Glucose-6-phosphate dehydrogenase increases Ca²⁺ currents by interacting with Ca_v1.2 and reducing intrinsic inactivation of the L-type calcium channel

Abstract

Pyridine nucleotides, such as NADPH and NADH, are emerging as critical players in the regulation of heart and vascular function. Glucose-6-phosphate dehydrogenase (G6PD), the rate-limiting enzyme in the pentose phosphate pathway, is the primary source and regulator of cellular NADPH. In the current study, we have identified two isoforms of G6PD (slow and fast migrating) and functionally characterized the slow migrating isoform of G6PD (G6PD₅₄₅) in bovine and human arteries. We found that G6PD₅₄₅ is eluted in the caveolae fraction of vascular smooth muscle (VSM) and has a higher maximum rate of reaction (V_max: 1.65-fold) than its fast migrating isoform (G6PD₅₁₅). Interestingly, caveolae G6PD forms a complex with the pore-forming α_1C-subunit of the L-type Ca²⁺ channel, Ca_v1.2, as demonstrated by a proximity ligation assay in fixed VSMCs. Additionally, Förster resonance energy transfer (FRET) analysis of HEK293-17T cells cotransfected with red fluorescent protein (RFP)-tagged G6PD₅₄₅ (C-G6PD₅₄₅) and green fluorescent protein (GFP)-tagged Ca_v1.2-(Ca_v1.2-GFP) demonstrated strong FRET signals as compared with cells cotransfected with Ca_v1.2-GFP and C-G6PD₅₁₅. Furthermore, L-type Ca²⁺ channel conductance was larger and the voltage-independent component of availability (c₁) was augmented in C-G6PD₅₄₅ and Ca_v1.2-GFP cotransfectants compared with those expressing Ca_v1.2-GFP alone. Surprisingly, epiandrosterone, a G6PD inhibitor, disrupted the G6PD-Ca_v1.2 complex, also decreasing the amplitude of L-type Ca²⁺ currents and window currents, thereby reducing the availability of the c₁ component. Moreover, overexpression of adeno-G6PD₅₄₅-GFP augmented the KCl-induced contraction in coronary arteries compared with control. To determine whether overexpression of G6PD had any clinical implication, we investigated its activity in arteries from patients and rats with metabolic syndrome and found that G6PD activity was high in this disease condition. Interestingly, epiandrosterone treatment reduced elevated mean arterial blood pressure and peripheral vascular resistance in metabolic syndrome rats, suggesting that the increased activity of G6PD augmented vascular contraction and blood pressure in the metabolic syndrome. These data suggest that the novel G6PD-Ca_v1.2 interaction, in the caveolae fraction, reduces intrinsic voltage-dependent inactivation of the channel and contributes to regulate VSM L-type Ca²⁺ channel function and Ca²⁺ signaling, thereby playing a significant role in modulating vascular function in physiological/pathophysiological conditions.

NEW & NOTEWORTHY In this study we have identified a novel isozyme of glucose-6-phosphate dehydrogenase (G6PD), a metabolic enzyme, that interacts with and contributes to regulate smooth muscle cell l-type Ca²⁺ ion channel function, which plays a crucial role in vascular function in physiology and pathophysiology. Furthermore, we demonstrate that expression and activity of this novel G6PD isoform are increased in arteries of individuals with metabolic syndrome and in inhibition of G6PD activity in rats of metabolic syndrome reduced blood pressure.

INTRODUCTION

Glucose-6-phosphate dehydrogenase (G6PD), the rate-limiting enzyme in the pentose phosphate pathway (PPP), generates >60% of NADPH that is essential for the following: 1) maintaining redox poise; 2) anabolic/synthetic reactions; and 3) producing ribose sugars needed for de novo nucleic acid synthesis in the cell. After the discovery of the PPP and the initial work establishing the primary role of G6PD in glucose metabolism, the significance of G6PD in other aspects of cell physiology was relatively unexplored (27, 50). Typically, G6PD is thought of as a housekeeping enzyme, whose activity is detected in multiple locations within cells, including the sarco(endo)plasmic reticulum, cytosol, peroxisomes, and periphery (11). Furthermore, G6PD expression reportedly exhibits adaptive regulation, such that it is constitutively expressed in some tissues but transcriptionally and posttranslationally regulated in others (6, 31, 32, 52). Consistent with these findings, our laboratory demonstrated that increases in G6PD activity in coronary artery (CA) are PKC-, phosphatidylinositol 3-kinase (PI3K)-, and phosphatase and tensin homolog (PTEN) dependent (1, 13), whereas such increases in rat liver and endothelial cells are Src kinase dependent (14, 43). Other studies have suggested the presence of two or more G6PD isoforms in plants, yeast, and the bark beetle (8, 51, 53). However, the subcellular localization and the number of G6PD isoforms in vascular smooth muscle cells (VSMCs) have not been studied.

