Skip to main content
NCBI home page
Physiology and Molecular Biology of Plants logoLink to Physiology and Molecular Biology of Plants
. 2020 Aug 29;26(9):1831–1845. doi: 10.1007/s12298-020-00873-4

SOS5 gene-abscisic acid crosstalk and their interaction with antioxidant system in Arabidopsis thaliana under salt stress

Tuba Acet 1,✉, Asım Kadıoğlu 2
PMCID: PMC7468026  PMID: 32943819

Abstract

SOS5 locus, encodes cell wall adhesion protein under salt stress conditions in plants, and it is required for normal cell expansion as well as for sustaining cell wall integrity and structure. However, it is still unknown how this gene locus-ABA cross-talk and interacts with the antioxidant mechanism under salt stress conditions. For this purpose, the study focused on mutant sos5-1 plant treated with ABA under NaCl stress and observed its growth and development as well as stomatal aperture, lipid peroxidation, proline, hydrogen peroxide (H2O2) and ABA contents, and some antioxidant enzyme activities. In addition, the expression levels of ABA related genes have been analysed by RT-PCR after stress application. According to findings, sos5-1 mutant plants treated with ABA under salt stress resulted in eliminated cellular damage compared to those which are solely exposed to salt stress; other observations include closing of stomata, decreased H2O2 content, increased amount of proline, and similarity with the wild type due to induced antioxidant enzyme activities. Besides, both ABA biosynthetic and inducible gene expressions of the mutant plant under salt stress were lower compared to the control, and catabolism gene expression was higher. As a result, SOS5 gene in synergy with ABA, scavenge the ROS by stimulating antioxidant system, leads to an increase in stress related gene expressions and thus contributes to salinity tolerance. This study is significant in the way that it shows how SOS5 gene locus, under salt stress conditions, interacts with antioxidant system in sustaining cell wall integrity.

Keywords: Abscisic acid, Antioxidant enzymes, Arabidopsis thaliana, Gene expression, Salt stress, sos5-1 mutant

Introduction

Plants are sedentary organisms, and they are prone to many environmental stress factors throughout their lives. Salinity, especially NaCl, is one of the prominent stress factors limiting plant growth and development (Sun et al. 2020). With inaccurate agriculture and irrigation practices as well as industrial activities leading to salt effects on millions of hectares of land (FAO 2016), salinity becomes a global problem for humanity. The harmful effects of NaCl on plants result from decreased usage of water in soil due to sodium accumulation and toxicity of Na+/Cl− ions on plants. The plants named halophytes have developed special strategies in order to cope with salinity (Feng et al. 2018). However, most plants are glycophytes and they are sensitive to salt. Optimization studies aiming at increasing their salt tolerance might be considered as a strategy to cultivate resistant plants on agricultural lands affected from salinity and to increase their productivity (Van Zelm et al. 2020). So, Arabidopsis thaliana is frequently used as a molecular model in reverse and forward genetic studies (Claudia and Krol Matthaus 2011; Pehlivan et al. 2016).

When plants are exposed to salt stress, they respond in two stages. The first phase is called osmotic phase, and as the most rapid phase, it affects growth directly (such as slowing down cell expansion in fresh leaves and root tips and stomata closing). In the second phase named ionic phase, the plant responds in time such as accelerating aging of mature leaves (Munns and Tester 2008). In this phase, the stimulation in the concentration of Na+ and Cl− ions and the lack of K+ ions damage multiple metabolic pathways, including the inhibition of protein biosynthesis and enzyme activities, and leads to the increase of reactive oxygen types causing membrane damage (Pehlivan et al. 2016).

In order to survive, plants have the ability to perceive external signals and to respond to them at different levels. At cellular level, plants have SOS signalization pathways extremely sensitive to salt, and they have a very significant role in stimulating salinity tolerance and providing ion balance in cytosol (Van Zelm et al. 2020). Although, most SOS genes have been studied in terms of their expression and role under salt stress conditions, very little information is available about SOS5 gene, an assumed cell surface adhesion protein that is fundamental for cell expansion (Mahajan et al. 2008). SOS5 (SOS5: Salt Overly Sensitive 5) locus, defined as fasciclin-like AGP (FLAs) which is a sub-group of Arabinogalactan proteins (AGPs) is responsible of information transmission between cell wall and cytoplasm; AGPs are one of the complex glycoproteins localized on cellular surface and wall (Driouich and Baskin 2008; Seifert et al. 2014). FLAs are shown to perform a role in many biological processes including plant growth, cell expansion, salt tolerance, disease response, tissue formation, and cell wall accumulation (Seifert et al. 2014; Basu et al. 2016). In a study, Shi et al. (2003) obtained sos5-1 (fla4) mutant plants as a result of mutation in FLA4 (SOS5) gene locus, and this is a point mutation in which a single nucleotide change results in a codon (C to T) that codes for a different amino acid (Ser to Phe in the commissure region between the fasciclin-like and the AGP-like domains). They found that these plants developed abnormal epidermal, cortical and endodermal cell expansion under salt stress conditions, and as a result a phenotype with extremely short and expanded root tip occurred. The sos5-1 mutant phenotypes definitely demonstrate a crucial role for Ser-348 in the appropriate function of SOS5 (Shi et al. 2003). As a result, it is understood that the gene has approximation to arabinogalactan proteins and domains relevant to cell adhesion. Also, SOS5 is necessary to normal mucilage adherence to seeds (Shi et al. 2003).

Hormones in plants play a substantial role in perceiving and transmitting stress signals (Alazem and Lin 2020). Hormonal signalling interacts with ROS and this is considered as cross-talk that is involved in plant growth, development and stress tolerance (Fujita et al. 2006; Bahin et al. 2011). Although, most of the phytohormones included in this process, especially ABA is a primary hormone which plays a key role in responding to various abiotic stresses through the activation of ROS-scavenging mechanisms (Khan et al. 2020) and while de novo biosynthesis of ABA is being catalysed with a range of enzymes such as ZEP (zeaxanthin epoxidase), NCEDs (9-cis-epoxycarotenoid dioxygenases), and AAO3 (aldehyde oxidase 3), the ABA degradation is basically organized by CYP707As (ABA-8′-hydroxylases) (Finkelstein 2013; Ma et al. 2018). ABA participates in numerous biological processes such as seed dormancy, maturation, germination, blooming, senescence and vegetative development, and it acts like a signal molecule in stimulating the antioxidant system and expressions of stress related genes (RD29A, RD29B, RD22; ERD1), as well as leading to the accumulation of various osmoprotective molecules, and in this way, it contributes to the removal of reactive oxygen types (Lu et al. 2009; Ozfidan et al. 2013; Brunetti et al. 2019; Qi et al. 2020).

