Using CRISPR/Cas9 for Gene Knockout in Immunodeficient NSG Mice

Abstract

NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ (NSG) mice are an immunodeficient strain that enables human cell xenografts. However, NSG mice possess a complex genetic background that would complicate cross-breeding with other inbred transgenic or knockout mouse strains to establish a congenic strain with a desired genetic modification in the NSG background. Newly developed clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology enables modification of the mouse genome at the zygote stage without the need for extensive cross-breeding or the use of embryonic stem cells. In this chapter, we use the knockout of the X-linked Cybb gene as an example to describe our procedures for genetically modifying NSG mice using the CRISPR/Cas9 method. Briefly, two sgRNAs were designed and made to target exon 1 and exon 3 of the Cybb gene, and either sgRNA was then microinjected together with Cas9 mRNA into fertilized eggs collected from NSG mice. The injected embryos are subsequently transferred into the oviducts of pseudopregnant surrogate mothers. Offspring born to the foster mothers were genotyped by PCR and DNA sequencing. In this chapter, we describe our experiment procedures in detail and report our genotyping results for demonstrating that NSG mice can be genetically modified using the CRISPR/Cas9 technology in a highly efficient manner.

1. Introduction

Immunodeficient mouse strains, such as NOD.Cg-Prkdc^scid Il2rg^tm1Wjl/SzJ (NSG) mice [1], allow for xenotransplants of human cells. NSG mice carry two mutations in the nonobese diabetic (NOD)/ShiLtJ genetic background: knockout of the DNA repair gene Prkdc for severe combined immunodeficiency (scid), rendering the mice deficient in producing mature B and T lymphocytes, and a completely null allele of the IL2 receptor common gamma chain (IL2rg) gene, resulting in a deficiency of natural killer (NK) cell activity due to prevention of signaling through multiple cytokine receptors. Together, these immune deficiencies render NSG mice defective for graft rejection. Consequently, the NSG mouse strain is useful for human cell transplants to model human hematopoiesis and immune cell function, stem cell biology, tumor engraftment, and infectious disease research.

Further genetic modifications to the NSG mouse strain can generate improved models for studying human diseases or enhancing human cell transplants, such as by expressing human hematopoietic cytokines for increased engraftment of specific human hematopoietic cell lineages [2–4]. Until recently, the introduction of new genetic modifications into the complex NSG background has relied on crossbreeding with other established knockout or knockin mouse strains, requiring a complicated and lengthy breeding program to ensure that the new congenic strain contains the NSG alleles as well as the new desired mutation, assuming that their chromosomal locations allow for co-inheritance. As an alternate approach, direct genetic modification of the NSG strain would enable a more rapid establishment of a new desired congenic strain.

Conventional gene-targeting technology for generating knockout or knockin mice involves introducing mutations by homologous recombination in mouse embryonic stem (ES) cells, followed by microinjection into wild-type blastocysts, resulting in chimeric mice with potential germline transmission [5]. This methodology requires screening of ES cell clones for rare homologous recombination events, typically following drug selection for the targeted insertion of a donor DNA sequence containing a drug-resistance gene (thereby disrupting the targeted gene in case of a knockout strategy, or inserting a desired new sequence for a knockin approach). Although initial attempts were unsuccessful at deriving ES cells capable of germline transmission from NOD and NSG mouse strains, more recently the inclusion of PD0325901 mitogen-activated protein kinase kinase inhibitor and CHIR99021 glycogen synthase kinase 3 inhibitor in serum-free derivation conditions has enabled the establishment of NSG germline-competent ES cells [6], providing a means for more rapid targeted genetic modification of NSG mice. However, due to the generally low efficiency of modifying both alleles of a target gene by homologous recombination in ES cells, additional mouse breeding is often required to establish homozygosity using this approach.

In the past few years, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease has proved to be a more efficient method for targeted gene editing, following induction of a double-strand break by Cas9 nuclease at the target DNA sequence [7]. For gene knockout, the design is straightforward, relying on error-prone non-homologous end joining (NHEJ) or microhomology-mediated end joining (MMEJ) [8] at the Cas9 nuclease cutting site in the genome to induce knockout mutations, instead of using homologous recombination as in ES cell-based approaches. Although typically less efficient than gene knockout strategies, Cas9 nuclease can also be used for gene knockin through homology-directed repair at the genomic double-strand break by a co-administered donor plasmid or single-stranded DNA oligos possessing homology to the genomic target [7, 9].

Target specificity of Cas9 nuclease relies on a guide RNA (gRNA) containing a sequence (typically 20 bases in length) that is complementary to the target genomic DNA sequence, which must be adjacent to a protospacer adjacent motif (PAM) that is specific for each nuclease. The most commonly used Cas9 for genome engineering is derived from Streptococcus pyogenes (SpCas9) which utilizes a site-specific CRISPRRNA (crRNA) and a trans-activating RNA (tracrRNA) for providing a scaffold for binding to the Cas9 protein and the target DNA sequence; however, for simplicity, these two components are often fused together into a single-guide RNA (sgRNA) [10–12]. Using a traditional transgenic delivery method, a mixture of sgRNA and Cas9 (either mRNA or protein) can be microinjected into fertilized eggs [13]. One or both alleles can be modified and identified by genotyping, and homozygotes can be obtained in the first generation, bypassing the need for breeding chimeric mice for germline transmission and for crossing with mice expressing FLP or Cre recombinase to remove the selection marker (usually the neomycin-resistance gene), consequently saving two generations of mouse breeding when compared with the conventional ES cell-mediated method.

We previously reported the CRISPR/Cas9-mediated knockout of the Cybb gene on the X-chromosome to establish a mouse model of X-linked chronic granulomatous disease (X-CGD) in the NSG strain (see Note 1), which is useful for modeling human hematopoietic cell transplantation for developing gene therapies for the treatment of X-CGD [14]. In the current chapter, we describe our methodology in detail, including the making of CRISPR/Cas9 reagents, embryo microinjection, surgical procedures for embryo implantation, and genotyping procedures as well as detailed results, for demonstrating the feasibility of using CRISPR/Cas9 to genetically modify immunocompromised mouse strains.

2. Materials

2.1. Mice (See Note 2)

1. NSG mice as embryo donors: ten stud males (10–32 weeks old) individually caged; 30 females (6–16 weeks old) housed in groups (up to five mice per cage).

2. Vasectomized male mice: ten CD-1 outbred male mice (8–40 weeks old) individually caged. Vasectomy can be requested from the animal supplier for a reasonable fee.

3. Recipient females: 20 CD-1 females (8–12 weeks old) for mating with vasectomized males for generating pseudopregnant foster mothers.

2.2. Instruments and Supplies for Preparing CRIPSR Reagents and Genotyping

1. Bacterial culturing incubator with shaker, set to 37 °C and 200–250 rpm.

2. Heat blocks set to 50–56, 70, and 98 °C.

3. PCR thermocycler.

4. 250 or 500 mL glass Erlenmeyer flasks.

5. Microwave oven.

6. Horizontal gel casting tray and gel combs.

7. Optional: Gel electrophoresis apparatus suitable for TBE-Urea polyacrylamide gels, with power supply.

8. Gel electrophoresis apparatus suitable for agarose gels, with power supply.

9. Ultraviolet (UV) transilluminator for visualizing ethidium bromide-stained DNA, preferably with 365 nm wavelength UV for gel band excision (or an appropriate light source for visualizing alternatives to ethidium bromide).

