Skip to main content
NCBI home page
ACS Omega logoLink to ACS Omega
. 2020 Aug 19;5(34):21355–21363. doi: 10.1021/acsomega.0c01325

Characterization of Free Fatty Acid Receptor 4 and Its Involvement in Nutritional Control and Immune Response in Pacific Oysters (Crassostrea gigas)

Busu Li †,‡,∥, Li Li †,∥,§,¶,*, Wei Wang †,∥, Jie Meng †,∥, Fei Xu †,§,∥, Fucun Wu †,‡,⊥, Guofan Zhang †,‡,§,∥,*
PMCID: PMC7469124  PMID: 32905352

Abstract

graphic file with name ao0c01325_0008.jpg

Free fatty acid receptor 4 (FFAR4) has various physiological functions, including energy regulation and immunological homeostasis. We examined the only FFAR4 homologue in the Pacific oyster Crassostrea gigas (CgFFAR4), which functions as a sensor of long-chain fatty acids. CgFFAR4 is 1098 bp long and contains a seven-transmembrane G protein-coupled receptor domain. CgFFAR4 expression was high in the hepatopancreas, but it was downregulated after fasting, indicating that it plays an essential role in food digestion. Lipopolysaccharide stimulation downregulated CgFFAR4 level, probably as an immune response of the animal. Reduced glycogen level alongside decreased insulin receptor, insulin receptor substrate, and C. gigas glycogen synthase transcription levels after CgFFAR4 knockdown revealed that CgFFAR4 was involved in the regulation of fatty acid and glycogen levels via the insulin pathway. Accordingly, this is the first study on an invertebrate FFAR and provides new insights into the role of this receptor in immune response and nutritional control.

1. Introduction

Fatty acids (FAs) are carboxylic acids with long saturated or unsaturated aliphatic chains.1 FAs are essential dietary nutrients for animals and important cellular components.2 Circulating plasma FAs are called free fatty acids (FFAs) (aka, nonesterified FAs). FFAs bind to glycerol and form triglycerides, a major energy source in animals.2 FAs provide one of the main flavors in food. For example, certain short-chain FFAs have been used as indicators of cheese flavor to assess the quality of Swiss cheese.3 Additionally, FFAs also function as essential physiological molecules that participate in various FFA–receptor-mediated signaling pathways.4,5 FFA receptors, which are G protein-coupled receptors (GPCRs), contain the typical seven-transmembrane domain and function in maintaining the energy and immune homeostasis.

To date, four FFARs have received considerable attention in mammals. Of the identified FFARs, FFAR2 (GPR43) and FFAR3 (GPR41) are activated by short-chain FAs (SCFAs),6,7 whereas FFAR1 (GPR40) and FFAR4 (GPR120) function as the sensors of medium- (FFAR1) or long-chain FAs (FFAR1 and FFAR4).8 FFAR4 is widely expressed in various tissues, especially highly in digestive or immune-related organs.5 Consistent with this expression pattern, FFAR4 has multiple physiological functions, such as energy regulation,9 immunological homeostasis,10 and neuronal functions.11

FFAR4 is highly expressed in mammalian proinflammatory macrophages and mature adipocytes.12 Recently, a marked decrease in FFAR4 levels has been shown to be induced by interleukin (IL)-1β and tumor necrosis factor α (TNF-α), two major proinflammatory cytokines in human adipocytes13 and macrophages.8 Additionally, lipopolysaccharide (LPS) inhibits macrophage activation and FFAR4 expression in macrophages, thereby enhancing the proinflammatory response.8,14 However, ω-3 FAs or GW9508 (GPR120 agonist) treatment broadly represses the LPS-stimulated inflammatory response through GPR120.8 These results indicate that FFAR4 plays an important role in the immune response.

To date, no FFAR has been identified in invertebrates, unlike in mammals. Herein, we identified and cloned the only FFAR homolog in Crassostrea gigas (CgFFAR4) to investigate the role of this receptor in the immune response and nutritional control. In this study, we investigated CgFFAR4 mRNA levels in various tissues during homeostasis and after LPS stimulation or during fasting. To further analyze the function of CgFFAR4, we knocked down CgFFAR4 and characterized the resulting phenotypes. This is the first study about an FFAR in an invertebrate and significantly improves our mechanistic understanding of FFARs and their roles in immune response and nutritional control.

2. Materials and Methods

2.1. Animals

Pacific oysters (C. gigas) in this study were collected from the aquaculture basement of Jiaonan, Qingdao, Shandong, China. No specific permissions were required for this study, and all the experiments were conducted with approval from the Experimental Animal Ethics Committee, Institute of Oceanology, Chinese Academy of Sciences, China. Eight types of oyster tissue, including the adductor muscle, intestine, gonads, stomach, mantle, gill, hepatopancreas, and labial palps, were dissected from 18 live oysters in July 2017. Samples were immediately placed into liquid nitrogen and then preserved at −80 °C.

2.2. Characterization of the Full-Length CgFFAR4 and Phylogenetic Analysis

The CgFFAR4 coding sequence was downloaded from the National Center for Biotechnology Information (NCBI)15 and confirmed by PCR amplification using the specific primers. The open reading frame (ORF) was predicted using ORFfinder in the NCBI database (https://www.ncbi.nlm.nih.gov/orffinder/). To construct the phylogenetic tree, FFAR4 sequences from various species were downloaded from the NCBI, and multiple sequence alignment was performed using ClustalW (http://www.ebi.ac.uk/clustalw/). A phylogenetic tree of FFAR4 was constructed in MEGAX16 by using the neighbor-joining algorithm. The reliability of the estimated tree was evaluated with 1000 bootstrap replicates by using the Poisson model. The molecular weight and theoretical isoelectric point of the predicted CgFFAR4 were computed using ProtParam (http://web.expasy.org/protparam/).