It is significant to understand the internal cellular signal networks of ABA under salt conditions, in order to illuminate its tolerance mechanisms. Studies show that FLA responds to many abiotic and biotic stresses in relation to ABA (Zang et al. 2015). So it can interact with plant growth stimulation signals of AGP’s and thus can affect development and growth (Seifert and Roberts 2007). Functional loss at AGP30 resulting in a decrease in the sensitivity to ABA and a decrease in the expressions of ABA responsive genes can be seen as an indicator of this effect (Van Hengel and Roberts 2003). Additionally, another study with sos5-1 mutant shows that damaged root phenotype has returned to normal like wild type after having treated the plant with ABA under salt stress (Seifert et al. 2014). This study has shown that At-FLA4 domain controlled cell wall biosynthesis and root growth under salt stress in synergy with ABA signalization. However, related literature does not include any study on how the communication with antioxidants is carried out during this synergy.

Previous studies show that Arabidopsis thaliana sos5-1 mutant exhibits a sensitive root phenotype under salt stress and its treatment with ABA inhibits this phenotype; it is also shown that FLA4 (SOS5) gene controls root development as a positive regulator at ABA signalization (Shi et al. 2003; Seifert et al. 2014). However, how ABA stimulates antioxidant systems is not illuminated, nor the regulation of ABA related genes under long term salt stress conditions. Therefore, this study aims: (1) measurement of the antioxidant enzyme activities such as catalase (CAT), superoxide dismutase (SOD), ascorbate peroxidase (APX) and guaiacol peroxidase (GPX); (2) evaluation of the proline level changes, stomatal aperture, membrane damages, internal H2O2, and ABA contents; (3) determination of the expression grades of ABA related genes under salt stress conditions. Our hypothesis is that FLA4 (SOS5) gene might have a positive relation with ABA signalization; on the other hand, it can stimulate the antioxidant system and scavenge ROS in order to restore cell wall integrity under salt stress conditions.

Materials and methods

Growth of the plants and stress applications

Arabidopsis thaliana ecotype Col gl wild type (WT) and the At-fla4 mutant (sos5-1) were kindly provided by Georg Seifert (University of Natural Resources and Life Science, Department of Applied Genetics and Cell Biology, Vienna, Austria). Firstly, the seeds were sterilized with bleach containing hypochlorite (10%) and waited for 5–10 min, vortexed, followed by rinsing with sterile water three times. Then, the seeds were plated with Barky Ultipette (0.5–10 µl product code CP-10) on 1X MS medium (Murashige and Skoog 1962) (Duchefa Biochemie, NL-Haarlem) and for stratification, put them into + 4 °C for 2 days. Following this, seeds were grown under 16/8 h light period (100 mmol m−2 s−1), 70% humidity and 24.5 °C conditions.

For phenotyping observations, 4 days old seedlings were transferred with the help of forceps to test media (MS0, 100 mM NaCl, and 100 mM NaCl + 5 µM ABA) and used Leica EZ4 HD microscope for documentation. Abscisic acid was obtained by Sigma-Aldrich (Vienna, Austria) and it was dissolved in 0.01 M NaOH.

Root lengths measurements

To measure the root lengths under different test conditions (MS0, NaCl, NaCl + ABA), petri dishes were scanned during 3 days with an HP scanner, then root lengths were measured by ImageJ program as mm.

Confocal scanning laser microscope experiments

In order to observe the changes in Arabidopsis root phenotype in more detail, Laser Scanning Confocal Microscope (CSLM) was used. Calcofluor white (Calcofluor White: 4,4′-bis- [4-anilino-bis-diethylamino-5-triazine-2-ylamino]-2,2′-stilben-disulfonic, especially as a biological marker to see changes in the cell wall acid is a disodium salt) dye was used. In the current study, after the seedlings were kept in calcofluor dye for 5 min, they were taken to the lamella and changes in the cell wall were observed under 405 nm laser.

Germination tests

The germination bioassay was designed according to Clément et al. (2011). Freshly obtained seeds were planted in media containing MS-0 and 1 μM, 5 μM, 10 μM and 20 μM ABA. It was kept for 2 days for stratification at +4 °C and placed horizontally in the growth chamber (Memmert). Petries were monitored on the 5th, 7th and 14th days under a microscope, and the germination status was decided according to radicular formations and especially green leaf formations. Approximately 50 seeds were sown for each treatment as 3 biological replicates. Experiments were repeated at different times and similar results were achieved.

Determination of stomatal aperture

Stomatal bioassay was carried out according to He et al. (2005). 9 leaves of sos5-1 mutant and Col-gl (WT) grown in different pots of 5 weeks old (3 biological repetitions) were cut and kept in the opening solution (CO2 free MES-KCl buffer: 10 mM MES-KOH, 50 mM KCI, pH: 6.15) for 2 h in light conditions in the growth chamber. The leaves were then transferred to the opening solution (for control), 100 mM NaCl and 100 mM NaCl + 5 µM ABA, and kept for 4 h. Then, the leaves were watered on a napkin, and transparent nail polish was applied on the bottom surface of the leaf carefully, before it dried completely, transparent tape was adhered on it and quickly pulled. Then this transparent tape was adhered to the glass slide, the stomata were photographed with Leica DFC300 FX fluorescence microscope. Stoma openings were measured in µm with the help of the ImageJ program, at least 30 stomata from each application.

Determining the lipid peroxidation

Malondialdehyde (MDA) content was determined according to the method of Heath and Packer (1968). The absorbance of the samples was measured at 532 and 600 nm and MDA content was given as nmol MDA g−1 dry weight (DW).

Determining the proline content

Proline content was determined according to Bates et al. (1973) method. Samples measured at 520 nm and proline content was expressed as μg g−1 DW.

Determination of H2O2 content (3,3′-diaminobenzidine (DAB) staining assay)

For determination of H2O2, a DAB (3,3′- Diaminobenzidine) staining protocol was modified from the method by Daudi et al. (2012). The plants taken that were exposed to MS0, salt and salt + ABA for 72 h were subjected to DAB with 0.05% v/v Tween 20 and 10 mM sodium phosphate buffer (pH 7.0). The plants were incubated in fresh bleaching solution for 30 min. The leaves and roots were observed and pictured by microscope for DAB staining.

Enzyme extractions and assays

100 mg frozen roots, exposed to MS0, NaCl and NaCl + ABA conditions for three days, were crushed into fine powder in a mortar and pestle under liquid nitrogen. The samples were prepared according to Sezgin et al. (2018) for the following enzyme assays.

Superoxide dismutase (SOD, EC 1.15.1.1) activity was determined according to the method of Beauchamp and Fridovich (1971), as modified by Dhinsa and Matowe (1981). The volume of supernatant corresponding to 50% inhibition of the reaction was dedicated a value of 1 enzyme unit.

Catalase (CAT, EC 1.11.1.6) activity was determined according to the method of Aebi (1983).

Ascorbate peroxidase (APX, EC 1.11.1.11) activity was assayed by the method of Nakano and Asada (1987).

Guaiacol peroxidase (GPX, EC 1.11.1.7) activity was measured according to the method of Urbanek et al. (1991).