10. NanoDrop 2000 or equivalent spectrophotometer.

2.3. Equipment and Supplies for Embryo Microinjection and Mouse Surgery

1. Stereo microscopes for embryo collection and embryo transfer procedures.

2. Sutter P-97 horizontal pipette puller for pulling microinjection needles.

3. Microinjection setup: inverted microscope, micromanipulators, Eppendorf FemtoJet, Eppendorf CellTram Vario injector for holding pipette.

4. P10 or P20 Pipetman and Eppendorf GELoader pipette tips for loading injection needles.

5. CO₂ incubators for culturing embryos.

6. Mouth pipette for transferring embryos.

7. Hair clipper.

8. Povidone-Iodine Swabsticks.

9. Alcohol prep pads (70% isopropyl alcohol).

10. Sterile surgical gloves.

11. Ethicon 5–0 Vicryl suture.

12. 29-G × ½ in. 1.0 mL insulin syringe.

13. Micro dissecting scissors.

14. Small iris forceps and No. 5 micro dissecting tweezers.

15. Small Dieffenbach micro clamp.

16. Wound clip applier.

17. Suturing needle holder.

18. Heating water blanket.

19. Benchtop Sterilizer for autoclaving surgical instruments.

20. Hot beads sterilizer for sterilizing surgical tools between animals when more than one animal is used during a session.

21. Mouse ear puncher.

22. Surgical scissors or razor blade (sterile).

23. RNase-free 1.5 mL microcentrifuge tubes.

2.4. Media, Chemicals, and Other Reagents

1. sgRNA expression plasmid for T7 in vitro transcription (DR274; Addgene plasmid # 42250) [15].

2. Cas9 expression plasmid for T7 in vitro transcription (MLM3613; Addgene plasmid # 42251) [15].

3. PCR-grade or molecular biology grade water (double-distilled, sterilized, nuclease-free).

4. Single-stranded DNA oligos for cloning sgRNAs into DR274 plasmid (see Subheading 3.2; examples listed are for exon 1 and exon 3 of the mouse Cybb gene, as described in Subheading 3.1):

   • Cybb Ex-1 forward: 5′-taggTACTTACAATGACAAAGA-3′.
   • Cybb Ex-1 reverse: 5′-aaacTCTTTGTCATTGTAAGTA-3′.
   • Cybb Ex-3 forward: 5′-taggATTTCGACACACTGGCAGC-3′.
   • Cybb Ex-3 reverse: 5′-aaacGCTGCCAGTGTGTCGAAAT-3′.

   When the forward and reverse strand oligos for each target site (Ex-1 or Ex-3) are annealed, the nucleotides shown in uppercase letters (corresponding to the guide sequence) hybridize to each other and form double-strand DNA, while the four nucleotides in lowercase letters form sticky ends which increase cloning efficiency.

5. BsaI (Eco31I) restriction endonuclease.

6. Competent E. coli bacteria for transformation with plasmid DNA.

7. Luria-Bertani (LB) medium.

8. Kanamycin (50 mg/mL for 1000 × stock).

9. LB agar plates prepared with 50 μg/mL Kanamycin.

10. Plasmid DNA miniprep and midiprep kits.

11. Optional: Cas9 protein or Cas9 mRNA from commercial source (as an alternative to synthesizing Cas9 mRNA in-house, as described in Subheading 3.3.2).

12. DraI restriction endonuclease.

13. M13 reverse primer: 5′-CAGGAAACAGCTATGAC-3′ (for sequencing DR274 plasmid to confirm sgRNA cloning).

14. Invitrogen MEGAshortscript T7 transcription kit.

15. Invitrogen mMESSAGE mMACHINE T7 Ultra Transcription Kit.

16. PmeI restriction endonuclease.

17. 3 M sodium acetate (pH 5.2).

18. Phenol and phenol/chloroform (water-saturated, buffer-saturated, or acidic; see Note 3).

19. Chloroform.

20. 100% ethanol.

21. 70% ethanol (molecular biology grade).

22. Optional: RNA loading dye.

23. Optional: single-stranded RNA ladder.

24. Optional: 6% TBE-Urea polyacrylamide gel.

25. M2 culture medium.

26. M16 culture medium.

27. Embryo culture-tested mineral oil.

28. Hyaluronidase: concentrated solution (10 ×) is prepared by dissolving the entire bottle (100 mg) in 20 mL of M2 medium. Filter through a 0.22 μm filter, aliquot into microcentrifuge tubes, and store at −20 °C in the dark.

29. Ketamine/Xylazine: 0.2 mL of ketamine (100 mg/mL) and 0.1 mL of xylazine (20 mg/mL) are mixed with 1.7 mL of 0.9% saline for a 2 mL anesthetic mixture (see Note 4).

30. 0.25% Bupivacaine.

31. Meloxicam 5 mg/mL Solution for injection.

32. Kaneka Easy DNA Extraction kit (version 2) or equivalent genomic DNA isolation kit.

33. PCR primers specific for CRISPR target site in genome. Primers used for amplification of mouse Cybb exons 1 and 3 (depicted in Fig. 5a, b) were:

    • Primer 1 (exon 1 forward): 5′-GTTGGAAGAGCCTGTGAG AAGA-3′.
    • Primer 2 (exon 1 forward): 5′-GGGAACAGCCTTTCAGTT GG-3′
    • Primer 3 (exon 1 reverse): 5′-ACCGAATCTACCTGCAAGC A-3′.
    • Primer 4 (exon 1 reverse): 5′-TGCACTCTGGTAAATGCTG G-3′.
    • Primer 5 (exon 3 forward): 5′-AGGATAGGAGTTCTTGCCG C-3′.
    • Primer 6 (exon 3 forward): 5′-AACTGTGGTCTGGGAGGT GA-3′.
    • Primer 7 (exon 3 reverse): 5′-TCCAGGAACTTTTGCCCTC A-3′.

34. ThermoFisher DreamTaq Green PCR Master Mix or equivalent.

35. Optional: 6x DNA loading dye (if using a different PCR buffer than DreamTaq Green).

36. 0.2 mL PCR tubes (or appropriate size tubes for PCR thermocycler to be used).

37. 100 base pair (bp) DNA ladder.

38. Agarose powder (molecular biology grade), or precast 1–3% agarose gels.

39. Ethidium bromide (see Note 5 regarding safety, handling, and disposal) or an alternative less-toxic/less-mutagenic DNA stain.

40. Gel electroporation buffer: 1x Tris-acetate-EDTA (TAE) or 0.5x Tris-borate-EDTA (TBE) buffer.

41. NucleoSpin Gel and PCR Clean-Up kit (Machery-Nagel), or equivalent PCR clean-up kit or gel extraction kit.

42. Optional: TOPO-TA Cloning Kit for cloning PCR fragments for DNA sequencing.

Fig. 5.