2.3. RNA Extraction and qRT-PCR

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed to investigate the tissue expression pattern of CgFFAR4. Total RNA from embryos or larvae in 10 typical developmental stages (zygote, two-cell, early morula, morula, rotary swimming, gastrula, trochophore, D-shaped-larval, and umbo larval) was isolated using the RNAprep Pure Tissue Kit (Tiangen, Beijing, China), following the protocol of the manufacturer. The RNA integrity and concentration were assessed with agarose gel electrophoresis and NanoDrop spectrophotometer, respectively. For cDNA construction, 1 μg of total RNA was reverse-transcribed using the PrimeScript RT Reagent kit with a gDNA Eraser (Takara Bio Inc., Shiga, Japan), following the instructions of the manufacturer. Afterward, qRT-PCR was performed in an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The 20 μL reaction volume contained 10 μL of 2× SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan), 5.8 μL RNase-free water, 0.4 μL of each 10 mM gene-specific primer (Table 1), 0.4 μL of 50× ROX reference dye, and 3 μL oyster cDNA template at 1:20 dilution. The thermocycling program was set at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. C. gigas elongation factor (CgEF) was used as an internal control, and the primers used were the same as in our previous study17 (Table 1). A melting curve analysis was performed at the end of the reaction to confirm amplification specificity. Gene transcript levels were normalized to the expression of the internal control, and the comparative 2–ΔΔCq method was used to analyze sample gene expression18 using Prism 8.0 software (GraphPad).

Table 1. Primer Used in the Study.

sequence ID   sequences (5′–3′) application
CgFFAR4 forward ATGGCAAATGTGAACAAGTCCT CDS amplification
  reverse TCAAGATGAGGATGTCACACT  
qCgFFAR4 forward TCGGAACGCCGTCAAAG q-RT-PCRa
  reverse CAAGAAACAGGAATACGAGCAG  
qCgGN forward ATGCTTTGGGATGTCTTGTC  
  reverse AACTGATTTCTCATAGGTTGGGT  
qCgGS forward GACGCCAACGACCAAATC  
  reverse TTCAGGAACTCGGGGTGA  
qCgEF forward AGTCACCAAGGCTGCACAGAAAG  
  reverse TCCGACGTATTTCTTTGCGATGT  
qCgCIR forward GGAAGTGGAGCGTGAC  
  reverse CCAAATGACCCTTGACCTA  
qCgIRS forward GGTCCGTTTCTCCGTTA  
  reverse AATGTAGCCAGGGTCAGTA  
qCgGP forward CATTAGAGTGCGTGAATAACA  
  reverse GCAAGGGCAAAGAAGTAA  
Open in a new tab
a

qPCR, quantitative polymerase chain reaction.

2.4. CgFFAR4 Knockdown (KD) in the Oyster and Glycogen Content Assay

To investigate the role of FFAR4 in the glycogen metabolism of Pacific oyster, we knocked down CgFFAR4 expression via CgFFAR4-specific siRNAs (GenePharma Inc., Shanghai). We designed three siRNAs against CgFFAR4 and a negative control siRNA, which had no homology with CgFFAR4. Each siRNA was verified to knockdown CgFFAR4. To achieve the maximum KD efficiency, the three siRNAs were combined at equal amounts. The siRNA sequences are shown in Table 1. The siRNAs were dissolved in RNase-free water to reach 100 μg/mL. We obtained 30 oysters from the aquaculture basement of Jiaonan, Qingdao, Shandong, China, and acclimatized them in the same environment for seven days. Thirty oysters were randomly divided into three groups, namely, experimental (injected with the siRNA mixture), blank control (injected with only water), and negative control. The oysters were anesthetized by mixed seawater (MgCl2: seawater, 500: 500 mL) following the protocol of Suquet.19 The three groups of oysters were injected on the adductor muscle. Seventy-two hours later, five oysters from each group were sampled into liquid nitrogen with a piece of gill used for RNA extraction and the other tissues for glycogen content. The mRNA levels of FFAR4 and the genes involved in the insulin pathway or glycogen metabolism were evaluated using qRT-PCR. The glycogen contents were analyzed using a kit for liver and muscle glycogen content detection from Nanjing Jiancheng Bio-Engineering Institute, Nanjing, China. The samples were freeze-dried and ground into a powder before the analysis. The procedure was as follows: 0.5 μg of the sample was added to alkaline liquor and incubated for 20 min at 100 °C and diluted 16-fold with water. Subsequently, color reagent was added to the hydrolysate and incubated at 100 °C for 5 min. Finally, the optical density of the samples was measured at 620 nm with a path length of 1 cm and normalized using the blank control (Table 2).

Table 2. Sequences of siCgFFAR4s.

sequence ID sequences (5′–3′) sequences (5′–3′)
siCgFFAR4-963 CCGAGUCAAACGCAGAAUUTT AAUUCUGCGUUUGACUCGGTT
siCgFFAR4-209 GCACAGUCACCAACUACUUTT AAGUAGUUGGUGACUGUGCTT
siCgFFAR4-102 GCUCGGUUUACCUUACAUUTT AAUGUAAGGUAAACCGAGCTT
Open in a new tab

2.5. Oyster Starvation and LPS Treatment

To evaluate the expression of FFAR4 under starvation, 50 oysters were cultured at 18 °C with filtered seawater daily changed without food for 10 days and then refed with marine algae (Arthrospira platensis) daily for 14 days. The hepatopancreas and visceral ganglia of five oysters were sampled at days 0, 5, and 10 of starvation, as well as 7 and 14 days after starting refeeding.

To activate the immune response, LPS was injected into the oyster adductor muscle. One hundred and twenty oysters were anesthetized using mixed seawater, and then 100 μL of LPS (0.5 mg mL–1) and phosphate-buffered saline (control pH = 7.4) were injected into the adductor muscle. The gills of 15 oysters were randomly sampled at 0, 6, 12, 24, 48, and 72 h postinjection.

2.6. Statistical Analysis

Statistical analyses were performed using Prism 8.0 software (GraphPad). Comparisons between two groups were performed using the unpaired, two-tailed t-test. Multiple comparisons among more than two groups were performed using one-way ANOVA, followed by Bonferroni’s posthoc test or two-way ANOVA. P-values were two-tailed, and values <0.05 were considered statistically significant. P < 0.05, P < 0.01, and P < 0.001 are designated in all the figures with *, **, and ***, respectively.