In addition to the traditional role of G6PD as an antioxidant, recent studies have suggested that G6PD-derived NADPH fuels NADPH oxidase-dependent superoxide oxide production: in cardiac myocytes and endothelial cells cultured in high-glucose media (3, 54); in vascular and cardiac tissue from obese-diabetics and diabetic rats (26, 48); and in adipose tissue and liver of diabetic mice (25) and humans (46). Consistently, previously we found that inhibition or knockdown of G6PD reduces superoxide generation and relaxes precontracted arteries by reducing the membrane depolarization-induced Ca²⁺ influx and increasing Ca²⁺ uptake by the sarcoplasmic reticulum (13, 16, 21). These observations suggest the existence of a membrane-bound G6PD in mammalian cells, which may account for membrane-dependent novel functions of G6PD, which may be critical in regulating the redox poise and the voltage-gated Ca²⁺ channel function in VSMCs.

This study was undertaken to identify the different G6PD isoforms and their subcellular location in the VSMCs and to elucidate the mechanism by which G6PD influences membrane function. We identified two isoforms of G6PD (slow and fast migrating) and found that their expression was compartmentalized in the CA and coronary artery smooth muscle cells (CASMCs). Furthermore, the slow migrating G6PD formed a complex with the pore-forming α_1C subunit of L-type Ca²⁺ channel Ca_v1.2. Interestingly, epiandrosterone (EPI), a G6PD inhibitor, dissociated this complex and induced an increase of voltage-dependent inactivation as explained by the appearance of intrinsic inactivation of the Ca_v1.2 channel. Taken together, our data demonstrated the existence of two G6PD isoforms in the VSMCs, which play crucial but distinct roles in regulating Ca²⁺ influx and signaling, which evoke VSM contraction in the physiological and pathophysiological state.

MATERIALS AND METHODS

Tissue Preparation

Bovine.

The left anterior descending and circumflex coronary arteries [bovine coronary artery (BCA)] were harvested from hearts of male Angus cows purchased from a slaughterhouse (Stuckey's Meat Packer, Semmes, AL). After the heart was quickly excised from the animal, it was placed in normal Tyrode’s solution (in mmol/L: 135 NaCl, 5.4 KCl, 1.8 CaCl₂, 1.0 MgCl₂, 5 HEPES, and 11 glucose; pH was adjusted to 7.40 with NaOH) and transported to the laboratory on ice. All animal work was approved by Institutional Biosafety Committee and Institutional Animal Care and Use Committee at University of South Alabama.

Human.

Surgical human internal mammary artery (HIMA) discards were collected from de-identified patients undergoing coronary artery bypass graft surgery at Westchester Medical Center, Valhalla, NY, between 2000 and 2004 as described previously (17, 23). These samples were transported to the laboratory in ice-cold normal Tyrode’s solution and immediately used for vascular function and biochemical studies. HIMA were collected based on Institutional Review Board policy and approval to use discarded de-identified patient material, including a waiver of informed consent, was obtained as described previously (17, 23). Therefore, the demographics, including sex, of the patients were unknown.

G6PD-Deficient (G6PD^Def) Mice

G6PD^Def mice (male, 25–30 g) that harbor a polymorphism within the 5′-UTR of G6pd were provided by Dr. Jane Leopold (Brigham’s Women Hospital, Harvard School of Medicine, Boston, MA). Metabolic syndrome (JCR) rats (males, 600–800 g) were provided by Dr. Spencer Proctor (University of Alberta, Edmonton, Alberta, Canada) to Dr. Petra Rocic (New York Medical College, NY). Sprague-Dawley (SD) rats were used as the physiological control for JCR.

Cells and Culture Media

Bovine and human coronary artery smooth muscle cells (BCASMCs and HCASMCs) were purchased from Cell Application, Inc. (San Diego, CA). Human embryonic kidney (HEK) cell line HEK293-17T cells were purchased from ATCC. BCASMCs and HEK293-17T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) and 10% fetal bovine serum. For serum-free studies, the BCASMCs were cultured in the absence or presence of serum (10%). HCASMCs were cultured in HSMC growth media from Cell Application (San Diego, CA).

Reagents

All reagents used in the present study were purchased from Sigma Chemical (St. Louis, MO) and Cayman Chemical (Ann Arbor, MI).

Western Blot Analysis

Western blot analyses were performed as described previously (20). Briefly, lysates were prepared from frozen tissue (20 mg) in lysis buffer (50 mM Tris·HCl pH 7.4, 150 M NaCl, and 0.5% Nonidet P-40) containing EDTA-free complete protease and phosphatase inhibitor (Sigma-Aldrich/Roche). Protein levels were measured using Bradford assays (Bio-Rad), after which 35-μg samples were run on 7–9% SDS-PAGE gels, transferred to nitrocellulose membranes and blocked with either 5% bovine serum albumin (BSA) or 4% milk. The blots were subsequently incubated with respective primary, and secondary antibodies as noted below and specific proteins were detected using SuperSignal West Pico Chemiluminescent Substrate kit (ThermoFisher Scientific).

