Skip to main content
Cell Cycle logoLink to Cell Cycle
. 2020 Jun 17;19(14):1740–1753. doi: 10.1080/15384101.2020.1777804

miR-96-5p regulated TGF-β/SMAD signaling pathway and suppressed endometrial cell viability and migration via targeting TGFBR1

Silei Chen 1, Yajuan Luo 1, Liangyi Cui 1, Qing Yang 1,✉
PMCID: PMC7469441  PMID: 32635855

ABSTRACT

We previously performed high throughput RNA-seq in paired eutopic and ectopic endometrial specimen of endometriosis patients, and validated the results by qRT-PCR in endometriosis endometrial tissues. MiR-96-5p was significantly downregulated in ectopic endometrial tissues compared to eutopic tissues. In order to identify the role of miR-96-5p in endometriosis and endometrial cells, and investigate the underlying mechanisms, the Ishikawa and End1/E6E7 cell lines were transfected with miR-96-5p mimics, miR-96-5p inhibitors or TGFBR1 siRNA. The expression of TGF-β/SMAD signaling pathway components and epithelial–mesenchymal transition (EMT) markers were examined by qRT-PCR and western blot, and cell viability and migration were determined by CCK-8, transwell and wound healing assays, respectively.

We discovered miR-96-5p to be significantly downregulated while TGFBR1 was distinctly up-regulated in endometriosis. Overexpression of miR-96-5p inhibited endometrial cells viability and migration, while inhibition of miR-96-5p had opposite effect. Furthermore, we confirmed TGFBR1 was a direct target of miR-96-5p. Overexpression of miR-96-5p could block the TGF-β/SMAD signaling pathway via targeting TGFBR1 and reverse the TGF-β1 induced EMT in endometrial cell lines.

In conclusion, we demonstrated that miR-96-5p interacted with TGF-β/SMAD signaling pathway and blocked the TGF-β1 induced EMT in endometrial cells via directly targeting TGFBR1.

KEYWORDS: miR-96-5p, TGF-β/SMAD signaling pathway, TGFBR1, endometriosis, EMT

1. Introduction

1.1. Endometriosis

Endometriosis is a common inflammatory disease characterized by the presence of functional endometrial glands and stroma outside the uterine cavity. Typical clinical manifestations include chronic pelvic pain, dysmenorrhea, dyspareunia and infertility [1]. Endometriosis affects up to 10% of women of reproductive age and up to 50% of women with infertility and/or pelvic pain [2–4]. Despite being a benign disease, endometriosis shows malignant biological behaviors such as distant metastasis, adhesion, invasion, implantation and recurrence [5]. Recently, emerging evidence showed that endometriosis is a systematic disease with underlying immune and hormonal basis [6], among which the gynecological manifestations might just represent the tip of an iceberg [7]. It is speculated that endometriosis patients have certain susceptible factors that contribute to the onset and progression of this disease.

1.2. TGF-β/SMAD signaling pathway

Transforming growth factor β (TGF-β) contains three isoforms, TGF-β1, TGF-β2 and TGF-β3, among which TGF-β1 is the predominant isoform. TGF-β is a multifunctional cytokine regulating cell differentiation, proliferation, angiogenesis and immune responses [8]. Apart from participating in chronic inflammatory diseases, TGF-β also functions as tumor promoter or suppressor [9] in tumor pathology, which is dependent on the type of disease. Studies have shown that the level of TGF-β elevates in peritoneal fluid and serum of endometriosis patients [10–12], indicating that TGF-β signaling plays an important role in the pathogenesis of endometriosis. TGF-β initiates the downstream signaling pathways through transmembrane type I (TGFBR1) and type II (TGFBR2) receptors. When binding to TGF-β, TGFBR2 recruits and activates TGFBR1, which in turn phosphorylates its downstream key signaling molecules, SMAD2 and SMAD3. The activated SMADs then bind to SMAD4 and transfer to the nucleus to regulate subsequent gene expression [13]. TGF-β/SMAD signaling pathway is involved in the pathogenesis of endometriosis by regulating a variety of pathophysiological processes, among which epithelial–mesenchymal transition (EMT) is widely studied [14]. EMT is characterized by the loss of cell polarity and cell-cell contacts and gain of mesenchymal phenotypes, which in turn induces increased migration and invasiveness in epithelial cells, and exerts an important role in the pathogenetic process of endometriosis [15].

1.3. MicroRNA

MicroRNAs (miRNAs or miRs) are a class of endogenous non-coding small RNAs of 20–25 nucleotides in length, which bind to the 3ʹ untranslated region (3ʹ-UTR) of target genes and negatively regulate their expression by inhibition of translation or degradation of mRNAs.