3. Results

3.1. FFAR4 Characterization in C. gigas

The full-length cDNA of the FFAR4 in C. gigas was cloned. CgFFAR4 ORF was 1098 bp, encoding 365 amino acids. The predicted molecular weight was 4.1 kDa, and the theoretical pI was 9.71. CgFFAR4 was found to include a seven-transmembrane GPCR domain from position 41–320, as revealed by SMART (Simple Modular Architecture Research Tool) analysis (http://smart.embl-heidelberg.de/smart), which indicated that CgFFAR4 belonged to the GPCR family (Figure 1). CgFFAR4 shares 62.96% similarity with human GPR120 (FFAR4).

Figure 1.

Figure 1

Open in a new tab

Multiple sequence alignment of CgFFAR4 sequence with the FFAR4 sequences from Homo sapiens (>NP_859529.2 for long and >NP_001182684.1 for short), Rattus norvegicus (NP_001040553.1), and Mus musculus (NP_861413.1). The completely conserved residues across all the aligned species are shaded in black, and the residues labeled in gray indicate ≥75% identity. Dots refer to gaps.

To analyze the relationship of CgFFAR4 with the homologs in other species, a phylogenetic tree was constructed with FFAR4 sequences from C. gigas and 16 other species downloaded from the NCBI. Invertebrate and vertebrate FFAR4s were found to be separated into two distinct clusters (Figure 2).

Figure 2.

Figure 2

Open in a new tab

Neighbor-joining phylogenetic tree of FFAR4. The phylogenetic tree was constructed using MEGA X software, based on FFAR4 sequences from C. gigas and other species, including Mus musculus FFAR4 (NP_861413.1), Rattus norvegicus FFAR4 (NP_001040553.1), Homo sapiens GPR120-L (NP_859529.2), Homo sapiens GPR120-S (NP_001182684.1), Anas platyrhynchos FFAR4 (NP_001297760.1), Astyanax mexicanus FFAR4 (XP_022537849.1), Lingula anatine FFAR4 (XP_013379004.1), Pipra filicauda FFAR4 (XP_027598952.1), Xenopus tropicalis FFAR4 (XP_002937240.2), Cimex lectularius FFAR4-like (XP_014248460.1), Crassostrea virginica FFAR4-like (XP_022338246.1), Melanaphis sacchari FFAR4-like (XP_025204151.1), Mizuhopecten yessoensis FFAR4-like (XP_021363995.1), Octopus vulgaris FFAR4-like (XP_029654917.1), Onthophagus taurus FFAR4-like (XP_022910589.1), and Zootermopsis nevadensis FFAR4-like (XP_021919308.1).

3.2. CgFFAR4 mRNA Levels in Various Tissues and Different Developmental Stages

Among the embryonic and larval developmental stages, CgFFAR4 mRNA level increased at the D-shape larval stage (Figure 3A). Among the eight tissues, CgFFAR4 was found to be relatively highly transcribed in the hepatopancreas, stomach, and intestine, which constitutes the oyster digestive tract (Figure 3B).20

Figure 3.

Figure 3

Open in a new tab

CgFFAR4 expression patterns in the developmental stages and tissues. Data are displayed as mean ± SE. (A) Expression levels of CgFFAR4 relative to those of CgEF (elongation factor) in the hepatopancreas (hepa), stomachs, intestines, labial palps, mantles, gonads, adductor muscle (AM), and gills from 18 oysters. (B) CgFFAR4 expression pattern during the 10 developmental stages from egg to umbo larva.

3.3. CgFFAR4 Expression after Fasting or LPS Treatment

Figure 4A indicates that the relative mRNA level of CgFFAR4 to that of CgEF in the hepatopancreas and visceral ganglia significantly declined after 5–10 days of fasting and gradually recovered in 7–14 days after refeeding. After LPS injection, CgFFAR4 mRNA level significantly decreased relative to that under phosphate-buffered saline injection (Figure 4B).

Figure 4.

Figure 4

Open in a new tab

FFAR4 expression relative to the EF expression in the oysters after fasting or LPS treatment. (A) CgFFAR4 mRNA level relative to the CgEF mRNA level in the oyster hepatopancreas and visceral ganglia after fasting for 5 or 10 days and then refeeding for 7 or 14 days. F5d: fasting for 5 days, F10d: fasting for 10 days, R7d: re-feeding for 7 days, and R14d: re-feeding for 14 days. Data are displayed as mean ± SE from five individuals. The mRNA levels were calculated using the comparative 2–ΔΔCq method with the control samples as the reference samples in the two groups. (B) CgFFAR4 mRNA level relative to CgEF mRNA level in the oysters injected with phosphate-buffered saline (PBS) or LPS, 0, 6, 12, 24, 48, or 72 h postinjection. The mRNA levels were calculated using the comparative 2–ΔΔCq method with the 0-h samples as the reference samples in the two groups. *P < 0.05; **P < 0.01; and ***P < 0.001 (two-way ANOVA).

3.4. Glycogen Content of Oysters after CgFFAR4 KD

To further elucidate the involvement of CgFFAR4 in glycogen content in oysters, we knocked down FFAR4 in the oysters. Seventy-two hours after siRNA injection, a piece of gill was collected to inspect KD efficiency, and the other tissues were harvested for glycogen content assessment. Figure 5A indicates that 72 h after siRNA injection, CgFFAR4 was significantly downregulated compared with the level in the negative control. In the five knocked-down oysters, the glycogen contents were also significantly decreased (Figure 5B).

Figure 5.

Figure 5

Open in a new tab

CgFFAR4 knockdown efficiency and glycogen content after the knockdown. Data are displayed as mean ± SE from five individuals. ***P < 0.001 (one-way ANOVA). (A) CgFFAR4 mRNA level relative to CgEF mRNA level 72 h after CgFFAR4 siRNA injection. The mRNA level in the negative control was considered as the reference. (B) Whole-tissue glycogen content after CgFFAR4 knockdown.

