHBc transfected samples produced specific signals with the same mobility as the recombinant full-length proteins (Figure 5—figure supplement 2c); the Δ78–122_R124E band was weak, and thus consistent with the weak NAGE blot capsid signal. Strikingly, however, the R124E sample presented with a whole ladder of smaller products which in sum by far exceeded the left-over full-length band. Hence, the 124E mutation markedly enhances proteolytic susceptibility of the variant and concomitantly impedes its ability to form stable capsids in avian hepatoma cells.

Figure 5. Opposite charges at DHBc positions 109 and 124 warrant stable capsid formation in hepatoma cells.

(a) Capsid formation. Cytoplasmic lysates from LMH cells transfected with the indicated constructs (pCD16: mutations present in cis; pCD16_core^- + trans-DHBc: core-deficient DHBV genome co-transfected with DHBc vectors) were analyzed for capsid formation by NAGE and anti-DHBc immunoblot; recDHBc, E. coli derived CLPs. All samples except i95 -Nuc and WT -Nuc (lanes 14, 15) were treated with micrococcal nuclease to destroy non-packaged nucleic acids prior to NAGE. (b) Viral nucleic acid encapsidation. Cytoplasmic lysates separated as in (a) were examined by hybridization with a ³²P-labeled DHBV probe after opening the blotted capsids via alkali treatment for 15 s (leaving RNA and DNA intact) and, thereafter, for 15 min (hydrolyzing RNA but not DNA). Signals from pCD16_YMhD (encoding a reverse transcription-deficient polymerase) and trans-DHBc E110R (lanes 2, 10; marked by **) showed strong and moderate, respectively, reductions upon longer treatment. ^§ in lane one indicates poor transfer of the left part of the main band. (c) Absence of grossly aberrant reverse transcription products. DNAs from cytoplasmic capsids were analyzed by Southern blotting using the same probe as in (b). Labels WT vs. WTopt refer to the DHBc nucleotide sequence from DHBV16 vs. that from the E. coli optimized vectors. The presence of signals for DHBc_R124Q and E109,110R_R124E likely relates to the larger input of capsids for Southern blotting than for NAGE. M1-M3, marker DNAs; pla., pCD16 plasmid. The complete blot is shown in Figure 5—figure supplement 1.

Figure 5—figure supplement 1. Extension-less DHBc variants fail to support stable nucleocapsid formation in hepatoma cells.

(a) NAGE capsid immunoblot. LMH hepatoma cells were co-transfected with the core-deficient DHBV vector pCD16_core^- plus expression vectors for wt-DHBc or the extension-less variants DHBc_ Δ78–122_R124E (well expressed in E. coli but insoluble) or DHBc_ Δ78–122_R124E (well expressed in E. coli as soluble CLPs; Figure 4 and S2, S6). Formation of cytoplasmic capsids was analyzed by NAGE immunoblot as in Figure 5a, using the polyclonal rabbit anti-DHBc antiserum 12/99 which recognizes various avihepadnavirus core proteins (Vorreiter et al., 2007), followed by a peroxidase-conjugated secondary antibody and a chemiluminescent substrate. Despite long exposure only a very faint smear was detectable for variant Δ78–122_R124E. The signal from variant Δ78–122_R124E was stronger but still much weaker than that from wt-DHBV transfected cells. (b) Southern blot. The figure shows the complete version of the Southern blot from Figure 5, where lanes 9 and 12–14 loaded with redundant samples from repeat experiments (grey lettering, with labels b,c) had been spliced out. As variant Δ78–122_R124E did not form detectable capsids the lack of viral DNA is unsurprising. For variant Δ78–122_R124E the data suggest that if the weak immunoblot band in (a) represents true capsids they are defective in pgRNA packaging and/or reverse transcription.

Figure 5—figure supplement 2. Lack of stable capsid formation by variant DHBc_R124E in hepatoma cells correlates with increased proteolytic sensitivity.