MicroRNA has been shown to be involved in a variety of cellular functions, including cell differentiation, proliferation, apoptosis, migration and invasion [16,17]. Accumulated evidences suggested that microRNAs participate in the development of various human diseases, including cancer, metabolic diseases, cardiovascular disorders, reproductive and inflammatory diseases [18]. Recently, many studies have reported significant dysregulation of microRNAs in the circulation in endometriosis patients [16,18–20], suggesting microRNAs may be potential therapeutic targets of endometriosis.

miR-96-5p is a member of the miR-183-96-182 cluster and has been reported to act as oncogene or tumor suppressor in different kinds of tumors, for example hepatocellular carcinoma [21], thyroid carcinoma [22,23], pancreatic cancer [24], colorectal cancer [25], renal cancer [26] and osteosarcoma [27]. However, to the best of our knowledge, the specific role of miR-96-5p in endometriosis has not been investigated so far.

2. Methods and materials

2.1. Clinical specimens

Endometriosis eutopic (n = 32) and ectopic (n = 41) endometrium tissues were collected from patients suffering from endometriosis and received the operation at Shengjing Hospital Affiliated to China Medical University from January, 2018 to July, 2019. All patients were diagnosed laparoscopically and histologically with rASRM (the Revised American Society for Reproductive Medicine classification system, 1997) stage III/IV endometriosis. All patients had regular menstruation period (21–35 d) and none of them had received steroid hormonal therapy at least 6 months ahead of operation. The age range of the patients was between 26 and 54 years old. All samples were collected at the time of surgery and immediately transported to −80°C for further storage. Informed consent was obtained from each patient, and the study was approved by the Institutional Ethics Review Board of Shengjing Hospital Affiliated to China Medical University.

2.2. RNA isolation and qRT-PCR

Total RNA of cells and tissues was isolated by using Trizol reagent (Takara Bio, Inc., Otsu, Japan) following the manufacturer’s instructions. The concentration and quality of RNA were determined by N50 Touch (Implen) Spectrophotometer.

Genomic DNA was removed, and approximately 1000 ng RNA was converted into cDNA using a miRNA cDNA Synthesis Kit (Vazyme biotech co., ltd) for microRNA assays or PrimeScript RT reagent Kit (Takara Bio, Inc., Otsu, Japan) for mRNA assays. Quantitative Real-time PCR was then performed using miRNA SYBR qPCR Master Mix (Vazyme biotech co., ltd) or TB Green Premix Ex Taq (Takara Bio, Inc., Otsu, Japan) on an ABI 7500 fast system (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. The 2−ΔΔCt method was used to calculate the relative expressions of miRNA or mRNA, normalized to U6 snRNA or GAPDH mRNA. Stem-loop primers were adopted to detect microRNAs and were designed by Sangon Biotech (Sangon Biotech, Shanghai, China). The primer sequences are listed in Table 1.

Table 1.

List of primer sequences for qRT-PCR.

Primer name Sequence (5ʹ to 3ʹ)
hsa-miR-96-5p Forward GCGTTTGGCACTAGCACATT
hsa-miR-96-5p Reverse AGTGCAGGGTCCGAGGTATT
hsa-U6 Forward CGCTTCGGCAGCACATATAC
hsa-U6 Reverse TTCACGAATTTGCGTGTCATC
TGFBR1 Forward CTCTTCAAAAACTGGGTCTGTG
TGFBR1 Reverse CATCAACATGAGTGAGATGCAG
TGFBR2 Forward TAAGGCCAAGCTGAAGCAGAACAC
TGFBR2 Reverse AACTCCGTCTTCCGCTCCTCAG
SMAD3 Forward CACAGCATGGACGCAGGTTCTC
SMAD3 Reverse AGGAGATGGAGCACCAGAAGGC
GAPDH Forward CAGGAGGCATTGCTGATGAT
GAPDH Reverse GAAGGCTGGGGCTCATTT

2.3. Western blotting

Total protein of tissue samples and cells was extracted by RIPA Lysis Buffer (Beyotime Biotechnology, Shanghai, China) with protease inhibitor PMSF and phosphatase inhibitor. Forty micrograms of proteins was separated on 10% SDS PAGE and transferred onto PVDF membranes (AP124P, Merck, Germany). The membranes were blocked with 5% nonfat milk or 5% BSA (for phosphorylated proteins) at room temperature for 2 h and incubated with primary antibodies at 4°C overnight (12–16 h). After washed by Tris-buffered saline buffer with 0.1% Tween-20 (TBST) for 3 times, the membranes were incubated with the corresponding Peroxidase-Conjugated secondary antibodies for 2 h at room temperature and then visualized using Quantity One imaging software (Bio-Rad, CA, USA). The band density was analyzed using Image J software. GAPDH was adopted as loading control. Primary antibodies employed in the analysis were as follows: GAPDH (Proteintech, 60,004-1-Ig), TGFBR1 (Affinity, AF5347), TGFBR2 (Proteintech, 66,636-1-Ig), SMAD3 (Proteintech, 66,516-1-Ig), E-cadherin (Proteintech, 20,874-1-Ap), N-cadherin (Proteintech, 22,018-1-Ap), Vimentin (Proteintech, 60,330-1-Ig).

