Skip to main content
G3: Genes | Genomes | Genetics logoLink to G3: Genes | Genomes | Genetics
. 2020 Jun 29;10(9):3015–3024. doi: 10.1534/g3.120.401502

Ultraconserved Non-coding DNA Within Diptera and Hymenoptera

Thomas Brody *, Amarendra Yavatkar , Alexander Kuzin *, Ward F Odenwald *
PMCID: PMC7466983  PMID: 32601058

Abstract

This study has taken advantage of the availability of the assembled genomic sequence of flies, mosquitos, ants and bees to explore the presence of ultraconserved sequence elements in these phylogenetic groups. We compared non-coding sequences found within and flanking Drosophila developmental genes to homologous sequences in Ceratitis capitata and Musca domestica. Many of the conserved sequence blocks (CSBs) that constitute Drosophila cis-regulatory DNA, recognized by EvoPrinter alignment protocols, are also conserved in Ceratitis and Musca. Also conserved is the position but not necessarily the orientation of many of these ultraconserved CSBs (uCSBs) with respect to flanking genes. Using the mosquito EvoPrint algorithm, we have also identified uCSBs shared among distantly related mosquito species. Side by side comparison of bee and ant EvoPrints of selected developmental genes identify uCSBs shared between these two Hymenoptera, as well as less conserved CSBs in either one or the other taxon but not in both. Analysis of uCSBs in these dipterans and Hymenoptera will lead to a greater understanding of their evolutionary origin and function of their conserved non-coding sequences and aid in discovery of core elements of enhancers.

This study applies the phylogenetic footprinting program EvoPrinter to detection of ultraconserved non-coding sequence elements in Diptera, including flies and mosquitos, and Hymenoptera, including ants and bees. EvoPrinter outputs an interspecies comparison as a single sequence in terms of the input reference sequence. Ultraconserved sequences flanking known developmental genes were detected in Ceratitis and Musca when compared with Drosophila species, in Aedes and Culex when compared with Anopheles, and between ants and bees. Our methods are useful in detecting and understanding the core evolutionarily hardened sequences required for gene regulation.

Keywords: Ultraconserved non-coding sequences, EvoPrinter, Enhancers


Phylogenetic footprinting of Drosophila genomic DNA has revealed that cis-regulatory enhancers can be distinguished from other essential gene regions based on their characteristic pattern of conserved sequences (Hardison 2000; Bergman et al. 2002; Odenwald et al. 2005; Pennacchio et al. 2006; Brody et al. 2007; Kuzin et al. 2009; Kuzin et al. 2012). Cross-species alignments have also identified conserved non-coding sequence elements associated with vertebrate developmental genes (Thomas et al. 2003; Bejerano et al. 2005), and sequences that are conserved among ancient and modern vertebrates (e.g., the sea lamprey and mammals). Elements conserved between disparate taxa are considered to be ‘ultraconserved elements’ (Irvine et al. 2002; Visel et al., 2008; McEwen et al. 2009; Maeso et al. 2012). Many of these sequences act as cis-regulators of transcription (Pennacchio et al. 2006; Irvine et al. 2002; Visel et al. 2008; Visel et al. 2013; Dickel et al., 2018). Previous studies have identified ultra-conserved elements in dipterans, Drosophila species and sepsids and mosquitos (Glazov et al. 2005; Hare et al. 2008; Sieglaff et al. 2009 Engstrom et al., 2007; Tan et al., 2019). Comparison of consensus transcription factor binding sites in the spider Cupiennius salei and the beetle Tribolium castaneum have been shown to be functional in transgenic Drosophila (Ayyar et al. 2010).

In this study, we describe sequence conservation of non-coding sequences within and flanking developmentally important genes in the medfly Ceratitis capitata, the house fly Musca domestica and Drosophila genomic sequences (Table 1). The house fly and Medfly have each diverged from Drosophila for ∼100 and ∼120 My respectively (Beverley and Wilson, 1984). Our analysis reveals that, in many cases, CSBs that are highly conserved in Drosophila species, as detected using the Drosophila EvoPrinter algorithm, are also conserved in Ceratitis and Musca. Additionally, the linear order of these ultraconserved CSBs (uCSBs) with respect to flanking structural genes is also maintained. However, a subset of the uCSBs exhibits inverted orientation relative to the Drosophila sequence, suggesting that while enhancer location is conserved, their orientation relative to flanking genes is not.

Table 1. Genomic regions analyzed for presence of uCSBs.