LMH cells were cotransfected, in 10 cm dish format, with pCD16_core- and the indicated trans-DHBc constructs; for sample E109R_R124E lo only one fifth the amount of plasmid DNA was used. For sample GFP cells were solely transfected with the GFP vector pTRUF5. On day four post transfection cells were lysed using 750 µl lysis buffer containing NP40 detergent and protease inhibitor cocktail (Complete, EDTA-free; Roche). (a) NAGE capsid immunoblot. 20 µl of each lysate were analyzed by NAGE and immunoblotting as in Figure 5a. (b) NAGE capsid-DNA blot. 20 µl of each lysate were analyzed for capsid-borne DHBV DNA as in Figure 5b. (c) Steady-state levels and integrity of DHBc proteins irrespective of their assembly status. To enrich DHBc proteins, 400 µl of each lysate were subjected to immunoprecipitation using polyclonal rabbit anti-DHBc antibodies (rabbit serum 12/99, Vorreiter et al., 2007) immobilized on Protein A sepharose beads (GE Healthcare); after extensive washing the beads (about 40 µl gel bed each) were boiled with 80 µl SDS-containing sample buffer and 20 µl thereof were separated by SDS-PAGE (15% polyacrylamide), transferred to PVDF membrane and detected using the same polyclonal antiserum followed by an Fc-specific anti-rabbit IgG peroxidase conjugate and a chemiluminescent substrate. Approximately 30–50 ng of the indicated recombinant DHBc proteins served as markers. The 55 kDa band in the cell culture samples represents the heavy chains of the IP antibodies. The weak bands below the 25 kDa marker position (arrowheads) were present in all IP samples, including the GFP-only transfected lysates; hence they are not DHBc-specific. Note the multiple faster migrating DHBc-specific bands exclusively in the R124E sample (lane 2**), indicative of a much increased proteolytic sensitivity caused by the mutation.

To reveal capsid-borne viral nucleic acids a parallel NAGE blot was hybridized with a ³²P-labeled DHBV DNA probe, after breaking up the blotted capsids by brief exposure to 0.1 N NaOH; this leaves both RNA and DNA intact. All capsid-positive samples, except the recombinant non-viral RNA containing CLPs, scored positive in this assay (Figure 5b, top). Longer NaOH treatment ablated the signals for sample pCD16_YMhD and reduced it for DHBc_E110R (Figure 5b, bottom), in line with an exclusive and partial RNA content, respectively. Persistence of the other signals indicated they were DNA. A more sensitive Southern blot assay revealed in all these variants a wt-typical pattern of rc-DNA and dsL-DNA (Figure 5c). Such signals were also faintly visible for R124Q and the triple variant E109,110R_R124E but not for variant Δ78–122_R124E. In sum, only variant R124K preserving the positive charge, and the charge-polarity reversing variant E109R_R124E maintained an in all aspects wt-like replication phenotype (Figure 5c and Figure 5—figure supplement 1). Hence opposite charges at positions 109 and 124 and the extension domain´s ability to fold are critical for virus replication.

Discussion

Despite DHBV's long history as hepadnaviral model virus, knowledge of its structural biology has lagged behind that of HBV. Our EM-map of the DHBc CLP at 3.7 Å and of the DHBc_Δ78–122_R124E CLP at 3 Å resolution allowed us for the first time to build de novo models of DHBc’s assembly domain. Confirming selective aspects of evolutionary conservation between avi- and orthohepadnaviruses (Kenney et al., 1995), the new data also reveal unique structural modules, including a direct contribution of the very C-terminal residues to the capsid shell and a centrally inserted extension of ~45 aa that behaves like an independent folding entity.

Conserved and unique structural features in DHBc versus HBc capsids

In line with earlier data (Kenney et al., 1995; Nassal et al., 2007; Vorreiter et al., 2007) the major type of DHBc CLP conformed to the clustered-dimer T = 4 architecture known from HBc. The last resolvable contiguous chain residues around position 190 match the biochemically derived end of the assembly domain (Nassal et al., 2007). Without the extension domain this length corresponds well with the ≥140 aa of the HBc assembly domain, and so does its basic fold comprising five α-helices. As in HBc, α3 and α4 constitute major parts of the intra-dimer interface with another large contribution from the folded extension domain. α3 and α4 are slightly longer in DHBc than in HBc and they differ in tilt and twist. Therefore the structure of the CPs diverges in the protruding spikes while the basic architecture is similar in the actual capsid shell including the inter-dimer contacts, mainly provided by helix α5 and the downstream sequence that folds back on it. Notably, this helical framework forms independently of the extension domain (Figure 4).