2.4. Cell culture

The endometriotic eutopic cell (End1/E6E7) and Ishikawa cell lines were maintained in RPMI 1640 medium with 10% fetal bovine serum (FBS), respectively. The human embryonic kidney cell line HEK293T was maintained in RPMI 1640 medium with 10% FBS. All cells were cultured in a humidified incubator containing 5% CO2 at 37°C.

2.5. Cell transfection

The miR-96-5p mimics, miR-96-5p inhibitor, siRNA of TGFBR1 and their negative control (NC) were designed and purchased from GenePharma (GenePharma Biotechnology Co., Ltd, Shanghai, China). Lipofectamine 3000 (Invitrogen) was used to transfect cells for subsequent experiments following the manufacturer’s instructions. The sequences of TGFBR1 siRNA, miR-96-5p mimics and inhibitors are listed as follows.

TGFBR1 siRNA: 5ʹ-GGGUCUGUGACUACAACAUTTAUGUUGUAGUCACAGACCCTT-3ʹ.

miR-96-5p mimics:

5ʹ-UUUGGCACAGCACAUUUUUGCUCAAAAAUGUGCUAGUGCCAAAUU-3ʹ

miR-96-5p inhibitor: 5ʹ-AGCAAAAAUGUGCUAGUGCCAAA-3ʹ

2.6. Dual-luciferase reporter assay

HEK293 T cells were seeded into 96-well plates at a density of 10 × 104/well, and then transfected with TGFBR1-3ʹ UTR-wt (100 ng/well), TGFBR1-3ʹ UTR-mut (100 ng/well) and miR-96-5p mimics (50 nmol/l) with Lipofectamine 3000. After 36–48 hours of cell transfection, the cells were lysed and assayed for luciferase activities using the Dual-Glo Luciferase Assay System (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The data recorded on the luminometer were normalized by dividing Firefly luciferase activity with that of Renilla luciferase and were analyzed and graphed. The experiments were performed in triplicate.

2.7. Cell viability assay

End1/E6E7 cells were seeded in 96-well plates at a density of 5 × 103/well, and Ishikawa cells were seeded at a density of 3 × 103/well. A 10 μl CCK-8 (Cell Counting Kit-8; Bimake, Shanghai, China) reagent was added per well. After incubation for an additional 2–4 h at 37°C in 5% CO2, the absorbance at 450 nm of each well was measured with a microplate reader. Growth curves were drawn at days 1, 2, 3 and 4. The experiments were performed in triplicate.

2.8. Wound healing assay

The cells were seeded in 6‑well plates. When the cells reached 70% confluence, the cells were transfected respectively with miR-96-5p mimics, miR-96-5p inhibitors or TGFBR1 siRNA by Lipofectamine 3000 and incubated for another 24 h. The control groups were transfected with corresponding negative controls. A scratch wound was made using a sterilized 10‑μl pipette tip. The cells were subsequently washed with PBS 3 times to remove cell debris. The cells were incubated with RPMI 1640 supplemented with 1% FBS for 24 h, following which images were captured under a microscope (Nikon, Japan). Cell migration rate was calculated as 0hscratchwidth−24hscratchwidth0hscratchwidh×100%. The experiments were performed in triplicate.

2.9. Cell migration assay

The transwell method was adopted to detect cell migration. Cells were diluted to a density of 1 × 105/ml, and suspended in 200 μl serum-free medium and placed in the upper chambers (8-μM pore size transwell filter, Corning, NY, USA), and the lower chambers were filled with 700 μl of culture medium containing 10% FBS as the chemoattractant. After 24 hours, the non-invading cells on the upper surface of the membranes were gently wiped off with cotton swabs, and 4% paraformaldehyde was used to fix the invading cells for 30 min, which was followed by staining with 0.1% crystal violet for another 30 minutes and washing. The invaded cells were quantified via imaging under an inverted fluorescence microscope equipped with an image acquisition system (Nikon, Japan) with original magnification of 20 ×. The experiments were performed in triplicate.

2.10. Statistical analysis

Data were presented as the mean ± standard error (SE) from at least three independent replicates. All statistical analyses were performed with GraphPad Prism 7.0 and IBM Statistics SPSS 22.0. Student’s t-test was performed to evaluate the statistical differences between two groups. One-way analysis of variance (ANOVA) followed by Scheffe’s multiple group comparison was performed to evaluate the statistical differences between different groups. P < 0.05 was considered statistically significant.

3. Results

3.1. miR-96-5p was downregulated and TGFBR1 was upregulated in ectopic endometrial tissue

Our project group had preliminarily performed high throughput RNA-seq in six paired ectopic and eutopic endometrium tissues [28], microRNA fold change (FC, the ratio of the two groups’ averages) ≥2 and adjusted p-values (Padj) ≤0.05 were selected as significantly differentially expressed. We found 96 microRNAs significantly upregulated and 121 microRNAs significantly downregulated according to the selective standards mentioned above (Figure 1(a)). Among which miR-96-5p was downregulated in ectopic endometrial tissues, the fold change was −3.4567.

Figure 1.

Figure 1.