RNA isolation and cDNA synthesis

Samples were used as triplicates. For each biological replicates, more than 100 Arabidopsis seedlings were grown for 4 days on a nylon mesh (20 μm mesh size; Prosep, Belgium) and transferred to 100 mM NaCl medium for incubation and incubated for 2 h. Then, the root parts of the seedlings were carefully cut with scalpels and the leafy parts were removed. The roots that were stored at −80 °C were used for total RNA isolation and then the frozen root tissues were powdered with a miller using liquid nitrogen. Total RNA isolation was conducted according to the manufacture protocol (Quiagen RNeasy Plant Mini Kit). The amount and purity of RNA samples were confirmed by a nanodrop spectrophotometer (Thermo Scientific, Nanodrop 2000, USA). The cDNA was synthesised from isolated total RNA samples using cDNA Reverse Transcription Kit (Applied Biosystems).

Quantitative real-time (qRT) PCR analysis

Each reaction was carried out in total 20 μl volume including 1 μl cDNA sample, 1 μl of primers and 4 μl Supermix [5 × HOT FIREPol Eva Green qPCR Supermix (Solis Biodyne). The analysis was performed on CFX Connect Real Time PCR System (BioRad). qRT PCR protocol was conducted at 95 °C for 15 min, 40 cycles of 95 °C for 10 s, 55 °C for 30 s, and 72 °C for 30 s followed. Biological triplicates were analysed and the average technical error was considered to be in the form of 0.5 (± 1) Cq values. The results were normalized according to the UBQ5 gene and relative gene expression was presented. The primers that were used in this study are listed in Table 1.

Table 1.

The sequences of primers used for RT-PCR experiment

Primers Primer sequencing
ABA1/At5g67030 ABA1-F: “GTGGTTTGAAGATGACGATGC”
ABA1-R: “GATTACTTTCACCCTAAACGCC”
CYP707A3/At2g29090 CYP707A3-F: “CCAAGAGACATTAAGAGCTGC”
CYP707A3-R: “ATTCTGAGGAAGAGCGAACG”
RD29A/At5g52310.1 RD29A-F: “AGTTACTGATCCCACCAAAGAAGAAAC”
RD29A-R: “TTTCCTCCCAACGGAGCTCCTAAAC”
RD29B/At5g52300.1 RD29B-F: “TCCGGTTTACGAAAAAGTCAAAGAAAC”
RD29B-R: “AATCCGAAAACCCCATAGTCCCAAC”
RD22/At5g25610 RD22-F: “ACGTCAGGGCTGTTTCCACTGAGGTG”
RD22-R: “TAGTAGCTGAACCACACAACATGAG”
UBQ5 UBQ5-F: “AGGCGAAGATCCAAGACAAG”
UBQ5-R: “TGAACCTTTCCAGATCCATCG”
Open in a new tab

Determination of ABA

100 mg plant root tissue was powdered in liquid nitrogen and added distilled water at a ratio of 1:7 (w/v), then incubated at 4 °C overnight. The mixtures were centrifuged at 10,000 g for 10 min. Obtained supernatant was diluted in standard Tris-buffered saline four times. ABA in these extracts was quantified using the Phytodetek ABA ELISA kit (Agdia/Linaris) according to the manufacturer’s instructions.

Statistical analysis

All analyses were realized in triplicate. Variance analysis of mean values was performed with Duncan Multiple Comparison test (Two-way ANOVA) using SPSS software for Microsoft Windows (Ver. 20.0, SPSS Inc., USA) and significance level was determined at the 5% level (P < 0.05). Also excel student-t test was used in germination tests.

Results

ABA effects on sos5-1 (fla4) root phenotype under salt stress

To show the ABA effects on root on sos5-1 (fla4) root phenotype, mutant plants were grown on 100 mM NaCl stress conditions. As already expected, sos5-1 mutant plants exhibited short, swell and abnormal cell divisions (Fig. 1). As previously described by Seifert et al. (2014), 5 µM ABA fully suppressed the typical sos5-1 root phenotype under salt stress (Fig. 1a, b). On the other hand, when root lengths were compared on MS0, WT (20.154 mm) and mutant plants (19.489 mm) looked similar but under salt conditions, root lengths of sos5-1 (5.237 mm) drastically decreased, especially the differences appeared clearly after 48 and 72 h of stress. On the other hand, with ABA application under salt stress, roots (8.383 mm) became of similar lengths as WT (8.937 mm) (Fig. 1c).

Fig. 1.

Fig. 1

Open in a new tab

Comparison of changes in root phenotypes due to ABA treatment in wild type and mutant plants under salt stress conditions. a Root lengths views after 48 h. b Root phenotypes after 24 h. under MS0, 100 mM NaCl and 100 mM NaCl + ABA (% 0,1 Calcofluor stained) Bar = 5 µm c Effect of ABA on sos5 mutant root lengths in salt stress conditions after 3 days. Bar indicates ± SD of three replicates. The letters show a statistically significant differences according to Duncan’s multiple range test (P < 0.05)

Exogenous ABA affects H2O2, MDA and proline contents

In order to determine the H2O2 content, the DAB staining method was performed. The sos5-1 mutant and WT root, and leaf parts were photographed and compared after 72 h of stress application. As seen in Fig. 2a, b, under salt stress, mutant plants were quite intensely brown compared to WT and this indicated an increased H2O2 content. On the other hand, it was observed that the dark colour caused by salt stress in the root tip increased much more in sos5-1 mutant compared to WT and ABA treatment under salt stress changed both root phenotype and dark colour, making mutant and WT plant roots similar and lighter colour (Fig. 2b).

Fig. 2.

Fig. 2

Open in a new tab

Determination of H2O2 contents by DAB staining method (after 3 days). a leaves, b roots, magnification 40X

MDA (Malondialdehyde) content is released as a result of lipid peroxidation and shows membrane damage. In parallel with the H2O2 results, MDA amounts increased in both genotypes compared to the control group under salt stress. However, the amount of sos5-1 mutant (1.858 nmol g−1 DW) plants increased significantly compared to WT (1.548 nmol g−1 DW). After ABA application under salt stress, a decrease in MDA amounts was recorded in both genotypes and the sos5-1 mutant (1.394 nmol g−1 DW) plant became similar to WT (1.323 nmol g−1 DW) (Fig. 3).

Fig. 3.

Fig. 3

Open in a new tab

Changes of MDA contents with ABA application (after 3 days). (Control: MS medium without stress). Bar indicates ± SD of three replicates. The letters show a statistically significant differences according to Duncan’s multiple range test (P < 0.05)

Proline contents decreased significantly with salt stress in both genotypes compared to the control groups (Fig. 4). However, under salt stress, the content of proline in the mutant plant roots (0.089 µg g−1 DW) was much lower than in the WT (0.126 µg g−1 DW) The application of ABA under salt stress significantly increased the proline concentration in both genotypes and it was found to be very close to each other in terms of content (0.217–0.221 µg g−1 DW).

Fig. 4.