Insect Order Species Gene Genomic Location Conserved Sequence Blocks Figure
Diptera Drosophila melanogaster (Dm), Musca domestica (Md), Ceratitis capitata (Cc) ventral veins lacking/prata intragenic Drosophila melanogaster chr3L: 6,821,518-6,823,267 spanning 1,749 bp Musca domestica - 3 uCSBsb Fig 1
Ceratitis capitata - 4 uCSBs
Diptera Dm, Md, Cc ventral veins lacking/prat2a intragenic Drosophila melanogaster chr3L: 6,816,217-6,837,478 intragenic spanning 21,261 bp Musca domestica - 8 uCSBs Fig S1
Ceratitis capitata - 8 uCSBs
Diptera Dm, Md, Cc homothorax Drosophila melanogaster chr3R:10,558,002-10,613,102 upstream & intronic spanning 55,100 bp Musca domestica - 16 uCSB6 Not shown
Ceratitis capitata - 17 uCSBs
Diptera Dm, Md, Cc homothorax Drosophila melanogaster chr3R:10,612,883-10,613,947 upstream & intronic spanning 1,064 bp Musca domestica - 3 uCSBs Fig S2
Ceratitis capitata - 3 uCSBs
Diptera DM, Md, Cc goosecoid Drosophila melanogaster chr2L:583,290-599,309 upstream & intronic spanning 16,029 bp Musca domestica - 4 uCSBs Not shown
Ceratitis capitata - 6 uCSBs
Diptera Drn, Md, Cc castor Drosophila melanogaster chr3R:5,713,291-5,733,135 upstream spanning 19,844 bp Musca domestica - 2 uCSBs Not shown
Ceratitis capitata - 3 uCSBs
Diptera Dm, Md, Cc Dscam2c Drosophila rnelanogaster chr3L:7,180,410-7,230,562 upstream spanning 50,152 bp Musca domestica - 0 uCSBs Not shown
Ceratitis capitata - 3 uCSBs
Diptera Dm, Md, Cc wingless Drosophila melanogaster chr2L: upstream & intronic spanning 39,780 bp Musca domestica - 15 uCSBs Not shown
Ceratitis capitata — At least 1 uCSB, multiple genomic rearrangements
Diptera Anopheles gambiae (Ag), Aedes aegypti (Aa), Culex pipiens (Cp) Wnt oncogene analog 4 & wingless Anopheles gambiae chr3R:41,999,883-42,001,302 intragenic spanning 1,420 bp Aedes aegypti - 4 uCSBs Fig 2
Culex pipiens - 4 uCSBs
Diptera Ag, Aa, Cp glass bottom boat Anopheles gambiae chrX:15,337,999-15,343,860 upstream & intronic spanning 6,861 bp Aedes aegypti - none detected Not shown
Culex pipiens - none detected
Diptera Ag, Aa, Cp ventral veins lacking Anopheles gambiae chr2L:23,041,706-23-078,560 upstream & downstream spanning 36,855 bp Aedes aegypti - 3 uCSBs Not shown
Culex pipiens - 3 uCSBs
Diptera Ag, Aa, Cp goosecoid Anopheles gambiae chr2R:6,546,821-6,560,426 upstream & downstream spanning 13,605 bp Aedes aegypti - none detected Not shown
Culex pipiens - none detected
Diptera Ag Aa, Cp castor Anopheles gambiae chr3R:36,186,488-36,219,684 upstream spanning 33,198 bp Aedes aegypti - 3 uCSBs Not shown
Culex pipiens - 5 uCSBs
Diptera Ag, Aa, Cp homothorax Anopheles gambiae chr2R:17,034,707-17,103,053 upstream and intronic spanning 68,346 bp Aedes aegypti - 4 uCSBs Not shown
Culex pipiens - 4 uCSBs
Diptera Ag, Aa, Cp Dscam2c Anopheles gambiae chr2L:5,676,096-5,731,491 55,396 bp upstream & intronic Aedes aegypti - 8 uCSBs Not shown
Culex pipiens - 3 uCSBs
Hymenoptera 3 Apoidea (bees) & 4 Formicidae (ants) glass bottom boot Apis mellifera Group1:23,064,324-23,070,923 Wasmannia auropunctata LD307392.1 40,378-45,552 Five clusters conserved in both ants and bees; 4 clusters conserved in bees only; 1 cluster conserved in ants only Fig 3
Hymenoptera 7 Apoidea (bees) & 13 Formicidae (ants)d Dscam2c Apis mellifera GroupUn:45,913,123-45,915,930 Apis, Bombus, Habropoda, 2 CSB clusters & Megachile 1 CSB cluster Fig S4
Hymenoptera 7 Apoidea (bees) & 13 Formicidae (ants) goosecoid Apis mellifera Group6:69,716-71,416 Apis, Bombus, Habropoda and Megachile -1 CSB Fig S5A
Hymenoptera 7 Apoidea (bees) & 13 Formicidae (ants) castor Wasmannia auropunctata LD335973.1 523,260-526,337 Ants and Bees 1 CSB cluster, Ants only, 2 CSBs clusters Fig S5B
Hymenoptera 7 Apoidea (bees) & 13 Formicidae (ants) homothorax Apis mellifera Group5: 7,111,372-7,117,900 W. auropunctata 40,378-45,552 3 CSB clusters conserved in ants & bees, 3,138 clusters conserved in only ants or bees Fig 56
Hymenoptera Apis mellifera (bee), Atta cephalotes (ant) wingless & Wnt oncogene analog 6 Apis mellifera Group1:17,441,047-17,526,896 Upstream, introgenic and intronic spanning 90,099 bp Atta cephalotes - 10 CSB clusters Not shown
a

Phosphoribosylamidotransferase 2.

b

Ultra-conserved Conserved Sequence Blocks.

c

Down syndrome cell adhesion molecule 2.

d

Species listed in Methods Section.

For detection of conserved sequences in mosquitos, we have adapted EvoPrinter algorithms to include 22 species of Anopheles plus Culex pipens and Aedes aegypti. Use of Anopheles species allows for the resolution of CSB clusters that resemble those of Drosophila. Comparison of Anopheles with Culex and Aedes, separated by ∼150 million years of evolutionary divergence (Krzywinski et al. 2006), reveals uCSBs shared among these taxa. Although mosquitoes are considered to be Dipterans, uCSBs were identified conserved between mosquito species but these were generally not found in flies.

In addition, we have developed EvoPrinter tools for sequence analysis of seven bee and thirteen ant species. Both ants and bees belong to the Hymenoptera order and have been separated by ∼170 million years (Peters et al. 2017). Within the bees, Megachile and Dufourea are sufficiently removed from Apis and Bombus (∼100 My) (Peters et al. 2017) that only portions of CSBs are shared between species: these can be considered to be uCSBs. uCSBs are found that are shared between ant and bee species (Faircloth et al. 2015), and these are positionally conserved with respect to their associated structural genes. Finally, we show that ant specific and bee specific CSB clusters that are not shared between the two taxa are in fact interspersed between shared uCSBs.