Antibodies

Western blot analyses were performed using following antibodies mentioned below and in the respective figures. Polyclonal anti-G6PD (for Western blot), monoclonal anti-β-actin, monoclonal anti-LDH, and polyclonal anti-glucose kinase antibodies were purchased from Santa Cruz (Dallas, TX). A monoclonal anti-red fluorescent protein (RFP) antibody was purchased from Clontech (Mountain View, CA), monoclonal anti-caveolin-1 antibody was purchased from Cell Signaling Technology (Danvers, MA), and monoclonal anti-Ca_v1.2 antibody (NeuroMab clone N263/31) was purchased from University of California (UC) Davis (Sacramento, CA). Monoclonal anti-Na⁺-K⁺-ATPase, monoclonal anti-dihydropyridine (DHP)-α₂, and polyclonal anti-G6PD (for immunoprecipitation) antibodies were purchased from Sigma and Santa Cruz. The specificity of the following: 1) anti-G6PD antibody was determined by our laboratory by knocking down G6PD in BCASMCs; and Western blot analyses of G6PD expression in nontransfected and human G6PD transfected HEK 293T whole cell lysate by Santa Cruz (sc-67165); 2) anti-Ca_v1.2 antibody was determined by transiently transfected COS cells with untagged Ca_v1.2, Ca_v1.3, or K_v2.1 plasmids and probed with N263/31 by the vendor (UC Davis NeuroMab Data Sheet); 3) anti-LDH and -glucose kinase antibodies was verified and published previously (33, 47); and 4) anti-Na⁺K⁺ATPase and -DHP, widely used antibodies, were characterized previously (2, 39).

Reverse Transcription and PCR

Total RNA was isolated from cultured HCASMCs and BCASMCs using RNeasy mini kits (Qiagen, Valencia, CA). First-strand cDNA was synthesized using a SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Random hexamers (RHx; 50 ng·μL⁻¹·reaction⁻¹) and OligodT₂₀ (OdT; 50 μM/reaction) were used, as recommended by the manufacturer for reverse transcription. The following primers for G6PD₅₄₅ gene (1,638 bp; NM_000402.4): forward: 5′-GTCGACATGGGCCGGCGGGG-3′ and reverse: 5′-AAAGCTTGAGCTTGTGGGGGTTCACCCAC-3′ were used for PCR amplification. The PCR products were run on 1% agarose gel along with a DNA marker: M; New England Biolabs, Ipswich, MA). Following subcloning, the pDNAs were send for DNA sequencing (Davis Sequencing, Davis, CA).

Construction of RFP-Tagged G6PD pDNAs and Overexpression in HEK293-17T Cells

Human full-length G6PD₅₄₅ (1,638 bp; NM_000402.4) and G6PD₅₁₅ (1,548 bp; NM_001042351.3) pDNAs cloned into the pCMV6-XL5 vector were purchased from Origene Technologies, Inc. G6PD₅₄₅ and G6PD₅₁₅ full-length cDNAs were isolated by PCR and cloned into the p-Ds-RedN1 expression vector (Clontech) between the Nhe I and Xho I sites such that the G6PD_545/515 genes were ligated to the NH₂-terminus of the RFP gene (C-G6PD_545/515), respectively, leaving the NH₂-terminus of G6PD_545/515 genes free. Also, a full-length G6PD₅₄₅ cDNA was cloned into p-Ds-RedC1 expression vector (Clontech) between the Xho I and Sal I sites, such that the G6PD₅₄₅ genes were ligated to the COOH-terminus of RFP gene (N-G6PD₅₄₅), leaving the COOH-terminus of G6PD₅₄₅ gene free. HEK293-T17 cells (10⁶) were incubated for 48 h in 24-well plates and then transfected with 0.8 µg of p-Ds-Red vector or G6PD_545/515-RFP pDNAs, respectively, using 2 mg of FUGENE 6 reagent (Roche) for 48 h.

Construction of G6PD₅₄₅ and G6PD₅₁₅-Coral Green Fluorescent Protein Chimers in an Adenoviral Vector and Transfection in Bovine Coronary Artery

The full-length cDNA sequence of G6PD₅₄₅ (1,638 bp) and G6PD₅₁₅ (1,548 bp) was isolated by PCR and cloned into a pshuttle-CMV adenoviral (Ad) vector (Genscript) between the Sal I and Hind III restriction sites, such that the coral green fluorescent protein (GFP) gene was ligated at COOH-terminus of G6PD₅₄₅ and G6PD₅₁₅. Bovine CA rings (2 × 2 mm) were incubated for 48 h in 24-well plates and transfected with 5.0 µg of adenoviral vector alone (Ad-GFP-Ctrl) or adenoviral G6PD₅₄₅-GFP (Ad-G6PD₅₄₅-GFP) and G6PD₅₁₅-GFP (Ad-G6PD₅₁₅-GFP), respectively, using 20.0 µg of Lipofectamine 2000 for 48 h, as described previously (13).

