Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Sep 2.
Published in final edited form as: Methods Mol Biol. 2020;2133:327–341. doi: 10.1007/978-1-0716-0434-2_16

Recombinant expression of cyclotides using expressed protein ligation

Maria Jose Campbell 1, Jingtan Su 1, Julio A Camarero 1,2
PMCID: PMC7467683  NIHMSID: NIHMS1574117  PMID: 32144675

Abstract

Cyclotides are naturally-occurring micro-proteins (≈30 residues long) present in several families of plants. All cyclotides share a unique head-to-tail circular knotted topology containing three disulfide bridges forming a cystine knot topology. Cyclotides possess high stability to chemical, physical and biological degradation and have been reported to cross cellular membranes. In addition, naturally-occurring and engineered cyclotides have shown to possess various pharmacologically-relevant activities. These unique features make the cyclotide scaffold an excellent tool for the design of novel peptide-based therapeutics by using molecular evolution and/or peptide epitope grafting techniques. In this chapter, we provide protocols to recombinantly produce a natively folded cyclotide making use of a standard bacterial expression system in combination with an intein-mediated backbone cyclization with concomitant oxidative folding.

Keywords: Cyclotides, CCK motif, intein, protein splicing, GyrA intein

1. Introduction

Cyclotides are small globular microproteins (ranging from 28 to 37 residues) possessing a head-to-tail cyclized backbone topology and three interlocked disulfide bonds forming a cystine-knot (CCK) motif (1, 2) (Fig. 1). The CCK topology found in the cyclotide scaffold imparts high molecular rigidity to its backbone backbone (3-5) making it exceptional stable towards physical, chemical and biological degradation (6). In fact, the use of cyclotide-containing plants in indigenous medicine first highlighted the fact that the peptides are resistant to boiling and are orally active (7).

Figure 1.

Figure 1.

Open in a new tab

Tertiary structure of cyclotide MCoTI-II (PDB code: 1IB9) (42) and the primary structure of related cyclotide MCoTI-I used in this study. The backbone cyclized peptide (connecting bond shown in green) is stabilized by the three disulfide bonds (shown in red). The cyclization site used in this chapter is indicated with a black arrow.

The main features of cyclotides are a remarkable stability due to the CCK topology, a small size making them readily accessible to chemical synthesis (8), and an excellent tolerance to sequence variations. Naturally-occurring cyclotides have shown to possess various pharmacologically-relevant activities (see refs (1, 2) for recent reviews on the different biomedical applications of cyclotides). Cyclotides can also be engineered for the production of compounds with novel biological activities to target extracellular (9-11) and intracellular (12) molecular targets, with some of them working in vivo in cancer animal models. Some of these novel cyclotides have been shown to be orally bioavailable (10) and able to cross cellular membranes efficiently (13, 14). All these features make cyclotides a highly promising framework for peptide drug design (1, 2, 15).

Naturally-occurring cyclotides are produced in plants from ribosomally produced precursor proteins (16-20). The mechanism of excision of the cyclotide domains and ligation of the free N- and C-termini to produce the circular peptides involves two types of enzymes, papain-like cysteine proteases required in the N-terminal cleavage of cyclotide precursors (16) and asparaginyl endopeptidase-like ligases involved in the cyclization process (21-23).

Cyclotides can also be produced recombinantly using standard microbial expression systems by making use of modified protein splicing units (24-29). This has made possible the production of genetically-encoded libraries of cyclotides for rapid screening and selection of cyclotides with novel biological activities (25, 27).

We provide in this chapter a protocol to produce cyclotide MCoTI-I (Fig. 1) employing a standard Escherichia coli-based expression system in combination with the use of an intramolecular version of expressed protein ligation (EPL) (30-32). Cyclotide MCoTI-I is a very potent trypsin inhibitor (Ki ≈ 20 pM) that can be isolated from dormant seeds of Momordica cochinchinensis, a plant member of the Cucurbitaceae family (33). Trypsin inhibitor cyclotides are very interesting candidates for the development of novel peptide-based therapeutics because they are not toxic to mammalian cells (up to concentrations of 100 μM) (12) and they can cross mammalian cell membranes (13, 14). In addition, MCoTI-cyclotides are amenable to sequence modification through molecular evolution or by grafting of bioactive peptide epitopes allowing the generation of cyclotides with novel biological functions (9, 12, 25).

Backbone cyclization of a polypeptide using EPL can be accomplished by placing a cysteine at the N-terminus of the target protein while the C-terminus is fused to an N-terminus of a modified Cys intein engineered to favor N-terminal cleavage (Fig. 2) (8, 34). A cysteine can either be generated by introducing an upstream intein or by conventional proteolytic cleavage. The Cys residue can then react in an intramolecular fashion with an α-thioester generated by the downstream intein, thus providing a backbone cyclized polypeptide (Fig. 2). EPL has been used for the production of different disulfide-rich backbone cyclized polypeptides including sunflower trypsin inhibitor 1 (SFTI-1) (35), θ-defensins (36, 37), and cyclotides (12, 28, 29).