3.5. Expression Levels of Insulin-Signaling- or Glycogen-Synthesis-Related Genes after CgFFAR4 KD

FFAR4 has been reported to participate in insulin resistance.8,21 To further investigate the relationship between FFAR4 and the insulin pathway, we analyzed the expression levels of insulin-signaling- or glycogen-synthesis-related genes after FFAR4 KD in the oysters. Figure 6A indicates that insulin receptor (CIR) and insulin receptor substrate (IRS) decreased upon FFAR4 KD in C. gigas. CIR and IRS sequences were obtained from the oyster genome.15 Among the three key regulators of the glycogen content, glycogen synthase level decreased upon CgFFAR4 KD (Figure 6B). Glycogenin (CgGN) participates in glycogen synthesis, and CgFFAR4 KD did not significantly alter the level of glycogen phosphorylase (CgGP), the main protein involved in glycogenolysis (Figure 6B).

Figure 6.

Figure 6

Open in a new tab

The mRNA levels of insulin-signaling- or glycogen-synthesis-related genes after CgFFAR4 knockdown. (A) The relative mRNA levels of the insulin receptor and insulin receptor substrate in the H2O, negative control or siCgFFAR4 knockdown group. (B) The relative mRNA levels of glycogen synthase, glycogenin, and glycogen phosphorylase in the three groups. Data are displayed as mean ± SE from five individuals. *P < 0.05; and ***P < 0.001 (two-way ANOVA). The mRNA levels were calculated using the comparative 2–ΔΔCq method with the negative control sample used as the reference.

4. Discussion

In oysters, glycogen22,23 and FFAs24−26 have been reported to be involved in the response pathways to stresses, such as temperature and toxicity stresses. Our previous study has identified that glycogen content is closely related to the FA content.27 However, it has remained unknown how FAs and glycogen interact with each other in oysters. In this study, we demonstrated that FFAR4 is a GPCR [also known as seven-(pass)-transmembrane domain receptor], and, together with the insulin signaling pathway, it is involved in the interaction between FAs and glycogen content in Pacific oysters. As an n-3 unsaturated FFA sensor, FFAR4 also contributes to the anti-inflammatory response.8,28 The inhibition of FFAR4 expression induced by LPS stimulation has been reported to enhance the proinflammatory reaction.14 In Pacific oysters, we found that LPS downregulated CgFFAR4, and this effect may contribute to the immune response of the oysters.

FFAs are essential dietary components and act as signaling molecules in multiple physiological processes.29 Multiple FFARs act as sensors for FFAs containing specific carbon chain lengths. These receptors have been reported to mediate physiological functions, such as anti-inflammatory effects, taste preference, and energy regulation.5,7,30,31 In mammals, the FFAR family comprises FFAR 1–4, formerly known as GPR40, 43, 41, and 120, which are now classified into a new GPCR family.32 Long-chain saturated and unsaturated FAs activate FFAR133 and FFAR4,34 whereas SCFAs activate FFAR2 and FFAR3.35,36 In the genome of a pacific oyster, FFAR4 is the only gene annotated as FFAR and has the seven-transmembrane receptor structure similar to mammalian FFARs (Figure 1). The reason why there is only one FFAR homolog in Pacific oysters may be because the specialized FFAR functions observed in mammals can be executed by a single FFAR in evolutionarily low animals such as the oysters because of simpler physiology.

FFAs as nutrients are not only involved in nutrition control but also play an essential role in anti-inflammatory activity. For example, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) can function through the cell surface receptor GPR120 to control the inflammatory signaling and related gene expression patterns.37 Incubation with IL-1b or TNF-α results in a dose-dependent downregulation of the GPR120 mRNA level in human adipocytes.13 LPS is a major component of the outer membrane of Gram-negative bacteria and can induce a strong immune response in mammalian cells38 and invertebrates.39−41 It is a common immune response stimulator in pacific oysters.42,43 LPS has been reported to be able to activate the p-JNK44 and NF-κB45 signaling pathways and to be related to the multiple immune response processes, such as inflammation45 and apoptosis.46 In this study, the CgFFAR4 level significantly decreased after the LPS injection versus the phosphate-buffered saline injection, indicating that CgFFAR4 is involved in the anti-immune response of Pacific oysters. In human or mouse cells, FFAR4 expression markedly decreases upon LPS challenge14 and inhibits LPS-stimulated cytokine expression.8 These observations indicate that the immune function of FFAR4 is conserved in invertebrates and mammals.

To further investigate the function of CgFFAR4, the expression patterns of CgFFAR4 in the tissues and developmental stages of C. gigas were evaluated by qRT-PCR. C. gigas undergoes the typical molluskan developmental stages with mosaic development, including trochophore and veliger larvae and metamorphosis.15 The oysters were sampled during each of the 10 developmental stages (from eggs to umbo larvae) for 14 days. CgFFAR4 mRNA level increased at the D-shape larval stage, which is the essential period for the development of the velum responsible for larval ingestion and swimming. Additionally, CgFFAR4 was variably expressed in all the major tissues. The highest expression was observed in the hepatopancreas, which is the digestive tract of mollusks. This organ combines the hepatic functions and pancreatic digestion observed in vertebrates and follows with the intestine and stomach. These data indicated that CgFFAR4 was closely related to the digestive function of the oysters, consistent with the data about the mammalian homologs. GPR120 is closely related to the digestive function, and it is present at the mRNA level in rodent pancreas.47 It is also expressed throughout the digestive tract of the goats.48 Decreased activities of digestive enzymes (such as amylase, lipase, and pepsin) have previously been observed in mollusks upon starvation treatment.49−51 Since then, this treatment has been applied to the study of digestive function in marine mollusks.52,53 Accordingly, to further investigate the role that CgFFAR4 plays in digestion, we subjected the oysters to starvation. The high CgFFAR4 levels in the hepatopancreas and stomach and CgFFAR4 downregulation upon starvation (Figure 4A) indicate that this protein plays an essential role in food digestion in C. gigas. Decreased CgFFAR4 transcription after starvation may be because of the low level of ingestion and digestion or a stress response.