Methods

Sequence curation and alignment

Drosophila melanogaster (Dm), Apis mellifera (Am) and Anopheles gambiae (Ag), fly, bee and mosquito genomic sequences respectively, were curated from the UCSC genome browser. BLASTn (Altschul et al. 1990) was used to identify non-coding sequences within other species not represented in the UCSC genome browser. Where possible, BLAT (Kent 2002) and BLASTn were used in comparing the order and orientation of ultra-conserved sequences in reference species with dipteran, bee and mosquito test species. BLAT was not available for the Culex comparison to Aedes, but we found that the ‘align two sequences’ algorithm of BLAST, using the ‘Somewhat similar sequences’ (BLASTn) setting, was comparable to BLAT in sensitivity to sequence homology and was useful for this comparison. Similarly, the pairwise sequence alignment program Needle, which uses the Needleman-Wunsch algorithm (Needleman and Wunsch 1970), aligned shorter regions of near identity that could not be seen using other methods.

Identification and orientation analysis of non-coding conserved sequence

For comparison of Drosophila genomic sequence to Ceratitis and Musca, we first curated a D. melanogaster genomic sequence using the BLAT algorithm, verifying the orientation of the downloaded sequence. We then selected Ceratitis and Musca from the Refseq Genome Database and submitted the D. melanogaster sequence to BLAST using BLASTn. The BLAST answer table was sorted by ‘query start position’ and the orientation of the subject sequence with respect to the orientation of the input genomic was verified. Finally, we analyzed the conserved CSBs with respect to a within Drosophila EvoPrint of the input sequence.

For analysis of sequence conservation of mosquito, ant and bee genomes we developed EvoPrint algorithms for each taxonomic group. An EvoPrint provides a single uninterrupted view, with near base-pair resolution, of conserved sequences as they appear in a species of interest. Prior papers describe protocols for genome indexing, enhanced BLAT alignments and scoring of EvoPrint alignments (Odenwald et al. 2005; Yavatkar et al. 2008). For discovery of mosquito, ant and bee uCSBs, we first selected the sequence to be analyzed from respectively Anopheles gambiae or the Apis mellifera genome browser using a coding sequence as an anchor for assuring homologous hits. The curated sequences were submitted to either mosquito or bee EvoPrinterHD (evoprinter.ninds.nih.gov), and EvoPrints were generated as described previously (Odenwald et al., 2005; Yavatkar et al., 2008). For development of EvoPrintHD, in addition to using the original BLAT procedure (Kent 2002; Odenwald et al. 2005), we also generated overlapping 9 and 11 Kmers as described previously by (Yavatkar et al. 2008), improving the identification of conserved sequences, and these were used in the EvoPrintHD algorithm. For EvoPrinting ant genomic sequences, ant sequence homologous to the Apis sequence was curated using BLAST against a single ant species (Atta, for example). Care was taken to EvoPrint ant species whose region of interest was intact without major sequence interruptions. Ant and bee EvoPrints were examined in side-by-side comparison, using the align two sequence algorithm of BLAST to ensure accuracy.

To compare 24 Anopheles (A), Aedes and Culex genomes, sequences were obtained from VectorBase (https://beta.vectorbase.org/vectorbase.beta/app/). The mosquito EvoPrinter consists of 20 species as follows; 7 species of the Gambiae subgroup and related species A. christyi and A. epiroticus; 5 species of the Neocellia and Myzomyia series (including A. stephensi, A. maculates, A. calcifacies, A. funestus and A. minimus); 2 species of the Neomyzomyia series (A. darius and A. farauti); 2 species of subgenus Anopheles (A. sinensus and A. atroparvus); Nyssoryhynchus and other American species, (A. albimanus and A. darling); and two species of the subfamily Culicinae (Aedes aegypti and Culex quinquefaciatus). Mosquito genomes are documented by Holt et al. 2002; Nene et al. 2007; Reddy et al. 2012, and Neafsey et al. 2015.

We have also formatted seven bee species for EvoPrintHD analysis, including 6 members of the family Apidae and one member of each of the Megachilidae and Halictidae families (see Table S1). In addition, we have formatted 13 ant (Formicidae) species, a diverse family of social insects, for EvoPrinter analysis (see Table S1). Among these are eight species representative of the subfamily Myrmicinae, three representatives of the Formicinae, two of the Ponerinae, and one Dolichoderinae. For consistency, we selected a member of the Myrmicinae as input/reference sequence, and species selection was dependent on the integrity and completeness of the sequence.

Data availability

EvoPrinterHD application for Hymenoptera, Drosophila, and mosquitos is available at the following URL: https://evoprinter.ninds.nih.gov/evoprintprogramHD/evphd.html?. Instructions for EvoPrintHD are found at https://evoprinter.ninds.nih.gov/evopoverviewHD.htm. Supplemental material available at figshare: https://doi.org/10.25387/g3.12523505.