Figure 2.

Figure 2.

Open in a new tab

In-cell expression of native folded cyclotide MCoTI-I using EPL-mediated backbone cyclization in bacterial cells.

Heterologous production of cyclotide MCoTI-I will be accomplished employing a modified version of the Mxe GyrA intein (38). This bacterial-derived mini-intein has a relatively small size (≈27 kDa) and shows high levels of expression in bacterial-based expression systems. This ensures a higher level of expression for the corresponding cyclotide linear precursor. Incorporation of a Met residue at the N-terminus of the cyclotide linear precursor sequence makes possible the generation of a N-terminal Cys residue by endogenous Met aminopeptidase (MAP) as the corresponding cyclotide-intein precursor protein is translated in vivo (39).

In cell production of folded MCoTI-I can be accomplished by expressing MCoTI-intein fusion protein 1 (Fig. 3). This construct contains an MCoTI-I linear precursor fused to the N-terminus of the Mxe GyrA intein. None of the additional native N-extein residues of the intein are used in this construct. To facilitate backbone cyclization we use the native Cys residue located at the beginning of loop 6 of MCoTI-II (Figs. 1 and 3). This loop contains a highly flexible peptide sequence and it is not required for folding or biological activity (3, 40). Construct 1 also contains a chitin binding domain (CBD) fused at the C-terminus of the GyrA intein to facilitate purification. In-cell expression of cyclotide MCoTI-I using EPL-mediated backbone cyclization is achieved by transforming the plasmid encoding the cyclotide-precursor 1 into Origami 2(DE3) cells to facilitate folding. Origami E. coli strains are K-12 derivatives that have mutations in both the thioredoxin reductase (trxB) and glutathione reductase (gor) genes, which greatly enhance disulfide bond formation in the E. coli cytoplasm (41).

Figure 3.

Figure 3.

Open in a new tab

Architecture of the intein precursor used for the expression of cyclotide MCoTI-I described in this protocol.

2. Materials

All solutions were prepared using ultrapure water with a resistivity of 18 MΩ x cm at 25° C and analytical grade reagents. All reagents and solutions were stored at room temperature unless indicated otherwise.

2.1. Instruments

  1. Water bath able to operate at 95 °C.

  2. Table-top micro centrifuge capable of operating at 14,000 rpm.

  3. Microbiology incubator set at 37 °C.

  4. Temperature controlled incubator Shaker.

  5. Orbital shaker.

  6. Polymerase chain reaction thermocycler.

  7. Agarose gel electrophoresis unit.

  8. Electrophoresis power pack able to operate up to 250 V.

  9. UV-visible spectrophotometer.

  10. Sonicator.

  11. High speed centrifuge.

  12. SDS-PAGE electrophoresis apparatus.

  13. Centrifuge tubes of 0.5 mL, 1.5 mL, 15 mL and 30 mL of capacity.

  14. 5 ml Polypropylene Columns.

  15. Lyophilizer.

  16. HPLC system equipped with gradient capability and UV-vis detection.

  17. C18 reverse phase HPLC columns.

  18. Electrospray mass spectrometer (ES-MS or similar mass spectrometer).

2.2. Cloning of MCoTI-intein contruct 1

  1. Expression plasmid pTXB-1 (New England Biolabs). This vector contains an engineered GyrA intein and a chitin-binding domain (CBD)

  2. DNA ultramers encoding MCoTI-II (20 nmol scale, 5’-phosphorylated and purified by PAGE) (Table 1).

  3. TE buffer: 10 mM Tris-HCl and 1 mM EDTA buffer at pH 8.0.

  4. Annealing buffer: 20 mM Na2HPO4, 300 mM NaCl buffer at pH 7.4.

  5. QIAquick PCR Purification Kit (QIAGEN or similar).

  6. QIAprep Spin Miniprep Kit (QIAGEN or similar).

  7. QIAquick Gel Extraction Kit (QIAGEN or similar).

  8. PCR reagents: Vent DNA polymerase, TaqDNA polymerase, dNTPs solution, 10X thermopol PCR buffer, 10X Taq DNA polymerase buffer (New England Biolabs Inc).

  9. Chemical competent DH5α cells (Invitrogen).

  10. LB medium: Dissolve 25 g of LB broth in 1 L of pure H2O and sterilized by autoclaving at 120 °C for 30 min.

  11. LB medium-agar: Suspend 3.3 g of LB agar in 100 mL of pure H2O and sterilized by autoclaving at 120° C for 30 min. To prepare plates, allow LB medium-agar to cool to ≈50 °C, then add 0.1 mL of ampicillin stock solution (100 mg ampicillin/mL in H2O, sterilized by filtration over a 45 μm filter), gently mix and pipet 20 mL into a sterile petri dish (100 mm diameter).