In addition to being a digestion-related organ, the hepatopancreas also serves as the energy reserve and a metabolic organ in marine bivalves.54 Our previous data have indicated that FFAs are also involved in the regulation of the glycogen content.27 Thus, FFAR4 may be a mediator between FFAs and the glycogen metabolism. To further investigate how FFAR4 regulates FFAs and glycogen content, we performed CgFFAR4 knockdown with siCgFFAR4. The CgFFAR4 transcriptional level significantly decreased with qRT-PCR, following with reduction in the glycogen content.

It has been reported that FFAR4 is related to the insulin pathway. Insulin content decreases upon knocking out FFAR4 in mouse islets.21 The insulin signaling plays a critical role in the glycogen regulation in bivalve mollusks.55 In this study, CgCIR (C. gigas insulin receptor) and CgIRS (C. gigas insulin receptor substance) were downregulated alongside CgGS (C. gigas glycogen synthase) in FFAR4-KD oysters, whereas the expression levels of CgGN (C. gigasglycogenin) and CgGP (C. gigasglycogen phosphorylase) did not significantly differ between the control and KD groups (Figure 6). In Pacific oysters, glycogen synthase is closely linked to glycogen regulation and acts as a molecular marker of the glycogen metabolism.56 We hypothesize that FFAR4 KD in C. gigas induces the downregulation of glycogen content by reducing glycogen synthesis because of the involvement of the insulin signaling.

In conclusion, the present study characterized the only FFAR in C. gigas (CgFFAR4). FFAR4 in C. gigas has conserved structural motifs, such as seven-transmembrane helices. It plays an essential role in the immune response and is involved in the regulation of glycogen and FFA contents via the insulin signaling. CgFFAR4 may be the key regulator of the mechanism by which FFA content is associated with glycogen content and contributes to the immune response. Further research is required to confirm whether there is only one FFAR homolog in Pacific oysters and whether it can replace the functions of the FFARs in mammals. This study serves as the first step in the characterization of FFAs and provides an insight into their roles in the immune response and nutritional control in invertebrates.

Acknowledgments

We are grateful to F.X. of the Institute of Oceanology Chinese Academy of Science for providing the fasting samples of Pacific oysters. The authors thank all the members of the laboratory for valuable discussions.

This work was supported by the Strategic Priority Research Program of the Chinese Academy of Sciences (grant no. XDA24030105); Major Scientific and Technological Innovation Project of Shandong Province (2019JZZY010813); National Natural Science Foundation of China (31530079), and the Earmarked Fund for China Agriculture Research System (CARS-49).

The authors declare no competing financial interest.