Summary of mouse Cybb mutations from CRISPR targeting. Shown are the CRISPR target region and cut site (dotted line) for (a) exon 1 or (b) exon 3. Deletions matching MMEJ predictions are denoted by “*”. (c) Mutations matching predicted MMEJ-induced deletions. Wild-type sequences (bold) are listed in 5′ to 3′ orientation, with exons (uppercase), introns (lowercase), and CRISPR targets (underlined). CRISPR target and PAM sequences are shown in reverse complement, as they are on the complementary strand to the Cybb gene orientation

3. Methods

3.1. General Considerations for Designing and Making CRISPR sgRNAs

When designing CRISPR gRNAs, a critical aspect of nuclease cutting activity relies on the presence of a PAM sequence adjacent to the complementary 20-nucleotide sequence in the target DNA. For Streptococcus pyogenes Cas9, the required PAM sequence is NGG (any nucleotide followed by two guanine nucleotides) immediately to the 3′ of the 20-nucleotide genomic target sequence, and the Cas9 nuclease cut occurs at 3–4 bp upstream of the PAM site (within the target sequence). It is important to note that this PAM sequence must be present at the genomic target site, but should not be included in the gRNA.

Although CRISPR target sites can be manually identified by searching target genomic DNA sequences for PAM sequences, easy-to-use online CRISPR gRNA design tools have been developed for ready identification of target sequences. Many such tools also perform analysis of similar DNA sequences in the target organism’s genome that might serve as additional off-target sites for CRISPR cutting with a particular gRNA (based on one or more base mismatches with the target sequence), in order to rank and identify CRISPRs with higher potential specificity for a particular target. Examples of these tools include Keith Joung lab’s ZiFiT Targeter (http://zifit.partners.org/ZiFiT/), Feng Zheng lab’s CRISPR design tool (http://crispr.mit.edu), and Jin-Soo Kim lab’s Cas-Designer (http://www.rgenome.net/cas-designer/). Use of these tools simply requires selecting the option for Streptococcus pyogenes Cas9 nuclease (if other options are available), pasting a target DNA sequence corresponding to the genomic region to be targeted (which can include 250 or more bases, depending on the tool), and selecting the target organism.

It should be noted that at present CRISPR design tools cannot predict the actual cutting activity of a particular CRISPR/gRNA, which may vary based on target location, sequence, chromatin accessibility, and other as yet undetermined factors. Consequently, it is highly advisable to design at least two gRNAs aimed at different sequences or regions within the target gene, to improve the likelihood that one will result in sufficient cutting activity for gene editing.

While some of these tools also allow for the design of alternative CRISPRs with different PAM and guide requirements, the protocols described here assume the use of the standard Streptococcus pyogenes Cas9 nuclease (SpCas9). If using an alternative nuclease, a different gRNA expression plasmid would be needed in Subheading 3.2 to provide the appropriate gRNA scaffold, and a different nuclease mRNA instead of SpCas9 would be needed in Subheadings 3.3 and 3.4.

As illustrated in greater detail in Subheading 3.7, the presence of microhomology sequences flanking the CRISPR cutting site can result in the deletion of the intervening sequences by MMEJ, thereby affecting the frequency of frameshift knockout deletions versus in-frame deletions that may not result in gene knockout [8]. Consequently, when designing CRISPRs to knock out a target gene, it may be useful to assess the suitability of a particular gRNA target using the Cas-Designer or Microhomology-Predictor tool at http://www.rgenome.net.

Once a desired guide has been designed, the appropriate guide sequence can be cloned into a plasmid vector such as DR274 (Fig. 1), which is used for in vitro transcription of an sgRNA using the T7 promoter present in this plasmid (see Notes 6 and 7), as described in Subheadings 3.2 and 3.3.1. This plasmid also contains the remaining nonspecific portion of the gRNA (corresponding to the tracrRNA and a portion of the crRNA sequence), which reconstitutes a complete sgRNA upon cloning of the 20-nucleotide guide sequence. In order to clone the guide sequence, two corresponding single-strand oligonucleotides DNAs should be synthesized (which can be done commercially, as for PCR primers) as described below, with the string of N’s corresponding to the guide sequence matching the genomic target (without the PAM) in the forward strand oligonucleotide, and corresponding to the complementary sequence of this guide sequence in the reverse strand oligonucleotide (see Note 8). Note that the reverse strand oligonucleotide is listed below in 3′ to 5′ orientation (for purposes of showing DNA strand alignment with the forward strand oligonucleotides), so care should be taken to change the reverse strand oligonucleotide sequence to 5′ to 3′ orientation before synthesizing.

• Forward oligonucleotide: 5′-taggNNNNNNNNNNNNNNNNNNNN-3′.

• Reverse oligonucleotide: 3′-NNNNNNNNNNNNNNNNNNNNcaaa-5′.

Fig. 1.

Cloning of sgRNAs into the pDR274 vector. For generating sgRNAs using in vitro transcription, the pDR274 vector (https://www.addgene.org/42250/) is first digested with BsaI restriction enzyme, which recognizes GGTCTC sequence (bold) but cuts further downstream and create a 4 bp overhang. Then, annealed forward and reverse strand oligos containing the 20 bp sgRNA sequence and matching overhangs (TAGG for forward oligos and AAAC for reverse oligos) were ligated into the digested vector, so that the sequence highlighted yellow is replaced by the 20 bp sgRNA sequence. For in vitro transcription, the completed DNA construct is digested with DraI (recognition sequence shown in bold), and the linearized plasmid is used as templated for synthesizing RNA using T7 RNA polymerase

The T7 promoter requires that the sgRNA sequence start with two G nucleotides for optimal expression during in vitro transcription; this “GG” will be appended to the start of the sgRNA during transcription. If your desired guide does not start with one or two G nucleotides, these G’s can simply be inserted in front of the guide sequence, generally without substantially affecting CRISPR targeting. However, if the guide target sequence does start with one or two G’s, you can shorten the 20-nucleotide guide sequence in the forward and reverse oligos by the same number of G’s. For example, the Cybb exon 1 sgRNA target (GGTACTTACAATGACAAAGA) starts with GG, so we shortened the guide sequence in the exon 1 forward and reverse oligos by two bases, as follows:

• Cybb Ex-1 forward oligo: 5′-taggTACTTACAATGACAAAGA-3′.

• Cybb Ex-1 reverse oligo: 3′-ATGAATGTTACTGTTTCTcaaa-5′.

The exon 3 sgRNA target (GATTTCGACACACTGGCAGC) starts with G, so we shortened the guide sequence in the exon 3 forward and reverse oligos by one base, as follows:

• Cybb Ex-3 forward oligo: 5′-taggATTTCGACACACTGGCAGC-3′.

• Cybb Ex-3 reverse oligo: 3′-TAAAGCTGTGTGACCGTCGcaaa-5′.

For the Cybb exon 1 sgRNA, this will result in no changes to the overall sgRNA sequence following T7 transcription; for exon 3 sgRNA, this will result in an additional G appended to the beginning of the sgRNA sequence following T7 transcription.

3.2. Cloning sgRNAs into pDR274 Vector

For inactivating the mouse Cybb gene, we designed two sgRNAs to target exon 1 and exon 3 using the following protocol (see Fig. 1 for plasmid map and cloning site):

1. Order commercial synthesis of both the forward and reverse strand oligos (see Subheading 3.1 for designing sgRNAs and Subheading 2.4, item 4 for sequences of the four oligos). Dissolve the lyophilized oligos in TE at the concentration of 100 μM.

2. Digest 10 μg of DR274 plasmid with BsaI restriction enzyme for 2 h at 37 °C. After confirming complete digestion by running a mini agarose gel (see Subheading 3.6 for a detailed protocol on agarose gel preparation and electrophoresis), purify the linearized plasmid DNA by adding 20 μL of 3 M sodium acetate and 200 μL of saturated phenol. Mix well and centrifuge for 1 min at 14,000 × g. Collect the aqueous phase and transfer it to a new tube, then add 200 μL of chloroform. Mix well, then centrifuge for 1 min at 14,000 × g. Transfer the aqueous phase to a new tube.