Down-regulation of miR-96-5p and up-regulation of TGFBR1 in ectopic endometrial tissue. (a) Volcano plots demonstrate differentially expressed microRNAs between ectopic and eutopic endometrium of endometriosis patients. Green points indicated upregulated while red points indicated downregulated microRNAs. (b) RT-PCR showed miR-96-5p was downregulated in ectopic endometrial tissue (***, P< 0.001). (c) RT-PCR showed mRNA expression of TGFBR1 and SMAD3 was upregulated in ectopic endometrial tissue (***, P< 0.001). (d) A significant correlation between the levels of miR-96-5p and TGFBR1 in ectopic endometrium tissues was demonstrated using Pearson’s correlation coefficient analysis (r = −0.3315, P = 0.0482). (e) Western blot showed protein expression of TGFBR1 and SMAD3 was upregulated in ectopic endometrial tissue (*, P < 0.05).

We further measured the expression of miR-96-5p in 41 ectopic and 32 eutopic endometrial tissues of endometriosis patients by RT-qPCR. We found that the expression of miR-96-5p was significantly decreased in ectopic endometrial tissue compared with eutopic endometrial tissue, which is in accordance with the high throughput results (Figure 1(b)). In addition, we measured the expression of TGFBR1 and SMAD3 in endometriosis endometrium tissues by RT-qPCR, and the results indicated that TGFBR1 and SMAD3 were increased in ectopic endometrium compared with eutopic endometrium (Figure 1(c)). Moreover, the expression of miR-96-5p was negatively correlated with the expression of TGFBR1 (Pearson’s rank correlation method, r = −0.3315, P = 0.0482) (Figure 1(d)). Western blot also indicated the expression of TGFBR1 and SMAD3 was increased in ectopic endometrium samples compared with eutopic endometrial samples (Figure 1(e)).

3.2. Overexpression of miR-96-5p inhibited endometrial cell viability and migration

To identify whether miR-96-5p affects the biological behaviors of endometrial cells, the endometrial cell line Ishikawa and End1/E6E7 were transfected with miR-96-5p mimics and its negative control (NC) for 48 hours. The level of miR-96-5p increased significantly after transfection (Figure 2(a)), which confirmed that the transfection was effective. To evaluate the effect of miR-96-5p on cell viability, we performed CCK-8 assay on Ishikawa and End1/E6E7 cell lines after transfected with miR-96-5p or NC. The results indicated that miR-96-5p significantly suppressed cell viability (Figure 2(b)). We further performed transwell on both cell lines to evaluate the effect of miR-96-5p on cell migration. The results indicated that miR-96-5p inhibited cell migration in Ishikawa and End1/E6E7 cell lines, the difference was statistically significant (Figure 2(c)). Wound healing assay also showed that miR-96-5p inhibited cell migration significantly (Figure 2(d)).

Figure 2.

Figure 2.

Overexpression of miR-96-5p inhibited endometrial cell viability and migration. (a) The ectopic expression of miR-96-5p in Ishikawa and End1/E6E7 cell lines transfected with mimics was confirmed by RT-PCR (**, P< 0.01). (b)CCK-8 assay showed miR-96-5p overexpression inhibited endometrial cells viability (*, P< 0.05). (c) Transwell assay showed miR-96-5p overexpression inhibited endometrial cell migration. (d) Wound assay showed overexpression of miR-96-5p inhibited endometrial cell migration (*, P< 0.05; **, P< 0.01).

3.3. Inhibition of miR-96-5p promoted endometrial cell viability and migration

We further transfected Ishikawa and End1/E6E7 cell lines with miR-96-5p inhibitor and inhibitor-NC to see whether miR-96-5p downregulation has the opposite effects on miR-96-5p overexpression. The transfection efficiency was verified by PCR (Figure 3(a)). CCK-8 assay showed that inhibiting miR-96-5p promoted endometrial cell viability (Figure 3(b)). Transwell showed that the downregulation of miR-96-5p significantly increased the cell migration ability (Figure 3(c)). Wound healing results showed that miR-96-5p downregulation could promote cell migration significantly (Figure 3(d)).

Figure 3.

Figure 3.

Inhibition of miR-96-5p promoted endometrial cell viability and migration. (a) The downregulation of miR-96-5p in Ishikawa and End1/E6E7 cell lines was confirmed by RT-PCR (***, P < 0.001). (b) CCK-8 assay showed miR-96-5p downregulation promoted endometrial cells viability (*, P < 0.05). (c) Transwell assay showed miR-96-5p downregulation promoted endometrial cell migration. (d) Wound assay showed inhibition of miR-96-5p promoted endometrial cell migration (**, P < 0.01; ***, P < 0.001).

3.4. Silencing TGFBR1 inhibited endometrial cell viability and migration

In order to investigate the role of TGFBR1 in endometrial cells, we transfected Ishikawa and End1/E6E7 cell lines with TGFBR1 siRNA and NC for 48 hours. The transfection efficiency was verified by PCR (Figure 4(a)). CCK-8, transwell and wound healing assay were performed to clarify the biological effects of silencing TGFBR1. CCK-8 assay indicated that silencing TGFBR1 significantly suppressed cell viability (Figure 4(b)). Transwell and wound healing assay indicated that TGFBR1 downregulation inhibited cell migration in Ishikawa and End1/E6E7 cell lines, the difference was statistically significant (Figure 4(c–d)). The above experimental results indicated that silencing TGFBR1 has the same effect as miR-96-5p overexpression.