References

  1. Olson J. A. Lipid metabolism. Annu. Rev. Biochem. 1966, 35, 559–598. 10.1146/annurev.bi.35.070166.003015. [DOI] [PubMed] [Google Scholar]
  2. Kimura I.; Ichimura A.; Ohue-Kitano R.; Igarashi M. Free Fatty Acid Receptors in Health and Disease. Physiol. Rev. 2020, 100, 171–210. 10.1152/physrev.00041.2018. [DOI] [PubMed] [Google Scholar]
  3. Koca N.; Rodriguez-Saona L. E.; Harper W. J.; Alvarez V. B. Application of Fourier transform infrared spectroscopy for monitoring short-chain free fatty acids in Swiss cheese. J. Dairy Sci. 2007, 90, 3596–3603. 10.3168/jds.2007-0063. [DOI] [PubMed] [Google Scholar]
  4. Blad C. C.; Tang C.; Offermanns S. G protein-coupled receptors for energy metabolites as new therapeutic targets. Nat. Rev. Drug Discov. 2012, 11, 603–619. 10.1038/nrd3777. [DOI] [PubMed] [Google Scholar]
  5. Hara T.; Kimura I.; Inoue D.; Ichimura A.; Hirasawa A. Free fatty acid receptors and their role in regulation of energy metabolism. Rev. Physiol. Biochem. Pharmacol. 2013, 164, 77–116. 10.1007/112_2013_13. [DOI] [PubMed] [Google Scholar]
  6. Kasubuchi M.; Hasegawa S.; Hiramatsu T.; Ichimura A.; Kimura I. Dietary gut microbial metabolites, short-chain fatty acids, and host metabolic regulation. Nutrients 2015, 7, 2839–2849. 10.3390/nu7042839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Miyamoto J.; Hasegawa S.; Kasubuchi M.; Ichimura A.; Nakajima A.; Kimura I. Nutritional Signaling via Free Fatty Acid Receptors. Int. J. Mol. Sci. 2016, 17, 450. 10.3390/ijms17040450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Oh D. Y.; Talukdar S.; Bae E. J.; Imamura T.; Morinaga H.; Fan W.; Li P.; Lu W. J.; Watkins S. M.; Olefsky J. M. GPR120 is an omega-3 fatty acid receptor mediating potent anti-inflammatory and insulin-sensitizing effects. Cell 2010, 142, 687–698. 10.1016/j.cell.2010.07.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ichimura A.; Hirasawa A.; Poulain-Godefroy O.; Bonnefond A.; Hara T.; Yengo L.; Kimura I.; Leloire A.; Liu N.; Iida K.; Choquet H.; Besnard P.; Lecoeur C.; Vivequin S.; Ayukawa K.; Takeuchi M.; Ozawa K.; Tauber M.; Maffeis C.; Morandi A.; Buzzetti R.; Elliott P.; Pouta A.; Jarvelin M.-R.; Körner A.; Kiess W.; Pigeyre M.; Caiazzo R.; Van Hul W.; Van Gaal L.; Horber F.; Balkau B.; Lévy-Marchal C.; Rouskas K.; Kouvatsi A.; Hebebrand J.; Hinney A.; Scherag A.; Pattou F.; Meyre D.; Koshimizu T.-a.; Wolowczuk I.; Tsujimoto G.; Froguel P. Dysfunction of lipid sensor GPR120 leads to obesity in both mouse and human. Nature 2012, 483, 350–354. 10.1038/nature10798. [DOI] [PubMed] [Google Scholar]
  10. Konno Y.; Ueki S.; Takeda M.; Kobayashi Y.; Tamaki M.; Moritoki Y.; Oyamada H.; Itoga M.; Kayaba H.; Omokawa A.; Hirokawa M. Functional analysis of free fatty acid receptor GPR120 in human eosinophils: implications in metabolic homeostasis. PLoS One 2015, 10, e0120386 10.1371/journal.pone.0120386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Su K.-P.; Matsuoka Y.; Pae C.-U. Omega-3 Polyunsaturated Fatty Acids in Prevention of Mood and Anxiety Disorders. Clin. Psychopharmacol. Neurosci. 2015, 13, 129–137. 10.9758/cpn.2015.13.2.129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Oh D. Y.; Walenta E. Omega-3 Fatty Acids and FFAR4. Front. Endocrinol. 2014, 5, 115. 10.3389/fendo.2014.00115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Muredda L.; Kępczyńska M. A.; Zaibi M. S.; Alomar S. Y.; Trayhurn P. IL-1β and TNFα inhibit GPR120 (FFAR4) and stimulate GPR84 (EX33) and GPR41 (FFAR3) fatty acid receptor expression in human adipocytes: implications for the anti-inflammatory action of n-3 fatty acids. Arch. Physiol. Biochem. 2018, 124, 97–108. 10.1080/13813455.2017.1364774. [DOI] [PubMed] [Google Scholar]
  14. Zhao Y. Y.; Fu H.; Liang X. Y.; Zhang B. L.; Wei L. L.; Zhu J. X.; Chen M. W.; Zhao Y. F. Lipopolysaccharide inhibits GPR120 expression in macrophages via Toll-like receptor 4 and p38 MAPK activation. Cell Biol. Int. 2020, 44, 89. 10.1002/cbin.11204. [DOI] [PubMed] [Google Scholar]
  15. Zhang G.; Fang X.; Guo X.; Li L.; Luo R.; Xu F.; Yang P.; Zhang L.; Wang X.; Qi H.; Xiong Z.; Que H.; Xie Y.; Holland P. W. H.; Paps J.; Zhu Y.; Wu F.; Chen Y.; Wang J.; Peng C.; Meng J.; Yang L.; Liu J.; Wen B.; Zhang N.; Huang Z.; Zhu Q.; Feng Y.; Mount A.; Hedgecock D.; Xu Z.; Liu Y.; Domazet-Lošo T.; Du Y.; Sun X.; Zhang S.; Liu B.; Cheng P.; Jiang X.; Li J.; Fan D.; Wang W.; Fu W.; Wang T.; Wang B.; Zhang J.; Peng Z.; Li Y.; Li N.; Wang J.; Chen M.; He Y.; Tan F.; Song X.; Zheng Q.; Huang R.; Yang H.; Du X.; Chen L.; Yang M.; Gaffney P. M.; Wang S.; Luo L.; She Z.; Ming Y.; Huang W.; Zhang S.; Huang B.; Zhang Y.; Qu T.; Ni P.; Miao G.; Wang J.; Wang Q.; Steinberg C. E. W.; Wang H.; Li N.; Qian L.; Zhang G.; Li Y.; Yang H.; Liu X.; Wang J.; Yin Y.; Wang J. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 2012, 490, 49–54. 10.1038/nature11413. [DOI] [PubMed] [Google Scholar]
  16. Kumar S.; Stecher G.; Li M.; Knyaz C.; Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Li B.; Meng J.; Li L.; Liu S.; Wang T.; Zhang G. Identification and Functional Characterization of the Glycogen Synthesis Related Gene Glycogenin in Pacific Oysters (Crassostrea gigas). J. Agric. Food Chem. 2017, 65, 7764–7773. 10.1021/acs.jafc.7b02720. [DOI] [PubMed] [Google Scholar]