Construction of Ca_v1.2-GFP pDNA and Förster Resonance Energy Transfer Analysis in HEK293-T17 Cells

Ca_v1.2-GFP pDNA was a gift from Dr. Nagomi Kuryabashi (Juntendo University School of Medicine, Tokyo, Japan). HEK293-T17 cells were plated in 24-well plates at a density of 10⁶/well and incubated for 48 h. They were then cotransfected with 0.8 µg of 1) Ca_v1.2-GFP + N-G6PD₅₄₅; 2) Ca_v1.2-GFP + C-G6PD₅₄₅; and 3) Ca_v1.2-GFP + N-G6PD₅₁₅, separately, using 2 mg of FUGENE 6 reagent (Roche), for 48 h. Förster resonance energy transfer (FRET) experiments were performed on a Leica TCS SP2 confocal Microscope (×63 oil objective) using the sensitized emission approach. Spectral bleed through was corrected for by measuring donor only and acceptor only samples. Regions of interest (ROIs) were selected and FRET efficiency calculated with Leica software using the formula EA (i) = [B − A × b − C × (c − a × b)]/C, where EA is the apparent FRET efficiency; A, B, and C are the donor, FRE, and acceptor channel intensities, respectively; and a, b, and c are correction factors. FRET signals determined using the sensitized emission approach were confirmed using acceptor photobleaching.

G6PD Knockdown

BCASMCs were cultured in DMEM, in a 24-well plate at 37°C for 72 h and were then transfected with 1) Smart pool-G6PD-siRNA (100 nmol/L; Dharmacon) targeting the four exons in the G6PD gene that are common to both the G6PD₅₄₅ (slow migrating) and G6PD₅₁₅ (fast migrating) isoforms; or 2) with siRNA (100 nmol/L) targeting only the G6PD₅₄₅ (5′ CGGAAACGGUCGUACACUUCG 3′; Ambion/Life Technologies, Carlsbad, CA), using 10 mg of Lipofectamine 2000 reagent (Invitrogen), for 67 h. Control experiments were performed using a nontargeting/scrambled (NT) siRNA (negative control).

G6PD Activity

G6PD activity was measured in homogenates (50 μL) by following the reduction of NADP⁺ to NADPH, as published previously (20). Briefly, G6PD enzyme activity was determined by measuring the rate of conversion of NADP⁺ to NADPH. Substrate concentrations used were glucose-6-phosphate (G6P; 200 μM) and NADP⁺ (100 μM). NADPH fluorescence (excitation: 340 nm; emission: 460 nm) was detected using an Flx800 microplate and Synergy 2 fluorescence detectors (BioTek Instruments, Winooski, Vermont).

Cell Fractionation and Cholesterol Studies

Bovine coronary artery (BCA) homogenates were prepared by centrifuging a filtered homogenate suspension at 29,000 g and 5°C. The supernatant obtained was transferred to a Beckman ultracentrifuge equipped with a Ti50 rotor and centrifuged for 60 min at 100,000 g, as described previously (38). Following centrifugation, the membrane fraction was further purified on a Ficol gradient, and the cholesterol-rich caveolae fraction was isolated. Cholesterol was measured using a kit purchased from Cayman Chemical (MI) following the manufacturer’s instructions.

NADP(H) Levels

NADP(H) levels were measured by HPLC using an Elite LaChrom Chromatography System (Hitachi Corporation, Tokyo, Japan), as described previously (22).

Coimmunoprecipitation Assays

Bovine coronary rings were pretreated with contractile agents for various times indicated in the specific figures, after which they were homogenized in lysis buffer containing 1 mM Na₃VO₄ and 1 mM NaF, as described previously (15). The precleared lysates were incubated with the polyclonal anti-G6PD antibody (Sigma) for 3 h at 4°C. The immune complexes were then immobilized on agarose-A and G beads overnight at 4°C, followed by Western blot analyses using antibodies as mentioned in Fig. 3. Specific proteins for immunoblotting were detected using chemiluminescence, or the proteins were eluted and analyzed using liquid chromatography-tandem mass spectrometry (LC-MS/MS; Applied Biomics, Hayward, CA). NanoLC fractionation and matrix-assisted laser desorption ionization-time of flight/time of flight (MALDI-TOF/TOF) were followed by a standard search of the National Center for Biotechnology Information and SwissProt databases, using MASCOT.

Fig. 3.