Figure 4.

Figure 4.

Silencing TGFBR1 inhibited endometrial cell migration and cell viability. (a)The downregulation of TGFBR1 in endometrial cell lines by siRNA was confirmed by RT-PCR (***, P < 0.001). (b) CCK-8 assay showed TGFBR1 downregulation by siRNA inhibited endometrial cells viability (*, P < 0.05). (c) Transwell assay showed TGFBR1 downregulation inhibited endometrial cell migration. (d) Wound assay showed silencing TGFBR1 inhibited endometrial cell migration (*, P < 0.05; **, P < 0.01).

3.5. TGFBR1 is a direct target of miR-96-5p

According to bioinformatics prediction (miRanda, PicTar and TargetScan), miR-96-5p may bind the 3ʹUTR of TGFBR1 to affect the pathogenesis of endometriosis. The seed sequences of miR-96-5p and TGFBR1 are shown in (Figure 5(a)). We then cotransfected HEK293 T cells with wild-type TGFBR1 3′-UTR or mutant TGFBR1 3′-UTR along with miR-96-5p mimics or NC and performed dual-luciferase reporter assay to explore whether miR-96-5p directly targets TGFBR1. We discovered that the luciferase activity of PGL3-TGFBR1-wt was decreased compared with the PGL3-TGFBR1-mut group (Figure 5(b)). In addition, the mRNA and protein expression of TGFBR1 was significantly reduced following miR-96-5p mimics transfection compared with NC transfection group (Figure 5(c–d)). These results indicated that TGFBR1 is a direct target of miR-96-5p.

Figure 5.

Figure 5.

TGFBR1 is a direct target of miR-96-5p. (a) The predicted miR-96-5p binding sites of TGFBR1 3ʹUTR. (b) Dual-luciferase assay confirmed that miR-96-5p directly targets TGFBR1 (*, P < 0.05). (c), (d) PCR and western blot showed that the expression of TGFBR1 was diminished by overexpression of miR-96-5p (*, P < 0.05).

3.6. TGF-β1 activated TGF-β/SMAD pathway and induced EMT in endometrial cell lines

To clarify the role of TGF-β1 on endometrial cells, the Ishikawa and End1/E6E7 cells were treated with TGF-β1 of different concentration (0 ng/ml, 0.5 ng/ml, 1 ng/ml, 2.5 ng/ml, 5 ng/ml, 10 ng/ml), RNA was collected after 48 h and protein was collected after 72 h. PCR and western-blot indicated that TGF-β1 activated TGF-β/SMAD signaling pathway and increased the expression of TGFBR1, TGFBR2 and SMAD3 (Figure 6(a–b)). However, the optimum concentration seemed to vary between two cell lines, namely 1 ng/ml for Ishikawa and 5 ng/ml for End1/E6E7, respectively. Furthermore, the expression of E-cadherin was downregulated, while the expression of N-cadherin and Vimentin was upregulated, indicating that TGF-β1 could induce EMT in Ishikawa and End1/E6E7 cell lines (Figure 6b).

Figure 6.

Figure 6.

TGF-β1 activated TGF-β/SMAD signaling pathway and induced EMT in endometrial cells. (a) PCR showed that after TGF-β1 treatment, RNA expression of TGF-β/SMAD signaling pathway components, TGFBR1, TGFBR2 and SMAD3 was increased in Ishikawa and End1/E6E7 cell lines. (b) Western blot showed that after TGF-β1 treatment, protein expression of TGF-β/SMAD signaling pathway components, TGFBR1, TGFBR2 and SMAD3 was increased in Ishikawa and End1/E6E7 cell lines. Expression of epithelial marker E-cadherin was decreased, and expression of mesenchymal markers N-cadherin and Vimentin was increased following TGF-β1 treatment in Ishikawa and End1/E6E7 cell lines.

3.7. miR-96-5p reversed the TGF-β1 activation of TGF-β/SMAD signaling pathway and TGF-β1-induced-EMT

Western blot was used to evaluate the effect of miR-96-5p on TGF-β/SMAD signaling pathway activated by TGF-β1 (Figure 7a). TGF-β1 activated TGF-β/SMAD signaling pathway compared with control, whereas miR-96-5p mimics treatment suppressed the expression of TGFBR1 and SMAD3 in comparison with TGF-β1 intervention alone; however, the expression of TGFBR2 remained unchanged, indicating that miR-96-5p reversed the activation of TGF-β/SMAD signaling pathway, probably by targeting TGFBR1. Additionally, western blot showed that TGF-β1 induced EMT in endometrial cells. However, the EMT induced by TGF-β1 can be partially reversed by miR-96-5p overexpression, which is characterized by elevated expression of E-cadherin and decreased expression of N-cadherin and Vimentin (Figure 7(b)).