3. Precipitate linearized plasmid DNA with 400 μL of 100% ethanol at −20 °C for at least 15 min. Centrifuge at 4 °C for 10 min at 14,000 × g to pellet DNA. Decant the supernatant, and wash the DNA pellet with 1 mL of70% ethanol. Centrifuge for 1 min, and decant the supernatant. Air dry DNA pellet for 10 min. Dissolve the linearized DNA in 100 μL of TE buffer and store at 4 °C until step 5.

4. Add 10 μL of forward and 10 μL of reverse oligos to 80 μL of 1× PCR reaction buffer in a PCR tube. Using a PCR thermocycler to heat the tube to 94 °C for 5 min and then gradually cool down to 50 °C over 15 min. Then, place the annealed oligos on ice until use.

5. Mix 1 μL of annealed oligos, 2 μL of linear DR274, 2 μL T4 DNAligase buffer, 14 μL ddH₂O, and 1 μL T4 ligase. Incubate at 16 °C overnight.

6. Transform 1 μL of the ligation mix into E. coli competent cells and plate onto an LB agar plate containing 50 μg/mL Kana-mycin, following the manufacturer’s supplied protocols. Culture overnight at 37 °C in a bacteria incubator.

7. Pick 24 colonies and transfer each into 1–5 mL of LB medium containing 50 μg/mL Kanamycin. Culture bacteria 8 h or overnight in a bacterial shaker incubator for plasmid minipreps (performed using manufacturer’s supplied protocol), setting aside a residual amount (~100 μL) of the bacterial culture for further culturing. Perform DNA sequencing on the plasmid DNA samples using M13 reverse primer, to identify clones containing the correct sgRNA sequences.

8. Inoculate 10–50 mL of LB medium containing 50 μg/mL Kanamycin with 1:1000–1:10,000 dilution of remaining bacterial culture from one of the correct bacterial clones, and culture overnight in a bacterial shaker incubator for plasmid midiprep (using manufacturer’s supplied protocol) to obtain DNA template for synthesizing sgRNA (see Subheading 3.3.1).

3.3. Preparation of sgRNA and Cas9 mRNA

A protocol for sgRNA synthesis using the MEGAshortscript T7 Transcription kit follows (see Notes 6 and 7). All reagents are RNase-free.

3.3.1. T7 Promoter Driven sgRNA Synthesis

1. Prepare DNA template for in vitro transcription by digesting DR274 (into which the sgRNA sequence has been cloned) with DraI restriction enzyme as follows: in a microfuge tube, mix 10 μg of DR274 in 180 μL of nuclease-free water, 20 μL of 10× digest buffer, and 100 Units of DraI. Incubate at 37 °C for 1 h.

2. Purify digested DNA template (or PCR product) by adding 20 μL of 3 M sodium acetate and 200 μL of phenol/chloroform. Mix well and centrifuge for 1 min at 14,000 × g. Collect the aqueous phase and transfer it to a new tube, then add 200 μL of chloroform. Mix well, then centrifuge for 1 min at 14, 000 × g. Transfer the aqueous phase to a new tube.

3. Precipitate DNA with 400 μL of 100% ethanol at −20 °C for at least 15 min. Centrifuge at 4 °C for 10 min at 14,000 × g to pellet DNA. Decant the supernatant, and wash the DNA pellet with 1 mL of 70% ethanol. Centrifuge for 1 min, and decant the supernatant. Air dry DNA pellet for 10 min. Dissolve DNA in 10 μL of nuclease-free water. Determine DNA concentration with a NanoDrop.

4. In an RNase-free microfuge tube at room temperature, gently mix 1 μg of template DNA (PCR product or plasmid) in 8 μL of nuclease-free water with 2 μL of T7 reaction buffer, 2 μL of each NTP, and 2 μL of T7 enzyme mix (from MEGAshortscript kit). Incubate at 37 °C for 2–4 h.

5. Add 1 μL of TURBO DNase (from MEGAshortscript kit) to the reaction and continue incubation at 37 °C for 15 min.

6. Add 115 μL of nuclease-free water and 15 μL of 3 M sodium acetate to the reaction. Add 150 μL of phenol/chloroform and briefly vortex. Then centrifuge at 14,000 × g for 1 min. Collect the aqueous phase and transfer to a new tube.

7. Add 150 μL of chloroform and briefly vortex. Centrifuge at 14, 000 × g for 1 min. Collect the aqueous phase and transfer to a new tube.

8. Add 300 μL of 100% ethanol and mix well, then chill for at least 15 min at −20 °C to precipitate sgRNA.

9. Centrifuge at 4 °C for 10 min at 14,000 × g to pellet sgRNA, and carefully remove and discard the ethanol supernatant. Wash the sgRNA pellet with 70% ethanol, and then centrifuge and discard ethanol supernatant.

10. Dry the sgRNA pellet at room temperature for 10 min, then dissolve in 100 μL of nuclease-free water. Measure the sgRNA concentration by a NanoDrop and check the RNA integrity by 6% TBE-Urea polyacrylamide gel if desired, following the manufacturer’s protocol (see Note 9).

11. Aliquot sgRNA and store at −80 °C.

3.3.2. T7 Promoter Driven Cas9 mRNA Synthesis

A protocol for Cas9 mRNA synthesis using the mMESSAGE mMACHINE T7 Ultra Transcription kit follows (see Note 10). All reagents are RNase-free.

1. Linearize 12 μg of MLM3613 T7-Cas9 plasmid by digesting with 100 Units of PmeI restriction enzyme in 20 μL of 10x enzyme digestion buffer and 180 μL of nuclease-free water at 37 °C for 1 h.

2. Extract digested DNA by adding 20 μL of 3 M sodium acetate and 200 μL of saturated phenol. Mix well and centrifuge for 1 min at 14,000 × g. Collect the aqueous phase and transfer it to a new tube, then add 200 μL of phenol/chloroform. Mix well, then centrifuge for 1 min at 14,000 × g. Transfer the aqueous phase to a new tube.

3. Precipitate DNA with 400 μL of 100% ethanol at −20 °C for at least 15 min. Centrifuge at 4 °C for 10 min at 14,000 × g to pellet DNA. Decant the supernatant, and wash the DNA pellet with 1 mL of 70% ethanol. Centrifuge for 1 min, and decant the supernatant. Air dry DNA pellet for 10 min. Dissolve DNA in 12 μL of nuclease-free water.

4. At room temperature, add 20 μL of nuclease-free water, 40 μL of T7 2x NTP/ARCA, 8 μL of 10× T7 reaction buffer, 4 μL (1 μg/μL) of linearized MLM3613, and 8 μL of T7 enzyme mix. Incubate at 37 °C for 2 h.

5. Add 4 μL of TURBO DNase; mix well and incubate at 37 ° C for 15 min.

6. Add 144 μL of nuclease-free water, 80 μL of 5× E-PAP buffer, 40 μL of 25 mM MnCl₂, and 40 μL of ATP solution. Add 16 μL of E-PAP; incubate at 37 °C for 45 min.

7. Add 40 μL of ammonium acetate stop solution. Add 400 μL of phenol/chloroform to extract. Mix vigorously, then centrifuge for 1 min at 14,000 × g. Transfer the aqueous phase to a new tube. Add 400 μL of chloroform, then mix vigorously. Centrifuge for 1 min at 14,000 × g. Transfer the aqueous phase to a new tube.