  12. SOC Medium: 20 g of tryptone, 5 g yeast extract, 0.5 g NaCl and 0.186 g KCl. Suspend ingredients into 980 mL of pure water and sterilize by autoclaving at 120° C for 30 min. Dissolve 4.8 g MgSO4, 3.603 g dextrose in 20 mL of pure H2O and filter sterilize over a 45 μm filter and add to the autoclaved medium.

Table 1.

Forward (p5) and reverse (p3) 5’-phosphorylated oligonucleotides used to clone the different MCoTI-intein linear precursor into the pTXB1 expression plasmid. DNA sequences were generated using optimal codons for expression in E. coli.

Linear
Precursor		 Oligonucleotide sequence
1 p5 5’-TATGTGCGGTTCTGGTTCTGACGGTGGTGTTTGCCCGAAAATCCTGAAAA
AATGCCGTCGTGACTCTGACTGCCCGGGTGCTTGCATCTGCCGTGGTAACGG
TTAC-3’
p3 5’-GCAGTAACCGTTACCACGGCAGATGCAAGCACCCGGGCAGTCAGAGTCA
CGACGGCATTTTTTCAGGATTTTCGGGCAAACACCACCGTCAGAACCAGAA
CCGCACA-3’
Open in a new tab

2.3. Cyclotide expression, purification and characterization

  1. Chemical competent Origami2 (DE3) cells (EMD Millipore).

  2. 1 M Isopropyl-thio-β-D-galactopyranoside (IPTG) in H2O. Sterilize by filtration over 45 μm filter and store at −20° C.

  3. Sterile conical bottom flask.

  4. Lysis buffer: 0.1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM phenylmethylsulfonyl fluoride (PMSF), 50 mM sodium phosphate, 250 mM NaCl buffer at pH 7.2 containing 10% glycerol

  5. Chitin agarose beads (New England Biolabs).

  6. 100 mM phenylmethylsulphonyl fluoride (PMSF) in EtOH (better to prepare fresh before use)

  7. 4×SDS-PAGE sample buffer: 1.5 mL of 1 M Tris-HCl buffer at pH 6.8, 3 mL of 1 M DTT (dithiothreitol) in pure H2O, 0.6 g of sodium dodecyl sulfate (SDS), 30 mg of bromophenol blue, 2.4 mL of glycerol, bring final volume to 7.5 mL.

  8. SDS-PAGE sample buffer: dilute 4 times 4×SDS-PAGE sample buffer in pure H2O and add 20% 2-mercaptoethanol (by volume). Prepare fresh.

  9. SDS-4-20% PAGE gels, 1X SDS running buffer.

  10. Gel stain: Gelcode® Blue (Thermo scientific or similar).

  11. N-hydroxy-succinimide ester (NHS)-activated sepharose beads (GE Healthcare life sciences or similar).

  12. Porcine pancreatic trypsin type IX-S (14,000 units/mg).

  13. Coupling buffer: 200 mM sodium phosphate, 250 mM NaCl buffer at pH 6.0.

  14. Washing buffer: 200 mM sodium acetate, 250 mM NaCl buffer at pH 4.5.

  15. Column buffer: 0.1 mM ethylenediaminetetraacetic acid (EDTA), 50 mM sodium phosphate, 250mM NaCl buffer at pH 7.2.

  16. 8 M guanidium chloride in pure water for molecular biology (Sigma-Aldrich, USA).

  17. Solid-phase extraction silica-C18 cartridge (820 mg of silica-C18, 55-105 μm particle size) (Sep-Pak C18 Plus Long Cartridge, Waters, USA).

  18. HPLC buffers. Buffer A: pure and filtered (over 45 μm filter) H2O with 0.1% trifluoroacetic acid (TFA) (HPLC grade). Buffer B: 90% acetonitrile (HPLC grade) in pure and filtered (over 45 μm filter) H2O with 0.1% TFA.

3. Methods

3.1. Construction of MCoTI-intein construct 1

This section allows the production of an expression plasmid encoding the cyclotide-intein fusion precursor protein 1 (Figs. 2 and 3).

3.1.1. Obtaining the dsDNA encoding cyclotide MCoTI-I

  1. Dissolve each ultramer shown in Table 1 in TE buffer to a concentration of 1 μg/μL with TE buffer.

  2. Add 5 μL of a solution containing the upper DNA strand (P5) and 5 μL of a solution containing the lower strand (P3) to a 0.5 mL centrifuge tube containing 2.5 μL of 10X annealing buffer and 12 μL of pure H2O.

  3. Incubate sample from step 2 on a preheated water bath to 95° C for 15 min. After the allocated time, turn the power of the water bath off, and allow the samples to slowly cool down until room temperature is reached. The cooling process should not take less than 60 min.