Fig. 4

Open in a new tab

Changes of Proline contents with ABA application (after 3 days). (Control: MS medium without stress). Bar indicates ± SD of three replicates. The letters show a statistically significant differences according to Duncan’s multiple range test (P < 0.05)

Effects of ABA on antioxidant enzyme system under salt stress

SOD activity was slightly induced by salt stress in sos5-1 mutant plants compared to control. But it (4.092 U mg protein−1) was still lower than WT (5.316 U mg protein−1) under salt stress. On the other hand, ABA application increased the activity of mutant (5.344 U mg protein−1) as compared to the WT (3.939 U mg protein−1) (Fig. 5a). CAT activity increased under salt stress compared to control. However, sos5-1 mutant (35.080 U mg protein−1) plants still displayed lower activity than WT (43.765 U mg protein−1). The activity increased by ABA application under salt stress conditions and both genotypes exhibited similar activities (40.367–39.354 U mg protein−1) (Fig. 5b). APX activity was decreased by salt stress in both genotypes compared to controls, but sos5-1 mutant (152.267 U mg protein−1) had lower activity than WT (189.461 U mg protein−1). On the other hand, activity induced by ABA under salt stress in both genotypes compared to only salt conditions (289.483–246.619 U mg protein−1) (Fig. 5c). GPX enzyme activity was increased by salt stress compared to control in both genotypes. Also, this activity induced by ABA under salt stress compared to control and salt conditions (Fig. 5d).

Fig. 5.

Fig. 5

Open in a new tab

Antioxidant enzyme activities in sos5-1 mutant. a SOD, b CAT, c APX, d GPX (after 3 days). Bar indicates ± SD of three replicates. The letters show a statistically significant differences according to Duncan’s multiple range test (P < 0.05)

Determining the stomatal aperture under salt stress

Under normal (stress-free) conditions, the stomatal apertures of both genotypes were very similar (3.185–3.233 µm). However, while WT (0.595 µm) plant closed its stomata sharply under salt stress, the stomatal apertures of mutant plants (3.402 µm) were almost unchanged compared to control. On the other hand, although sos5-1 mutant (1.956 µm) did not totally look like WT (1.021 µm), ABA induced stomatal closure in both genotypes compared to control (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

Stomatal aperture of sos5-1 mutant. Bar indicates ± SD of replicates. The letters show a statistically significant differences according to Duncan’s multiple range test (P < 0.05)

Effect of ABA on sos5 mutant germination

In the germination trials conducted to understand the sensitivity of sos5-1 mutant seeds to ABA, both genotypes were similarly germinated under control conditions without ABA. Due to the increase in ABA concentration, the germination rates of sos5-1 mutant seeds were higher than WT. Especially in the medium containing 5 µM ABA, the sos5-1 mutant (65%) seeds germinated significantly compared to the WT (22%). Only, in the medium containing 20 µM ABA, germination in both genotypes was almost never observed (Fig. 7).

Fig. 7.

Fig. 7

Open in a new tab

Effect of ABA on sos5-1 mutant germination (after 14 days). a graphical representation, b seed germination pictures. Bar indicates ± SD of three replicates. *Show a statistically significant differences according to student-t test (P < 0.05)

ABA related gene expressions under salt stress

Relative gene expressions involved in the ABA metabolic pathway were determined after 2 h of salt stress treatments and shown in Fig. 8. While the transcript level of ABA1, RD29A, ER29B, and RD22 reduced, CYP707A-3 was upregulated in sos5-1 mutant compared to the WT under salt stress conditions.

Fig. 8.

Fig. 8

Open in a new tab

Relative gene expressions of genes in ABA metabolic pathway (after 2 h of 100 mM NaCl stress). a ABA biosynthesis gene, b ABA catabolic gene, c–e ABA related stress response genes. Bar indicates ± SD of triplicates. The * show a statistically significant differences according to Duncan’s multiple range test (P < 0.05)

Change in ABA content under Salt Stress

ABA contents were measured after 3 days of salt stress and results were given in Fig. 9. There was a 1.44 fold difference between WT and sos5-1 mutant under salt condition. ABA content of mutant plants (0.45 pmol g−1 DW) was significantly lower than WT (0.65 pmol g−1 DW) under stress.

Fig. 9.

Fig. 9

Open in a new tab

ABA content under 100 mM NaCl stress (after 3 days)

Discussion

ABA supresses the hypersensitive sos5-1 (fla4) root phenotype under salt stress

In this study, it was tried to reveal how At-FLA4 (SOS5), which acts synergistically with ABA, crosstalk with the antioxidant system. The Arabidopsis thaliana Fasciclin like arabinogalactan protein 4 (FLA4) locus is required for normal root growth (Turupcu et al. 2018) and sos5-1 (fla4) mutant exhibited hypersensitivity of salt (Shi et al. 2003). Seifert et al. (2014) suggested that exogenous application of ABA suppresses the At-fla4 under salt stress conditions. We also confirm these results with details (Fig. 1). ABA has effects on the Arabidopsis root system architecture (Hong et al. 2013; Dong et al. 2020). Also, it has been reported that exogenous ABA is beneficial for plants under stress as it inhibits stoma closure, provides osmotic adjustment and increases the activity of antioxidant enzymes (Teng et al. 2014). Here, we showed that normal root growth under salt stress might be caused by SOS5, ABA and antioxidant system interactions.

Exogenous ABA induced antioxidant systems to overcome salt stress effects

SOS5 might reduce H2O2, MDA while induce proline contents by connecting ABA

Under salt stress, plants produce reactive oxygen species (ROS) which can damage cellular structures. One of the main indicators of the damage is the peroxidation of membrane lipids (Akyol et al. 2020; Cheng et al. 2020). In the present study, the content of H2O2 under salt stress was found to be higher in sos5-1 mutant compared to WT (Fig. 2). This result suggested that loss of SOS5 (FL4) function increased ROS production under stress condition. In accordance with this experiment, MDA content increased in mutant as well. Similarly, salt-sensitive Arabidopsis genotypes have been reported to increase the amount of MDA under salt stress compared to control (Shi et al. 2014). However, with ABA application, both H2O2 and MDA contents were decreased under salt stress and lead normal root phenotype as WT (Figs. 2 and 3). Similarly, ABA has been reported to increase the activation of antioxidant enzymes, scavenges H2O2 in plants and increase drought tolerance by reducing the amount of MDA (Lu et al. 2009).

Plants accumulate proline to perform important functions such as adjusting osmotic balance, preserving membrane and protein structures, and scavenge ROS, under salt stress (Ozturk et al. 2020). Here, we reported that proline contents were different in stress free control conditions, mutant was significantly lower than WT, and on the other hand proline content of mutant slightly increased by salt stress but it was still significantly lower than WT. With ABA application, proline contents increased in both genotypes. This results show that ABA might induce the production of proline to provide stress tolerance (Fig. 4). This theory is supported by previous studies. For instance, the hypersensitivity to osmotic stress and also defective ABA accumulation in snrk2.2/3/6 triple mutant had impaired accumulation of proline (Fujii et al. 2011) and exogenous ABA induced proline content in ABA-deficient aba2 mutant plants under stress (Ozfidan et al. 2013). In addition to this, in the Arabidopsis salt hypersensitive hss mutant, the endogenous ABA and proline contents were reported to be significantly lower than the WT under salt stress (Wei et al. 2019). Our findings showed that sos5-1 mutant plants might have a defect in ABA signalization and because of this could not produce enough proline under salt stress conditions.