Results and Discussion

Comparative analysis of dipteran non-coding DNA

Our previous study of 19 consecutive in vivo tested Drosophila enhancers, contained within a 28.9 kb intragenic region located between the vvl and Prat2 genes, revealed that each CSB cluster functioned independently as a spatial/temporal cis-regulatory enhancer (Kundu et al. 2013). Submission of this enhancer field to the RefSeq Genome Database of Ceratitis capitata via BLASTn revealed 17 uCSBs; all 17 regions were colinear and located between the Ceratitis orthologs of Drosophila vvl and Prat2 genes. In each case the matches between Ceratitis and Drosophila corresponded to either a complete or a portion of a CSB identified by the Drosophila EvoPrinter as being highly conserved among Drosophila species (Kundu et al. 2013). Submission of the same Drosophila region to Musca domestica RefSeq Genome Database using BLASTn revealed 13 uCSBs that were colinearly arrayed within the Musca genome. Nine of these Ceratitis and Musca CSBs were present in both species and corresponded to CSBs contained in several of the enhancers identified in our previous study of the Drosophila enhancer field (Kundu et al. 2013). The conservation within one of these embryonic neuroblast enhancers, vvl-41, is depicted in Figure 1A and B and Table 1. Each of the CSB elements in vvl-41 that are shared between Dm and Ceratitis are in the same orientation with respect to the vvl structural gene. Figure S1 presents three-way alignments of each of the other eight uCSBs within the vvl enhancer field that are shared between Dm, Ceratitis and Musca. The uCSB of vvl-49 in Ceratitis is in reverse orientation with respect to the vvl structural gene. Many of the uCSBs in Musca are in a different orientation on the contig than in Dm, indicating microinversions. One of the two uCSBs in Ceratitis goosecoid was in reverse orientation compared to Drosophila CSBs, while three of the four uCSBs in Musca goosecoid were in reverse orientation (Table 1; data not shown). One uCSB each in Ceratitis and Musca castor was in reverse orientation compared to Drosophila castor. 10 of the 15 uCSBs in the Musca wingless non-coding region were in the reverse orientation compared to the orientation in Drosophila, while all uCSBs in Ceratitis Dscam2 were in forward orientation compared to the orientation in Drosophila. We conclude that, except for microinversions, the order and orientation is the same, with respect to flanking genes of highly conserved non-coding sequences in select developmental determinants of Drosophila, Ceratitis and Musca.

Figure 1.

Figure 1

Ultra-conserved sequences shared among a Drosophila ventral veins lacking enhancer and orthologous DNA within the Ceratitis capitata and Musca domestica genomes. A) An EvoPrint of the D. melanogaster vvl-41 neuroblast enhancer showing 1,775 bp, located 26.6 kb 3′ of the vvl transcribed sequence. Capital letters represent bases in the D. melanogaster reference sequence that are conserved in D. simulans, D. sechellia, D. yakuba, D. erecta, D. ananassae, D. persimilis, D. grimshawi, D. mojavensis and D. virilis orthologous DNAs. Lower case gray bases are not conserved in one or more of these species. Conserved sequence blocks (CSBs) shared with Ceratitis and Musca, as detected using BLASTn, DNA Block Aligner and the EvoPrinter CSB aligner are shown in Green text while red bases are shared between D. melanogaster and Ceratitis but not with Musca. B) Two and three-way alignments between of the ultra-conserved CSBs using BLASTn alignments. Green and red font annotations in the Drosophila CSBs are as describe above. Yellow highlighted bases in Ceratitis and Musca are not shared in Drosophila. Flanking BLASTn designator numbers indicate genomic sequence positions.

Many of the non-coding regions in dipteran genomes contain uCSBs, especially in and around developmental determinants, and many of these are likely to be cis-regulatory elements such as those found in the vvl enhancer field. Another example is the prevalence of uCSBs found in the non-coding sequences associated the Dm hth gene locus. A previous study identified an ultraconserved region in hth shared between Drosophila and Anopheles (Glazov et al. 2005). We have identified additional hth uCSBs shared among Dm, Ceratitis and Musca. We examined a 55,100 bp upstream region of Dm hth terminating just after the start of the first exon. We identified a total of 11 CSBs shared between the three species, 5 CSBs shared between Dm and Ceratitis but not Musca, and 6 CSBs shared between Dm and Musca, but not Ceratitis (see Table 1, Figure S2 and data not shown). Ceratitis exhibited 4 uCSBs and Musca exhibited 8 uCSBs that were in reversed orientation with respect to the Drosophila orthologous regions. Additional genes analyzed in this paper were also analyzed for association with uCSBs in Ceratitis and Musca, and these results are summarized in Table 1. In some cases, for example wingless in Ceratitis, the presence of uCSBs could not be verified because of the incomplete assembly of the genome, leaving coding sequences and uCSBs on different contigs. In another case, Dscam2 in Musca, no uCSBs were identified.

EvoPrint analysis of Drosophila hth sequences immediately upstream and including the first exon, revealed a conserved sequence cluster (see Figure S2) associated with the transcriptional start site. Fig. S2A illustrates correspondence of the Dm conserved region in Ceratitis and Musca. Two of the longer CSBs were conserved in both Ceratitis and Musca, one shorter CSB was conserved only in Musca, and a second shorter CSB was conserved only in Ceratitis. Two and three-way alignments as revealed by BLASTn in a comparison of Dm, Ceratitis and Musca are shown in Figure S2B. Each of the uCSBs was in the same orientation with respect to the hth structural gene.

Discovery of non-coding conserved sequence elements in mosquitoes

EvoPrinting combinations of species using A. gambiae as a reference species and multiple species from the Neocellia and Myzomyia series and the Neomyzomyia provides a sufficient evolutionary distance from A. gambiae to resolve CSBs. Phylogenic analysis has revealed the Anopheles species diverged from ∼48 My to ∼30 My (Kamali et al., 2014) while Aedes and Culex diversified from the Anopheles lineage in the Jurassic era (∼145–200 Mya) (Krzywinski et al. 2006) or even earlier.