In HBc the N-terminal residues 1–5 embrace the base of the half-spike formed by the partner subunit in the dimer and contribute to the intra-dimer interface. In DHBc the respective positions are occupied by the C-terminal residues 250–262 while the N-termini point towards the particle lumen (Figure 3, Figure 3—figure supplement 1). This places the C-termini at a strategic position to adopt a capsid-external disposition, e.g. for exposure of nuclear localization signals, and antibodies against the C-terminal residues of DHBc can precipitate entire capsids (Schlicht et al., 1989). However, our analysis of the asymmetric units in DHBc capsids did not show evidence of individual C-termini protruding further to the outside. A similar, albeit less exposed position of the C-termini underneath the base of the spikes has been observed for HBc, yet also without direct structural evidence of further externalization (Böttcher and Nassal, 2018). A structural role of the DHBc C-terminus is further supported by the variety of particle morphologies that result from C-terminal truncations (Nassal et al., 2007). Whether the DHBc sequence from positions 190 to 250 has a specific morphogenic role remains to be determined; plausibly it contributes together with packaged RNA to the ring-like capsid-internal density (Figure 1, Figure 1—figure supplements 3 and 4, Figure 4, Figure 4—figure supplement 1).

A temporarily mobile spike extension - defining feature of hepadnaviruses employing large type CPs?

The most distinctive feature in DHBc vs. HBc are the large extensions at the tips of the spikes that comprise residues 79–119, in line with the biochemical prediction (Nassal et al., 2007) and directly supported by the structure of the extension-less Δ78–122_R124E CLPs (Figure 4). The extension sequence is unusually rich in P (8 of 45 aa, Figure 2) and E residues (6 of 45 aa), the two most disorder-promoting amino acids (Theillet et al., 2013; Uversky, 2013). Notably, P79/P80 and P117/P120 at the borders of the extension domain are ideally located to insulate it from the spike-forming four-helix bundle (Figure 2). These features are preserved in the CPs of diverse other avian hosts (Figure 1—figure supplement 1). Non-avian hosts with large-type CPs such as the 266 aa sequence of the Tibetan frog HBV CP diverge at many positions. Yet, the sequence aligning to the DHBc extension domain also has a very high proline content (10 of 48 aa; Figure 1—figure supplement 1), indicating evolutionary conservation of this feature over millions of years. We therefore expect that the fundamental structural aspects of the DHBV capsid revealed in this study are prototypical for all hepadnaviruses employing the large-type CPs. The plasticity of the extension domain is also reflected by local resolution analysis and high local B-factors in the model (Figure 1—figure supplement 4). Also the spike tips in HBc have high local B-factors (Böttcher and Nassal, 2018), perhaps in both cases facilitating induced-fit interactions, e.g. with the envelope proteins, which for DHBV might be more akin to a folding-by-binding process (Weng and Wang, 2020). Notably, the structure of one HBc spike tip fits well into the DHBc extension domain emerging from the core-spike which provides two such sites per spike (Figure 3—figure supplement 2). Thus, large-type CPs could have evolved two surface protein binding sites per spike in the extension domains, compared to only one in small-type CPs. This coincides with a generally smaller membrane part of the surface proteins in hepadnaviridae with large-type CPs allowing for more surface proteins per area of envelope.

Despite its disposition for disorder, the extension domain in wt DHBc can adopt a stably folded state, albeit very slowly in vitro. The time-scale in live cells is unknown but in sum our data favour that assembly of the capsid shell precedes folding of the extension domains. Assembly can occur in the complete absence of the extension domain, and CLPs with permanently disordered extension domains, such as R124E, present with more homogeneous morphologies than those from wt DHBc. Hence the large contact area to the intra-dimer interface that forms upon folding of the extension domain may even disfavour regular icosahedral assembly; conversely, the requirement for a folding helper would increase the time-span for undisturbed assembly. Thereafter, extension domain folding provides extra stability to the assembled structure. As a resolution of around 7 Å is sufficient to distinguish folded from unfolded extension domains, defining their states in various stages of the viral life-cycle, including in enveloped virions, appears worthwhile and feasible.

Based on the high density of prolines in the extension domain we expect the folding helper to be a peptidyl-prolyl cis-trans isomerase, as is supported by the higher frequency of DHBc CLPs with folded extension domains upon coexpression of E. coli FkpA. From such activity of a bacterial enzyme it appears unlikely that a specialized isomerase is required in DHBV host cells.