Glucose-6-phosphate dehydrogenase (G6PD) interacts with Ca_v1.2, a α_1c-subunit of L-type Ca²⁺ channels. A: whole cell homogenates obtained from bovine coronary artery (BCA) were immunoprecipitated (IP) using anti-G6PD antibody and immunoblotted (IB) with anti-Ca_v1.2 (A,i) and anti-dihydropyridine (DHP)-α₂ (A,ii) antibodies, respectively. B: in separate experiments, whole cell homogenates obtained from BCA were subjected to coimmunoprecipitation assays with anti-G6PD and anti-glucose kinase (GK) antibodies, respectively, and immunoblotted with anti-Ca_v1.2 antibody. C: G6PD-Ca_v1.2 interaction was detected in fixed vascular smooth muscle cells (VSMCs) using Duolink Proximity Ligation Assay (PLA). The pictures show a maximum intensity projection of the raw image. C,i and C,ii: the image was acquired in one z-plane. Assays were performed in bovine coronary artery smooth muscle cells (BCASMCs) without the presence (C,i) of the anti-G6PD antibody (without 1 Ab) and in the presence (C,ii) of anti-G6PD antibody (with 1°Ab). PLA signals are shown in red (positive reaction) and the nuclei in blue (negative reaction). C,iii and C,iv: BCASMCs were treated with epiandrosterone (EPI; 100 μM) for an hour, and G6PD-Ca_v1.2 interaction was assessed using Duolink PLA in the absence and presence of anti-G6PD antibody. C,v: summary data of pixel density-to-area ratio from PLA experiment are shown (No-Ab: n = 20 observation/cells from 5 separate experiments; Ab: 25 observation/cells from 5 separate experiments; and Ab + EPI: 20 observations/cells from 5 separate experiments). D: schematic representation of human Ca_v1.2-green fluorescent protein (GFP) and red fluorescent protein (RFP)-tagged G6PD constructs. E: G6PD activity was determined for C-G6PD₅₄₅ and C-G6PD₅₁₅, respectively. Enzyme kinetics demonstrated that G6PD₅₄₅ had a higher V_max than G6PD₅₁₅; n = 5 experiments in each group. F: Förster resonance energy transfer (FRET) was performed using HEK293-17T cells that were cotransfected with Ca_v1.2-GFP and RFP-G6PD constructs. Graph represents the cumulative data from FRET analyses demonstrating energy transfer efficiency between Ca_v1.2-GFP + N-G6PD₅₄₅ (left) (n = 17 observations from 5 separate experiments) Ca_v1.2-GFP + C-G6PD₅₄₅ (middle) (n = 5 observations from 5 separate experiments), and Ca_v1.2-GFP+C-G6PD₅₁₅ (right) (n = 8 observations from 5 separate experiments), respectively.

Isolation of BCASMCs

The endothelium was removed, and the medial layer of the BCA was finely cut in pieces and then digested with a collagenase (91 mg/mL) solution containing soybean trypsin inhibitor (0.25 mg/mL) and elastase (0.125 mg/mL) in 20 mM MOPS-KOH buffer (pH 7.4) containing 250 mM sucrose (1 g tissue/2 mL buffer) at 37°C for 15 min, as described previously (22). Freshly isolated BCASMCs were used for the Proximity Ligation Assay and to record L-type Ca²⁺ currents described below.

Proximity Ligation Assay for Detection of Protein-Protein Interaction

BCASMCs were cultured in tissue culture slides and incubated without or with epiandrosterone (100 μM) or control for 1 h. Protein-protein interaction between G6PD and Ca_v1.2 was detected using Duolink in situ Proximity Ligation Assay kit (Sigma-Aldrich). Briefly, cells were fixed in 10% formalin (in PBS, pH7.0) for 30 min at room temperature followed by three washes in PBS. After the postfixation PBS washes, cells were permeabilized with 0.25% Triton-X100 for 10 min at room temperature followed by three washings in PBS. Blocking was performed with Duolink Blocking Solution in a heated humidity chamber for 60 min at 37°C. Samples were stained with 2 μg/mL primary rabbit anti-G6PD antibody and mouse anti-Ca_v1.2 antibody diluted in Duolink Antibody Diluent and incubated and incubated in the humidity chamber for 60 min at 37°C. Next, cells were incubated in PLUS and MINUS Proximity Ligation Assay (PLA) secondary proximity probes diluted 1:5 in the Duolink Antibody Diluent and the slides were then incubated in a preheated humidity chamber for 1 h at 37°C followed by incubation in ligase (1:40 in 1× ligation buffer) in a preheated humidity chamber for 30 min at 37°C. Finally, polymerase (1:80 in 1× amplification buffer) was added and the slides were incubated in a preheated humidity chamber for 100 min at 37°C and washed two times for 10 min in 1× wash buffer at room temperature and in 0.01× Wash Buffer B for 1 min. Slides were mounted in Duolink in situ mounting medium with DAPI for 15 min before analyzing in a fluorescent or confocal microscope, using a ×20 objective.