We sought to identify uCSBs in selected mosquito developmental genes (Table 1) by comparing Anopheles species with Aedes and Culex. We used non-coding sequences associated with the mosquito homolog of the morphogen wingless to discover associated conserved non-coding sequences. Figure 2 illustrates a CSB cluster slightly more than 27,000 bp upstream of the A. gambiae wingless coding exons. CSB orientation in A. gambiae was reversed with respect to the ORF when compared to the orentations of both Culex and Aedes CSBs. It is noteworthy that this EvoPrint, carried out using multiple Anopheles, consists of a cluster of CSBs, resembling EvoPrints carried out using Drosophila species (Odenwald et al. 2005; Brody et al. 2007; Kuzin et al. 2009; Kuzin et al. 2012). This general pattern of CSB clusters separated by poorly conserved ‘spacers’ is prevalent among other developmental determinants in mosquitos (data not show). uCSBs, conserved in Culex and Aedes, coincide with CSBs revealed by EvoPrint analysis of Anopheles non-coding sequences. Figure S3 illustrates an EvoPrinter scorecard for the non-coding wingless-associated CSB cluster described in Figure 2. Scores for the first four species, all members of the gambiae complex, are similar to that of A. gambiae against itself, with subsequent scores reflecting increased divergence from A. gambiae. Culex and Aedes are distinguished from the other species by their belonging to a distinctive branch of the mosquito evolutionary tree, the Culicinae subfamily and their low scores against the A. gambiae input sequence. No uCSBs were detected associated with gbb or gsc, while uCSBs were readily detected associated with vvl, cas and hth (Table 1). A single uCSB in Aedes cas and two uCSBs in Culex cas exhibited a reverse configuration compared to the uCSBs in Anopheles (data not shown). One uCSB in Culex vvl and no uCSBs in Aedes vvl exhibited a reverse configuration compared to the uCSB in Anopheles (data not shown). Finally, all uCSBs in Culex and Aedes hth were in forward orientation compared to Anopheles (data not show). None of the uCSBs shared between Drosophila, Ceratitis and Musca were conserved in mosquitos, with the exception of a single uCSB associated with a 3′UTR (CTTCGTTTTTGCAAGAGGCCCATATAGCTCGCCAA) that is fully conserved in the Dipteran species tested, A possible explanation for this lack of conservation is the observation that mosquitos are only distantly related to Diptera (Wiegmann et al. 2011).

Figure 2.

Figure 2

EvoPrint analysis of the intragenic region adjacent to the Anopheles Wnt-4 and wingless genes identifies ultra-conserved sequences shared with the evolutionary distant Culex pipiens and Aedes aegypti genomes. A) Anopheles gambiae genomic EvoPrint that spans 1,420 bp, located 10.2 kb upstream of the Wnt-4 gene and 27.5 kb upstream of the wingless gene which is transcribed in the opposite orientation of Wnt-4 transcription. Capital letters (all font colors) represent bases conserved in all or all but one of the following Anopheles test species: A. gambiae-S1, A. merus, A. melas, A. epiroticus, A. christyi, A. funestus, A. culicifacies, A. dirus or A. farauti. Lower case gray letters represent bases that are not conserved in two or more of the Anopheles species included in the relaxed EvoPrint. Green uppercase bases indicate sequences are conserved in the Anopheles species, Culex pipiens and Aedes aegypti, blue font indicates Anopheles sequences that are shared only between Culex pipiens but not with Aedes aegypti and red font sequences are present only in Anopheles and Culex. B) To confirm the shared ultra-conserved CSBs, two and three-way BLASTn alignments of the shared sequences are shown. Color coding is as in panel A and yellow highlighted bases in the three-way alignments indicate identity between Culex and Aedes that is not present in Anopheles. Flanking BLASTn designator numbers indicate genome base positions.

Conserved sequence elements in bees and ants

Bees and ants are members of the Hymenoptera Order, representing the Apoidea (bee) and Vespoidea (ant) super-families. Current estimates suggest that the two families have evolved separately for over 100 million years (Peters 2017). To identify conserved sequences either shared by bees and ants or unique to each family, we developed EvoPrinter alignment tools for seven bee and 13 ant species (see Table S1) and searched for CSBs that flank developmental determinants (Table 1). Three approaches were employed to identify/confirm conserved elements and their positioning within bee and ant orthologous DNAs. First, EvoPrinter analysis of bee and ant genes identified conserved sequences in either bees or ants and ultra-conserved sequence elements shared by both families (Figure 3 and Figures S5 and S6). Second, BLASTn alignments of the orthologous DNAs identified/confirmed CSBs that were either bee or ant specific or shared by both (Table 1). Third, side-by-side comparisons of ant and bee EvoPrints and BLASTn comparisons revealed similar positioning of orthologous CSBs relative to conserved exons (Figure 3, Figure S7 and data not shown).

Figure 3.

Figure 3

Side-by-side comparison of conserved sequences within the bee and ant glass bottom boat loci identify clusters of conserved and species-specific sequences. A) Relaxed EvoPrint of Apis mellifera genomic DNA that includes the glass bottom boat (gbb) second and third exons (red underlined sequences) plus flanking intronic sequences (6.6 kb). Black uppercase bases are conserved in all test bee species and colored uppercase bases are conserved in all but one of the color-coded test species: Bombus terrestrialis, Habropoda laboriosa, Megachile rotundata and Bombus impatiens. First and second exons sequences underlined red. Blue underlined sequences are homologous to underlined sequences in panel B. Vertical red bars flanking the EvoPrint indicate conserved bee-specific sequences that are not found in ants. B) Relaxed EvoPrint of Wasmannia auropunctata DNA that spans the second and third exons of the gbb gene including their flanking intronic sequences (5.1 kb). As in panel A, black uppercase bases are conserved in all test ant species and colored uppercase bases are conserved in all but one of the color-coded species: Cardiocondyla obscurior, Cerapachys biroi and Linepithema humile. Red and blue underlined sequences are respectively homologous coding and non-coding sequences in panel A and the green vertical bar flanking the EvoPrint indicates ant-specific conserved sequences that are not found in bees.