In contrast to wt DHBc CLPs, the extension domains in R124E CLPs remained invisible (Figure 4—figure supplement 1), suggesting the homogeneous appearance of class2 CLPs relates to mostly disordered extension domains, as supported by their similarity to the extension-less variant (Figure 4, Figure 4—figure supplement 1).

Intriguingly, despite their efficient expression in bacteria DHBc class2 variants were barely if at all detectable in hepatoma cells (Figure 5); also Δ78–122_R124E gave only faint signals in the NAGE immunoblot (Figure 5—figure supplement 1). As the same eukaryotic vectors led to efficient production of wt DHBc and other class1 particles, the class2 mutations probably interfered with some aspect of protein stability. In fact, decreased CP stability and lack of capsid formation have independently been reported for a fortuitously identified variant lacking H107 (Guo et al., 2006) which we now know to reside within the center of helix αe2. Deletion of H107 thus puts the remaining residues of the helix out of register and, specifically, ablates a hydrophobic interaction of H107 with I99 in αe1 (Figure 2—figure supplement 1) which contributes to the stability of the folded extension domain.Likely, long-term unfolded extension domains enhance accessibility of instability determinants, e.g. target sites for proteases, or for ubiquitylation which initiates proteasomal degradation. This view is strongly supported by the multiple proteolysis products seen with DHBc _R124E (Figure 5—figure supplement 2), and the simultaneous absence of stable capsids and/or nucleocapsids from this variant (Figure 5;.Figure 5—figure supplements 1 and 2). In addition, without the extra contribution of the folded extension domains to the intra-dimer interface the capsid shell may become too labile to withstand the replication process, in particular double-stranded DNA formation. While these are testable hypotheses the lack of stable capsids from these variants precluded statements on a specific role of the extension domain in DHBV replication. Most striking, however, is the complete rescue of wt DHBV-like replication by combining two per se detrimental mutations in the double mutant E109R_R124E (Figure 5), fully supporting our structural model as well as the importance of a salt-bridge between these two specific positions for the ordered state of the extension domain (Figure 6). Conversely, protonation of the glutamic acid carboxylate, realistically achievable at pH values of certain cell compartments (Huotari and Helenius, 2011), would be sufficient to break this bridge and thus create a reversible pH-responsive conformational switch for capsid stabilization and capsid disintegration.

Figure 6. Model correlating disorder vs. order of the DHBc extension domain with phenotypes in bacteria and hepatoma cells.

Opposite charges in WT-DHBc and the double mutant E109R_R124E facilitate folding of the extension domain, in cells probably accelerated by chaperones, proline cis-trans-isomerases, and/or perhaps the envelope proteins. The shape of the folded extension domain is a schematic approximation to the structural data. Protonation of the E109 carboxylate at low pH ablates the salt-bridge, possibly creating a trigger for a conformational switch. In the absence of opposite charges at positions 109 and 124 (R124E, E109R) repulsion or lack of attraction (R124Q, not shown) hamper folding of the extension domain. This may expose eukaryotic instability determinants and cause the apparent capsid instability in hepatoma cells.

Materials and methods

Key resources table.

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Strain, strain background (duck)	DHBV16	GenBank	K01834	duck hepatitis B virus
Strain, strain background (Escherichia coli)	BL21Star (DE3) CodonPlus RIL	Thermofisher and Agilent	C601003 #230240	BL21Star (DE3) transformed with RIL CodonPlus plasmid
Cell line (Gallus gallus)	LMH	ATCC	CRL-2117	chicken hepatocellular carcinoma
Recombinant DNA reagent	pCD16	Nassal lab Dallmeier et al., 2008		CMV promoter controlled DHBV16 vector
Recombinant DNA reagent	pAAV-DHBc	This paper	pAAV-MCS Addgene #46954	authentic DHBV16 C gene cloned in pAAV-MCS2 for eukaryotic expression (see Plasmid Constructs)
Recombinant DNA reagent	pAAV-DHBc_Opt	This paper	pAAV-MCS Addgene #46954	E. coli optimized DHBV C gene cloned in pAAV-MCS2 for (see Plasmid Constructs) eukaryotic expression
Recombinant DNA reagent	pRSF-DHBc_Opt	This paper Heger-Stevic et al., 2018a		E. coli optimized DHBV C gene cloned in pRSF under T7 promoter for bacterial expression; (see Plasmid Constructs)
Antibody	anti-DHBc (rabbit poylclonal)	Vorreiter et al., 2007	serum 12/99	raised against recombinant full-length DHBc WB (1:10,000) For immuno precipitation (IP): 50 µl Antiserum 12/99 are loaded onto 500 µl Protein A Sepharose beads (Gelbett); 30 µl loaded beads are used per IP
Antibody	Goat IgG anti-Rabbit IgG (Fc)-HRPO	Jackson Immuno Research	Dianova Cat. # 111-035-046	WB (1:10,000)
Chemical compound, drug	TransIT-LT1	Mirus Bio	VWR Cat. # 10767–118	IF(1:500)
Software, algorithm	Relion 3	Zivanov et al., 2018
Software, algorithm	MotionCor2	Zheng et al., 2017
Software, algorithm	Ctffind4	Rohou and Grigorieff, 2015
Software, algorithm	Chimera	Yang et al., 2012