Figure 7.

Figure 7.

miR-96-5p reversed the TGF-β1 activated TGF-β/SMAD signaling pathway and TGF-β1 induced EMT. (a) Western blot showed miR-96-5p overexpression decreased the expression of TGFBR1 and SMAD3 but not TGFBR2 in endometrial cell lines treated with TGF-β1. (b) Western blot showed miR-96-5p overexpression increased the expression of E-cadherin and decreased the expression of N-cadherin and Vimentin in endometrial cell lines treated with TGF-β1. (c) CCK-8 showed TGF-β1 increased cell viability, miR-96-5p overexpression reduced the promotive effect of TGF-β1 (*, P < 0.05; **, P < 0.01). (d) Transwell showed miR-96-5p overexpression attenuates the cell migration ability induced by TGF-β1 (**, P < 0.01). (e) Wound assay showed miR-96-5p overexpression inhibited the TGF-β1 induced cell migration ability (**, P < 0.01).

Considering the promotive effect of TGF-β1 on endometrial cells, the correlation between miR-96-5p and TGF-β/SMAD signaling pathway and their effect on endometrial cell biological behaviors was further evaluated. CCK-8 assay showed that TGF-β1 could promote cell viability; however, the promotive effect was reduced by miR-96-5p overexpression (Figure 7(c)). Moreover, transwell showed that miR-96-5p could attenuate the promoting effect of TGF-β1 on cell migration (Figure 7(d)). As expected, wound assay results also showed that miR-96-5p could inhibit the migration ability of endometrial cells induced by TGF-β1 (Figure 7(e)). These findings demonstrated that miR-96-5p overexpression blocked TGF-β/SMAD signaling by reducing TGFBR1 expression in endometrial cells, and suppressed cell viability and migration of endometrial cells induced by TGF-β1.

4. Discussion

Endometriosis is a common gynecological disease which affects up to millions of women worldwide and significantly decreases life quality in symptomatic patients [1,2]. However, due to the unspecific clinical manifestations and lack of clinically effective biomarkers, the average lag phase between the onset of endometriosis and clinical diagnosis was estimated to be 8–10 y [29]. Thus, identifying specific biomarkers for early diagnosis and discovery of therapeutic targets for endometriosis is an urgent but unmet clinical need. A growing body of evidence suggested that microRNA plays an important role in the pathophysiology of endometriosis and acts as candidate biomarkers [18–20].

Our preliminary work showed that miR-96-5p was one of the significantly downregulated microRNAs in the ectopic endometrium of endometriosis patients. miR-96-5p belongs to the miR-183-96-182 cluster and has been investigated as an oncogenic or tumor-suppressive gene in multiple types of cancers. Liu et al. discovered that miR-96-5p downregulated CCDC67 and promoted cell proliferation and invasion in papillary thyroid carcinoma [22]. Similarly, Song et al. found that miR-96-5p acted as an oncogene and regulated AKT/FOXO1/Bim pathway in papillary thyroid carcinoma [23]. miR-96-5p could function as an oncogene in bladder cancer and hepatocellular carcinoma as well [21,30]. However, researches have shown that miR-96-5p could directly target EZRIN and inhibit cell proliferation, invasion and migration in renal cancer [26] and osteosarcoma [27]. Ress et al. discovered that miR-96-5p could downregulate the expression of oncogene KRAS, and low expression of miR-96-5p is associated with poor survival, indicating its tumor-suppressive role in colorectal cancer [25]. However, to the best of our knowledge, little is known about the role of miR-96-5p in endometriosis.

In the present study, we demonstrated that miR-96-5p was downregulated in ectopic endometrium tissues of endometriosis patients, indicating that miR-96-5p may play a role similar to tumor suppressor in the pathogenesis of endometriosis. Further experiments on cell biological behaviors indicated that overexpression of miR-96-5p inhibited endometrial cell viability and migration, while inhibition of miR-96-5p showed opposite trends. Similar research in vascular smooth muscle cell (VSMC) showed that miR-96-5p overexpression downregulated the expression of cell migration associated proteins MMP2 and MMP9 [31], further confirmed that overexpression of miR-96-5p can inhibit cell migration from the molecular level. Furthermore, silencing TGFBR1 in endometrial cells has the same effect as miR-96-5p overexpression. Since the expression of miR-96-5p and TGFBR1 was negatively correlated in ectopic endometrium tissues of endometriosis patients, we hypothesized that miR-96-5p may exert its biological function through targeted degradation of TGFBR1.

Through bioinformatics prediction (miRanda, PicTar and TargetScan), we identified TGFBR1 to be a potential target gene of miR-96-5p. Dual-luciferase reporter assay confirmed that miR-96-5p could directly bind to the 3ʹUTR of TGFBR1. The RNA and protein expression of TGFBR1 was also reduced by miR-96-5p overexpression in endometrial cell lines, which further confirmed that TGFBR1 is a direct target of miR-96-5p.