8. Precipitate Cas9 mRNA by adding 800 μL of 100% ethanol. Keep at −20 °C for at least 15 min. Centrifuge at 4 °C for 10 min at 14,000 × g. Decant the supernatant without disturbing the pellet. Wash pellet by adding 1 mL of 70% ethanol, then centrifuge for 1 min at 14,000 × g. Decant the supernatant and air dry for 10 min at room temperature.

9. Dissolve Cas9 mRNA in 400 μL of nuclease-free water. Measure the Cas9 mRNA concentration by a NanoDrop. The yield should be approximately 400 μg in 400 μL of nuclease-free water. Check the mRNA integrity by agarose gel (1% agarose) electrophoresis if desired (see Note 11).

10. Aliquot mRNA and store at −80 °C.

3.4. Cytoplasmic Microinjection of CRISPR Reagents (See Note 12)

1. In our experience, NSG female mice do not respond to hormone-stimulated ovulation well, so we prefer to use natural mating to produce zygotes. The day before scheduled microinjection, select females that are in estrus (Fig. 2) and mate each female with an individually caged stud male.

2. In the next morning, check the females for vaginal plugs. Euthanize plugged females with CO₂ and dissect out both oviducts from each female (part of the uterus horn and whole ovary can be dissected to avoid damage to the oviduct). Place the dissected tissues in a 35 mm culture dish containing M2 medium to rinse off blood and other loose debris (see Fig. 3 for an outline of the remaining steps of microinjection and embryo transfer).

3. Place 4–5 cleaned oviducts into one 50 μL M2 drop under mineral oil. Under the stereo microscope, using a 29-G insulin needle, tear open the ampulla to allow the cumulus mass to extrude spontaneously into the medium. Discard the oviduct tissue.

4. After releasing the egg clutches from all oviducts, add 5 μL of 10x concentrated hyaluronidase solution to each M2 drop. Gently swirl the dish and incubate at room temperature for a few minutes to allow hyaluronidase to release follicle cells from the eggs. Wash eggs using an embryo transfer pipette through three drops of M2 medium to remove residual hyaluronidase.

5. Transfer 30–50 zygotes into the M2 drop in the injection chamber, and place the injection chamber onto the microscope stage, then lower the tip of the holding pipette into the M2 drop.

6. Mix the desired amount of sgRNA and Cas9 mRNA (see Note 13), and dilute with microinjection buffer to the final concentration of 100 ng/μL of Cas9 mRNA and 50 ng/μL of sgRNA (see Note 14). Then, centrifuge the mixture for 5 min at 14,000 × g in a microcentrifuge to pellet any possible particles that may clog the injection needle.

7. Use a P10 or P20 Pipetman and an Eppendorf microloader tip to deliver 2–3 μL of sgRNA/Cas9 solution into the barrel of a microinjection needle through the open (back) end. The filament inside the needle will facilitate transporting the solution to the needle tip through capillary action.

8. Lower the injection needle into the injection chamber. Break open the tip of the microinjection needle by hitting the needle tip against the holding pipette.

9. Use the holding pipette to hold an egg and insert the needle into its cytoplasm. Sometimes the needle has to pass through the entire cytoplasm in order to penetrate the plasma membrane. When the needle tip is inside the cytoplasm, push the injection foot paddle of the FemtoJet 4i to inject the sgRNA/Cas9 solution (see Note 15).

10. After injection, the egg is transferred to a different area using the holding pipette to separate it from the uninjected eggs. After all eggs in the chamber are injected, transfer them to an M16 drop in the CO₂ incubator and culture overnight to allow them to develop into 2-cell stage embryos (see Notes 15 and 17).

Fig. 2.

Photographs of female NSG mice that are in estrous and non-estrous. Mouse’s estrous cycle is typically 4–5 days, and therefore on average only 20–25% of female mice will mate on a particular day. For strains that do not respond to hormone-stimulated superovulation, it is important to select and mate the females in estrous in order to obtain enough zygotes on the microinjection day. The morphological differences between estrous and non-estrous female mice are subtle and difficult to describe using language alone. As shown in the photographs, the genital area of an estrous female swells slightly and shows a little deeper in pink color

Fig. 3.

Outlining of microinjection and embryo transfer procedures. Plugged female NSG mice are euthanized and fertilized eggs are collected from their oviducts. These zygotes are subsequently microinjected with Cas9 mRNA and either Cybb exon 1 or exon 3 sgRNA. After culturing injected eggs overnight, those that reach 2-cell stage of development are implanted into the oviducts of pseudopregnant surrogate mothers using a mouth-controlled glass transfer pipette

3.5. Surgical Implantation of Injected Embryos

1. On the day of microinjection, estrus CD-1 females are selected and set up with vasectomized male mice for mating. The next morning, check the mice for vaginal plugs. The plugged mice can be used as recipient mothers for embryo transfer.

2. The day after the injection, examine microinjected embryos using a stereo microscope. Count the number of embryos that have reached the 2-cell stage of development. A large number of eggs at the 1-cell stage indicate toxicity of the gRNA. Transfer the 2-cell embryos into an M2 drop.

3. Anesthetize the recipient mothers by injecting ketamine/xylazine solution (intraperitoneal, with a 29-G needle) at a dose of 0.1 mL per 10 g of body weight.

4. Remove hair from the back using a small hair clipper. Disinfect the clipped area using alternating applications of 70% isopropyl alcohol and Betadine.

5. Cut a midline incision (~1 cm) in the cleaned skin area, and place the mouse on its left side. Move the skin incision to the right side near the right ovary area, then make a small cut in the body wall and extend it to 0.5–1 cm long using the back of the scissors’ blades.

6. Pull the fat pad that is associated with the ovary with a pair of iris forceps until a segment of the uterine horn appear. Clamp the fat pad with a Dieffenbach clip to hold the organs in place.

7. Load the embryo transfer pipette with 12 embryos. Because the embryos are barely visible in the transfer pipette, two air bubbles are sucked into the transfer pipette to mark the boundaries of the suspended embryos.

8. Under the dissecting microscope, find the oviduct and ampulla. Use a 29-G needle to punch a small hole in the oviduct wall one turn before the ampulla after the ovary. Carefully insert the tip of the transfer pipette into the hole with the pipette opening pointing toward the ampulla. Gently blow into the mouthpiece to expel the two air bubbles and the embryos sandwiched between them. The presence of the air bubbles in the ampulla is a good indication that all embryos have been successfully transferred.

9. Remove the Dieffenbach clip and carefully push the ovary back into the abdominal cavity. Close the abdominal wall with a cruciate suture utilizing absorbable 5–0 Vicryl suture.

10. Drop one drop of 0.25% Bupivacaine solution on the muscle at the surgical site. Bupivacaine solution is a long-lasting local anesthetic for reducing pain at the surgical site.

11. For implanting embryos into the left oviduct, turn the mouse on its right side and make a 0.5–1 cm incision in the left ovary area of the body wall. Then, repeat steps 6–10.

12. Close the skin incision with stainless steel surgical wound clips. Inject 0.2 mL meloxicam (intraperitoneal, with a 29-G needle).

13. Place the mice in a pre-warmed mouse cage placed on a circulating water blanket. Normally, the mice will wake 30–60 min post-operation. They can then be returned to the animal room.