  4. Purify the double strand DNA fragments using a PCR purification kit following the manufacturer instructions.

  5. Quantify double strand DNA fragments by UV-vis spectroscopy (for a 1-cm pathlength, an optical density at 260 nm (OD260) of 1.0 equals to a concentration of 50 μg/mL solution of dsDNA).

3.1.2. Preparation of expression plasmid pTXB1-MCoTI

  1. Digest plasmid pTXB1 (New England Biolabs) with restriction enzymes Nde I and Sap I. Use a 0.5 mL centrifuge tube and add 5 μL of cut smart buffer (New England Biolabs), add enough pure sterile water to have a final volume reaction of 50 μL, add ≈ 10 μg of the corresponding dsDNA to be digested add finally add 1 μL (20 units) of restriction enzyme Nde I (New England Biolabs). Incubate at 37° C for 3 h. Then, add 1 μL (20 units) of restriction enzyme Sap I (New England Biolabs) to the same tube and incubate at 37° C for 3 h.

  2. Purify double digested pTXB1 plasmid by using 0.8% agarose gel electrophoresis. Cut the band corresponding to the double digested DNA and purify it using the QIAquick Gel Extraction Kit (QIAGEN or similar), elute it with TE buffer and quantify it using UV-visible spectroscopy.

  3. Ligate double digested pTXB1 and dsDNA encoding MCoTI-intein. Use a 0.5 mL centrifuge tube, add ≈ 100 ng of Nde I, Sap I-digested pTXB1, ≈50 ng of 5’-phosporylated dsDNA MCoTI-I, enough pure sterile H2O to make a final reaction volume of 20 μL, 2 μL of 10X T4 DNA ligase buffer, 1 μL of 10 mM ATP and 1 μL (400 units) T4 DNA ligase. Incubate at 16° C overnight.

  4. Transform the ligation mixture into DH5α competent cells. ≈100 μL of chemical competent cells are thawed on ice and mixed with the ligation mixture (20 μL) for 30 min. Heat -shock cells at 42° C for 45 s and then kept on ice for an extra 10 min. Add 900 μL of SOC medium and incubate at 37° C for 1 h in an orbital shaker. Plate 100 μL on LB agar plate containing ampicillin (100 μg/mL) and incubate the plate at 37° C overnight.

  5. Pick up several colonies (most of the times 5 colonies should be enough) and inoculate each individual colony into separate 5 ml of LB media containing ampicillin (100 μg/mL). Incubate the tubes at 37° C overnight in an orbital shaker.

  6. Pellet down cells and extract DNA using the QIAprep Spin Miniprep Kit (QIAGEN) following the manufacturer protocol and quantify plasmid using UV-visible spectroscopy.

  7. Verify the presence of DNA encoding MCoTI-intein construct in each colony using EcoR I restriction enzyme as this restriction site is removed during cloning. Use a 0.5 mL centrifuge tube and add 2 μL of cut smart buffer (New England Biolabs), add enough pure sterile water to have a final volume reaction of 20 μL, add ≈ 100 ng of the corresponding plasmid to be digested, and finally add 1 μL (20 units) of restriction enzyme EcoR I (New England Biolabs). Incubate at 37° C for 3 h. Analyze the reaction by 0.8% agarose gel electrophoresis. Positive clones should not be linearized by EcoR I digestion.

3.2. Expression and purification of MCoTI-intein precursor 1

This section allows the expression of the cyclotide-intein protein construct 1 and to evaluate the expression level of 1 using SDS-PAGE as shown in Fig. 4.

Figure 4.

Figure 4.

Open in a new tab

Expression of cyclotide precursor 1 and characterization of cyclotide MCoTI-I produced in E. coli cells. A. SDS-PAGE analysis of the recombinant expression of cyclotide precursors 1 in Origami2(DE3) cells for in-cell production of cyclotide MCoTI-I. The bands corresponding to precursor 1, and cleaved intein are marked with arrows. M stands for protein markers. B. Analytical HPLC trace of the soluble cell extract of bacterial cells expressing precursor 1 after purification by affinity chromatography on a trypsin-sepharose column. Folded MCoTI-I is marked with an arrow. Mass spectrum (inset) of affinity purified MCoTI-I. The expected average molecular weight is shown in parentheses.

3.2.1. Expression of precursor protein encoding the MCoTI-intein construct 1

  1. Transform chemical competent Origami2(DE3) cells with plasmid containing the DNA encoding MCoTI-intein construct 1 (plasmid pTXB1-MCoTI) (Note:1). Transformed cells are plated on LB agar plates containing ampicillin (100 μg/mL) and incubated at 37° C overnight as described is section 3.1.2 (Note: 2).

  2. All the colonies from 2 plates are resuspended in 2 mL of LB and inoculated in 1 L of LB containing ampicillin (100 μg/mL) in a 2.5 L flask.

  3. Grow cells in an orbital shaker incubator at 37° C for 2-3 h to reach mid-log phase (OD at 600 nm ≈ 0.5). Add IPTG to reach a final concentration of 0.3 mM. Adjust the temperature of the incubator to 25°C and incubate cells in shaker for 16 h.

  4. Pellet the cells down by centrifugation at 6,000 x g for 15 min at 4° C. Discard the supernatant and process the pellet immediately. (Note: 3).

Determination of protein precursor 1 expression level

  1. Resuspend cell pellet with 30 mL of Lysis buffer containing 5% glycerol. Lyse cells by sonication on ice using 25 s bursts spaced 30 s each (Note: 4). Repeat the cycle six times. (Note: 5). Take two 100 μL aliquots. In one of the samples add 33 μL 4X SDS-PAGE sample buffer containing 20% 2-mercaptoethanol heat it at 94° C for 5 min (label it total cell lysate, T). For the other aliquot, separate the insoluble and soluble fractions by centrifugation at 14,000 rpm in a microcentrifuge at 4° C for 30 min. Take the supernatant fraction and resuspend the pellet in 100 μL of lysis buffer. Add 33 μL of 4X SDS-PAGE sample buffer containing 20% 2-mercaptoethanol to both fractions and heat them at 94° C for 5 min (label them soluble and insoluble cell lysate samples, S and P, respectively). Save the samples for later SDS-PAGE analysis.

  2. Separate the soluble cell lysate fraction by centrifugation at 15,000 x g for 20 min at 4° C. Store the pellets at −80° C in case they need to be re-processed.

  3. Transfer the soluble cell lysate fraction (≈ 30 mL) into a 50 mL centrifuge tube and add 1 mL of pre-equilibrated chitin-agarose beads by washing them with at least 10 column volumes of column buffer. Incubate with gentle rocking for 30 min at 4° C.

  4. Separate the beads from the supernatant by centrifugation at 3,000 x g for 10 min at 4° C. Take the supernatant and save it at 4°C for later processing (Section 3.4). Separate the beads and wash them in a 5 mL polypropylene column (QIAGEN) with no less than 50 column volumes of column buffer containing 0.1% Triton X100 and then rinsed and equilibrated with 100 bead-volumes of column buffer. Take ≈ 100 μL chitin-agarose beads into a 0.5 mL centrifuge tube, add 33 μL of 4X SDS-PAGE sample buffer containing 20% 2-mercaptoethanol heat it at 94° C for 5 min (label it soluble cell lysate bound to chitin-agarose beads, B). Save the sample for later SDS-PAGE analysis.

  5. Analyze the expression level of the precursor protein 1 using SDS-PAGE (Fig. 4A). Load 25 μL of samples labeled T, P, S and B (see above) onto an SDS-4-20% PAGE gel. Run the samples at 125 V for about 1 h and 30 min in 1X SDS running buffer. Remove SDS with pure water and stain the gel with 20 mL GelCode® Blue reagent (Thermo Scientific) using the manufacturer protocol (Fig. 4A). A bacterial clone with good expression level of precursor protein 1 should show two protein bands on the analysis by SDS-PAGE of the chitin beads fraction (Fig. 4A), where the upper and lower bads are the the uncleaved and cleaved cyclotide-intein precursor. The ratio of cleaved/uncleaved proteins usually ranges from 6/4 to 7/3 for this cyclotide.

  6. Discard any samples not showing intein precursor protein 1 or its cleaved product as they will not contain cyclotide to be purified.

3.3. Preparation of trypsin-immobilized agarose beads

This section allows the production of trypsin-agarose beads that will be used for the purification of folded cyclotide MCoTI-I by using affinity chromatography (section 3.4).

  1. Wash ≈ 1 mL of NHS-activated sepharose (GE Healthcare) with 15 column volumes of ice-cold 1 mM HCl using a 5 mL polypropylene column (QIAGEN).

  2. Equilibrate the column with 15 volumes of coupling buffer.

  3. Dissolve 4 mg of porcine pancreatic trypsin in 500 μL of coupling buffer using gentle rocking

  4. Add the trypsin solution to the equilibrated NHS-activated sepharose beads and incubate for 3 h with gentle rocking at room temperature.

  5. Wash the sepharose beads with 10 volumes of coupling buffer containing 100 mM ethanolamine.

  6. Incubate beads with 3 column volumes of coupling buffer containing 100 mM ethanolamine for 3 h with gentle rocking at room temperature.

  7. Wash the sepharose beads with 50 column volumes of washing buffer and store a 4° C until use (Note: 6). The loading of the trypsin-sepharose can be determined by incubating a small aliquot of the beads with a known amount of pure MCoTI-I and determining the amount of cyclotide captured on the beads using HPLC, see below).

3.4. Affinity-purification of cyclotide MCoTI-I from bacterial soluble cell lysate

This section allows the purification of the natively folded cyclotide MCoTI-I produced during the intein-induced backbone cyclization of the cyclotide precursor 1 by using by affinity chromatography with trypsin-agarose beads. This procedure will allow only to capture natively folded cyclotide as missfolded product/s will not be able to bind the trypsin immbobilized onto the sepharose beads. The bound cyclotide can be simply eluted using a chaotropic salt to destabilize the complex between the cyclotide and trypsin.

  1. Wash ≈ 500 μL of trypsin-sepharose beads with 10 column volumes of column buffer.

  2. Incubate the washed beads with the soluble cell lysate flow-through from the chitin agarose beads purification step (Section 3.2.2, step 4) for 1 h at room temperature with gentle rocking.

  3. Separate the supernatant by centrifugation at 3,000 x g for 10 min at 4° C.

  4. Transfer the trypsin-beads to a 5 mL polypropylene column (QIAGEN) and wash the beads with 50 volumes of column buffer containing 0.1% Tween 20.

  5. Wash trypsin-beads with 50 volumes of column buffer with no detergent added.

  6. Elute bound cyclotide MCoTI-I with 3 volumes (3 x 500 μL) of 8 M guanidium hydrochloride at room temperature for 15 min by gravity.

  7. Desalt the sample using a solid-phase extraction cartridge (SepPak or similar) by following the manufacturer protocol. Briefly, pre-swell the SepPak cartridge with 20 mL of 50% acetonitrile in water containing 0.1% TFA. Equilibrate cartridge with 50 mL of HPLC buffer A. Load sample into the cartridge using a plastic 20 mL syringe slowly with a flow rate of ≈ 1 mL/min. Collect the flow-through and repeat this step for efficient binding. Wash the cartridge with 20 mL of 5% acetonitrile in H2O containing 0.1% TFA. Elute cyclotide MCoTI-I from the solid-phase extraction cartridge with 5 mL of HPLC buffer-B. Lyophilize to remove solvents.

  8. Dissolve in 5 mL of HPLC buffer A. Analyze sample by HPLC using an isocratic of 0% buffer B for 2 min and then a linear gradient of 0% to 70% buffer B in 30 min. Use detection at 220 and 280 nm. Using these conditions the retention time of the cyclotide should be around 15 min (Fig. 4B). Collect the peak and analyze by mass spectrometry to confirm identity of cyclotide MCoTI-I (expected molecular weight: 3481.0 Da) (Fig. 4B).

  9. Quantify the cyclotide using UV-vis spectroscopy and a molar absorptivity at 280 nm of 2240 M−1 x cm−1. Around 40 μg of folded cyclotide should be obtained per liter of LB culture.

Footnotes

1.

We recommend at this point to use at least least 3-4 different colonies or clones for evaluating the expression levels of the MCoTI-I intein construct 1.

2.

When plating the transformed cells with pTXB1-MCoTI, it is better to aim for plates containing 100-200 colonies. Plates containing excessive number of colonies may facilitate the appearance of colonies not containing the plasmid due to the destruction of the antibiotic by the secreted beta-lactamase.

3.

Cell pellets can be stored at −80° C for no more than 2-3 weeks before being processed.

4.

During sonication, be sure the temperature of the sample does not overheat.

5.

A french press can be also used to lyse cells, depending on the availability.

6.

The trypsin-sepharose column should not be stored for more than 2 weeks.

References

  • 1.Gould A, and Camarero JA (2017) Cyclotides: Overview and Biotechnological Applications, ChemBioChem 18: 1350–1363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang CK, and Craik DJ (2018) Designing macrocyclic disulfide-rich peptides for biotechnological applications, Nat. Chem. Biol 14: 417–427. [DOI] [PubMed] [Google Scholar]
  • 3.Puttamadappa SS, Jagadish K, Shekhtman A, and Camarero JA (2010) Backbone dynamics of cyclotide MCoTI-I free and complexed with trypsin, Angew. Chem. Int. Ed. Engl 49: 7030–7034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Puttamadappa SS, Jagadish K, Shekhtman A, and Camarero JA (2011) Erratum in: Backbone Dynamics of Cyclotide MCoTI-I Free and Complexed with Trypsin, Angew. Chem. Int. Ed. Engl 50: 6948–6949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Daly NL, Thorstholm L, Greenwood KP, King GJ, Rosengren KJ, Heras B, Martin JL, and Craik DJ (2013) Structural Insights into the Role of the Cyclic Backbone in a Squash Trypsin Inhibitor, J. Biol. Chem 288: 36141–36148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chaudhuri D, Aboye T, and Camarero JA (2019) Using backbone-cyclized Cys-rich polypeptides as molecular scaffolds to target protein-protein interactions, Biochem. J 476: 67–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Saether O, Craik DJ, Campbell ID, Sletten K, Juul J, and Norman DG (1995) Elucidation of the primary and three-dimensional structure of the uterotonic polypeptide kalata B1, Biochemistry 34: 4147–4158. [DOI] [PubMed] [Google Scholar]
  • 8.Li Y, Bi T, and Camarero JA (2015) Chemical and biological production of cyclotides, Adv. Bot. Res 76: 271–303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Aboye TL, Ha H, Majumder S, Christ F, Debyser Z, Shekhtman A, Neamati N, and Camarero JA (2012) Design of a novel cyclotide-based CXCR4 antagonist with anti-human immunodeficiency virus (HIV)-1 activity, J. Med. Chem 55: 10729–10734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wong CT, Rowlands DK, Wong CH, Lo TW, Nguyen GK, Li HY, and Tam JP (2012) Orally active peptidic bradykinin B1 receptor antagonists engineered from a cyclotide scaffold for inflammatory pain treatment, Angew. Chem. Int. Ed. Engl 51: 5620–5624. [DOI] [PubMed] [Google Scholar]
  • 11.Chan LY, Gunasekera S, Henriques ST, Worth NF, Le SJ, Clark RJ, Campbell JH, Craik DJ, and Daly NL (2011) Engineering pro-angiogenic peptides using stable, disulfide-rich cyclic scaffolds, Blood 118: 6709–6717. [DOI] [PubMed] [Google Scholar]
  • 12.Ji Y, Majumder S, Millard M, Borra R, Bi T, Elnagar AY, Neamati N, Shekhtman A, and Camarero JA (2013) In vivo activation of the p53 tumor suppressor pathway by an engineered cyclotide, J. Am. Chem. Soc 135: 11623–11633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Contreras J, Elnagar AY, Hamm-Alvarez SF, and Camarero JA (2011) Cellular uptake of cyclotide MCoTI-I follows multiple endocytic pathways, J. Control. Release 155: 134–143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cascales L, Henriques ST, Kerr MC, Huang YH, Sweet MJ, Daly NL, and Craik DJ (2011) Identification and characterization of a new family of cell-penetrating peptides: cyclic cell-penetrating peptides, J. Biol. Chem 286: 36932–36943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Camarero JA (2017) Cyclotides, a versatile ultrastable micro-protein scaffold for biotechnological applications, Bioorg. Med. Chem. Lett 27: 5089–5099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Rehm FBH, Jackson MA, De Geyter E, Yap K, Gilding EK, Durek T, and Craik DJ (2019) Papain-like cysteine proteases prepare plant cyclic peptide precursors for cyclization, Proc. Natl. Acad. Sci. U. S. A 116: 7831–7836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Mylne JS, Chan LY, Chanson AH, Daly NL, Schaefer H, Bailey TL, Nguyencong P, Cascales L, and Craik DJ (2012) Cyclic peptides arising by evolutionary parallelism via asparaginyl-endopeptidase-mediated biosynthesis, Plant Cell 24: 2765–2778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Poth AG, Mylne JS, Grassl J, Lyons RE, Millar AH, Colgrave ML, and Craik DJ (2012) Cyclotides associate with leaf vasculature and are the products of a novel precursor in petunia (Solanaceae), J. Biol. Chem 287: 27033–27046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Poth AG, Colgrave ML, Lyons RE, Daly NL, and Craik DJ (2011) Discovery of an unusual biosynthetic origin for circular proteins in legumes, Proc. Natl. Acad. Sci. U. S. A 108: 10127–10132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jennings C, West J, Waine C, Craik D, and Anderson M (2001) Biosynthesis and insecticidal properties of plant cyclotides: the cyclic knotted proteins from Oldenlandia affinis, Proc. Natl. Acad. Sci. U. S. A 98: 10614–10619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gillon AD, Saska I, Jennings CV, Guarino RF, Craik DJ, and Anderson MA (2008) Biosynthesis of circular proteins in plants, Plant J. 53: 505–515. [DOI] [PubMed] [Google Scholar]