SOS5 might act as ABA positive regulator and cross-talk with antioxidant enzyme systems

Plants have antioxidant defence systems involving several enzymes to eliminate the ROS under stress conditions (Kadioglu et al. 2011; Boughalleb et al. 2020). In our study, SOD activity was slightly increased at salt stress condition in sos5-1 mutant compared to control while it was lower than WT under salt stress. On the other hand, ABA application increased the activity as compared to the WT plants (Fig. 5a). CAT activity increased under salt stress compared to control. However, sos5-1 mutant plants displayed lower activity than WT. Interestingly, the activity increased by ABA application under salt stress conditions and both genotypes exhibited similar activities (Fig. 5b). APX activity was decreased sharply by salt stress in both genotypes compared to control but sos5-1 mutant had lower activity than WT. On the other hand, activity induced by ABA under salt stress in both genotypes compared to only salt conditions (Fig. 5c). GPX enzyme activity was increased by salt stress compared to control in both genotypes. Similar to other results, this activity induced by ABA under salt stress compared to control and salt conditions (Fig. 5d). It is clear that ABA has induced all antioxidant enzyme activities more than control plants under salt stress condition. Our results showed that the increases in enzyme activities may be related to the induction of antioxidant responses that protect the plant from oxidative damage. Similarly, Ozfidan et al. (2012) found that ABA induced antioxidant enzyme activities in ABA-deficient mutant aba2-1 under osmotic stress. There is another information supporting that ABA behaved as a signal molecule that increases the activity of antioxidant enzymes such as the SOD, CAT, APX and GPX activities in plants to relieve oxidative stress (Yoshida et al. 2004; Sezgin et al. 2018). Additionally, lower concentration of ABA increased the antioxidant enzyme transcription levels in plant under H2O2-induced stress (Yao et al. 2020). According to obtained results, the decrease of H2O2 content in mutant might be related to inducing of antioxidant enzyme activities by ABA that protects the plant from effects of salt stress. As a result, sos5-1 root phenotype turn to normal as WT under salt stress condition.

SOS5 might enhances salt tolerance by regulating stomatal aperture under salt stress

Stomata are necessary for gas exchange and have critical functions in related mechanisms such as photosynthesis and evapotranspiration. On the other hand, different kinds of stresses lead to closing the stomata and ABA has a significant role in this process to deal with water deficit conditions (Liu et al. 2013; Rui et al. 2017; Chen et al. 2019). For instance, researches revealed that ABA insensitive mutants (i.e., abi1 and abi2) are so susceptible to water deficit because of impaired stomatal aperture regulation (Schroeder et al. 2001). In present study, we observed that under salt stress condition, sos5-1 mutant plants could not close their stomata compare to WT. However, exogenous ABA induces stomatal closure especially in mutant (Fig. 6). These results suggest that sos5-1 mutant might be less sensitive to ABA or not able to produce enough ABA under salt stress. Also, the hypersensitivity of the mutant plant to salt may be due to its inability to close its stomata under stress. Additionally, it is reported that Arabidopsis cml20 mutant that is hypersensitive to ABA regulated stomatal closure showed great tolerance to drought stress (Wu et al. 2017). Also, Liu et al. (2013) determined that overexpression of a maize Ub E3 ligase gene enhances drought tolerance through reduce stomatal aperture and induce antioxidant enzyme activities in transgenic tobacco. In the present study, the antioxidant enzyme system was found less active in sos5-1 mutant than WT under salt stress. This phenomenon might be related to stomatal aperture. So, our study demonstrates that the SOS5 is important for stomatal closure and by the way induces ROS scavenger systems under salt conditions.

SOS5 may affect ABA response during seed germination

ABA is known to control seed germination mechanism (Chen et al. 2020). The seed dormancy is explained as an adaptation behaviour that enables the seed to adjust itself to the appropriate environmental conditions by preventing the plants from timely germination. Plant hormone ABA has been reported to maintain seed dormancy during this process and inhibit germination (Zhang et al. 2013). Additionally, ABA has been reported to act on the seed cell wall, slowed down the seed germination (Yan et al. 2020). In present study, we observed that the sos5-1 mutant seeds less sensitive to ABA compared to the WT (Fig. 7). Similarly, it was stated that the crk45 mutant that was obtained from loss of function of ABA positive regulator CRK45 showed higher rates of seed germination than WT due to the less ABA level (Zhang et al. 2013). On the other hand, it was reported that two loss-of-function atper1 mutants’ atper1-1 and atper1-2 displayed suppressed seed dormancy accompanied by reduced ABA contents and ABA related gene expressions, as well as the high level of ROS (Chen et al. 2020). Besides, transgenic Arabidopsis WRKY-OE that was sensitive to salt stress displayed a strong ABA-insensitivity at seed germination (Luo et al. 2020). Our results may relate to impairment of ABA metabolism in mutant and due to the lower ABA levels in mutants, therefore the earlier germination. Together, our results suggested that SOS5 might enhance seed dormancy via effecting ABA metabolism.

SOS5 may positively affect ABA related gene expressions under salt stress

Plants can provide abiotic stress tolerance with activating or repressing gene expression via ABA regulation (Yang et al. 2020). Transcriptomic studies showed that Arabidopsis plants exposed to abiotic stresses, nearly half of the genes induced by stresses are also induced by ABA. In addition to this, impairment of ABA metabolism, Arabidopsis plants caused to stress hypersensitivity (Marco et al. 2019). These kinds of scientific information imply the critical role of ABA phytohormone as a signalling molecule in response to abiotic stress such as salt and drought. To better understand the potential connection between genes involvement in ABA metabolism and SOS5, we measured relative gene expression level of genes under salt stress condition. According to the obtained data, under normal salt free conditions, there was a not significant difference between sos5-1 mutant and WT plant (data not shown). However, after 100 mM salt treatment of 2 h, while ABA1 (involve in ABA biosynthesis) gene expression level reduce in mutant, CYP707A3 (involve in ABA degradation) gene induced (Finkelstein 2013). On the other hand, RD29A, RD29B, RD22 which are known ABA and stress-inducible genes (Zang et al. 2015; Wu et al. 2017), downregulated in sos5-1 mutant compare to WT (Fig. 8). The reduction of ABA 1 gene expression in mutant plant roots under salt stress may be a sign that the mutant is unable to synthesize enough ABA against stress and may be considered the cause of the hypersensitive root phenotype. The increase in the expression of the catabolism gene supports to this hypothesis. These results may indicate that there is a defect in the mutant ABA mechanism. Also, the reduction in expression levels of RD29A, RD29B and RD22 genes, which are induced by stress through the ABA-dependent pathway, may be evidence that the SOS5 locus is directly related to ABA in salt stress tolerance. In a study that supports our data, it has been reported that the expression rates of ABA1, RD29A and RD22 genes have increased significantly in transgenic plants obtained by over-expression of the MYB2 gene that provides gene expression in the ABA dependent pathway in Arabidopsis (Shan et al. 2012). In another study, it has been found that in Arabidopsis max2 mutant, which is hypersensitive to drought, stress-related gene expression rates such as RD29A and RD29B, as well as ABA biosynthesis related to NCED3 and CYP707A3 are quite low compared to WT under stress (Bu et al. 2014). In addition, Seifert et al. (2014) noted that after a 40-minute salt treatment, ABA1, ABA3 and AAO3 genes decreased compared to WT. Our study has demonstrated how gene expression is affected in the later stages of stress and is compatible with the literature. When all the results are evaluated together, the hypothesis that the SOS5 locus takes place in the ABA-dependent pathways in salt stress tolerance is supported.

SOS5 might induce ABA production to overcome salt stress effects

When plants are exposed to stress, cellular ABA levels increase rapidly leading to the induction of extensive physiological responses to protect them from possible damage (Han et al. 2020). As a matter of fact, Os3BGlu6 overexpression rice lines have been reported to exhibit stress tolerance due to ABA accumulation and, conversely, mutants obtained by disruption in this gene locus have a stress-sensitive, dwarf and lower ABA content (Wang et al. 2020). In present study, it was found that after 3 days salt stress treatments, content of mutant plants was significantly lower than WT (Fig. 9). This result is seen compatible with literature as mentioned above. The salt hypersensitivity of sos5-1 mutant plants might be related to less production of ABA than WT under salt stress conditions.

Conclusion

Considering all the data together, because of salt-sensitivity, sos5-1 mutant plants cannot synthesize enough ABA and express ABA-related genes as WT and fail in activation of antioxidant systems under salt stress conditions, it might be hypersensitive to salt. In other words, SOS5 may acts as a positive regulator of ABA and eliminated the mutant hypersensitivity via antioxidant defence systems. The results obtained from this study will fill the gap in the literature, bring a new approach to the salt stress tolerance mechanism in plants, and shed light on the relationship between plant ABA-induced abiotic stress tolerance and cell wall integrity. However, in order to understand the salt tolerance of plants, how they balance growth and development, and to develop strategies to increase crop yields, new phenotyping studies should be conducted and advanced technological studies should be included to clarify the mechanisms.

Acknowledgements

We many thanks to Dr. Georg Seifert (University of Natural Resources and Life Science, Vienna, Austria) for all helps (I started to work on sos5 in his lab) especially supply seeds and for technical assistance with a confocal laser microscope photograph.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Aebi H. Catalase. In: Bergmeyer HU, editor. Methods of enzymatic analysis. Weinhem: Verlag Chemie; 1983. pp. 273–286. [Google Scholar]
  2. Akyol TY, Yilmaz O, Uzilday B, et al. Plant response to salinity: an analysis of ROS formation, signaling, and antioxidant defense. Turk J Bot. 2020;44:1–13. doi: 10.3906/bot-1911-15. [DOI] [Google Scholar]
  3. Alazem M, Lin NS. Interplay between ABA signaling and RNA silencing in plant viral resistance. Curr Opin Virol. 2020;42:1–7. doi: 10.1016/j.coviro.2020.02.002. [DOI] [PubMed] [Google Scholar]
  4. Bahin E, Bailly C, Sotta B, et al. Crosstalk between reactive oxygen species and hormonal signalling pathways regulates grain dormancy in barley. Plant Cell Env. 2011;34:980–993. doi: 10.1111/j.1365-3040.2011.02298.x. [DOI] [PubMed] [Google Scholar]
  5. Basu D, Tian L, DeBrosse T, et al. Glycosylation of a Fasciclin-Like Arabinogalactan-Protein (SOS5) mediates root growth and seed mucilage adherence via a cell wall receptor-like kinase (FEI1/FEI2) pathway in arabidopsis. PLoS ONE. 2016;11:1–27. doi: 10.1371/journal.pone.0145092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bates LS, Waldern RP, Teare ID. Rapid determination of free proline for water stress studies. Plant Soil. 1973;39:205–207. doi: 10.1007/BF00018060. [DOI] [Google Scholar]
  7. Beauchamp C, Fridovich I. Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal Biochem. 1971;44:1276–1287. doi: 10.1016/0003-2697(71)90370-8. [DOI] [PubMed] [Google Scholar]
  8. Boughalleb F, Abdellaoui R, Mahmoudi M, Bakhshandeh E. Changes in phenolic profile, soluble sugar, proline, and antioxidant enzyme activities of polygonum equisetiforme in response to salinity. Turk J Bot. 2020;44:25–35. doi: 10.3906/bot-1908-2. [DOI] [Google Scholar]
  9. Brunetti C, Sebastiani F, Tattini M. Review: ABA, flavonols, and the evolvability of land plants. Plant Sci. 2019;280:448–454. doi: 10.1016/j.plantsci.2018.12.010. [DOI] [PubMed] [Google Scholar]
  10. Bu Q, Lv T, Shen H, et al. Regulation of drought tolerance by the F-box protein MAX2 in Arabidopsis. Plant Physiol. 2014;164:424–439. doi: 10.1104/pp.113.226837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen K, Song M, Guo Y, et al. MdMYB46 could enhance salt and osmotic stress tolerance in apple by directly activating stress-responsive signals. Plant Biotechnol J. 2019;17:2341–2355. doi: 10.1111/pbi.13151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chen F, Zhou W, Yin H, et al. Shading of the mother plant during seed development promotes subsequent seed germination in soybean. J Exp Bot. 2020;71:2072–2084. doi: 10.1093/jxb/erz553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cheng YW, Kong XW, Wang N, et al. Thymol confers tolerance to salt stress by activating anti-oxidative defense and modulating Na+ homeostasis in rice root. Ecotoxicol Environ Saf. 2020;188:109894. doi: 10.1016/j.ecoenv.2019.109894. [DOI] [PubMed] [Google Scholar]
  14. Claudia Blaukopf, Krol Matthaus SG. New insights into the control of cell growth. Plant Cell Wall Methods Mol Biol. 2011;715:221–244. doi: 10.1007/978-1-61779-008-9_16. [DOI] [PubMed] [Google Scholar]
  15. Clément M, Leonhardt N, Droillard M-J, Reiter I, Montillet J-L, Genty B, Laurière C, Nussaume L, Noël LD. The cytosolic/nuclear HSC70 and HSP90 molecular chaperones are important for stomatal closure and modulate abscisic acid-dependent physiological responses in Arabidopsis. Plant Physiol. 2011;156(3):1481–1492. doi: 10.1104/pp.111.174425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Daudi A, Cheng Z, O’Brien JA, et al. The apoplastic oxidative burst peroxidase in Arabidopsis is a major component of pattern-triggered immunity. Plant Cell. 2012;24:275–287. doi: 10.1105/tpc.111.093039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dhinsa SR, Matowe W. Drought tolerance in two mosses: correlated with enzymatic defence against lipid peroxidation. J Exp Bot. 1981;32:79–91. doi: 10.1093/jxb/32.1.79. [DOI] [Google Scholar]
  18. Dong H, Ma X, Zhang P, et al. Characterization of Arabidopsis thaliana root-related mutants reveals aba regulation of plant development and drought resistance. J Plant Growth Regul. 2020 doi: 10.1007/s00344-020-10076-6. [DOI] [Google Scholar]
  19. Driouich A, Baskin TI. Intercourse between cell wall and cytoplasm exemplified by arabinogalactan proteins and cortical microtubules. Am J Bot. 2008;95:1491–1497. doi: 10.3732/ajb.0800277. [DOI] [PubMed] [Google Scholar]
  20. FAO (2016) Extent of salt-affected soils. The Food and Agriculture Organization of the United Nations. https://www.fao.org/soils-portal/soil-management/management-of-some-problem-soils/salt-affected-soils/more-information-on-salt-affected-soils/en/. Accessed 18 Aug
  21. Feng W, Kita D, Peaucelle A, et al. The FERONIA receptor kinase maintains cell-wall integrity during salt stress through Ca2+ Signaling. Curr Biol. 2018;28:666–675. doi: 10.1016/j.cub.2018.01.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Finkelstein R. Abscisic acid synthesis and response. Arabidopsis Book. 2013;11:e0166. doi: 10.1199/tab.0166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Fujii H, Verslues PE, Zhu JK. Arabidopsis decuple mutant reveals the importance of SnRK2 kinases in osmotic stress responses in vivo. Proc Natl Acad Sci USA. 2011;108:1717–1722. doi: 10.1073/pnas.1018367108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Fujita M, Fujita Y, Noutoshi Y, et al. Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr Opin Plant Biol. 2006;9:436–442. doi: 10.1016/j.pbi.2006.05.014. [DOI] [PubMed] [Google Scholar]
  25. Han Y, Watanabe S, Shimada H, Sakamoto A. Dynamics of the leaf endoplasmic reticulum modulate β-glucosidase-mediated stress-activated ABA production from its glucosyl ester. J Exp Bot. 2020;71:2058–2071. doi: 10.1093/jxb/erz528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. He JM, Xu H, She XP, et al. The role and the interrelationship of hydrogen peroxide and nitric oxide in the UV-B-induced stomatal closure in broad bean. Funct Plant Biol. 2005;32:237–247. doi: 10.1071/FP04185. [DOI] [PubMed] [Google Scholar]
  27. Heath RL, Packer L. Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys. 1968;125:189–198. doi: 10.1016/0003-9861(68)90654-1. [DOI] [PubMed] [Google Scholar]
  28. Hong JH, Seah SW, Xu J. The root of ABA action in environmental stress response. Plant Cell Rep. 2013;32:971–983. doi: 10.1007/s00299-013-1439-9. [DOI] [PubMed] [Google Scholar]
  29. Kadioglu A, Saruhan N, Sağlam A, et al. Exogenous salicylic acid alleviates effects of long term drought stress and delays leaf rolling by inducing antioxidant system. Plant Growth Regul. 2011;64:27–37. doi: 10.1007/s10725-010-9532-3. [DOI] [Google Scholar]
  30. Khan N, Bano A, Ali S, Babar MA. Crosstalk amongst phytohormones from planta and PGPR under biotic and abiotic stresses. Plant Growth Regul. 2020;90:189–203. doi: 10.1007/s10725-020-00571-x. [DOI] [Google Scholar]
  31. Liu J, Xia Z, Wang M, et al. Overexpression of a maize E3 ubiquitin ligase gene enhances drought tolerance through regulating stomatal aperture and antioxidant system in transgenic tobacco. Plant Physiol Biochem. 2013;73:114–120. doi: 10.1016/j.plaphy.2013.09.006. [DOI] [PubMed] [Google Scholar]
  32. Lu S, Su W, Li H, Guo Z. Abscisic acid improves drought tolerance of triploid bermudagrass and involves H2O2- and NO-induced antioxidant enzyme activities. Plant Physiol Biochem. 2009;47:132–138. doi: 10.1016/j.plaphy.2008.10.006. [DOI] [PubMed] [Google Scholar]
  33. Luo X, Li C, He X, et al. ABA signaling is negatively regulated by GbWRKY1 through JAZ1 and ABI1 to affect salt and drought tolerance. Plant Cell Rep. 2020;39:181–194. doi: 10.1007/s00299-019-02480-4. [DOI] [PubMed] [Google Scholar]
  34. Ma Y, Cao J, He J, et al. Molecular mechanism for the regulation of ABA homeostasis during plant development and stress responses. Int J Mol Sci. 2018;19:1–14. doi: 10.3390/ijms19113643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mahajan S, Pandey Girdhar K, Tuteja N. Calcium- and salt-stress signaling in plants: shedding light on SOS pathway. Arch Biochem Biophys. 2008;471(2):146–158. doi: 10.1016/j.abb.2008.01.010. [DOI] [PubMed] [Google Scholar]