TGF-β1 is a multifunctional cytokine participating in cell differentiation, proliferation, angiogenesis, immune responses and tumor pathology [8,9]. It has been shown that TGF-β is dysregulated in peritoneal fluid and serum of endometriosis patients [10,12], suggesting that TGF-β and relative signaling pathways may be involved in the pathogenesis and progression of endometriosis. Epithelial–mesenchymal transition (EMT) is a cell-remodeling process characterized by loss of epithelial phenotypes and gain of mesenchymal phenotypes. It is not only a basic biological process for living tissues maintenance but also a key step in the acquisition of invasion and metastasis of epithelial-derived cells [32]. EMT is a well-studied process and researches have shown that EMT is an important process in the onset and progression of endometriosis [15].

In our study, TGF-β1 could activate the TGF-β/SMAD signaling pathway and induce EMT in endometrial cells. To clarify the interaction between miR-96-5p and TGF-β/SMAD signaling pathway, cells were treated with TGF-β1 alone, or transfected with miR-96-5p mimics after TGF-β1 treatment. The results indicated that miR-96-5p overexpression could diminish the TGF-β1-induced activation of TGF-β/SMAD signaling pathway as evidenced by altered expression of TGFBR1 and SMAD3. Moreover, miR-96-5p could partially reverse the TGF-β1-induced EMT, characterized by increased E-cad expression and decreased N-cad and Vimentin. Additionally, miR-96-5p could diminish the enhanced cell viability and migration induced by TGF-β1. These results indicated that miR-96-5p interact with TGF-β/SMAD signaling pathway through targeting TGFBR1 and reverse the promotive effects of TGF-β1 on endometrial cell biological behaviors.

5. Conclusion

In summary, our findings indicated that miR-96-5p acted as a tumor suppressor in endometriosis, and we provide the first evidence that miR-96-5p directly target TGFBR1 and interact with the TGF-β/SMAD signaling pathway in endometrial cells. Our study suggests that miR-96-5p targeting TGFBR1 may have an important effect on reversing EMT in endometriosis, and may be a potential therapeutic target and marker in the treatment of endometriosis.

Acknowledgments

The authors would like to thank the Biobank of Shengjing Hospital of China Medical University for their assistance in collecting and providing parts of the tissue specimen included in this research.

Funding Statement

This work was supported by grants from the Public Research Foundation of Liaoning Province [No. 20170017]; and the Support Program for Youth Backbone of China Medical University [No. QGZD2018062].

Disclosure statement

All authors declare no conflicts of interest.