Plasmid constructs

Bacterial DHBc vectors were based on either pET28a2-DHBc (Nassal et al., 2007) carrying the DHBc nucleotide sequence from DHBV16 (GenBank: K01834.1), or on pRSF_T7-DHBcOpt, a derivative of vector pRSF_T7-HBcOpt (Heger-Stevic et al., 2018b) in which the HBc ORF was replaced by a synthetic, E. coli codon usage optimized DHBc sequence (DHBcOpt). Eukaryotic DHBc expression vectors were based on the cytomegalovirus immediate early (CMV-IE) enhancer/promoter regulated plasmid pAAV-MCS (Stratagene). The parental vector pCD16 contains a 1.1x DHBV16 genome, also under CMV-IE control; in pCD16-core^- the initiator ATG codon of the DHBc ORF was changed to ACG. Mutations were introduced via PCR using appropriate primers and the Q5 Site-directed Mutagenesis Kit or the NEBuilder HiFi DNA Assembly Master Mix (both NEB).

The coding sequence for a cytoplasmic version (Levy et al., 2013) of the peptidyl prolyl isomerase FkpA (GenBank ID: AAC41459.1) was obtained by PCR on genomic DNA from E. coli Top10 cells, using primers FkpA_Nco⁺ 5´-CACCATCACGCCATGGCTGAAGCTGCAAAACCTG and FkpA_AvrNot^- 5´- GACTCGAGTGCGGCCGCCTAGGGTTTTTTAGCAGAGTCTGCGGCTTTCG (ATG start codon and complement to TAG stop codon underlined) providing terminal restriction sites to replace the Tet-promoter controlled serine-arginine-rich protein kinase (SRPK1) ORF in vector pRSF_Tet-SRPK1_T7-HBc183opt (Heger-Stevic et al., 2018b). All plasmid constructs were verified by DNA sequencing.

DHBc expression and CLP enrichment

Routine bacterial expression of DHBc and its variants was performed in E. coli BL21* Codonplus cells at 20–25°C for 16 hr in LB medium, followed by lysozyme/sonication mediated cell lysis and sedimentation of the cleared lysates in 10–60% sucrose step gradients, all as described for HBc (Heger-Stevic et al., 2018a). Co-expression with FkpA was conducted analogously to HBc-SRPK1 co-expression (Heger-Stevic et al., 2018b), using anhydrotetracyclin for Tet promoter induction.

For cryo-EM analysis of DHBc particles a modified procedure was used, intended to improve homogeneity of the samples. To this end, BL21*(DE3) cells transformed with plasmid pRSF_T7-DHBcOpt were grown in terrific broth and induced for 16 hr at 18°C. Cells were harvested and the cell pellet was re-suspended (20% w/v) in TN300+ buffer (100 mM TrisHCl, pH 7.5, 300 mM NaCl, 5 mM β-mercaptoethanol, 5 mM MgCl₂, 5 mM CaCl₂, 2 mM PMSF and 2 mM benzamidine). Using a Microfluidizer, the cells were disrupted by 2 passages at 1,500 bar. Insoluble material was removed by centrifugation at 2,000 g and 4°C for 90 min. Then, ammonium sulfphate was added to the supernatant to 40% saturation at pH 7.5 at 0°C. The resulting precipitate was isolated by centrifugation, re-solubilized, and re-precipitated by adding ammonium sulfphate to 30% final saturation. The new precipitate was dissolved and subjected to density-gradient centrifugation (six steps with: 10, 20, 30, 40, 50% and 60% sucrose in 50 mM TrisHCl at pH 7.5) in an SW 32 Ti rotor (Beckman Coulter) at 4°C and 125755 g for 4 hr. After centrifugation the topmost 5 ml of the gradient were discarded and the remaining volume was manually fractionated into thirty-three 1 ml fractions. Fractions were analyzed by SDS-PAGE and NAGE as described, except that nucleic acids were stained using SYBR Safe dye (1:5000 dilution; v/v).

Preparation of samples for electron cryo-microscopy

200 µl of the peak fractions containing about 30% sucrose were mixed with 300 µl TN50 (50 mM TrisHCl at pH 7.5 for the 2 weeks old sample) or TN20 buffer (20 mM TrisHCl pH 7.5, 50 mM NaCl, 1 mM Mg/CaCl₂, 5 mM DTT, for the 10 months old sample) and concentrated to 100 µl at 4°C and 2,500 g in a concentrator with a molecular weight cut-off of 100 kDa. The concentrate was five-fold diluted and re-centrifuged. This procedure was repeated until the sucrose concentration dropped below 0.03%. The final protein concentrations as determined by the Bradford assay were 2.6 mg/ml for the 2 weeks stored sample and 3.2 mg/ml for the 10 months stored sample. For the vitrification, grids (400 mesh copper grids (type R 1.2/1.3. Quantifoil Micro Tools, Jena/Germany)) were rendered hydrophilic by glow discharging in air at a pressure of 29 Pa for 2 min at medium power with a Plasma Cleaner (model PDC-002. Harrick Plasma Ithaca, NY/USA). Then, 3.5 µl of DHBc solution was pipetted onto the grids and they were plunge frozen in liquid ethane with a Vitrobot mark IV (FEI-Thermo Fisher Scientific). The settings for the Vitrobot were 3 s blot time, 45 s wait time, blot force 0 at a temperature of 4°C and 100% humidity. The vitrified samples were stored in liquid nitrogen until use.

Electron cryo-microscopy

Grids were loaded into a Titan Krios G3 with Falcon III camera (FEI-Thermo Fisher Scientific) and movies were acquired with EPU in integrating mode for DHBc and DHBc+FkpA prepared after 2 weeks and in counting mode for DHBc prepared after 10 months, DHBc+FkpA prepared after 2 weeks and DHBc R124EΔ (Table 1).

Image processing

Data of the different samples were processed separately, following similar protocols. In brief: Movies were dose-weighted and motion corrected with MotionCor2 (Zheng et al., 2017). Dose weighted and motion corrected averages were imported into RELION 3.0 (Zivanov et al., 2018) for further processing. The defocus of the dose-weighted and motion corrected movie averages was determined with ctffind4 (Rohou and Grigorieff, 2015). Particles were selected by the Laplacian-of-Gaussian algorithm with a mask diameter of 320 Å (data of samples prepared after 2 weeks) or with cryolo using the general network (Wagner et al., 2019) for all other samples followed by autopicking with RELION using 6–9 selected class averages derived from 2D-classification of the picked data. Selected particles were extracted with a box size of 440 × 440 Px² using the phase_flip option. Extracted particles were grouped by 2D-classification. Particles representing distinct capsids of the same class based on the appearance of the class averages were retained. The EM-map of F97L-capsids (Böttcher and Nassal, 2018) was used as starting reference (initial low-pass filter 1/25 Å⁻¹) for auto-refinement of the 1^st data set (2 weeks). For the other data set (10 months) the current best map of DHBc was used as starting reference. During iterative auto-refinement icosahedral-symmetry was applied. Afterwards, particles were classified into 3 classes by 3D-classification without further refinement of orientations. The most populated 3D-class was further refined with auto-refine using only local orientation searches. This was followed by refinement of the contrast transfer function (ctf). For this, particles were re-extracted with a larger box of 800 × 800 Px² without phase-flipping followed by ctf-refinement per particle and beam-tilt refinement for the whole data set. For beam-tilt refinement, we defined beam-tilt classes for each day of acquisition to compensate for a possible drift of beam-tilt over time. For DHBcR124EΔ and DHBc+FkpA we also defined separate beam-tilt classes for each acquisition position in a hole. Ctf-refinement was followed by another round of local auto-refinement. Ctf-refinement only improved resolution of the maps of DHBc after 10 months and DHBcR124EΔ for the other maps no improvement was observed. In these cases we continued with the data without ctf-refinement.

The resolution was determined during the post-processing step for masked maps after gold-standard refinement.

Image processing of the asymmetric unit

Starting with the results of the final refinement of the capsids, particles were symmetry expanded (‘relion_particle_symmetry_expand’) followed by re-extraction (128 × 128 Px²), phase-flipping and re-centering to the center of one asymmetric unit. A 3D-map of the re-extracted particle fragments was calculated with ‘relion_reconstruct’ and a mask was generated from the model of the asymmetric unit with Chimera vop zone (Pettersen et al., 2004; Yang et al., 2012) followed by ‘relion_mask_create’. The 3D-map and inverted mask were used for signal-subtraction of the extracted particles with ‘relion_project’. The signal subtracted particle images were 3D-classified without further alignment using the reconstruction of the particle fragments as starting reference and the mask generated from the asymmetric unit to focus the classification. Particles of the best resolved classes without signal-subtraction were locally refined with auto-refine using the mask of the asymmetric unit for focusing the refinement. The resolution was assessed in post-processing for masked maps after gold-standard refinement or with the local resolution option of RELION.

Eukaryotic cell culture and transfections

Chicken LMH hepatoma cells were originally obtained from ATCC (CRL-2117) and maintained as described (Köck et al., 2010). Species identity of the LMH cell line was verified by amplification and partial sequencing of the mitochondrial 16S rRNA gene with primers 5'-TCCAACATCGAGGTCGTAAAC and 5'-GTACCGCAAGGGAAAGATGAA', also as described (Köck et al., 2010). Transfections were performed using TransIT-LT1 reagent (Mirus) as described (Dallmeier et al., 2008; Schmid et al., 2011). For trans-complementation of core-deficient DHBV in 6-well format 4 µg pCD16-core^- plasmid plus 1 µg of the desired pAAV-DHBc vector per well were used; for 10 cm dish format (Figure 5—figure supplement 2) DNA amounts were increased to 12.5 µg plus 2.5 µg, respectively; for sample E109R_R124E lo only 0.5 µg pAAV plasmid was employed. For non-complemented controls pAAV-DHBc was replaced by the hGFP encoding vector pTRUF5 (Zolotukhin et al., 1996).

Mycoplasma testing

Potential mycoplasma contamination was monitored every fifth passage using a home-made PCR test, similar to a published procedure (Uphoff and Drexler, 2013). Primers UniMyco(+) 5´- CGCCTGAGTAGTATGCTCGC and MycoHom(-) 5´-GCGGTGTGTACAAAACCCGA amplify an about 520 bp segment from genomic DNA coding for the 16S rRNA of various mycoplasma species. As internal control, a pUC plasmid was constructed in which a 188 bp heterologous sequence replaces a 67 bp HpaI - BstBI fragment within a cloned 700 bp 16S rRNA gene fragment from M. yeatzii that contains the primer binding sites; on this template the primers amplify a 638 bp fragment. Standard 50 µl PCR reactions using KAPA HiFi polymerase (Kapa Biosystems) were set up as follows: 33 µl H₂O; 10 µl 5x KAPA HiFi buffer with Mg²⁺; 1.5 µl 10 mM dNTP; 1.5 µl of each 10 µM primer; 0.5 µl (1 U/µl) KAPA HiFi polymerase; plus 3 × 10E3 or 10E4 copies of the internal control template. Cycling conditions: (1) Initial denaturation, 98°C 2 min; (2) cycling denaturation, 98°C, 10 s; (3) primer annealing, 58°C, 15 s; (4) extension, 72°C, 30 s; total 34 cycles from step (4) to (2 ; 5) final extension, 72°C, 5 min. For analysis, 5 µl of the reactions were separated by electrophoresis in 1.3% agarose gels alongside a 50 bp or 100 bp DNA ladder marker. DNAs were visualized by ethidium bromide staining. Samples generating an about 500 bp amplicon in addition to the 638 bp control amplicon were considered positive; however, all cells used in this study scored negative in this assay.

Detection of viral capsids, capsid proteins, and capsid-borne DNA

Capsid formation by wt and mutant DHBc proteins was evaluated by immunoblotting after NAGE, using the polyclonal rabbit anti-serum 12/99 which recognizes various avihepadnavirus core proteins (Vorreiter et al., 2007). The same antiserum was used for immunoprecipitation of DHBc proteins in lysates from transfected cells and their detection by SDS-PAGE followed by immunoblotting on polyvinylidenfluoride (PVDF) membranes, as detailed in the legend to Figure 5—figure supplement 2. For detection of viral DNA in capsids NAGE gels were blotted onto Nylon membranes and hybridized with a ³²P-labeled DHBV DNA probe (Dallmeier et al., 2008; Schmid et al., 2011), after opening capsids by rinsing the membrane with 0.1 N NaOH for 15 s (preserving RNA and DNA) or 15 min (preserving only DNA). Labeled bands were visualized by phosphorimaging and/or autoradiography. Isolation of viral DNAs from cytoplasmic nucleocapsids and Southern blotting were conducted as described (Dallmeier et al., 2008; Schmid et al., 2011).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Funding Information

This paper was supported by the following grants:

• Deutsche Forschungsgemeinschaft BO1150/17-1 to Bettina Böttcher.

• Deutsche Forschungsgemeinschaft INST 92/903-1FUGG to Bettina Böttcher.

• Deutsche Forschungsgemeinschaft Na154/9-4 to Michael Nassal.

Data availability

EM-maps are deposited in the EMDB. Where applicable models were deposited in the pdb DHBc capsid: 10800 (EMDB) 6ygh (pdb) DHBC co expressed with FkpA: 10801 (EMDB) DHBC R124E (mutant): 10802 (EMDB) DHBCR124E_del (deletion-mutant): 10803 (EMDB) 6ygi (pdb).

The following datasets were generated:

Makbul C, Nassal M, Bottcher B. 2020. DHBc capsid. RCSB Protein Data Bank. 6ygh

Makbul C, Nassal M, Bottcher B. 2020. DHBCR124E_del (deletion-mutant) RCSB Protein Data Bank. 6ygi

Makbul C, Nassal M, Bottcher B. 2020. DHBc capsid. Electron Microscopy Data Bank. EMD-10800

Makbul C, Nassal M, Bottcher B. 2020. DHBC co expressed with FkpA. Electron Microscopy Data Bank. EMD-10801

Makbul C, Nassal M, Bottcher B. 2020. DHBC R124E (mutant) Electron Microscopy Data Bank. EMD-10802

Makbul C, Nassal M, Bottcher B. 2020. DHBCR124E_del (deletion-mutant) Electron Microscopy Data Bank. EMD-10803

The following previously published datasets were used:

Mandart E, Kay A, Galibert F. 1984. Nucleotide sequence of a cloned duck hepatitis B virus genome: comparison with woodchuck and human hepatitis B virus sequences. Uniprot. P0C6J7

Mandart E, Kay A, Galibert F. 1984. Nucleotide sequence of a cloned duck hepatitis B virus genome: comparison with woodchuck and human hepatitis B virus sequences. NCBI Nucleotide. K01834.1

Horne SM, Young KD. 1995. Escherichia coli and other species of the Enterobacteriaceae encode a protein similar to the family of Mip-like FK506-binding proteins. NCBI Protein. AAC41459.1

Böttcher B, Nassal M. 2018. WT Hepatitis B core protein capsid. RCSB Protein Data Bank. 6htx

Leslie AGW, Wynne SA, Crowther RA. 1999. HUMAN HEPATITIS B VIRAL CAPSID (HBCAG) RCSB Protein Data Bank. 1qgt

Galibert F, Mandart E, Fitoussi F, Tiollais P, Charnay P. 1979. Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Uniprot. P03146

El-Gebali S, Mistry J, Bateman A, Eddy SR, Luciani A, Potter SC, Qureshi M, Richardson LJ, Salazar GA, Smart A, Sonnhammer ELL, Hirsh L, Paladin L, Piovesan D, Tosatto SCE, Finn RD. 2019. Hepatitis core antigen. Pfam. PF00906