14. Wound clips are removed 10–14 days after surgery. Pups developed from injected embryos will be born approximately 19 days after the embryo transfer procedure. The offspring will be weaned when they are 18–21 days old.

3.6. Mouse Tail Biopsy and Genotyping by PCR

Mouse distal tail snips may be collected from mice at up to 21 days of age without anesthesia (see Note 18). Sample collection and mouse marking may be performed concurrent with weaning of mice. Steps 3 through 5 of the protocol described here use the Kaneka Easy DNA Extraction kit for rapid (<20 min) DNA isolation, but this may be readily replaced with any other genomic DNA extraction method appropriate for animal tissues (see Note 19). PCR analysis may be used both for initial identification of CRISPR-induced mutations in founder mice and for routine genotyping to screen for gene-modified offspring (see Note 20).

1. Mark each mouse by ear punch or other method to identify the mouse and the corresponding DNA sample.

2. Snip the distal 2–5 mm of the tail with a sterile razor blade or scissors, and transfer the tail snip to a labeled 1.5 mL microcentrifuge tube (see Note 21). Repeat for each mouse.

3. Add 100 μL of Kaneka kit Solution A to each tube containing a tail snip. Incubate at 98 °C for 10 min on a heat block. Remove tubes from heat block, and allow the sample to cool for at least 2 min.

4. Add 14 μL of Kaneka kit Solution B to each tube. Vortex.

5. Centrifuge tubes at maximum microcentrifuge speed for 1 min to pellet particulate matter and undigested tissue. Transfer liquid containing DNA to a new microcentrifuge tube, and store DNA at −20 °C until ready for PCR analysis.

6. Design PCR primers specific for the CRISPR-targeted genomic region (see Note 22). Given the potential for large deletions occurring in either direction from the CRISPR target site, initial PCR screening for unknown deletions at the target site may require designing either multiple overlapping primer pairs to cover the entire region or a single pair of primers spaced far enough apart to generate a PCR product of sufficient size to identify deletions of hundreds of bp on either side of the target, as was necessary for the identification and genotyping of the larger Cybb mutations (Figs. 4a–d and 5a, b; see Note 23).

7. Prepare a PCR reaction mix by combining the following reagent volumes, multiplied by (the total number of samples +1): 12.5 μL of 2x DreamTaq Green PCR Master Mix, 0.5 μL of 10 μM forward primer (200 nM final), 0.5 μL of 10 μM backward primer (200 nM final), and 9.5 μL of sterile PCR-grade water.

8. In separate PCR tubes for each sample to be genotyped, add 23 μL of PCR reaction mix to 2 μL of mouse genomic DNA (see Note 24).

9. Set up thermocycler settings (see Notes 25 and 26): 95 °C for 1 min for initial DNA denaturation; 25–35 cycles of 95 °C for 15–30 s, 55–60 °C (typically 3–5° below the lowest primer Tm) for 15–30 s, 72 °C for ~1 min per 1000-bp of PCR product size; and finally 72 °C for 7 min followed by indefinite incubation at 4 °C.

10. Prepare a 1–3% agarose gel as follows: add 1–3 g of agarose powder to 100 mL of 1x TAE or 0.5× TBE buffer (agarose percentage based on weight/volume, i.e., 1 g of agarose per percent per 100 mL for a 1% agarose gel) in an Erlenmeyer flask large enough to hold 2–4× the buffer volume (see Note 27). Microwave for 1.5–3 min (longer times for higher percentage gels), until agarose melts without liquid boiling over. Remove flask from microwave, swirl gently and carefully to mix, and allow to cool at room temperature until the outside of the flask can be touched safely (approximately 5 min, or less for higher percentage gels, which solidify faster). Add ethidium bromide to 0.5 μg/mL final volume (i.e., 5 μL of 10 mg/mL stock to a 100 mL gel) and gently and carefully swirl flask to mix. Assemble a gel casting tray with a gel comb inserted and with seals in place to prevent leakage, and pour the molten agarose into the tray (using approximately 30 mL for a small 8.5 cm × 8.5 cm gel tray, or 100 mL for a larger 12 cm × 12 cm gel tray). Allow gel to solidify for 20–30 min.

11. Remove the gel comb and the seals, and transfer the gel tray containing the gel into a gel electrophoresis apparatus. Orient the gel so that the samples will migrate toward the end of the apparatus with the red electrode. Add sufficient TAE or TBE buffer (that same buffer used to prepare the gel) to completely submerge the gel.

12. Run gel as follows: load a DNA ladder into one well for product size analysis. From each PCR reaction, load up to 25 μL into a well of gel (see Note 28). Place cover on gel apparatus, and perform gel electrophoresis at 5 V/cm (referring to the distance between electrodes in the apparatus; i.e., 100 V for a 20 cm apparatus) for 30–45 min, or until the DNA loading dye migrates approximately 75% of the way across the gel.

13. Visualize the DNA bands in the gel using a UV transilluminator (see Note 29); larger insertions or deletions may be readily distinguishable based on size differences from wild-type control (see Notes 30 and 31).

Fig. 4.

PCR and sequencing analysis of CRISPR-induced mutations in Cybb exon 1. (a) Gel electrophoresis of PCR products using primers 2 and 3 for mice (numbered 1–1 through 1–6), including water (H₂O) and wild-type (wt) mouse DNA controls. (b) PCR analysis of mouse number 1–3 using primers 1 and 4 to amplify alleles with 235 and 240 bp deletions that appear as a single band. PCR analysis of this mouse using (c) primers 1 and 3 amplifies only the 235 bp deleted allele, while PCR using (d) primers 2 and 4 amplifies only the 240 bp deletion. (e) PCR genotyping of the Cybb exon 1 knockout mouse strain containing the 235 bp deletion established from mouse number 1–3, using primers 1 and 3 to distinguish between the 628 bp wild-type (wt) allele and the 393 bp knockout (ko) allele. (f) DNA sequences from PCR products for wild-type exon 1 and four mice with small deletions (at locations indicated by arrowheads)

3.7. Confirmation of Mutations by DNA Sequencing and Analysis of Results

Initial identification of founder mouse mutations may be performed by purifying individual PCR products from Subheading 3.6 (using a PCR clean-up kit for samples containing a single PCR product, or by gel band excision and purification of separate bands using a gel extraction kit for samples containing multiple PCR products), followed by DNA sequencing (see Note 32). A protocol for PCR clean-up or gel band excision using a dual-purpose NucleoSpin Gel and PCR Clean-up kit follows (steps 1–5), and a discussion of CRISPR-induced mutations (with examples from Cybb targeted mice) can be found at the end of this section:

1. For DNA purification by cleanup of the PCR reaction, transfer PCR reaction to a 1.5 mL tube and proceed directly to step 2. For DNA extraction from agarose gels following gel electrophoresis, visualize ethidium bromide-stained DNA using a UV transilluminator in the dark (see Notes 29 and 33). Quickly cut out each desired DNA band using a clean scalpel, removing excess agarose from the excised slice. Transfer each excised gel band to a separate pre-weighed 1.5 mL tube. Reweigh the tube to determine the weight of the gel slice.

2. Add 200 μL of Buffer NTI to each 100 μL of PCR product or to each 100 mg of gel slice for gels containing ≤2% agarose (for gels containing >2% agarose, double the volume of Buffer NTI), then vortex. For PCR clean up, proceed directly to step 3. For gel purification, incubate tubes for 5–10 min at 50–56 °C, vortexing briefly every 2–3 min, until the gel slice is completed dissolved.