To identify conserved sequences within bee species we initially generated EvoPrints of the honey bee (Apis mellifera) genes using other Apis and Bombus species. Using EvoPrints of the Dscam2 locus, we resolved clusters of conserved sequences (see Figure S3). Dscam2 is implicated in axon guidance in Drosophila (Millard et al. 2007) and in regulation of social immunity behavior in honeybees (Cremer et al. 2007; Harpur et al. 2019). The EvoPrint scorecard (see Figure S4) reveals a high score (close relationship) with the homologous region in the other two Apis species. The more distant Bombus species score lower by greater than 50%, and Habropoda represents a step down from the more closely related Bombus species. Megachile shows a significantly lower score reflecting its more distant relationship to Apis mellifera. The relaxed EvoPrint (Yavatkar et al. 2008) readout reveals two CSB clusters (see Figure S4). Only one sequence cluster, the lower 3′ cluster, is conserved in all six test species examined, while the 5′ cluster is present in all species except Megachile. BLAST searches confirmed that the 3′ cluster was absent from Megachile, a more distant species Dufourea novaeangliae, and all ant species in the RefSeq genome database (data not shown). BLASTn alignments also revealed conservation of the 3′ cluster in D. novaeangliae, the wasp species Polistes canadensis and two ant species, Vollenhavia emeryi and Dinoponera quadriceps.

EvoPrinter analysis of bee and ant genes that are orthologs of Drosophila neural development genes goosecoid (gsc) and castor (cas) revealed conserved non-coding DNA that is unique to either bees or ants or conserved in both (see Figure S5). EvoPrints of the Hymenoptera orthologs identify non-coding conserved sequence clusters that contained core uCSBs shared by both ant and bee superfamilies, and these uCSBs are frequently flanked by family-specific conserved clusters. For example, analysis of the non-coding sequence upstream of the Wasmannia auropunctata (ant) cas first exon identifies both a conserved sequence cluster that contains ant and bee uCSBs and an ant specific conserved cluster that has no counterpart found in bees (see Figure S5B and data not shown). It is likely that the ant specific cluster was deleted in bees, since BLASTn searches of Wasmannia against the European paper wasp Polistes dominula reveals conservation of a core sequence corresponding to this cluster (data not shown). The combined evolutionary divergence in the gsc and cas EvoPrints, accomplished by use of multiple test species, reveals that many of the amino acid codon specificity positions are conserved while wobble positions in their ORFs are not (see Figure S5). The lack of wobble conservation indicates that the combined divergence of the test species used to generate the prints afford near base pair resolution of essential DNA.

Cross-group/side-by-side bee and ant comparison of their conserved DNA was performed using bee specific and ant specific EvoPrints and by BLASTn alignments (Figures 3 and Figure S6 and data not shown). Figure 3 highlights the conservation observed among bee and ant exons and flanking sequence of the glass bottom boat (gbb, 60A) locus of Apis melliflera EvoPrinted with four bee test species (panel A) and the Wasmannia auropunctata gbb locus EvoPrinted with three ant species (panel B). Position and orientation of these CSB clusters and uCSBs is conserved. Coding sequences are underlined red, non-coding homologous regions are underlined blue, and novel CSBs present in either ants or bees but not both are indicated by the vertical lines to the side of each EvoPrint. Similarly, EvoPrinting a single exon and flanking regions of the Apis mellifera homothorax locus with four bee species and generating an ant specific EvoPrint of the orthologous ant sequence of the Ooceraea biroi homothorax locus with ten other ant species, reveals CSBs that are conserved in both Apis and Ooceraea, as well as sequences that are restricted to one of the two Hymenopteran families (see Figure S6).

CSBs associated with wingless in Apis mellifera and Atta cephalotes (Table1) were grouped in clusters similar to those found in Drosophila species (Yavatkar et al., 2008 and Kundu et al. 2013).

Summary

This study describes the use of EvoPrinter to detect the presence of ultraconserved non-coding sequences in flies, including Drosophila species, Ceratitis and Musca, in mosquitos and in Hymenoptera species. uCSBs of the three fly taxa have, for the most part, maintained their linear order suggesting a functional constraint on the order of regulatory sequences. For mosquitos, an older taxon than that of flies and the Hymenoptera, uCSBs are found to be shared between Anopheles, Culex and Aedes. Importantly, in Hymenoptera, we found uCSBs within clusters of conserved sequences shared between ants and bees. This conservation of core sequences in enhancers suggests that these morphologically divergent taxa share common regulatory networks. Our approaches to detection of uCSBs in flies, mosquitos and ants and bees will lead to a greater understanding of their evolutionary origin and the function of their conserved non-coding sequences. Knowledge of clusters of CSBs and of uCSBs is an important tool for discovery of the core elements of enhancers and their sequence extent.

In most cases both nBLAST and the EvoPrinter algorithm had similar sensitivities and gave comparable results. However, we recommend that the two techniques should be used in conjunction with one another to enhance CSB and uCSB detection. For example, by using both approaches, we discovered uCSBs that were identified by one tool but not both. The advantage of EvoPrinter is the presentation of an interspecies comparison as a single sequence, while the advantage of nBLAST is that it provides a sensitive detection of sequence homology in a one-on-one alignment. EMBOSSED Needle alignment gives an even more sensitive detection of shorter sequences and is of use once BLAT or EvoPrinter has been used to discover shared CSBs and/or CSB clusters.