  18. Livak K. J.; Schmittgen T. D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  19. Suquet M.; de Kermoysan G.; Araya R. G.; Queau I.; Lebrun L.; Le Souchu P.; Mingant C. Anesthesia in Pacific oyster,Crassostrea gigas. Aquat. Living Resour. 2009, 22, 29–34. 10.1051/alr/2009006. [DOI] [Google Scholar]
  20. Gunter G. Digestive Tract of the Oyster. Science 1962, 136, 580. 10.1126/science.136.3515.580. [DOI] [PubMed] [Google Scholar]
  21. Suckow A. T.; Polidori D.; Yan W.; Chon S.; Ma J. Y.; Leonard J.; Briscoe C. P. Alteration of the Glucagon Axis in GPR120 (FFAR4) Knockout Mice. J. Biol. Chem. 2014, 289, 15751–15763. 10.1074/jbc.m114.568683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Cao C.; Wang W.-X. Copper-induced metabolic variation of oysters overwhelmed by salinity effects. Chemosphere 2017, 174, 331–341. 10.1016/j.chemosphere.2017.01.150. [DOI] [PubMed] [Google Scholar]
  23. Li Y.; Qin J. G.; Abbott C. A.; Li X.; Benkendorff K. Synergistic impacts of heat shock and spawning on the physiology and immune health ofCrassostrea gigas: an explanation for summer mortality in Pacific oysters. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2007, 293, R2353–R2362. 10.1152/ajpregu.00463.2007. [DOI] [PubMed] [Google Scholar]
  24. Wang Q.; Liu Y.; Zheng Z.; Deng Y.; Jiao Y.; Du X. Adaptive response of pearl oyster Pinctada fucata martensii to low water temperature stress. Fish Shellfish Immunol. 2018, 78, 310–315. 10.1016/j.fsi.2018.04.049. [DOI] [PubMed] [Google Scholar]
  25. Meng J.; Wang W.-X.; Li L.; Zhang G. Tissue-specific molecular and cellular toxicity of Pb in the oyster ( Crassostrea gigas ): mRNA expression and physiological studies. Aquat. Toxicol. 2018, 198, 257–268. 10.1016/j.aquatox.2018.03.010. [DOI] [PubMed] [Google Scholar]
  26. Pernet F.; Gauthier-Clerc S.; Mayrand É. Change in lipid composition in eastern oyster (Crassostrea virginica Gmelin) exposed to constant or fluctuating temperature regimes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2007, 147, 557–565. 10.1016/j.cbpb.2007.03.009. [DOI] [PubMed] [Google Scholar]
  27. Li B.; Song K.; Meng J.; Li L.; Zhang G. Integrated application of transcriptomics and metabolomics provides insights into glycogen content regulation in the Pacific oyster Crassostrea gigas. BMC Genom. 2017, 18, 713. 10.1186/s12864-017-4069-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Im D.-S. Functions of omega-3 fatty acids and FFA4 (GPR120) in macrophages. Eur. J. Pharmacol. 2016, 785, 36–43. 10.1016/j.ejphar.2015.03.094. [DOI] [PubMed] [Google Scholar]
  29. Hirasawa A. Free Fatty Acid Receptor Family: A New Therapeutic Target for Metabolic Diseases. Yakugaku Zasshi 2015, 135, 769–777. 10.1248/yakushi.14-00250-2. [DOI] [PubMed] [Google Scholar]
  30. Oh D. Y.; Olefsky J. M. G protein-coupled receptors as targets for anti-diabetic therapeutics. Nat. Rev. Drug Discov. 2016, 15, 161–172. 10.1038/nrd.2015.4. [DOI] [PubMed] [Google Scholar]
  31. Miyamoto J.; Kasubuchi M.; Nakajima A.; Kimura I.. Anti-Inflammatory and Insulin-Sensitizing Effects of Free Fatty Acid Receptors. Free Fatty Acid Receptors; Handbook of Experimental Pharmacology; Springer, 2017; Vol. 236, pp 221–231. [DOI] [PubMed] [Google Scholar]
  32. Hopkins M. M.; Meier K. E.. Free Fatty Acid Receptors and Cancer: From Nutrition to Pharmacology. Free Fatty Acid Receptors; Handbook of Experimental Pharmacology; Springer, 2017; Vol. 236, pp 233–251. [DOI] [PubMed] [Google Scholar]
  33. Itoh Y.; Kawamata Y.; Harada M.; Kobayashi M.; Fujii R.; Fukusumi S.; Ogi K.; Hosoya M.; Tanaka Y.; Uejima H.; Tanaka H.; Maruyama M.; Satoh R.; Okubo S.; Kizawa H.; Komatsu H.; Matsumura F.; Noguchi Y.; Shinohara T.; Hinuma S.; Fujisawa Y.; Fujino M. Free fatty acids regulate insulin secretion from pancreatic β cells through GPR40. Nature 2003, 422, 173–176. 10.1038/nature01478. [DOI] [PubMed] [Google Scholar]
  34. Hirasawa A.; Tsumaya K.; Awaji T.; Katsuma S.; Adachi T.; Yamada M.; Sugimoto Y.; Miyazaki S.; Tsujimoto G. Free fatty acids regulate gut incretin glucagon-like peptide-1 secretion through GPR120. Nat. Med. 2005, 11, 90–94. 10.1038/nm1168. [DOI] [PubMed] [Google Scholar]
  35. Brown A. J.; Goldsworthy S. M.; Barnes A. A.; Eilert M. M.; Tcheang L.; Daniels D.; Muir A. I.; Wigglesworth M. J.; Kinghorn I.; Fraser N. J.; Pike N. B.; Strum J. C.; Steplewski K. M.; Murdock P. R.; Holder J. C.; Marshall F. H.; Szekeres P. G.; Wilson S.; Ignar D. M.; Foord S. M.; Wise A.; Dowell S. J. The Orphan G protein-coupled receptors GPR41 and GPR43 are activated by propionate and other short chain carboxylic acids. J. Biol. Chem. 2003, 278, 11312–11319. 10.1074/jbc.m211609200. [DOI] [PubMed] [Google Scholar]
  36. Le Poul E.; Loison C.; Struyf S.; Springael J.-Y.; Lannoy V.; Decobecq M.-E.; Brezillon S.; Dupriez V.; Vassart G.; Van Damme J.; Parmentier M.; Detheux M. Functional characterization of human receptors for short chain fatty acids and their role in polymorphonuclear cell activation. J. Biol. Chem. 2003, 278, 25481–25489. 10.1074/jbc.m301403200. [DOI] [PubMed] [Google Scholar]
  37. Calder P. C. Marine omega-3 fatty acids and inflammatory processes: Effects, mechanisms and clinical relevance. Biochim. Biophys. Acta 2015, 1851, 469–484. 10.1016/j.bbalip.2014.08.010. [DOI] [PubMed] [Google Scholar]