  • 22.Saska I, Gillon AD, Hatsugai N, Dietzgen RG, Hara-Nishimura I, Anderson MA, and Craik DJ (2007) An asparaginyl endopeptidase mediates in vivo protein backbone cyclization, J. Biol. Chem 282: 29721–29728. [DOI] [PubMed] [Google Scholar]
  • 23.Nguyen GK, Wang S, Qiu Y, Hemu X, Lian Y, and Tam JP (2014) Butelase 1 is an Asx-specific ligase enabling peptide macrocyclization and synthesis, Nat. Chem. Biol 10: 732–738. [DOI] [PubMed] [Google Scholar]
  • 24.Jagadish K, and Camarero JA (2017) Recombinant Expression of Cyclotides Using Split Inteins, Methods Mol. Biol 1495: 41–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jagadish K, Gould A, Borra R, Majumder S, Mushtaq Z, Shekhtman A, and Camarero JA (2015) Recombinant Expression and Phenotypic Screening of a Bioactive Cyclotide Against alpha-Synuclein-Induced Cytotoxicity in Baker's Yeast, Angew. Chem. Int. Ed. Engl 54: 8390–8394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Jagadish K, Borra R, Lacey V, Majumder S, Shekhtman A, Wang L, and Camarero JA (2013) Expression of fluorescent cyclotides using protein trans-splicing for easy monitoring of cyclotide-protein interactions, Angew. Chem. Int. Ed. Engl 52: 3126–3131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Austin J, Wang W, Puttamadappa S, Shekhtman A, and Camarero JA (2009) Biosynthesis and biological screening of a genetically encoded library based on the cyclotide MCoTI-I, ChemBioChem 10: 2663–2670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Camarero JA, Kimura RH, Woo YH, Shekhtman A, and Cantor J (2007) Biosynthesis of a fully functional cyclotide inside living bacterial cells, ChemBioChem 8: 1363–1366. [DOI] [PubMed] [Google Scholar]
  • 29.Kimura RH, Tran AT, and Camarero JA (2006) Biosynthesis of the cyclotide Kalata B1 by using protein splicing, Angew. Chem. Int. Ed. Engl 45: 973–976. [DOI] [PubMed] [Google Scholar]
  • 30.Sarmiento C, and Camarero JA (2019) Biotechnological Applications of Protein Splicing, Curr Protein Pept Sci 20: 408–424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Conibear AC, Watson EE, Payne RJ, and Becker CFW (2018) Native chemical ligation in protein synthesis and semi-synthesis, Chem. Soc. Rev 47: 9046–9068. [DOI] [PubMed] [Google Scholar]
  • 32.Berrade L, and Camarero JA (2009) Expressed protein ligation: a resourceful tool to study protein structure and function, Cell. Mol. Life Sci 66: 3909–3922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hernandez JF, Gagnon J, Chiche L, Nguyen TM, Andrieu JP, Heitz A, Trinh Hong T, Pham TT, and Le Nguyen D (2000) Squash trypsin inhibitors from Momordica cochinchinensis exhibit an atypical macrocyclic structure, Biochemistry 39: 5722–5730. [DOI] [PubMed] [Google Scholar]
  • 34.Borra R, and Camarero JA (2013) Recombinant expression of backbone-cyclized polypeptides, Biopolymers 100: 502–509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Austin J, Kimura RH, Woo YH, and Camarero JA (2010) In vivo biosynthesis of an Ala-scan library based on the cyclic peptide SFTI-1, Amino Acids 38: 1313–1322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gould A, Li Y, Majumder S, Garcia AE, Carlsson P, Shekhtman A, and Camarero JA (2012) Recombinant production of rhesus theta-defensin-1 (RTD-1) using a bacterial expression system, Mol. Biosyst 8: 1359–1365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Conibear AC, Wang CK, Bi T, Rosengren KJ, Camarero JA, and Craik DJ (2014) Insights into the molecular flexibility of theta-defensins by NMR relaxation analysis, J. Phys. Chem. B 118: 14257–14266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Klabunde T, Sharma S, Telenti A, Jacobs WR, and Sacchettini JC (1998) Crystal structure of GyrA intein from Mycobacterium xenopireveals structural basis of protein splicing., Nat. Struct. Biol 5: 31–36. [DOI] [PubMed] [Google Scholar]
  • 39.Hirel PH, Schmitter JM, Dessen P, Fayat G, and Blanquet S (1989) Extent of N-Terminal Methionine Excision from Escherichia-Coli Proteins Is Governed by the Side-Chain Length of the Penultimate Amino-Acid, Proc. Natl. Acad. Sci. U. S. A 86: 8247–8251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Avrutina O, Schmoldt HU, Gabrijelcic-Geiger D, Le Nguyen D, Sommerhoff CP, Diederichsen U, and Kolmar H (2005) Trypsin inhibition by macrocyclic and open-chain variants of the squash inhibitor MCoTI-II, Biol. Chem 386: 1301–1306. [DOI] [PubMed] [Google Scholar]
  • 41.Bessette PH, Aslund F, Beckwith J, and Georgiou G (1999) Efficient folding of proteins with multiple disulfide bonds in the Escherichia coli cytoplasm, Proc. Natl. Acad. Sci. U. S. A 96: 13703–13708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Felizmenio-Quimio ME, Daly NL, and Craik DJ (2001) Circular proteins in plants: solution structure of a novel macrocyclic trypsin inhibitor from Momordica cochinchinensis, J. Biol. Chem 276: 22875–22882. [DOI] [PubMed] [Google Scholar]

RESOURCES