References

  • [1].Giudice LC, Kao LC.. Endometriosis [J]. Lancet. 2004;364(9447):1789–1799. [DOI] [PubMed] [Google Scholar]
  • [2].Giudice LC. Clinical practice. Endometriosis [J]. N Engl J Med. 2010;362(2010):2389–2398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Shafrir AL, Farland LV, Shah DK, et al. Risk for and consequences of endometriosis: A critical epidemiologic review [J]. Best Pract Res Clin Obstetrics Gynaecol. 2018. August;51(51):1–15. [DOI] [PubMed] [Google Scholar]
  • [4].Tomassetti C, D’Hooghe T. Endometriosis and infertility: insights into the causal link and management strategies [J]. Best Pract Res Clin Obstetrics Gynaecol. 2018. August;51(51):25–33. [DOI] [PubMed] [Google Scholar]
  • [5].Matalliotakis M, Matalliotaki C, Goulielmos GN, et al. Association between ovarian cancer and advanced endometriosis [J]. Oncol Lett. 2018;15(5):7689–7692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Agrawal S, Tapmeier T, Rahmioglu N. The miRNA Mirage: how close are we to finding a non-invasive diagnostic biomarker in endometriosis? A systematic review [J]. Int J Mol Sci. 2018;19(2):599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Naqvi H, Mamillapalli R, Krikun G, et al. Endometriosis located proximal to or remote from the uterus differentially affects uterine gene expression [J]. Reprod Sci. 2016;23(2):186–191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Yang L, Pang Y, Moses HL. TGF-β and immune cells: an important regulatory axis in the tumor microenvironment and progression [J]. Trends Immunol. 2010;31(6):220–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Ikushima H, Miyazono K. TGFbeta signalling: a complex web in cancer progression [J]. Nat Rev Cancer. 2010;10(6):415–424. [DOI] [PubMed] [Google Scholar]
  • [10].Sikora J, Smycz-Kubanska M, Mielczarek-Palacz A, et al. The involvement of multifunctional TGF-beta and related cytokines in pathogenesis of endometriosis [J]. Immunol Lett. 2018;201:31–37. [DOI] [PubMed] [Google Scholar]
  • [11].Xiu YL, Chen X, Li YL. Transforming growth factor-beta 1 involved in the pathogenesis of endometriosis through regulating expression of vascular endothelial growth factor under hypoxia [J]. 中华医学杂志(英文版). 2017;130(8):956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Young VJ, Brown JK, Saunders PTK, et al. The peritoneum is both a source and target of TGF-β in women with endometriosis [J]. Plos One. 2014;9(9):e106773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Heldin CH, Miyazono K, Dijke P,T. TGF-beta signalling from cell membrane to nucleus through SMAD proteins [J]. Nature. 1997;390(6659):465–471. [DOI] [PubMed] [Google Scholar]
  • [14].Saitoh M. Epithelial-mesenchymal transition is regulated at post-transcriptional levels by transforming growth factor-β signaling during tumor progression [J]. Cancer Sci. 2015;106(5):481–488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Bilyk O, Coatham M, Jewer M, et al. Epithelial-to-mesenchymal transition in the female reproductive tract: from normal functioning to disease pathology [J]. Front Oncol. 2017;7:145–165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Ferlita AL, Battaglia R, Caruso S, et al. Non-coding RNAs in endometrial physiopathology [J]. Int J Mol Sci. 2018;19(7):2120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Miska EA. How microRNAs control cell division, differentiation and death [J]. Curr Opin Genet Dev. 2005;15(5):563–568. [DOI] [PubMed] [Google Scholar]
  • [18].Bjorkman S, Taylor HS. MicroRNAs in endometriosis: biological function and emerging biomarker candidates [J]. Biol Reprod. 2019;100(5):1135–1146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Swati S, Vlad AM, Hui-Min L, et al. Plasma microRNAs as novel biomarkers for endometriosis and endometriosis-associated ovarian cancer [J]. Clin Cancer Res. 2013;19(5):1213–1224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Wang L, Huang W, Ren C, et al. Analysis of serum microRNA profile by solexa sequencing in women with endometriosis [J]. Reprod Sci. 2016;23(10):1359–1370. [DOI] [PubMed] [Google Scholar]
  • [21].Iwai N, Yasui K, Tomie A, et al. Oncogenic miR-96-5p inhibits apoptosis by targeting the caspase-9 gene in hepatocellular carcinoma [J]. Int J Oncol. 2018;53(1):237–245. [DOI] [PubMed] [Google Scholar]
  • [22].Liu ZM, Wu ZY, Li WH, et al. MiR-96-5p promotes the proliferation, invasion and metastasis of papillary thyroid carcinoma through down-regulating CCDC67 [J]. Eur Rev Med Pharmacol Sci. 2019;23(8):3421–3430. [DOI] [PubMed] [Google Scholar]
  • [23].Hong-Ming S, Yi L, Deng-Feng L, et al. MicroRNA-96 plays an oncogenic role by targeting FOXO1 and regulating AKT/FOXO1/Bim pathway in papillary thyroid carcinoma cells [J]. Int J Clin Exp Pathol. 2015;8(9):9889–9900. [PMC free article] [PubMed] [Google Scholar]
  • [24].Xuan H, Wei L, Jian-Hua Z, et al. miR-96 functions as a tumor suppressor gene by targeting NUAK1 in pancreatic cancer [J]. Int J Mol Med. 2014;34(6):1599–1605. [DOI] [PubMed] [Google Scholar]
  • [25].Ress AL, Stiegelbauer V, Winter E, et al. MiR-96-5p influences cellular growth and is associated with poor survival in colorectal cancer patients [J]. Mol Carcinog. 2015;54(11):1442–1450. [DOI] [PubMed] [Google Scholar]
  • [26].Yu N, Fu S, Liu Y, et al. miR-96 suppresses renal cell carcinoma invasion via downregulation of Ezrin expression [J]. J Exp Clin Cancer Res. 2015;34(1):107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Yao Q, Pei Y, Zhang X, et al. microRNA-96 acts as a tumor suppressor gene in human osteosarcoma via target regulation of EZRIN [J]. Life Sci. 2018;203:1–11. [DOI] [PubMed] [Google Scholar]
  • [28].Wang D, Luo Y, Wang G, et al. Circular RNA expression profiles and bioinformatics analysis in ovarian endometriosis [J]. Mol Genet Genomic Med. 2019;7(7):e00756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Hadfield R, Mardon H, Barlow D, et al. Delay in the diagnosis of endometriosis: a survey of women from the USA and the UK [J]. Hum Reprod. 1996;11(4):878–880. [DOI] [PubMed] [Google Scholar]
  • [30].Wu Z, Liu K, Wang Y, et al. Upregulation of microRNA-96 and its oncogenic functions by targeting CDKN1A in bladder cancer [J]. Cancer Cell Int. 2015;15:107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Tian L, Cai D, Zhuang D, et al. miR-96-5p regulates proliferation, migration, and apoptosis of vascular smooth muscle cell induced by angiotensin II via targeting NFAT5 [J]. J Vasc Res. 2020;57(2):86–96. [DOI] [PubMed] [Google Scholar]
  • [32].Thiery JP, Acloque H, Huang RY, et al. Epithelial-mesenchymal transitions in development and disease [J]. Cell. 2009;139(5):871–890. [DOI] [PubMed] [Google Scholar]

Articles from Cell Cycle are provided here courtesy of Taylor & Francis

RESOURCES