3. For each sample, place a NucleoSpin column in a collection tube, and add up to 700 μL of the sample to the column. Centrifuge for 30 s at 11,000 × g. Discard the flow-through from the collection tube and place the column back in the collection tube. Load any remaining volume of the sample (beyond the initial 700 μL) into the same tube and repeat centrifugation, discarding flow-through.

4. Add 700 μL of Buffer NT3 to the column. Centrifuge for 30 s at 11,000 × g. Discard the flow-through from the collection tube and place the column back in the collection tube. Repeat this wash step with another 700 μL of Buffer NT3, centrifuging and discarding the flow-through as above. Centrifuge for 1 min at 11,000 × g to remove any residual buffer.

5. Transfer the column to a new 1.5 mL microcentrifuge tube. Add 30 μL of Buffer NE or water. Incubate at room temperature for 1 min, then centrifuge for 1 min at 11,000 × g (see Note 34). Determine DNA concentration using a NanoDrop.

6. Sequence purified PCR product commercially using a sequencing primer (see Notes 35 and 36).

7. Once a desired mutation has been identified, the founder mouse can be bred and the resulting offspring genotyped (see Note 37) to confirm germline transmission of the mutation in order to establish the gene-modified strain (see Fig. 4e for PCR-based genotyping of offspring of mouse number 1–3 confirming germline transmission of the 235-bp deletion in Cybb exon 1 on the X-chromosome; shown are genotyping results for wild-type or knockout males and a female mouse heterozygous for one wild-type and one knockout allele).

CRISPR-induced mutations can include base deletions, additions, or substitutions at or near the target site. For CRISPR-mediated knockout of the Cybb gene at exon 1 or exon 3 in NSG embryos [14], all detected mutations were deletions ranging in size from 1- to >500-bp, stretching upstream and/or downstream from the genomic target site (Figs. 4f and 5a, b). Some smaller deletions may be the favored results of MMEJ rather than NHEJ at the CRISPR cut site [8], due to short regions (two or more bp) of microhomology flanking the cut site that can result in the exact deletion of the intervening sequence plus one of the microhomology repeats (Figs. 5c and 6). For CRISPR-mediated knockout of the Cybb gene in NSG mice, deletions matching MMEJ predictions occurred frequently, as they were detected in at least half of the founder mice (Fig. 5c). These deletions may be in-frame (encompassing one or more codons in multiples of 3-bp), and consequently may not result in knockout of the target gene. For this reason, when designing CRISPRs for gene knockout, it may be helpful to first identify potential microhomology sequences surrounding the CRISPR cut site in the genome, so as to choose CRISPRs that favor frameshifts rather than in-frame deletions (see Note 38).

Fig. 6.

Schematic interpretation of a prevalent microhomology-mediated end joining. Four out of seven offspring derived from embryos injected with Cybb exon 3 sgRNA carried exactly the same 3 bp deletion, supporting the notion that CRISPR-mediated deletions are not completely random. This diagram illustrates a plausible mechanism for interpreting biased deletion patterns mediated by short homologous sequences (in bold) near the two ends created by Cas9 cutting

4. Notes

1. This Cybb knockout NSG mouse strain (NSG.Cybb[KO]), which contains a 235 bp deletion in Cybb exon 1, will be available from The Jackson Laboratory as JAX stock # 030610. Due to their increased immunodeficiency beyond that of NSG mice, housing in a high barrier level specific pathogen-free facility is strongly recommended for these mice, to prevent spontaneous infection with bacterial and fungal agents that have low pathogenicity to NSG mice or that are non-pathogenic to immunocompetent mice.

2. Federally funded animal research in the United States requires review and approval from the appropriate Institutional Animal Care and Use Committee. The studies described here were approved by the National Institute of Allergy and Infectious Diseases Animal Care and Use Committee (ACUC) under animal use protocol LCIM 1E and by the National Heart, Lung, and Blood Institute ACUC under animal use protocol H-0125R2. For these studies, all mice were bred and maintained under specific pathogen-free conditions at an American Association for the Accreditation of Laboratory Animal Care accredited animal facility and housed in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals.

3. Acidic phenol may be used to partition DNA into the organic phase to remove DNA from RNA preparations, in place of performing DNase digestion.

4. Because ketamine (Ketaset) is a controlled substance regulated by the United States Drug Enforcement Administration, a license is required for purchasing and storing this anesthetic, and a lock box and log sheets are needed to store it and record its usage.

5. Ethidium bromide can be toxic at high concentrations, and its metabolites may be mutagenic in some species. Appropriate personal protective equipment should be used when handling; consult your institution’s safety requirements for approved handling practices and disposal procedures for ethidium bromide solutions and gels.

6. As an alternative to performing in vitro T7 transcription and purification of the sgRNA, the complete 100 bp sgRNA can be commercially synthesized (by Synthego or Origene, for example), or gRNA can be commercially synthesized as a separate target-specific crRNA and annealed to a common tracrRNA component (synthesized by Integrated DNA Technologies, for example).

7. As an alternative to cloning the sgRNA binding region into DraI-digested DR274 plasmid for using the vector’s T7 promoter, a PCR product may be used as a template for in vitro transcription. In this case, the DR274 plasmid can be used as a template for amplifying the sgRNA scaffold portion (common to all sgRNAs), while the T7 promoter and the 20-nucleotide target-specific region can be added to the scaffold using a forward primer (5′-TTAATACGACTCACTATAGGN₂₀GTT TTAGAGCTAGAAATAGC-3′, where N₂₀ is the 20-nucleotide target sequence of the sgRNA, the sequence before N₂₀ is the T7 promoter, and the sequence after N₂₀ is the first portion of the sgRNA scaffold), and the reverse primer (5′-AAAAGCACCGACTCGGTGCC-3′, which is complementary to the 3′ end of sgRNA scaffold). See Subheading 3.6, steps 7–9 for a general PCR protocol.

8. The complementary sequence refers to A/T base complementarity and G/C base complementarity from the opposite DNA strand to the 20-nucleotide target sequence. The complement to the TAGG sequence from the forward oligonucleotide should not be included in reverse oligonucleotide, and the complement to the AAAC sequence from the reverse oligonucleotide should not be included in the forward oligonucleotide, as these unpaired 5′ TAGG and AAAC overhangs are needed for cloning the annealed oligonucleotides into the restriction enzyme-digested DR274 plasmid in subsequent steps.

9. Following gel electrophoresis, good quality intact RNA should appear as a distinct band without smearing. If accurate size analysis of the sgRNA is desired, use a low range single-stranded RNA ladder instead of a DNA ladder.

10. As an alternative to performing in vitro T7 transcription and purification of Cas9 mRNA, multiple vendors offer Cas9 mRNA or Cas9 protein for purchase.

11. A detailed protocol for agarose gel preparation and electrophoresis can be found in Subheading 3.6. Following gel electrophoresis, good quality intact RNA should appear as a distinct band without smearing. Polyadenylated Cas9 mRNA is approximately 4.5 kb in size. However, in comparison with a DNA ladder, polyadenylated Cas9 mRNA appears to migrate at a size of approximately 1.5 kb on an agarose gel [16]; use a high range single-stranded RNA ladder and electrophorese under denaturing conditions if a more accurate size comparison is desired.