  36. Marco F, Busó E, Lafuente T, Carrasco P. Spermine confers stress resilience by modulating abscisic acid biosynthesis and stress responses in arabidopsis plants. Front Plant Sci. 2019;10:972. doi: 10.3389/fpls.2019.00972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Munns R, Tester M. Mechanisms of salinity tolerance. Annu Rev Plant Biol. 2008;59:651–681. doi: 10.1146/annurev.arplant.59.032607.092911. [DOI] [PubMed] [Google Scholar]
  38. Murashige T, Skoog F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant. 1962;15:473–497. doi: 10.1111/j.1399-3054.1962.tb08052.x. [DOI] [Google Scholar]
  39. Nakano Y, Asada K. Purification of ascorbate peroxidase in spinach chloroplasts; its inactivation in ascorbate-depleted medium and reactivation by monodehydroascorbate radical. Plant Cell Physiol. 1987;28:131–140. doi: 10.1093/oxfordjournals.pcp.a077268. [DOI] [Google Scholar]
  40. Ozfidan C, Turkan I, Sekmen AH, Seckin B. Abscisic acid-regulated responses of aba2-1 under osmotic stress: the abscisic acid-inducible antioxidant defence system and reactive oxygen species production. Plant Bio. 2012;14:337–346. doi: 10.1111/j.1438-8677.2011.00496.x. [DOI] [PubMed] [Google Scholar]
  41. Ozfidan C, Turkan I, Sekmen AH, Seckin B. Time course analysis of ABA and non-ionic osmotic stress-induced changes in water status, chlorophyll fluorescence and osmotic adjustment in Arabidopsis thaliana wild-type (Columbia) and ABA-deficient mutant (aba2) Environ Exp Bot. 2013;86:44–51. doi: 10.1016/j.envexpbot.2010.09.008. [DOI] [Google Scholar]
  42. Ozturk K, Saglam A, Kadioglu A. Heliotropium thermophilum, an extreme heat tolerant species, promises plants about adaptation to high soil temperature conditions. Physiol Mol Biol Plants. 2020;26:525–535. doi: 10.1007/s12298-020-00766-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Pehlivan N, Sun L, Jarrett P, et al. Co-overexpressing a plasma membrane and a vacuolar membrane sodium/proton antiporter significantly improves salt tolerance in transgenic arabidopsis plants. Plant Cell Physiol. 2016;57:1069–1084. doi: 10.1093/pcp/pcw055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Qi L, Liu S, Li C, et al. Phytochrome-interacting factors interact with the ABA receptors PYL8 and PYL9 to orchestrate ABA signaling in darkness. Mol Plant. 2020;13:414–430. doi: 10.1016/j.molp.2020.02.001. [DOI] [PubMed] [Google Scholar]
  45. Rui Y, Xiao C, Yi H, et al. Polygalacturonase involved in expansion3 functions in seedling development, rosette growth, and stomatal dynamics in Arabidopsis thaliana. Plant Cell. 2017;29:2413–2432. doi: 10.1105/tpc.17.00568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Schroeder JI, Allen GJ, Hugouvieux V, et al. Guard cell signal transduction. Annu Rev Plant Physiol Plant Mol Biol. 2001;52:627–658. doi: 10.1146/annurev.arplant.52.1.627. [DOI] [PubMed] [Google Scholar]
  47. Seifert GJ, Roberts K. The biology of arabinogalactan proteins. Annu Rev Plant Biol. 2007;58:137–161. doi: 10.1146/annurev.arplant.58.032806.103801. [DOI] [PubMed] [Google Scholar]
  48. Seifert GJ, Acet T, Xue H. The Arabidopsis thaliana fasciclin like arabinogalactan protein 4 gene acts synergistically with abscisic acid signalling to control root growth. Ann Bot. 2014;114:1125–1133. doi: 10.1093/aob/mcu010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sezgin A, Altuntaş C, Sağlam A, et al. Abscisic acid cross-talking with hydrogen peroxide and osmolyte compounds may regulate the leaf rolling mechanism under drought. Acta Physiol Plant. 2018;40:1–12. doi: 10.1007/s11738-018-2716-6. [DOI] [Google Scholar]
  50. Shan H, Chen S, Jiang J, et al. Heterologous expression of the chrysanthemum R2R3-MYB transcription factor CmMYB2 enhances drought and salinity tolerance, increases hypersensitivity to ABA and delays flowering in Arabidopsis thaliana. Mol Biotechnol. 2012;51:160–173. doi: 10.1007/s12033-011-9451-1. [DOI] [PubMed] [Google Scholar]
  51. Shi H, Kim Y, Guo Y, et al. The arabidopsis SOS5 locus encodes a putative cell surface adhesion protein and is required for normal cell expansion. Plant Cell. 2003;15:19–32. doi: 10.1038/nbt766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Shi CC, Feng CC, Yang MM, et al. Overexpression of the receptor-like protein kinase genes AtRPK1 and OsRPK1 reduces the salt tolerance of Arabidopsis thaliana. Plant Sci. 2014;217–218:63–70. doi: 10.1016/j.plantsci.2013.12.002. [DOI] [PubMed] [Google Scholar]
  53. Sun Y, Zhao J, Li X, Li Y. E2 conjugases UBC1 and UBC2 regulate MYB42-mediated SOS pathway in response to salt stress in Arabidopsis. New Phytol. 2020 doi: 10.1111/nph.16538. [DOI] [PubMed] [Google Scholar]
  54. Teng K, Li J, Liu L, et al. Exogenous ABA induces drought tolerance in upland rice: the role of chloroplast and ABA biosynthesis-related gene expression on photosystem II during PEG stress. Acta Physiol Plant. 2014;36:2219–2227. doi: 10.1007/s11738-014-1599-4. [DOI] [Google Scholar]
  55. Turupcu A, Almohamed W, Oostenbrink C, Seifert GJ. A speculation on the tandem fasciclin 1 repeat of FLA4 proteins in angiosperms. Plant Signal Behav. 2018;13:1–5. doi: 10.1080/15592324.2018.1507403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Urbanek H, Kuzniak-Gebarowska E, Herka K. Elicitation of defense responses in bean leave by botrytis cinerea polygalacturanase. Acta Physiol Plant. 1991;13:43–50. [Google Scholar]
  57. Van Hengel AJ, Roberts K. AtAGP30, an arabinogalactan-protein in the cell walls of the primary root, plays a role in root regeneration and seed germination. Plant J. 2003;36:256–270. doi: 10.1046/j.1365-313X.2003.01874.x. [DOI] [PubMed] [Google Scholar]
  58. Van Zelm E, Zhang Y, Testerink C. Salt tolerance mechanisms of plants. Annu Rev Plant Biol. 2020;71:1–31. doi: 10.1146/annurev-arplant-081519-035831. [DOI] [PubMed] [Google Scholar]
  59. Wang C, Chen S, Dong Y, et al. Chloroplastic Os3BGlu6 contributes significantly to cellular ABA pools and impacts drought tolerance and photosynthesis in rice. New Phytol. 2020;226:1042–1054. doi: 10.1111/nph.16416. [DOI] [PubMed] [Google Scholar]
  60. Wei M, Zhuang Y, Li H, et al. The cloning and characterization of hypersensitive to salt stress mutant, affected in quinolinate synthase, highlights the involvement of NAD in stress-induced accumulation of ABA and proline. Plant J. 2019;1:1–14. doi: 10.1111/tpj.14613. [DOI] [PubMed] [Google Scholar]
  61. Wu X, Qiao Z, Liu H, et al. CML20, an Arabidopsis calmodulin-like protein, negatively regulates guard cell ABA signaling and drought stress tolerance. Front Plant Sci. 2017;8:1–12. doi: 10.3389/fpls.2017.00824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Yan J, Fang L, Yang L, et al. Abscisic acid positively regulates l-arabinose metabolism to inhibit seed germination through ABSCISIC ACID INSENSITIVE4-mediated transcriptional promotions of MUR4 in Arabidopsis thaliana. New Phytol. 2020;225:823–834. doi: 10.1017/CBO9781107415324.004. [DOI] [PubMed] [Google Scholar]
  63. Yang W, Chen S, Cheng Y, et al. Cell wall/vacuolar inhibitor of fructosidase 1 regulates ABA response and salt tolerance in Arabidopsis. Plant Signal Behav. 2020 doi: 10.1080/15592324.2020.1744293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Yao XM, Ji J, Yue JY, et al. Exogenous abscisic acid modulates reactive oxygen metabolism and related gene expression in Platycladus orientalis under H2O2-induced stress. Russ J Plant Physiol. 2020;67:85–93. doi: 10.1134/S1021443720010264. [DOI] [Google Scholar]
  65. Yoshida K, Igarashi E, Wakatsuki E, et al. Mitigation of osmotic and salt stresses by abscisic acid through reduction of stress-derived oxidative damage in Chlamydomonas reinhardtii. Plant Sci. 2004;167:1335–1341. doi: 10.1016/j.plantsci.2004.07.002. [DOI] [Google Scholar]
  66. Zang L, Zheng T, Chu Y, et al. Genome-wide analysis of the fasciclin-like arabinogalactan protein gene family reveals differential expression patterns, localization, and salt stress response in populus. Front Plant Sci. 2015;6:1–16. doi: 10.3389/fpls.2015.01140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Zhang X, Yang G, Shi R, et al. Arabidopsis cysteine-rich receptor-like kinase 45 functions in the responses to abscisic acid and abiotic stresses. Plant Physiol Biochem. 2013;67:189–198. doi: 10.1016/j.plaphy.2013.03.013. [DOI] [PubMed] [Google Scholar]

Articles from Physiology and Molecular Biology of Plants are provided here courtesy of Springer

RESOURCES