Electrophysiology

L-type Ca²⁺ channel currents (I_Ca,L) were recorded and analyzed as described in detail previously (41). Briefly, cells were dispersed on a cover glass in a chamber mounted on an inverted microscope (IX72, Olympus, Tokyo, Japan). After attachment of the cells to the cover glass, the chamber was superfused, first with normal Tyrode’s solution, then with 10 mM Ba²⁺ solution for ~40 min before the first I_Ca,L was recorded. Patch pipettes were pulled from hard glass capillary tubing containing a glass filament using a micropipette puller (P-97 Sutter Instrument Co., Novato, CA), coated with silicone elastomer (Sylgard 184, Dow Corning Co., Midland, MI), and fire-polished using a microforge (MF-830, Narishige, Tokyo, Japan). The pipette resistance was ~10 MΩ when filled with pipette solution. The voltage-clamp amplifier (Axopatch 200B, Molecular Devices, Sunnyvale, CA) was driven by Clampex 10 software via a digital interface (Digidata 1400, Molecular Devices). Currents were filtered at 2 kHz using the amplifier's low-pass eight-pole Bessel filter and digitized at 10 kHz before being stored on a computer hard drive for later analysis. Membrane capacitance was obtained by applying a negative-going ramp step, as well as by using the built-in program in Clampex. The holding potential (HP) was −60 or −80 mV. The current-voltage (I-V) relationship for I_Ca,L was obtained by applying 500-ms depolarization steps at 0.2 Hz from −50 to 50 mV in 10-mV increments. I-V relationships of I_Ca,L were fitted with an equation adapted from the Boltzmann’s equation: I_Ca,L = G_max(V − E_rev)/[1 + exp(V − V_0.5/k)], where V is the membrane potential, G_max is the maximal conductance, E_rev is the reversal potential, V_0.5 is the half activation potential, and k is the slope factor (Boltzmann’s equation of activation). Quasi-steady-state inactivation curves (f_∞-V) were obtained using a gapped double-pulse protocol at 0.1 Hz. A 2-s conditioning pulse to potentials between −100 and 20 mV from an HP of −80 mV was followed by a 50- or 70-ms step to −40 mV, then a 500-ms test pulse to 0 mV. f_∞-V were fitted with the Boltzmann’s equation: f_∞ = c₀ + (c₁-c₀)/{1 + exp[−(V − V_0.5)/k]}, where c₀ is the maximal availability, c₁ is the voltage-independent availability, c₁-c₀ is the maximal availability of the voltage-dependent inactivation; V is the membrane potential of the prepulse; and V_0.5 is the voltage for 50% inactivation of the voltage-dependent component (Boltzmann’s equation of inactivation).

Arterial Contraction Measurements

Endothelium-intact bovine and mouse coronary artery and HIMA were studied for changes in isometric force as described previously (19).

Detection of Hydrogen Peroxide

Hydrogen peroxide levels were determined using luminol luminescence assay. In brief, arteries were homogenized in ice-cold buffer, followed by estimation of the protein concentrations using the Bradford method. Tissue homogenates (20 μL) were incubated at 37°C in the presence of 10 μM luminol plus 1 μM horseradish peroxidase for the detection of H₂O₂ in a final volume of 200 μL of air-equilibrated Krebs solution buffered with 10 mM HEPES-NaOH (pH 7.4). Chemiluminescence was determined using a microplate reader (Synergy 2 from BioTek Instruments, Winooski, VT).

Hemodynamics

All hemodynamic measurements were performed as described previously (29). Briefly, the adult rat was anesthetized with 4% isoflurane, and 2% isoflurane was used to maintain anesthesia for the entire duration of the surgery and data acquisition. The body temperature of the animal during the surgery was maintained using a heating pad. About 3 sq. cm area of skin over the ventral neck region was exposed to locate the right common carotid artery, which was then carefully isolated and a 2.0-F Millar microtip pressure-volume catheter was inserted to the carotid artery and pushed to the left ventricle to measure the systemic blood pressure and left ventricular hemodynamic parameter. Total peripheral resistance was calculated from mean arterial pressure (MAP)/cardiac output (CO).

Statistical Analysis

Values are reported as means ± SE (Table 1) or means ± SD (Tables 2–5). ANOVA and Tukey’s multiple comparison tests were used for analyses in all vascular contractility studies, biochemical assays, and electrophysiological studies with three or more groups. All enzyme activity, Western blot data, and vascular contractility were analyzed using Student’s t tests between two groups. Values of P < 0.05 were considered significant. In all cases, the number of experimental determinations (n) was equal to the number of individual cell culture wells, cells used to record ion currents, hearts from which CAs were harvested, or patients from which HIMAs were obtained.

Table 1.

List of calcium channel subunits and the PPP proteins in the immunocomplex with G6PD detected with LC-MALDI-TOFF

Top Ranked Protein Name	Accession No. GI	Protein MW	Protein PI	Peptide Count	Total Ion Score	Total Ion CI, %
Voltage-dependent L-type calcium channel subunit-α1D	300795582	247,309	6.4	5	69	100
Voltage-dependent L-type calcium channel subunit-α1D-isoform 2	296474884	242,190	6.3	5	65	100
Voltage-dependent R-type calcium channel subunit-α1E	300798325	256,162	8.6	5	49	100
Glyceraldehyde-3-phosphate dehydrogenase	77404273	35,845	8.5	4	200	100
Voltage-dependent calcium channel subunit α-2/δ-2	358418205	135,507	5.2	3	43	98
Voltage-dependent L-type calcium channel subunit-α1F	296470773	192,279	5.8	4	34	86
6-Phosphoglucoronate	296486083	27,514	5.6	2	32	81

LC-MALDI-TOFF, liquid chromatography-matrix-assisted laser desorption ionization-time of flight; PPP, pentose phosphate pathway; PI, protein isoelectric point; CI, confidence interval; MW, molecular weight; G6PD, glucose-6-phosphate dehydrogenase; GI, GenInfo Identifier.

Table 2.

Effect of G6PD on parameters of the I-V relationship

	n	Gmax, pS/pF	V0.5, mV	k, mV	Erev, mV
Cav1.2	32	200 (20)	−13.6 (1.4)	6.6 (0.8)	47.3 (2.4)
C-G6PD545	33	262 (16)****	−11.2 (0.9)***	6.9 (0.5)	43.5 (1.2)
N-G6PD545	21	208 (16)####	−6.4 (1.1)****,####	6.8 (0.6)	45.4 (1.5)

Values are means (SD); n, number of experiments (n was 9 for the simulation). G_max, maximal conductance; V_0.5, half activation potential; k, slope factor; E_rev, the reversal potential; G6PD, glucose-6-phosphate dehydrogenase. Statistical comparison of the parameters was performed using one-way ANOVA, followed by Turkey’s multiple comparison test.

^***P < 0.05,

^****P < 0.0001, compared with Ca_v1.2;

^####P < 0.0001, compared with C-G6PD.

Table 5.

Effect of epiandrosterone on parameters of the f_∞-V relationship

	n	c1	c0	V0.5, mV	k, mV
Control	7	0.19 (0.09)	0.99 (0.01)	−31.4 (0.5)	6.0 (0.4)
10 µM EPI	7	0.14 (0.01)	0.98 (0.01)	−32.1 (0.4)*,####	7.0 (0.3)***
100 µM EPI	7	0.08 (0.01)**	0.99 (0.01)	−33.9 (0.2)****,####	7.0 (0.2)***
Washout	4	0.15 (0.01)	0.97 (0.01)	−28.7 (0.6)****	7.5 (0.5)****

Values are means (SD); n, number of experiments. f_∞-V, quasi-steady-state inactivation curve; V_0.5, voltage to produce 50% inactivation of the voltage-dependent component; c₁, voltage-independent component; c₀, maximal current; k, slope factor; EPI, epiandrosterone. Statistical comparison of the parameters was performed using one-way ANOVA, followed by Turkey’s multiple comparison test.

^*P < 0.05,

^**P < 0.01,

^***P < 0.001,

^****P < 0.0001, compared with control.

^####P < 0.0001, compared with washout.

RESULTS

Vascular Smooth Muscle Cells Express Two Isoforms of G6PD

To determine whether the VSM expresses more than one isoform of G6PD and whether two isoforms are expressed in arteries and/or in cultured smooth muscle cells, we performed Western blot analyses using whole cell lysates obtained from the HIMAs, BCAs, HCASMCs, and BCASMCs, respectively. We observed two bands (fast and slow migrating) for G6PD, in the HIMAs, BCAs, HCASMCs, and BCASMCs lysates (Fig. 1A and Supplemental Fig. S1; all Supplemental material is available at https://doi.org/10.6084/m9.figshare.12311807).

Fig. 1.