12. Electroporation of zygotes with CRISPR/Cas9 has been shown to be an effective alternative to microinjection [17, 18], including electroporation of zygotes while they are still in the oviducts to negate the need for embryo transfer [19]. A detailed protocol on electroporation of mouse zygotes for CRISPR/Cas9 delivery can be found in this book in Chapter 10 by Qin and Wang [20].

13. The same amount of commercially available Cas9 protein can be used instead of Cas9 mRNA to achieve genomic incision. When using Cas9 protein instead of Cas9 mRNA, premix the Cas9 protein and gRNA and incubate at room temperature for 10–20 min to form the ribonucleoprotein complex before using for microinjection.

14. A single injection needle containing 2–3 μL of CRISPR reagents can be used to inject up to 100 zygotes; however, the total volume of CRISPR reagents needed may be greater than this if additional needles are required, depending on whether the needle tip is broken correctly and whether the reagents clog the needle. Preparation of 15–20 μL total of diluted CRISPR reagents (sgRNA and Cas9 diluted in microinjection buffer) should be more than sufficient for an entire microinjection procedure; this excess volume will facilitate centrifugation of the diluted reagents to pellet any particles that may clog the needle.

15. It is very important to adjust and optimize the microscope, so that movement of cytoplasmic organelles near the needle tip is clearly visible when the fluid containing CRISPR reagent is forced out of the needle. Otherwise, it is very easy to inject each egg with too much or too little reagent. A high percentage of lysed eggs indicates that the needle opening is too big or the volume injected is too high; change needle or adjust pressure accordingly.

16. M16 medium does not contain HEPES buffer, so it needs to be equilibrated in the CO₂ incubator for several hours before using.

17. We prefer to perform oviduct transfer the day after microinjection so we can monitor the egg development. If there is a shortage of pseudopregnant foster mothers, embryos can be further cultured in KSOM medium (KSOM medium is preferable to M16 for culturing embryos beyond the 2-cell stage of development). Embryos ranging from the 1-cell stage to the blastocyst stage can be transferred into the oviducts.

18. As an alternative to tail snips, ear punch biopsies may be used as a source of genomic DNA, and may be collected from mice older than 21 days without requiring anesthesia.

19. This extraction method yields genomic DNA containing impurities that can inhibit subsequent PCR reactions, so use of larger tail snips (>5 mm) can be problematic. Excessively large tail snips should be trimmed to reach this size limit; alternately, when proceeding with DNA extraction of larger tissue samples, dilution of the extracted DNA prior to PCR is recommended. As an alternative method, QIAGEN’s DNeasy Blood & Tissue kit yields purer DNA and can accommodate larger amounts of starting tissue, but requires 6 or more hours of tissue digestion for DNA extraction.

20. Upon identification of mutations present in founder mice, phenotypic analysis of the mice may indicate which mutations have resulted in functional gene knockout, prior to further breeding of the founder mice, in order to save time and effort in breeding for mutations that do not cause the desired phenotype.

21. Mouse biopsy samples may be stored short term (a few days to weeks) at −80 °C to protect from DNA degradation.

22. Design forward and backward PCR primer pairs using primer design software such as Primer-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Primer pairs typically have melting temperatures (Tm) within 3–5 °C of each other, as computed by primer design software. For sequencing across the CRISPR cut site, primers should be designed at least 150–200 bases from the CRISPR site, because some deletions can be quite large and DNA sequencing results may be poor within the first 50–100 bases of the primer binding site.

23. Forward and backward primer pairs initially designed for genotyping at each exon are indicated by white arrowheads in Fig. 5a, b, while additional primers indicated by black arrowheads were required to identify larger deletions. Mouse number 1–3 was heterozygous for 235 and 240 bp deletions at exon 1, but no PCR products could be amplified from this mouse using primers 2 and 3 in Fig. 4a, since each of these primers binds within one of the deleted regions as depicted in Fig. 5a. The additional primers were therefore required to amplify and distinguish between these similarly-sized PCR products, as shown in Fig. 4b–d.

24. A control sample of wild-type mouse genomic DNA should be included for comparison when screening for mutations; a negative control sample containing PCR-grade water instead of DNA template should also be included to check for DNA contamination of the PCR reagents.

25. Other DNA polymerases besides Taq polymerase may require different temperatures and times for the PCR denaturation, annealing, and extension steps. Follow manufacturer’s recommendations.

26. Detection of large insertions may require increasing the PCR extension time to amplify larger products.

27. Higher percentage agarose gels are better for separating smaller sizes of linear DNA. A 2% agarose gel is considered optimal for resolving linear DNA between 50 and 2000 bp in length.

28. DreamTaq Green PCR master mix already contains DNA loading dye. When using other PCR buffers that lack dye, add 6x DNA loading dye to samples prior to loading samples into gel.

29. For visualizing DNA stained with ethidium bromide, a 302/312 nm UV transilluminator gives stronger fluorescence intensity which is useful for capturing gel images, but these UV wavelengths can damage DNA in a little as 45 s, negatively affecting subsequent DNA sequencing or plasmid cloning. For visualizing DNA during gel band excision, use of a 365 nm UV transilluminator will cause less DNA damage, but produces weaker fluorescence; minimize UV exposure time during gel band excision to avoid DNA damage.

30. Similar sized PCR products within a sample may appear as a single band during gel electrophoresis, as illustrated in Fig. 4a, b.

31. Genetic mosaicism in founder animals may be evident by the presence of multiple PCR bands in a mouse genomic DNA sample (i.e., more than two bands for an autosomal gene, more than two bands for X chromosome genes in a female mouse, or more than one band for X or Y chromosome genes in male mice).

32. For PCR products containing multiple gel bands that cannot be easily separated by gel electrophoresis, identification of all mutations present at the genomic target site can be performed by TOPO-TA cloning of the mixed PCR product according to the manufacturer’s protocol, followed by sequencing of DNA prepared from multiple TOPO vector clones.

33. Use of a lab coat, gloves, and a UV blocking face shield is important when performing gel band excision, to protect from UV damage to skin and eyes.

34. For recovery of DNA fragments larger than 1000 bp, heat to 70 °C for 5 min after adding Buffer NE or water, instead of incubating at room temperature.

35. Typically, either of the primers used for the initial PCR can be used for subsequent sequencing. However, DNA sequence quality typically deteriorates beyond 300–500 bases from the primer binding site, so it may be necessary to design another sequencing primer closer to the CRISPR target site to obtain good quality sequences for larger PCR products. Sequence quality may also be poor within the first 50–100 bases of the primer binding site, so primers should be designed at least that far away from the CRISPR target site for accurate sequencing of CRISPR-induced mutations.

36. DNA sequence analyses for comparisons between wild-type sequences and CRISPR-induced mutations can be performed using free online tools such as the Basic Local Alignment Search Tool (BLAST; https://blast.ncbi.nlm.nih.gov) or commercial programs such as Sequencher DNA Analysis Software.

37. In the case of small mutations that cannot be easily distinguished from wild-type based on size differences of PCR products, analyze the sequences for the presence of a unique restriction endonuclease site that can distinguish between the wild-type and the mutation sequence, which would allow for genotyping to be performed by digesting PCR products with this restriction endonuclease and analyzing digested products by gel electrophoresis.

38. Predictions of MMEJ-induced deletions at the CRISPR target site may be determined using the Cas-Designer tool or Microhomology-Predictor tool of the Center for Genome Engineering, Institute for Basic Science, Korea (http://www.rgenome.net).