Acknowledgments

We would like to acknowledge the editorial expertise, support and assistance of Judy Brody, Mihaela Serpe, Rosario Vicidomini, and Saumitra Choudhury.

Footnotes

Supplemental material available at figshare: https://doi.org/10.25387/g3.12523505.

Communicating editor: E. Betran

Literature Cited

  1. Ayyar S., Negre B., Simpson P., and Stollewerk A., 2010.  An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian. BMC Biol. 8: 127 10.1186/1741-7007-8-127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Altschul S. F., Gish W., Miller W., Myers E. W., and Lipman D. J., 1990.  Basic local alignment search tool. J. Mol. Biol. 215: 403–410. 10.1016/S0022-2836(05)80360-2 [DOI] [PubMed] [Google Scholar]
  3. Bejerano G., Siepel A. C., Kent W. J., and Haussler D., 2005.  Computational screening of conserved genomic DNA in search of functional noncoding elements. Nat. Methods 2: 535–545. 10.1038/nmeth0705-535 [DOI] [PubMed] [Google Scholar]
  4. Bergman C. M., Pfeiffer B. D., Rincon-Limas D.E., Hoskins R. A., Gnirke A. et al. , 2002.  Assessing the impact of comparative genomic sequence data on the functional annotation of the Drosophila genome. Genome Bio 3: RESEARCH0086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Beverley S. M., and Wilson A. C., 1984.  Molecular evolution in Drosophila and the higher Diptera II. A time scale for fly evolution. J. Mol. Evol. 21: 1–13. 10.1007/BF02100622 [DOI] [PubMed] [Google Scholar]
  6. Brody T., Rasband W., Baler K., Kuzin A., Kundu M. et al. , 2007.  cis-Decoder discovers constellations of conserved DNA sequences shared among tissue-specific enhancers. Genome Biol. 8: R75 10.1186/gb-2007-8-5-r75 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cremer S., Armitage S. A., and Schmid-Hempel P., 2007.  Social immunity. Curr. Biol. 17: R693–R702. 10.1016/j.cub.2007.06.008 [DOI] [PubMed] [Google Scholar]
  8. Dickel D. E., Ypsilanti A. R., Pla R., Zhu Y., Barozzi I. et al. , 2018.  Ultraconserved enhancers are required for normal development. Cell 172: 491–499.e15. 10.1016/j.cell.2017.12.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Engstrom P. G., Ho Sui S. J., Drivenes O., Becker T. S., and Lenhard B., 2007.  Genomic regulatory blocks underlie extensive microsynteny conservation in insects. Genome Res. 17: 1898–1908. 10.1101/gr.6669607 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Faircloth B. C., Bransletter M. G., White N. D., and Brady S. G., 2015.  Target enrichment of ultraconserved elements from arthropods provides a genomic perspective on relationships among Hymenoptera. Mol. Ecol. Resour. 2015 15: 489–501. 10.1101/gr.3545105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Glazov E. A., Pheasant M., McGraw E. A., Bejerano G., and Mattick J. S., 2005.  Ultraconserved elements in insect genomes: a highly conserved intronic sequence implicated in the control of homothorax mRNA splicing. Genome Res. 15: 800–808. 10.1101/gr.3545105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hardison R. C., 2000.  Conserved noncoding sequences are reliable guides to regulatory elements. Trends Genet. 16: 369–372. 10.1016/S0168-9525(00)02081-3 [DOI] [PubMed] [Google Scholar]
  13. Harpur B. A., Guarna M. M., Huxter E., Higo H., Moon K. M. et al. , 2019.  Integrative Genomics Reveals the Genetics and Evolution of the Honey Bee’s Social Immune System. Genome Biol. Evol. 11: 937–948. 10.1093/gbe/evz018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hare E. E., Peterson B. K., Iyer V. N., Meier R., and Eisen M. B., 2008.  Sepsid even-skipped enhancers are functionally conserved in Drosophila despite lack of sequence conservation. PLoS Genet. 4: e1000106 10.1371/journal.pgen.1000106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Holt R. A., Subramanian G. M., Halpern A., Sutton G. G., Charlab R. et al. , 2002.  The genome sequence of the malaria mosquito Anopheles gambiae. Science 298: 129–149. 10.1126/science.1076181 [DOI] [PubMed] [Google Scholar]
  16. Irvine Q., Carr J. L., Bailey W. J., Kawasaki K., Shimizu N. et al. , 2002.  Genomic analysis of Hox clusters in the sea lamprey Petromyzon marinus. J. Exp. Zool. 294: 47–62. 10.1002/jez.10090 [DOI] [PubMed] [Google Scholar]
  17. Kamali M., Marek P. E., Peery A., Antonio-Nkondjio C., Ndo C. et al. , 2014.  Multigene phylogenetics reveals temporal diversification of major African malaria vectors. PLoS One 9: e93580 10.1371/journal.pone.0093580 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kent W. J., 2002.  BLAT–the BLAST-like alignment tool. Genome Res. 12: 656–664. 10.1101/gr.229202 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Krzywinski J., Grushko O. G., and Besansky N. J., 2006.  Analysis of the complete mitochondrial DNA from Anopheles funestus: an improved dipteran mitochondrial genome annotation and a temporal dimension of mosquito evolution. Mol. Phylogenet. Evol. 39: 417–423. 10.1016/j.ympev.2006.01.006 [DOI] [PubMed] [Google Scholar]