  38. Rietschel E. T.; Kirikae T.; Schade F. U.; Mamat U.; Schmidt G.; Loppnow H.; Ulmer A. J.; Zähringer U.; Seydel U.; Di Padova F.; et al. Bacterial endotoxin: molecular relationships of structure to activity and function. FASEB J. 1994, 8, 217–225. 10.1096/fasebj.8.2.8119492. [DOI] [PubMed] [Google Scholar]
  39. Hughes T. K. Jr.; Smith E. M.; Barnett J. A.; Charles R.; Stefano G. B. LPS stimulated invertebrate hemocytes: a role for immunoreactive TNF and IL-1. Dev. Comp. Immunol. 1991, 15, 117–122. 10.1016/0145-305x(91)90002-g. [DOI] [PubMed] [Google Scholar]
  40. Sampath V. Bacterial endotoxin-lipopolysaccharide; structure, function and its role in immunity in vertebrates and invertebrates. Agric. Nat. Resour. 2018, 52, 115–120. 10.1016/j.anres.2018.08.002. [DOI] [Google Scholar]
  41. Rowley A. F.; Powell A. Invertebrate Immune Systems-Specific, Quasi-Specific, or Nonspecific?. J. Immunol. 2007, 179, 7209–7214. 10.4049/jimmunol.179.11.7209. [DOI] [PubMed] [Google Scholar]
  42. Meng J.; Zhang L.; Huang B.; Li L.; Zhang G. Comparative analysis of oyster (Crassostrea gigas) immune responses under challenge by differentVibriostrains and conditions. Molluscan Res. 2014, 35, 1–11. 10.1080/13235818.2014.919696. [DOI] [Google Scholar]
  43. Li M.; Qiu L.; Wang L.; Wang W.; Xin L.; Li Y.; Liu Z.; Song L. The inhibitory role of γ-aminobutyric acid (GABA) on immunomodulation of Pacific oyster Crassostrea gigas. Fish Shellfish Immunol. 2016, 52, 16–22. 10.1016/j.fsi.2016.03.015. [DOI] [PubMed] [Google Scholar]
  44. Sun J.; Li Y.; Li M.; Liu Y.; Qu C.; Wang L.; Song L. A novel JNK is involved in immune response by regulating IL expression in oyster Crassostrea gigas. Fish Shellfish Immunol. 2018, 79, 93–101. 10.1016/j.fsi.2018.05.017. [DOI] [PubMed] [Google Scholar]
  45. Wang F.; Yu Z.; Wang W.; Li Y.; Lu G.; Qu C.; Wang H.; Lu M.; Wang L.; Song L. A novel caspase-associated recruitment domain (CARD) containing protein (CgCARDCP-1) involved in LPS recognition and NF-κB activation in oyster (Crassostrea gigas). Fish Shellfish Immunol. 2018, 79, 120–129. 10.1016/j.fsi.2018.05.018. [DOI] [PubMed] [Google Scholar]
  46. Lv Z.; Song X.; Xu J.; Jia Z.; Yang B.; Jia Y.; Qiu L.; Wang L.; Song L. The modulation of Smac/DIABLO on mitochondrial apoptosis induced by LPS in Crassostrea gigas. Fish Shellfish Immunol. 2019, 84, 587–598. 10.1016/j.fsi.2018.10.035. [DOI] [PubMed] [Google Scholar]
  47. Stone V. M.; Dhayal S.; Brocklehurst K. J.; Lenaghan C.; Sörhede Winzell M.; Hammar M.; Xu X.; Smith D. M.; Morgan N. G. GPR120 (FFAR4) is preferentially expressed in pancreatic delta cells and regulates somatostatin secretion from murine islets of Langerhans. Diabetologia 2014, 57, 1182–1191. 10.1007/s00125-014-3213-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Ran T.; Li H.; Liu Y.; Zhou C.; Tang S.; Han X.; Wang M.; He Z.; Kang J.; Yan Q.; Tan Z.; Beauchemin K. A. Cloning, Phylogenetic Analysis, and Distribution of Free Fatty Acid Receptor GPR120 Expression along the Gastrointestinal Tract of Housing versus Grazing Kid Goats. J. Agric. Food Chem. 2016, 64, 2333–2341. 10.1021/acs.jafc.5b06131. [DOI] [PubMed] [Google Scholar]
  49. Albentosa M.; Moyano F. J. Influence of nutritional stress on digestive enzyme activities in juveniles of two marine clam species, Ruditapes decussatus and Venerupis pullastra. J. Sea Res. 2008, 59, 249–258. 10.1016/j.seares.2008.02.004. [DOI] [Google Scholar]
  50. Dai W.-F.; Zhang J.-J.; Qiu Q.-F.; Chen J.; Yang W.; Ni S.; Xiong J.-B. Starvation stress affects the interplay among shrimp gut microbiota, digestion and immune activities. Fish Shellfish Immunol. 2018, 80, 191–199. 10.1016/j.fsi.2018.05.040. [DOI] [PubMed] [Google Scholar]
  51. Le K. X.; Wang Y.; Peng R. B.; Liang J. J.; Jiang X. M.; Han Q. X. Effects of starvation and re-feeding on survival rate, growth and digestive enzyme activities of juvenile Sepia pharaonis. Yingyong Shengtai Xuebao 2016, 27, 2002–2008. 10.13287/j.1001-9332.201606.009. [DOI] [PubMed] [Google Scholar]
  52. Yang B.; Zhang M.; Li L.; Pu F.; You W.; Ke C. Molecular Analysis of Atypical Family 18 Chitinase from Fujian Oyster Crassostrea angulata and Its Physiological Role in the Digestive System. PLoS One 2015, 10, e0129261 10.1371/journal.pone.0129261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Shan X.; Quan H.; Dou S. Morphological and histological changes in digestive tract development during starvation in the miiuy croaker. Fish Physiol. Biochem. 2016, 42, 529–546. 10.1007/s10695-015-0157-3. [DOI] [PubMed] [Google Scholar]
  54. Wang X.; Wang L.; Zhang H.; Ji Q.; Song L.; Qiu L.; Zhou Z.; Wang M.; Wang L. Immune response and energy metabolism of Chlamys farreri under Vibrio anguillarum challenge and high temperature exposure. Fish Shellfish Immunol. 2012, 33, 1016–1026. 10.1016/j.fsi.2012.08.026. [DOI] [PubMed] [Google Scholar]
  55. Shi Y.; He M.-x. PfIRR Interacts with HrIGF-I and Activates the MAP-kinase and PI3-kinase Signaling Pathways to Regulate Glycogen Metabolism in Pinctada fucata. Sci. Rep. 2016, 6, 22063. 10.1038/srep22063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zeng Z.; Ni J.; Ke C. Expression of glycogen synthase (GYS) and glycogen synthase kinase 3β (GSK3β) of the Fujian oyster, Crassostrea angulata, in relation to glycogen content in gonad development. Comp. Biochem. Physiol., Part B: Biochem. Mol. Biol. 2013, 166, 203–214. 10.1016/j.cbpb.2013.09.003. [DOI] [PubMed] [Google Scholar]

Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES