Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Sep 1.
Published in final edited form as: J Cell Biochem. 2018 Apr 6;119(7):6181–6193. doi: 10.1002/jcb.26827

Parathyroid hormone-induced down-regulation of miR-532-5p for matrix metalloproteinase-13 expression in rat osteoblasts

Vishal Mohanakrishnan 1,#, Arumugam Balasubramanian 1,#, Gokulnath Mahalingam 1, Nicola Chennell Partridge 2, Ilangovan Ramachandran 3, Nagarajan Selvamurugan 1
PMCID: PMC7461727  NIHMSID: NIHMS1618719  PMID: 29626351

Abstract

Parathyroid hormone (PTH) acts on osteoblasts and functions as an essential regulator of calcium homeostasis and as a mediator of bone remodeling. We previously reported that PTH stimulates the expression of matrix metalloproteinase-13 (MMP-13) in rat osteoblasts and that MMP-13 plays a key role in bone remodeling, endochondral bone formation, and bone repair. Recent evidence indicated that microRNAs (miRNAs) have regulatory functions in bone metabolism. In this study, we hypothesized that the down-regulation of miRNAs that target MMP-13 by PTH leads to the stimulation of MMP-13 expression in osteoblasts. We used various bioinformatic tools to identify miRNAs that putatively target rat MMP-13. Among these miRNAs, the expression of miR-532-5p in rat osteoblasts decreased at 4 h of PTH-treatment, whereas MMP-13 mRNA expression was maximal at the same time point. When an miR-532-5p mimic was transiently transfected into UMR-106-01 cells, MMP-13 mRNA and protein expression decreased. Using a luciferase reporter assay system, we also identified that miR-532-5p directly targeted the 3′ UTRs of MMP-13 gene. Based on these results, we suggest that PTH-induced down-regulation of miR-532-5p resulted in the stimulation of MMP-13 expression in rat osteoblasts. This study identified a significant role of miRNA in controlling bone remodeling via PTH-stimulated MMP-13 expression. This finding enhances our understanding of bone metabolism and bone-related diseases and it could provide information regarding the usage of miRNAs as therapeutic agents or biomarkers.

Keywords: miR-532-5p, MMP-13, osteoblasts, PTH

1 ∣. INTRODUCTION

Parathyroid hormone (PTH), an 84-amino acid peptide secreted by the parathyroid gland, is an important regulator of calcium (Ca2+) homeostasis and is the main hormone regulating bone remodeling via its actions on both bone formation and bone resorption.1,2 Bone maintains its integrity by the process of remodeling. In this process, the removal of a worn-out bone is the task of osteoclasts, whereas the replacement of the worn-out bone with new bone is the function of osteoblasts.2-4 PTH exerts its action both directly on bone formation via osteoblasts and indirectly on bone resorption via osteoclasts.5-8 Bone remodeling, and therefore bone Ca2+ turnover, achieves the long-term modulation of Ca2+ by the metabolic actions of osteoblasts or osteoclasts via incorporation or release of Ca2+ from bone, respectively.

Matrix metalloproteinase-13 (MMP-13 or collagenase-3) is expressed as a late-differentiation protein in osteoblasts and is primarily responsible for the degradation of extracellular bone matrix (ECM) components. MMP-13 gene expression is regulated by bone-resorbing agents such as PTH, cytokines such as interleukins (IL-1, −6), and growth factors9-13 that promote bone turnover. The regulation of this gene is likely to have important consequences for both normal and pathological remodeling of bone where the balance between bone resorption and bone formation is disrupted. Using mutant mice homozygous for a targeted mutation in Col1a1 that are resistant to MMP-13 cleavage of type I collagen, it was shown that bone resorption and calcemic responses were markedly diminished.14 MMP-13 has been shown to have important roles in endochondral and intramembranous ossification during human fetal bone development.15,16 The growth plate phenotype of MMP-13-null mice persists into adult life and is consistent with that seen in patients with SEMDMO.17 The Missouri type of human spondyloepimetaphyseal dysplasia (SEMDMO) is the first heritable disorder associated with an MMP-13 mutation, and abnormalities of collagen type II are associated with this genetic disease.18 This disease is also analogous to type II collagenopathies.19 These studies indicate the importance of MMP-13 in bone remodeling and bone formation.

MicroRNAs (miRNAs), which are endogenous RNAs of ~22-nts, exert vital regulatory functions on many fundamental physiological and pathological processes in multiple organisms via targeting messenger RNAs (mRNAs) for degradation or translational repression.20-22 The process of bone remodeling characterized by the anabolic and catabolic actions of osteoblasts and osteoclasts, respectively, is tightly regulated by a number of temporally and spatially expressed genes, and the expression of these genes is finely tuned by a host of miRNAs.23,24 There are reports indicating involvement of miRNA-MMP-13 in various cascades such as osteoarthritis, chondrogenesis, and estrogen replacement therapy.25-29 In this study, we detected the down-regulation of miRNAs that putatively target rat MMP-13, by PTH, and validated the role of one such down-regulated miRNA, miR-532-5p, during PTH-stimulation of MMP-13 expression in rat osteoblasts.

2 ∣. MATERIALS AND METHODS

2.1 ∣. Cell culture

Rat osteoblasts (UMR 106-01) were cultured in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum and penicillin-streptomycin (Invitrogen, Carlsbad, CA) at 37°C in a 5% CO2 atmosphere. UMR 106-01 cells were seeded in six-well plates at 1.5 × 105 cells/mL. Once cells reached confluence, they were starved in 0.1% DMEM overnight. The cells were then treated with rat PTH (1-34) (Sigma-Aldrich, St. Louis, MO) at 10−8M for different time periods, as indicated.

2.2 ∣. Isolation of primary osteoblasts from rat calvariae

The protocol for isolation of rat calvarial cells was approved by the Animal Ethical Committee, University of Madras, India. Two days old rat pups were sacrificed by chloroform anesthesia. Rat calvariae were extracted and digested sequentially by incubation with collagenase A (final concentration, 2 mg/mL; Sigma-Aldrich) and 0.25% trypsin for 20, 40, and 90 min at 37°C.30 The first and second digests were discarded. The third digest was cultivated in a 100 mm plate containing DMEM with 10% FBS and 1% antibiotics. Cells were monitored and the medium was changed once every 2 days. When the cells reached 70% confluency, they were trypsinized and maintained in osteogenic medium containing 50 mg/mL ascorbic acid, 10 nM β-glycerophosphate, and 10−8M dexamethasone with 10% FBS. The medium was changed every 2 days. After 7 days, the cells were treated control or 10−8M PTH-treated media.

2.3 ∣. Isolation of primary osteoblasts from rat bone marrow stromal cells

The protocol for isolation of rat bone marrow stromal cells was approved by the Animal Ethical Committee, University of Madras, India. Eight weeks old rats were sacrificed by chloroform anesthesia. The ligament, tissue, and muscles were detached from the femora and tibiae of the sacrificed rats.31 The long bones were excised at the end and bone marrow was flushed with DMEM containing 10% FBS and 1% antibiotics using a syringe. The process was repeated several times until the entire bone marrow was removed. Further, the bone marrow was cultured in DMEM with 10% FBS and 1% antibiotics at 37°C and 5% CO2. The non-adherent cells were discarded, and adherent cells were maintained in DMEM. Once the cells reached confluency, they were maintained in osteogenic medium containing 50 mg/mL ascorbic acid, 10 nM β-glycerophosphate, and 10−8M dexamethasone with 10% FBS. The medium was changed every 2 days. After 7 days, the cells were treated with control or 10−8M PTH-treated media.

2.4 ∣. Transient transfection

Rat-specific precursor miRNA-532 sequences (260 bp; mir532, MIR532) were amplified using rat genomic DNA with MIR532-forward-5′ GGTGGGTACCCTCTCAGGAC-CAACACAC3' and reverse-5′ GGTGCTCGAGCGTACA-GACAGAGCACATG3′ primers. The PCR products were purified by electrophoresis on 1.5% agarose gels and eluted using an EZ-10 spin column DNA gel extraction kit (BioBasic Inc, Canada). They were then cloned into pCMV6-Entry vector (OriGene, Rockville, MD) and the MIR532 insert in the plasmid (pMIR532) was verified by DNA sequencing.

UMR-106-01 cells were seeded in six-well plates. After reaching 70-80% confluence, cells were transiently transfected with pMIR532, negative control or miR-532-5p mimic (Life Technologies, Carlsbad, CA). Lipofectamine 2000 (Thermo Fisher, Waltham, MA) was used for transient transfection, and the protocol was followed as per the instructions given by the manufacturer. After 24 h, cells were treated with PTH and were subjected to RNA and protein isolation.

2.5 ∣. Quantitative reverse transcription PCR (RT-qPCR)

Total RNA was isolated from cells with Trizol reagent (Invitrogen) according to the manufacturer's instructions, and cDNA was synthesized using the iScript cDNA Synthesis kit according to the manufacturer's protocol (Bio-Rad, Hercules, CA). Quantitative PCR analysis was performed using Applied Biosystems QuantStudio 3 system using SYBR® Premix Ex Taq™ II (TliRNaseH Plus) (Takara Bio, Inc., Kusatsu, Shiga, Japan), as per instructions given by the manufacturer. The primers for miRNAs and mRNAs used in this study are listed in Table 1. The thermal cycling profile was as follows: 95°C for 30 s as initial denaturation, followed by 40 cycles of 95°C for 5 s, 58°C for 30 s. RPL13AB was used as internal control for normalization. The quantification of mature miRNA was performed according to miScript assay II (Qiagen, Hilden, Germany) manufacturer's instructions. The relative- and fold-change in expression was calculated by using the ΔΔCt method of relative quantification.32

TABLE 1.

Rat (R) specific primers for miRNAs and MMP13 used in the study

Name Forward Primer (5′à3′) Reverse Primer (5′à3′)
R-mir-141 CTGAGTCCATCTTCCAGTGC GTGTTAGGAGCTTCGTACTTC
R-mir-207 CAGGGGTGAGGGGCT GAGGAGAGCCAGGAGAAG
R-mir-32 GAGAATATCACACACACTAAATTG GGGATATTGCACATTACTAAGTT
R-mir-346 CTGTGTTGGGCATCTGTC CTTCAGAGCAACAGAGAGG
R-mir-3549 GAAAATGCCGGTCCTGG AGATGAGGGTGTCAGTTCAA
R-mir-3558 CCATAGAAGTCATCCCACAGT CAGGCTGACATAGAAACCCT
R-mir-3561 ACCTGAGACTGTGTCAATCC CAGGTTCTGAGTGTCTACCC
R-mir-3571 CACTTCTTTACATTCCATAGCA CAATAGTGCCTACTCAGAGC
R-mir-3575 CAGGGGCCTCCATCATTAC GTCTTACCCAGCAGTGTTTG
R-mir-3580 CTCATACTACCCTAGTCACAGA TGCCCTGCTTGTACTTATTC
R-mir-3584 GATGCGGGCTACCAGA CTGGGCGGGAGGAGT
R-mir-410 AGAGGTTGTCTGTGATGAGT AGGCCATCTGTGTTATATTCG
R-mir-494 GATACTTGAAGGAGAGGTTGT AGAGGTTTCCCGTGTATGTT
R-mir-511 GCTCTGCACTCAGTACATAATC CCCCATCCTGTCTTTTGCTA
R-mir-532 CTTCCATGCCTTGAGTGTA GTGTGGGAGGGTAATTAAGATG
R-mir-6316 ATCCACATGTCTGTCTCTGT ATGTGAAAGTCAGAGCACA
R-mir-6318 TTAACTTTAGGAGCAGCGG CCTGTGCCCAAGGACTC
R-mir-668 AACTTTAGGAGCAGCGGG CCTGTGCCCAAGGACT
R-mir-743b TCAGTATGGTGTCTTTCACAA GTGTTCAGACTGGTGTCC
R-mir-761 CAGCAGGGTGAAACTGAC TCAGGAGGAGCAGCAAA
R-MMP13 CTTCTGGCACACGCTTTTC GTAGCCTTTGGAGCTGCTT
Open in a new tab

2.6 ∣. Western blotting

Whole cell lysates were prepared and proteins were separated on 12% SDS-polyacrylamide gels. The proteins were electro-transferred to a polyvinylidenedifluoride (PVDF) membrane, which was blocked by 1× TBS containing 0.1% Tween 20 and 5% fat dried milk for 1 h with shaking. The membrane was then incubated with MMP-13 antibody (Cat # ab39012, Abcam, CA, UK) overnight, followed by 1 h incubation with secondary antibody coupled to horseradish peroxidase. The membrane was developed using an ECL kit (WESTAR Supernova, Bologna, Italy) and was visualized using ChemiDoc XRS+ system (Bio-Rad). The protein bands were quantified using Image J software (Bio-Rad). α-Tubulin was used as an internal control for normalization (Cat # sc-8035, Santacruz biotechnology, TX).

2.7 ∣. Dual-luciferase reporter assay

The 3′ untranslated regions (UTRs) of MMP-13 revealed the presence of three miR-532-5p binding sites at 317-328, 467-486, and 877-891. Three different forward and reverse primers containing wild-type or mutant MMP-13 3′ UTRs were chemically synthesized (Table 2). These sense and antisense primers containing an internal NotI site were annealed and cloned using PmeI and XbaI restriction sites present downstream of the Firefly luc2 gene in the pmirGLO dual-luciferase miRNA target expression vector (Promega, Madison, WI). Clones were identified by Not1 digestion. UMR-106-01 cells were seeded in 6-well plates and transfected with 1 μg of pCMV or pMIR532 along with pmirGLO-3′UTR-WT or pmirGLO-3′UTR-MUT constructs using lipofectamine 2000 reagent (Invitrogen). After 24 h, luciferase assays were carried out using the dual-luciferase reporter assay system (Promega) and a Luminoskan Ascent Microplate Luminometer (Thermo Fisher). Firefly luciferase activity was normalized to Renilla luciferase activity; Renilla luciferase is a constitutively expressed gene in the pmirGLO vector system.

TABLE 2.

Oligonucleotides Containing the Wild or Mutant MMP-13 3'UTRs Used in the Luciferase Reporter Assay

Name (MMP13-3'UTR) Sequences 5′>3′
323/28-WF AAACTAGCGGCCGCTATTAAAAAACCTAACAGGCATAAT
323/28-WR CTAGATTATGCCTGTTAGGTTTTTTAATAGCGGCCGCTAGTTT
886/91-WF AAACTAGCGGCCGCTTGTGTGACAGGAGCTAAGGCAGAT
886/91-WR CTAGATCTGCCTTAGCTCCTGTCACACAAGCGGCCGCTAGTTT
481/86-WF AAACTAGCGGCCGCTAACAGATAGCTTTCCAAGGCAAGT
481/86-WR CTAGACTTGCCTTGGAAAGCTATCTGTTAGCGGCCGCTAGTTT
323/28-MF AAACTAGCGGCCGCTATTAAAAAACCTAACAAGATTAAT
323/28-MR CTAGATTAATCTTGTTAGGTTTTTTAATAGCGGCCGCTAGTTT
886/91-MF AAACTAGCGGCCGCTTGTGTGACAGGAGCTATGATAGAT
886/91-MR CTAGATCTATCATAGCTCCTGTCACACAAGCGGCCGCTAGTTT
481/86-MF AAACTAGCGGCCGCTAACAGATAGCTTTCCATGATAAGT
481/86-MR CTAGACTTATCATGGAAAGCTATCTGTTAGCGGCCGCTAGTTT
Open in a new tab

The mutated nucleotides are highlighted in bold. W, Wild; M, Mutant; F, Forward; R, Reverse.

2.8 ∣. Prediction of potential miRNAs and their gene targets

All rat miRNA sequences were obtained using miRBase V19 and V21 (http://www.mirbase.org/).33 Mature miRNA sequences were subjected to STarMir analysis for computation of binding site features (http://sfold.wadsworth.org/cgi-bin/starmir.pl).34 miRmap was used to rank the potential miRNAs based on various criteria and also to identify putative target genes for selected miRNAs (http://mirmap.ezlab.org/). Experimentally validated miRNAs were checked using miRTarBase 2016 (http://mirtarbase.mbc.nctu.edu.tw/). A Venn diagram for miRNAs selection was drawn using Venn Diagram Generator.

2.9 ∣. Statistical analysis

All experimental data are shown as means ± standard deviation (SD) with n = 3. Significant differences (P < 0.05) between groups were determined using Student's t-test and one-way ANOVA.

3 ∣. RESULTS

3.1 ∣. PTH-stimulation of MMP-13 mRNA expression in rat osteoblasts

To determine the effects of PTH on the expression of MMP-13 mRNA, rat osteoblasts (UMR 106-01) were treated with PTH at 10−8M for different time periods, as indicated. Total RNA was isolated and subjected to RT-qPCR using primers for MMP-13 and RPL13AB. The results indicated that PTH stimulated a significant increase in mRNA expression of MMP-13 to a maximal level at 4 h (Figure 1).

FIGURE 1.

FIGURE 1

Open in a new tab

PTH-stimulation of MMP-13 mRNA expression. UMR-106-01 cells were treated with PTH (10−8M) over different time periods (1, 2, 4, 8, 12, and 24 h). At the end of treatment, cells were subjected to RNA isolation, cDNA synthesis, followed by qPCR analysis for MMP-13 mRNA expression. RPL13AB was used as a control for normalization. The fold-change of PTH-stimulation of MMP-13 expression was calculated over that of the control. *indicates a significant increase compared to the respective controls (P < 0.05)

3.2 ∣. Identification of miRNAs that target MMP-13

Recent reports indicated that miRNAs play a significant role in diverse physiological process, including cell growth, apoptosis, cell development, stress adaptation, metabolism, cell proliferation, and cell differentiation. miRNAs are also considered to be closely related regulators of osteogenesis and bone formation. Hence, we identified miRNAs that target rat MMP-13 using bioinformatic tools. Many bioinformatic tools and approaches have been developed in recent times to understand functions of specific miRNAs and their mechanism of action on target gene expression. We employed both conventional tools and an interdisciplinary strategy for miRNA selection. All miRNA sequences specific to rats were obtained from miRBase V19 and V21.33 In total, 705 rat miRNAs that putatively target MMP-13 were identified using STarMir and miRmap computational tools (Figure 2A). LogitProb score greater than 0.734 was used as the cutoff in STarMir. miRmap, a miRNA ranking tool based on the thermodynamic, evolutionary, probabilistic and sequences characteristics of miRNAs was used to rank them. Among the miRNAs identified (58 + 73), 36 and 35 were selected after removing the already available validated miRNAs. A common group of 20 miRNAs that putatively targeted rat MMP-13 were identified (Figure 2B) and used for further analysis.

FIGURE 2.

FIGURE 2

Open in a new tab

Identification of miRNAs that target rat MMP-13. A, Schematic illustration of the selection of miRNAs via various bioinformatic tools such as miRBase, miRmap, STarMir and miRTarBase. B, A list of miRNAs that putatively target rat MMP-13

3.3 ∣. Expression of miRNAs that putatively target rat MMP-13

Twenty rat-specific miRNAs putatively targeting MMP-13 (Figure 2B) were selected, and their expression was determined. UMR-106-01 cells were treated with PTH for different time periods (1, 2, 4, and 8 h), followed by total RNA isolation, cDNA synthesis, and qPCR analysis using the primers for precursor miRNAs. The expression of pre-miR-141, pre-miR-346, pre-miR-3580, pre-miR-410, and pre-miR-494 increased at all time periods compared to that of their respective controls following PTH-treatment. Although PTH increased the expression of pre-miR-511 and pre-miR-532 at most time points tested, it did not increase the expression of these miRNAs at the 4 h time point compared with that in their respective controls (Figure 3). Furthermore, an inverse correlation was observed between the levels of these two miRNAs and MMP-13 mRNA following 4 h of PTH-treatment (Figure 1). It can also be concluded that pre-miR-511 and pre-miR-532 showed maximal repression following PTH-treatment for 4 h. Even though miR-743b was identified as one of the MMP-13-targeting miRNAs, there was no expression of pre-miR-743b in UMR 106-01 cells. The other 12 miRNAs showed no change in their expression in response to PTH-treatment at all time periods (data not shown). Hence, these results (Figures 2 and 3) suggested that there are several miRNAs that putatively target MMP-13 and, among them, 2 miRNAs (pre-miR-511 and pre-miR-532) were down-regulated after 4 h of PTH-treatment in rat osteoblasts.

FIGURE 3.

FIGURE 3

Open in a new tab

Expression of precursor miRNAs that target MMP-13. UMR-106-01 cells were treated with PTH (10−8M) over different time periods (1, 2, 4, and 8 h). At the end of treatment periods, cells were subjected to RNA isolation, followed by cDNA synthesis and qPCR analysis using the primers for precursor miRNAs, as indicated. RPL13AB was used as a control for normalization. The fold-change of miRNAs was calculated over that of controls. *indicates a significant increase compared to controls (P < 0.05)

3.4 ∣. Computational analysis of miRNA(s) binding sites with MMP-13 3'UTRs

To understand the role played by miRNAs in the regulation of gene expression, their binding site(s) information and the pattern of their binding are important to gain understanding of the molecular mechanisms involved. The thermodynamic properties of duplex formation between a miRNA and its mRNA target could reveal the action of miRNA activity.34 The tool STarMir was used for computing binding site features for seven selected miRNAs and the 3′ UTRs of MMP-13. These computed binding site features included site position, LogitProb, seed position, and type. miR-511-5p and miR-532-5p exhibited the highest LogitProb values of 0.789 and 0.844, respectively (Figure 4A). Thermodynamic energy-based study and CLIP prediction models were used in combination to understand the stability of the mRNA-miRNA duplex, which contributes to the activity of miRNAs.35 Both miR-532-5p and miR-511-5p shared the same seed region (323-328) for their complementary binding to MMP-13 3′ UTRs at 317-328 and 319-328 bp, respectively. Figure 4B shows a diagrammatic representation of complementary binding of miRNAs’ seed regions to MMP-13 3′ UTRs. The location of rat miR-511 was in ch17: 83129840-83129918 [+] and was intronic in nature, originating from intron five of MRC1 (Mannose Receptor, C Type 1). Rat miR-532 was intergenic from chX: 16894994-16895072 [+] (Figure 4B). The key difference in the biogenesis of intronic and intergenic miRNAs lies in their mechanisms of transcriptional regulation; while intronic miRNAs appear to share promoters with their host genes, intergenic miRNAs have their own promoters.

FIGURE 4.

FIGURE 4

Open in a new tab

Binding site features of miRNAs and MMP-13 3′ UTRs. A, Computed binding site features of the seed position of miRNAs with the site position of MMP-13 3′ UTRs. B, Chromosomal locations of miR-511 and miR-532. miRNA-mRNA pair with the minimum free energy calculated using RNAHybrid

3.5 ∣. miR-532-5p decreased the PTH-stimulation of MMP-13 expression in rat osteoblasts

Since miR-532-5p showed the highest LogitProb score compared to miR-511-5p (Figure 4A), we selected this miRNA for further studies. We initially investigated whether there is an inverse correlation between the expression of miR-532-5p and MMP-13 in rat primary osteoblasts. PTH-treatment stimulated maximal expression of MMP-13 mRNA at 4 h in primary osteoblasts derived from rat calvariae (Figure 5A) and rat bone marrow stromal cells (Figure 5C); however, miR-532-5p showed repression following PTH-treatment for 4 h in these cells (Figures 5B and 5D). Moreover, an inverse correlation was observed between the levels of miR-532 and MMP-13 mRNA in UMR 106-01 cells, as well as rat primary osteoblasts, following 4 h of PTH-treatment (Figures 1, 3, and 5).

FIGURE 5.

FIGURE 5

Open in a new tab

PTH-mediated regulation of MMP-13 mRNA and miR-532-5p expression. Rat primary osteoblasts derived from calvarial cells (A and B) or bone marrow stromal cells (C and D) were treated with PTH (10−8 M) for different durations (1, 2, 4, and 8). At the end of treatment, total RNA was isolated from the cells and used for cDNA synthesis, followed by qPCR analysis for detecting MMP-13 mRNA (A and C) and miR-532-5p (B and D) expression. RPL13AB was used as a control for normalization. The relative MMP-13 and miR-532-5p levels under PTH stimulation were calculated. *indicates a significant increase compared to the respective controls (P < 0.05)

To determine the functional relevance of miR-532-5p, we cloned the full-length precursor miRNA-532 (260 nucleotides; mir-532; MIR532) into the pCMV expression vector (pMIR532), as described in the methods section. UMR-106-01 cells were transiently transfected with either the negative control (pCMV, empty plasmid) or pMIR532 for 24 h. Cells were then treated with PTH for 4 h and used for determination of MMP-13 mRNA levels. The results showed that overexpression of pMIR532 significantly decreased the expression of PTH-stimulated MMP-13 mRNA in UMR106-01 cells (Figure 6A). To specifically address the functional role of miR-532-5p in the PTH-stimulation of MMP-13 expression in rat osteoblasts, we also used a miR-532-5p mimic in this study. UMR 106–01 cells were transiently transfected with either the negative control or an miR-532-5p mimic for 24 h, and the levels of MMP-13 mRNA were determined. Overexpression of miR-532-5p decreased the PTH-stimulated expression of MMP-13 mRNA in UMR 106-01 cells (Figure 6B). The expression of mature miR-532-5p in cells after transfection was also determined. Endogenous expression of miR-532-5p increased when cells were transfected with miR-532-5p mimic as a control, whereas it was decreased following PTH-treatment of these cells (Figure 6C). A similar pattern for endogenous expression of miR-532-5p was also observed after pMIR532 transfection (data not shown).

FIGURE 6.

FIGURE 6

Open in a new tab

Overexpression of miR-532-5p down-regulated MMP-13. UMR-106-01 cells were transiently transfected with (A) negative control (pCMV) or pMIR532, (B) negative control miRNA or miR-532-5p mimic for 24 h followed by PTH-treatment for 4 h at 10−8 M. Total RNA was isolated, followed by cDNA synthesis and qPCR analysis. The relative expression of MMP-13 mRNA was calculated after normalization to RPL13AB. *indicates a significant increase compared to controls (P < 0.05). C, Total RNA obtained from the above transfected cells (B) was used for determination of the endogenous expression of miR-532-5p. *indicates a significant increase compared to respective negative controls (P < 0.05). #indicates a significant decrease compared to control transfected with miR-532-5p (P < 0.05). D, UMR-106-01 cells were transiently-transfected with negative control miRNA or miR-532-5p mimic. Whole cell lysates were prepared and subjected to western blot analysis using an antibody against MMP-13. α-Tubulin was used as a control for normalization. E, The above experiments were carried out in triplicate and a representative image is shown. The quantitative analysis of relative protein expression of MMP-13 was determined using Image J software. *indicates a significant increase compared to controls (P < 0.05). #indicates a significant decrease compared to PTH-treatment in the presence of negative controls (P < 0.05)

As overexpression of miR-532-5p decreased the expression of PTH-stimulated MMP-13 mRNA (Figures 6A and 6B), we further determined the expression of MMP-13 at the protein level. UMR-106-01 cells were transiently transfected with either the negative control or an miR-532-5p mimic for 24 h, followed by PTH-treatment for 8 h. Whole cell lysates were prepared and subjected to Western blot analysis. When cells were transiently-transfected with negative control, there was a significant increase in the expression of PTH-stimulated MMP-13 protein, whereas cells transiently-transfected with miR-532-5p mimic showed a significant decrease in the expression of PTH-stimulated MMP-13 protein (Figures 6D and 6E). The MMP-13 antibody used in this study was able to detect both the latent MMP-13 (pro-MMP-13) and active MMP-13 forms.

3.6 ∣. Direct targeting of MMP-13 by miR-532-5p using luciferase reporter assay

The computational tool STarMir was used for determining the binding site features of miR-532-5p interacting with the 3′ UTR of MMP-13 mRNA. miR-532-5p had good/highest LogitProb scores at three different sites of MMP-13 3′ UTRs, namely site 1 (317-328 bp), site 2 (467-486 bp) and site 3 (877-891 bp) (Figure 7A). To validate whether miR-532-5p directly targets these sites, we used a dual luciferase reporter assay system. Wild-type or mutant oligonucleotides containing the sites of MMP-13 3′ UTRs were cloned into the pmirGLO dual-luciferase miRNA target expression vector. The pmiRGlo plasmids containing wild or mutant MMP-13 3′ UTRs were transiently co-transfected with pCMV or pMIR532 for 24 h and subjected to dual-luciferase assays. When cells were co-transfected with MMP-13 3′ UTR wild-type (sites 1, 2, or 3) and pMIR532, there was a significant decrease in luciferase activity, whereas there was no significant effect on luciferase activity when cells were co-transfected with MMP-13 3′ UTR mutant (sites 1, 2, or 3) and pMIR532 (Figure 7B). From these experiments, it can be extrapolated that miR-532-5p directly targeted MMP-13 3′ UTRs in rat osteoblasts.

FIGURE 7.

FIGURE 7

Open in a new tab

miR-532-5p directly targeted MMP-13 3′ UTRs. A, A diagrammatic representation of the binding sites of rat MMP-13 3′ UTRs (site 1: 317-328 bp, site 2: 467–486 bp, site 3: 877-891 bp) with the seeding sequences of miR-532-5p. B, UMR 106-01 cells were transiently-transfected with the pmirGLO construct containing the wild-type or mutant MMP-13 3′ UTRs (sites 1, 2, or 3) along with pCMV or pMIR532. After 24 h, cell lysates were prepared and the relative luciferase activity was determined after normalization of Firefly luciferase activity to Renilla luciferase activity. #indicates a significant decrease compared to pCMV vector (P < 0.05)

4 ∣. DISCUSSION

In this study, we showed PTH-stimulation of MMP-13 mRNA expression in UMR 106-01 cells (Figure 1), primary osteoblasts derived from rat calvarial cells (Figure 5A), and bone marrow stromal cells (Figure 5C), and this effect was maximal at the 4 h time point. It has been reported that stimulation of MMP-13 expression by PTH requires activator protein-1 (AP-1) and Runx2 in rat osteoblastic cells.36-38 Runx2 is a bone transcription factor and is essential for the expression of osteoblast differentiation marker genes.13,20,32,39-46 PTH-treatment also disrupted the interaction of Runx2 with histone deacetylase 4 (HDAC4), resulting in MMP-13 expression in vitro and in vivo.47,48 HDAC4 is a class II histone deacetylase expressed at high levels in differentiated mature osteoblasts and pre-hypertrophic chondrocytes.49 There are several papers that throw light on the mechanisms involved in the control of Runx2 and HDAC4 function in cells, by miRNAs,20,47,49,50-53 whereas the direct involvement of miRNAs that regulate PTH-stimulation of MMP-13 expression in osteoblasts is not yet explored.

During skeletal development, several miRNAs have been identified as positive (miR-15b, −20a, −21, −210, −27, −29c, −196a, −218, and −590-5p) and negative (miR-34c, −135, −138, −203, −204, −211, −133, and −135) regulators.13,32,20,21,44,45,51,54-56 Of the 20 rat-specific miRNAs putatively targeting MMP-13 (Figure 2B) that were selected and subjected to expression analysis (Figure 3), pre-miR-511 and pre-miR-532 showed maximal repression following PTH-treatment for 4 h. miR-532-5p showed a higher LogitProb score than miR-511-5p (Figure 4A); hence, miR-532-5p was used for further studies. There was an inverse correlation between the level of miR-532-5p and MMP-13 mRNA following 4 h of PTH-treatment in rat osteoblasts (Figures 1, 3, and 5).

The function of a particular miRNA can be determined either by its overexpression or by inhibition of its activity in cells. Since miR-532-5p was down-regulated by PTH-treatment in rat osteoblasts (Figures, 3, and 5 1), we overexpressed this miRNA for determining whether MMP-13 is also down-regulated. Overexpression of miR-532-5p decreased the PTH-stimulated expression of MMP-13 mRNA and protein in UMR 106-01 cells (Figure 6). miRNAs have the potential to target the 3′ UTRs of mRNA, resulting in degradation of the mRNA or translational arrest of mRNAs.26,32,51 Thus, it is likely that the miR-532-5p identified in this study targeted and degraded MMP-13 mRNA in rat osteoblasts. We also identified direct targeting of the MMP-13 3′UTR by miR-532-5p using a luciferase reporter system (Figure 7). Direct targets of several other miRNAs have also been validated using the luciferase reporter system.32,51,57

Targeting of MMP-13 by miRNAs in several types of cells under physiological and pathological conditions has been reported. It has been shown that miR-27b may play a role in regulating the expression of MMP-13 in human chondrocytes.58 MMP-13 was identified as a direct target of miR-125b, and there was an inverse relationship between the expression of miR-125b and MMP-13 in cutaneous squamous cell carcinoma.59 miR-126-5p was significantly down-regulated in the stromal cells of giant cell tumors and affected osteoclast differentiation and bone resorption by repressing MMP-13 expression.60 The expression level of miR-125b can be negatively correlated with the metastatic potential of non-small cell lung cancer, and this effect was likely exerted through regulation of MMP-13.61 miR-375 was identified as an anti-metastatic miRNA, and MMP-13 was directly regulated by this miRNA in esophageal squamous cell carcinoma.62 Circular RNAs also regulated MMP-13 expression by functioning as a miR136 “sponge” during chondrocyte ECM degradation.63 miR-320 directly targeted MMP-13 and regulated chondrogenesis.27 It was shown that miR-148a inhibited the migration of breast cancer cells by targeting MMP-13.64 In intervertebral disc degeneration disease, MMP-13 may act as a target of miR-27b and miR-127-5p.65,66 Overexpression of miR100 and miR125b in breast cancer cells negated the release of stimulated MMP-13 from cells.67 Thus, it appears that MMP-13 can be targeted directly or indirectly, which could lead to alteration to the degradation of ECM under physiological and pathological conditions.

In conclusion, this study identified that PTH down-regulated a number of miRNAs that putatively target MMP-13, and down-regulation of miR-532-5p resulted in the stimulation of MMP-13 mRNA expression in rat osteoblasts. miR-532-5p could play a significant role by acting as an intermediate between PTH and MMP-13 in bone remodeling. Hence, identification of miR-532-5p as one of the functional targets responsible for PTH-stimulation of MMP-13 expression in osteoblasts could improve our understanding of bone metabolism and bone-related diseases, and this could possibly open doors to the potential use of miRNAs as therapeutic agents and biomarkers.

ACKNOWLEDGEMENTS

This work was supported by the Department of Biotechnology, India [Grant No. BT/PR15014/BRB/10/1481/2016 to N. S].

Funding information

Department of Biotechnology, Ministry of Science and Technology, India, Grant number: BT/PR15014/BRB/10/1481/2016

Footnotes

CONFLICTS OF INTEREST

The authors declare no conflicts of interest related to this study.

REFERENCES

  • 1.Swarthout JT, D'Alonzo RC, Selvamurugan N, Partridge NC. Parathyroid hormone-dependent signaling pathways regulating genes in bone cells. Gene. 2002;282:1–7. [DOI] [PubMed] [Google Scholar]
  • 2.Raggatt LJ, Partridge NC. Cellular and molecular mechanisms of bone remodeling. J Biol Chem. 2010;285:25103–25108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Crockett JC, Rogers MJ, Coxon FP, Hocking LJ, Helfrich MH. Bone remodelling at a glance. J Cell Sci. 2011;124:991–998. [DOI] [PubMed] [Google Scholar]
  • 4.Katsimbri P The biology of normal bone remodelling. Eur J Cancer Care. 2017;26 10.1111/ecc.12740 [DOI] [PubMed] [Google Scholar]
  • 5.Teitelbaum SL. Bone resorption by osteoclasts. Science. 2000;289: 1504–1508. [DOI] [PubMed] [Google Scholar]
  • 6.Silva BC, Bilezikian JP. Parathyroid hormone: anabolic and catabolic actions on the skeleton. Curr Opin Pharmacol. 2015;22:41–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Siddiqui JA, Partridge NC. Physiological bone remodeling: systemic regulation and growth factor involvement. Physiology 2016;31:233–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yavropoulou MP, Michopoulos A, Yovos JG. PTH and PTHR1 in osteocytes. New insights into old partners. Hormones- Int J Endocrinol Metab. 2017;16:150–160. [DOI] [PubMed] [Google Scholar]
  • 9.Varghese S, Rydziel S, Canalis E. Basic fibroblast growth factor stimulates collagenase-3 promoter activity in osteoblasts through an activator protein-1-binding site. Endocrinology. 2000;141: 2185–2191. [DOI] [PubMed] [Google Scholar]
  • 10.Mengshol JA, Vincenti MP, Brinckerhoff CE. IL-1 induces collagenase-3 (MMP-13) promoter activity in stably transfected chondrocytic cells: requirement for Runx-2 and activation by p38 MAPK and JNK pathways. Nucl Acids Res. 2001;29:4361–4372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Selvamurugan N, Kwok S, Alliston T, Reiss M, Partridge NC. Transforming growth factor-β1 regulation of collagenase-3 expression in osteoblastic cells by cross-talk between the Smad and MAPK signaling pathways and their components, Smad2 and Runx2. J Biol Chem. 2004;279:19327–19334. [DOI] [PubMed] [Google Scholar]
  • 12.Raggatt LJ, Qin L, Tamasi J, et al. Interleukin-18 is regulated by parathyroid hormone and is required for its bone anabolic actions. J Biol Chem. 2008;283:6790–6798. [DOI] [PubMed] [Google Scholar]
  • 13.Arumugam B, Vairamani M, Partridge NC, Selvamurugan N. Characterization of Runx2 phosphorylation sites required for TGF-β1-mediated stimulation of matrix metalloproteinase-13 expression in osteoblastic cells. J Cell Physiol. 2018a;233:1082–1094. [DOI] [PubMed] [Google Scholar]
  • 14.Zhao W, Byrne MH, Boyce BF, Krane SM. Bone resorption induced by parathyroid hormone is strikingly diminished in collagenase-resistant mutant mice. J Clin Invest. 1999;103:517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Inada M, Wang Y, Byrne MH, et al. Critical roles for collagenase-3 (MMP-13) in development of growth plate cartilage and in endochondral ossification. Proc Natl Acad Sci USA. 2004;101:17192–17197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mackie EJ, Tatarczuch L, Mirams M. The skeleton: a multifunctional complex organ. The growth plate chondrocyte and endochondral ossification. J. Endocrinol 2011;211:109–121. [DOI] [PubMed] [Google Scholar]
  • 17.Patel AC, McAlister WH, Whyte MP. Spondyloepimetaphyseal dysplasia: clinical and radiologic investigation of a large kindred manifesting autosomal dominant inheritance, and a review of the literature. Medicine (Baltimore). 1993;72:326–342. [PubMed] [Google Scholar]
  • 18.Kennedy AM, Inada M, Krane SM, et al. MMP-13 mutation causes spondyloepimetaphyseal dysplasia, Missouri type (SEMDMO). J Clin Invest. 2005;115:2832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hall CM, Elcioglu NH, MacDermot KD, Offiah AC, Winter RM. Spondyloepimetaphyseal dysplasia with multiple dislocations (Hall type): three further cases and evidence of autosomal dominant inheritance. J Med Genet. 2002;39:666–670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lian JB, Stein GS, Van Wijnen AJ, et al. MicroRNA control of bone formation and homeostasis. Nat Rev Endocrinol. 2012;8:212–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Vimalraj S, Miranda PJ, Ramyakrishna B, Selvamurugan N. Regulation of breast cancer and bone metastasis by microRNAs. Dis Markers. 2013;35:369–387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhao X, Xu D, Li Y, et al. MicroRNAs regulate bone metabolism. J Bone Miner Metab. 2014;32:221–231. [DOI] [PubMed] [Google Scholar]
  • 23.Lian JB, Javed A, Zaidi SK, et al. 2004. Regulatory controls for osteoblast growth and differentiation: role of Runx/Cbfa/AML factors. Critical Reviews™ in Eukaryotic Gene Expression 14 (1&2). [PubMed] [Google Scholar]
  • 24.Li Z, Hassan MQ, Volinia S, et al. A microRNA signature for a BMP2-induced osteoblast lineage commitment program. Proc Natl Acad Sci. 2008;105:13906–13911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Song J, Jin E-H, Kim D, Kim KY, Chun C-H, Jin E-J. MicroRNA-222 regulates MMP-13 via targeting HDAC-4 during osteoarthitis pathogenesis. BBA Clinical 2015;3:79–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wang JX, Zhang XJ, Feng CS, et al. MicroRNA-532-3p regulates mitochondrial fission through targeting apoptosis repressor with caspase recruitment domain in doxorubicin cardiotoxicity. Cell Death Dis. 2015;6:e1677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Meng F, Zhang Z, Chen W, et al. MicroRNA-320 regulates matrix metalloproteinase-13 expression in chondrogenesis and interleukin-1β-induced chondrocyte responses. Osteoarthritis Cartilage 2016;24:932–941. [DOI] [PubMed] [Google Scholar]
  • 28.Liang Y, Duan L, Xiong J, et al. E2 regulates MMP-13 via targeting miR-140 in IL-1β-induced extracellular matrix degradation in human chondrocytes. Arthritis Res Ther 2016;18:105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Si H-b, Zeng Y, Liu S-y, et al. Intra-articular injection of microRNA-140 (miRNA-140) alleviates osteoarthitis (OA) progression by modulating extracellular matrix (ECM) homeostasis in rats. Osteoarthritis Cartilage 2017;25:1698–1707. [DOI] [PubMed] [Google Scholar]
  • 30.Selvamurugan N, Kwok S, Vasilov A, Jefcoat SC, Partridge NC. Effects of BMP-2 and pulsed electromagnetic field (PEMF) on rat primary osteoblastic cell proliferation and gene expression. J Orthop Res. 2007;25:1213–1220. [DOI] [PubMed] [Google Scholar]
  • 31.Zhang Y, Deng X, Scheller EL, et al. The effects of Runx2 immobilization on poly (epsilon-caprolactone) on osteoblast differentiation of bone marrow stromal cells in vitro. Biomaterials 2010;31:3231–3236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Vishal M, Vimalraj S, Ajeetha R, et al. MicroRNA-590-5p stabilizes runx2 by targeting smad7 during osteoblast differentiation. J Cell Physiol. 2017;232:371–380. [DOI] [PubMed] [Google Scholar]
  • 33.Kozomara A, Griffiths-Jones S. MiRBase: annotating high confidence microRNAs using deep sequencing data. Nucl Acids Res. 2013;42:D68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rennie W, Liu C, Carmack CS, et al. STarMir: a web server for prediction of microRNA binding sites. Nucl Acids Res. 2014;42: W114–W118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Cao S, Chen S-J. Predicting kissing interactions in microRNA-target complex and assessment of microRNA activity. Nucl Acids Res. 2012;40:4681–4690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Selvamurugan N, Chou W-Y, Pearman AT, Pulumati MR, Partridge NC. Parathyroid hormone regulates the rat collagenase-3 promoter in osteoblastic cells though the cooperative interaction of the activator protein-1 site and the runt domain binding sequence. J Biol Chem. 1998;273:10647–10657. [DOI] [PubMed] [Google Scholar]