  20. Kundu M., Kuzin A., Lin T. Y., Lee C. H., Brody T. et al. , 2013.  Cis-regulatory complexity within a large non-coding region in the Drosophila genome. PLoS One 8: e60137 10.1371/journal.pone.0060137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kuzin A., Kundu M., Ekatomatis A., Brody T., and Odenwald W. F., 2009.  Conserved sequence block clustering and flanking inter-cluster flexibility delineate enhancers that regulate nerfin-1 expression during Drosophila CNS development. Gene Expr. Patterns 9: 65–72. 10.1016/j.gep.2008.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kuzin A., Kundu M., Ross J., Koizumi K., Brody T. et al. , 2012.  The cis-regulatory dynamics of the Drosophila CNS determinant castor are controlled by multiple sub-pattern enhancers. Gene Expr. Patterns 12: 261–272. 10.1016/j.gep.2012.05.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Maeso I., Irimia M., Tena J. J., Gonzalez-Perez E., Tran D. et al. , 2012.  An ancient genomic regulatory block conserved across bilaterians and its dismantling in tetrapods by retrogene replacement. Genome Res. 22: 642–655. 10.1101/gr.132233.111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. McEwen G. K., Goode D. K., Parker H. J., Woolfe A., Callaway H. et al. , 2009.  Early evolution of conserved regulatory sequences associated with development in vertebrates. PLoS Genet. 5: e1000762 10.1371/journal.pgen.1000762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Millard S. S., Flanagan J. J., Pappu K. S., Wu W., and Zipursky S. L., 2007.  Dscam2 mediates axonal tiling in the Drosophila visual system. Nature 447: 720–724. 10.1038/nature05855 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Neafsey D. E., Waterhouse R. M., Abai A. R., Aganezov S. S., Alekseyev M. A. et al. , 2015.  Mosquito genomics. Highly evolvable malaria vectors: the genomes of 16 Anopheles mosquitoes. Science 347: 1258522 10.1126/science.1258522 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Needleman S. B., and Wunsch C. D., 1970.  A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48: 443–453. 10.1016/0022-2836(70)90057-4 [DOI] [PubMed] [Google Scholar]
  28. Nene V., Wortman J. R., Lawson D., Haas B., Kodira C. et al. , 2007.  Genome sequence of Aedes aegypti, a major arbovirus vector. Science 316: 1718–1723. 10.1126/science.1138878 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Odenwald W. F., Rasband W., Kuzin A., and Brody T., 2005.  EVOPRINTER, a multigenomic comparative tool for rapid identification of functionally important DNA. Proc. Natl. Acad. Sci. USA 102: 14700–14705. 10.1073/pnas.0506915102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pennacchio L. A., Ahituv N., Moses A. M., Prabhakar S., Nobrega N. A. et al. , 2006.  In vivo enhancer analysis of human conserved non-coding sequences. Nature 444: 499–502. 10.1038/nature05295 [DOI] [PubMed] [Google Scholar]
  31. Peters R. S., Krogmann L., Mayer C., Donath A., Gunkel S. et al. , 2017.  Evolutionary History of the Hymenoptera. Curr. Biol. 27: 1013–1018. 10.1016/j.cub.2017.01.027 [DOI] [PubMed] [Google Scholar]
  32. Reddy B. P., Labbe P., and Corbel V., 2012.  Culex genome is not just another genome for comparative genomics. Parasit. Vectors 5: 63 10.1186/1756-3305-5-63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sieglaff D. H., Dunn W. A., Xie X. S., Megy K., Marinotti O. et al. , 2009.  Comparative genomics allows the discovery of cis-regulatory elements in mosquitoes. Proc. Natl. Acad. Sci. USA 106: 3053–3058. 10.1073/pnas.0813264106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tan G., Polychronopoulos D., and Lenhard B., 2019.  CNEr: A toolkit for exploring extreme noncoding conservation. PLOS Comput. Biol. 15: e1006940 10.1371/journal.pcbi.1006940 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Thomas J. W., Touchman J. W., Blakesley R. W., Bouffard G. G., Beckstrom-Sternberg S. M. et al. , 2003.  Comparative analyses of multi-species sequences from targeted genomic regions. Nature 424: 788–793. 10.1038/nature01858 [DOI] [PubMed] [Google Scholar]
  36. Visel A., Prabhakar S., Akiyama J. A., Shoukry M., Lewis L. D. et al. , 2008.  Ultraconservation identifies a small subset of extremely constrained developmental enhancers. Nat. Genet. 40: 158–160. 10.1038/ng.2007.55 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Visel A., Taher L., Girgis H., May D., Golonzhka O. et al. , 2013.  A high-resolution enhancer atlas of the developing telencephalon. Cell 152: 895–908. 10.1016/j.cell.2012.12.041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wiegmann B. M., Trautwein M. D., Winkler I. S., Barr N. B., Kim J. W. et al. , 2011.  Episodic radiations in the fly tree of life. Proc. Natl. Acad. Sci. USA 108: 5690–5695. 10.1073/pnas.1012675108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yavatkar A. S., Lin L. Y. J., Ross J., Fann Y., Brody T., Odenwald W. F., 2008.  Rapid detection and curation of conserved DNA via enhanced-BLAT and EvoPrinterHD analysis. BMC Genomics 9: 106 10.1186/1471-2164-9-106 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

EvoPrinterHD application for Hymenoptera, Drosophila, and mosquitos is available at the following URL: https://evoprinter.ninds.nih.gov/evoprintprogramHD/evphd.html?. Instructions for EvoPrintHD are found at https://evoprinter.ninds.nih.gov/evopoverviewHD.htm. Supplemental material available at figshare: https://doi.org/10.25387/g3.12523505.


Articles from G3: Genes|Genomes|Genetics are provided here courtesy of Oxford University Press

RESOURCES