  • 37.Winchester SK, Selvamurugan N, D'Alonzo RC, Partridge NC. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and therunt domain binding sites. J Biol Chem. 2000;275:23310–23318. [DOI] [PubMed] [Google Scholar]
  • 38.Shimizu E, Selvamurugan N, Westendorf JJ, Olson EN, Partridge NC. HDAC4 represses matrix metalloproteinase-13 transcription in osteoblastic cells, and parathyroid hormone controls this repression. J Biol Chem. 2010;285:9616–9626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747–754. [DOI] [PubMed] [Google Scholar]
  • 40.Prince M, Banerjee C, Javed A, et al. Expression and regulation of Runx2/Cbfa1 and osteoblast phenotypic markers during the growth and differentiation of human osteoblasts. J Cell Biochem. 2001;80:424–440. [DOI] [PubMed] [Google Scholar]
  • 41.Javed A, Bae JS, Afzal F, et al. Structural coupling of Smad and Runx2 for execution of the BMP2 osteogenic signal. J Biol Chem. 2008;283:8412–8422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Komori T Regulation of osteoblast differentiation by Runx2. Adv Exp Med Biol. 2010;658:43–49. [DOI] [PubMed] [Google Scholar]
  • 43.Muthusami S, Senthilkumar K, Vignesh C, et al. Effects of Cissus quadrangularis on the proliferation, differentiation and matrix mineralization of human osteoblast like SaOS-2 cells. J Cell Biochem. 2011;112:1035–1045. [DOI] [PubMed] [Google Scholar]
  • 44.Selvamurugan N, He Z, Rifkin D, Dabovic B, Partridge NC. Pulsed electromagnetic field regulates MicroRNA 21 expression to activate TGF- β signaling in human bone marrow stromal cells to enhance osteoblast differentiation. Stem Cells Int. 2017;2017:2450327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Arumugam B, Balagangadharan K, Selvamurugan N. Syringic acid, a phenolic acid, promotes osteoblast differentiation by stimulation of Runx2 expression and targeting of Smad7 by miR-21 in mouse mesenchymal stem cells. J Cell Commun Signal. 2018. 10.1007/s12079-018-0449-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Dhivya S, Keshav Narayan A, Logith Kumar R, Viji Chandran S, Vairamani M, Selvamurugan N. Proliferation and differentiation of mesenchymal stem cells on scaffolds containing chitosan, calcium polyphosphate and pigeonite for bone tissue engineering. Cell Prolif. 2018;51:e12408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Shimizu E, Nakatani T, He Z, Partridge NC. Parathyroid hormone regulates histone deacetylase (HDAC) 4 through protein kinase A-mediated phosphorylation and dephosphorylation in osteoblastic cells. J Biol Chem. 2014;289:21340–21350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Nakatani T, Chen T, Partridge NC. MMP-13 is one of the critical mediators of the effect of HDAC4 deletion on the skeleton. Bone. 2016;90:142–151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bradley EW, Carpio LR, Van Wijnen AJ, McGee-Lawrence ME, Westendorf JJ. Histone deacetylases in bone development and skeletal disorders. Physiol Rev. 2015;95:1359–1381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wang Z, Qin G, Zhao TC. HDAC4: mechanism of regulation and biological functions. Epigenomics. 2014;6:139–150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Vimalraj S, Partridge NC, Selvamurugan N. A positive role of MicroRNA-15b on regulation of osteoblast differentiation. J Cell Physiol. 2014;229:1236–1244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Chen W, Sheng P, Huang Z, et al. MicroRNA-381 regulates chondrocyte hypertrophy by inhibiting histone deacetylase 4 expression. Int J Mol Sci. 2016;17:1377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Vishal M, Ajeetha R, Keerthana R, Selvamurugan N. Regulation of Runx2 by histone deacetylases in bone. Curr Protein Pept Sci. 2016;17:343–351. [DOI] [PubMed] [Google Scholar]
  • 54.Vimalraj S, Selvamurugan N. MicroRNAs: synthesis, gene regulation and osteoblast differentiation. Curr Issues Mol Biol. 2012;15:7–18. [PubMed] [Google Scholar]
  • 55.Moorthi A, Vimalraj S, Chaudhary A, He Z, Partridge NC, Selvamurugan N. Expression of microRNA-30c and its target genes by nano-Bioglass ceramic-treatment in human osteoblastic cells. Int J Biol Macromol. 2013;56:181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Taipaleenmäki H, Browne G, Akech J, et al. Targeting of Runx2 by miR-135 and miR-203 impairs progression of breast cancer and metastatic bone disease. Cancer Res. 2015;75:1433–1444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Colden M, Dar AA, Saini S, et al. MicroRNA-466 inhibits tumor growth and bone metastasis in prostate cancer by direct regulation of osteogenic transcription factor RUNX2. Cell Death Dis. 2017;8: e2572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Akhtar N, Rasheed Z, Ramamurthy S, Anbazhagan AN, Voss FR, Haqqi TM. MicroRNA-27b regulates the expression of matrix metalloproteinase 13 in human osteoarthitis chondrocytes. Arthritis Rheum. 2010;62:1361–1371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Xu N, Zhang L, Meisgen F, et al. MicroRNA-125b down-regulates matrix metallopeptidase 13 and inhibits cutaneous squamous cell carcinoma cell proliferation, migration, and invasion. J Biol Chem. 2012;287:29899–29908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Wu Z, Yin H, Liu T, et al. MiR-126-5p regulates osteoclast differentiation and bone resorption in giant cell tumor through inhibition of MMP-13. Biochem Biophys Res Commun. 2014;443: 944–949. [DOI] [PubMed] [Google Scholar]
  • 61.Yu X, Wei F, Yu J, et al. Matrix metalloproteinase 13: a potential intermediate between low expression of microRNA-125b and increasing metastatic potential of non-small cell lung cancer. Cancer Gen. 2015;208:76–84. [DOI] [PubMed] [Google Scholar]
  • 62.Osako Y, Seki N, Kita Y, et al. Regulation of MMP-13 by antitumor microRNA-375 markedly inhibits cancer cell migration and invasion in esophageal squamous cell carcinoma. Int J Oncol. 2016;49:2255–2264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Liu Q, Zhang X, Hu X, et al. Circular RNA related to the chondrocyte ECM regulates MMP-13 Expression by functioning as a MiR-136 ‘Sponge’in human cartilage degradation. Sci Rep. 2016; 6:22572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Xue J, Chen Z, Gu X, Zhang Y, Zhang W. MicroRNA-148a inhibits migration of breast cancer cells by targeting MMP-13. Tum Biol. 2016;37:1581–1590. [DOI] [PubMed] [Google Scholar]
  • 65.Li J, Wang G, Jiang J, et al. Dynamical expression of microRNA-127-3p in proliferating and differentiating C2C12 cells. Asian-Australas J Anim Sci 2016;29:1790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Hua WB, Wu XH, Zhang YK, et al. Dysregulated miR-127-5p contributes to type II collagen degradation by targeting matrix metalloproteinase-13 in human intervertebral disc degeneration. Biochimie. 2017;139:74–80. [DOI] [PubMed] [Google Scholar]
  • 67.Ahram M, Mustafa E, Zaza R, et al. Differential expression and androgen regulation of microRNAs and metalloprotease 13 in breast cancer cells. Cell Biol Int. 2017;17. [DOI] [PubMed] [Google Scholar]

RESOURCES