Vascular tissue and vascular smooth muscle cells (VSMCs) express 2 isoforms of glucose-6-phosphate dehydrogenase (G6PD). A: Western blot analyses were performed using homogenates obtained from the human internal mammary artery (HIMA), bovine coronary artery (BCA), cultured human coronary artery smooth muscle (HCASMC), and cultured bovine coronary artery smooth muscle (BCASMC) cells, respectively. Proteins were separated on 9% SDS-PAGE and immunoblotted using rabbit anti-G6PD antibody. Two distinct bands (a fast and slow migrating) of G6PD were observed as shown in the representative Western blot of 4 different experiments. B: 2-step RT and PCR were performed with total RNA isolated from HCASMC and BCASMC. OligodT (OdT) and random hexamers (RHx) were used for the RT, and specific primers for G6PD₅₄₅ (1,638 bp; NM_000402.4) were used for the PCR amplification. The PCR products were run on 1% agarose gel along with a DNA marker (M). C: G6PD₅₄₅ mRNA/cDNA isolated from HCASMCs and BCASMCs, respectively, exhibited 100% homology with the human (accession no. NM_000402.4; C,i) and bovine (accession No. NM_001244135.1; C,ii) G6PD₅₄₅ mRNA, reported in GenBank. Alignment of the first 93 nucleotides (5′-end) of the human and bovine G6PD₅₄₅ and G6pd₅₄₅ genes showed the presence of 2 ATG/start codons, located 90 nucleotides apart. C,iii: alignment of the first 30, NH₂-terminal amino acids between the human (NP_000393.4) and bovine (NP_001231064.1) orthologs of G6PD₅₄₅ protein shows 63.3% homology across the 2 species. Hu, human; gb, Genbank; Bv, bovine. D and E: bovine coronary arteries smooth muscle cells (BCASMCs) were transfected with Smartpool-G6PD-siRNAs (D) or G6PD₅₄₅-siRNA (E) separately and scramble/nontargeting (NT) siRNA sequence for 72 h. Western blot analyses were performed using rabbit anti-G6PD antibody. β-Actin (ACTB) was used as a loading control. UT, untransfected. A representative of 4 different Western blot experiments is shown. F: BCASMCs were cultured in serum-free or 10% serum containing cell culture media. Western blot analyses were performed using rabbit anti-G6PD antibody. The slow migrating G6PD isoform was not expressed in SMCs cultured in serum-free media; n = 3 in each group. G: basal G6PD activity was measured in SMCs cultured in serum-free and 10% serum containing media. The activity increased (*P < 0.05) by culturing the BCASMCs in 10% serum as compared to serum-free condition; n = 5 in each group; note overlapping circles represent number of experiments.

There are two different mRNAs reported for G6PD in GenBank (1,638 bp; NM_000402.4 and 1,548 bp; NM_001042351.3) that encodes for two different isoforms of G6PD, one harboring 545 amino acids (G6PD₅₄₅; NP_000393.4) and the other harboring 515 amino acids (G6PD₅₁₅; NP_001035810). We performed two-step reverse transcription (RT) and polymerase chain reaction (PCR) for the G6PD₅₄₅-mRNA/cDNA (1,638 bp; NM_000402.4), using total RNA extracted from HCASMCs and BCASMCs. We obtained a band at 1,638 bp using random hexamers (RHx) primers for RT and G6PD₅₄₅ specific primers for PCR (Fig. 1B). DNA sequencing data revealed that the G6PD₅₄₅ mRNA/cDNA sequence was identical to that of G6PD₅₁₅ mRNA (NM_001042351.3) with the exception of the first 90 nucleotides at the 5′-end of the transcript. Furthermore, G6PD₅₄₅ mRNA/cDNA isolated from HCASMCs and BCASMCs exhibited 100% homology with the human (accession no. NM_000402.4) and bovine (accession no. NM_001244135.1) G6PD₅₄₅ mRNA, respectively, reported in the GenBank. Alignment of the first 93 nucleotides (5′-end) of the human (Fig. 1C,i) and bovine (Fig. 1C,ii) G6PD₅₄₅ mRNA/cDNA shows the presence of two ATG/start codons located 90 nucleotides apart. Consequently, G6PD₅₄₅ protein contains 30 additional amino acids residues at its NH₂-terminus as compared with the G6PD₅₁₅ isoform. Furthermore. the human and bovine orthologs share 63.3% homology (Fig. 1C,iii), within these 30 residues.

To further substantiate the existence of the two G6PD isoforms in VSMCs, we used two sets of G6PD-siRNAs to perform knockdown assays in BCASMCs. The smart pool-G6PD-siRNA (Dharmacon, CO) that targeted four exons in the G6PD gene downregulated both the G6PD₅₁₅ (fast migrating; 61 ± 15.4%) and G6PD₅₄₅ (slow migrating; 25 ± 8.7%) as compared with nontargeting siRNA (Fig. 1D and Supplemental Fig. S1; see https://doi.org/10.6084/m9.figshare.12311807). Interestingly, the second siRNA that we designed to target the first 90 nucleotides of G6PD₅₄₅, specifically downregulated (56 ± 8.2%) the expression of the slow migrating G6PD isoform without affecting the expression of the fast migrating G6PD isoform compared with nontargeting siRNA (Fig. 1E and Supplemental Fig. S1), suggesting that two distinct isoforms of G6PD existed in BCASMCs, with G6PD₅₄₅ isoform migrating slower than the G6PD₅₁₅ isoform.

To determine whether the expression of the two G6PD isoforms is differentially regulated, we cultured the BCASMCs, in the presence and absence of serum. Interestingly, the expression of slow migrating G6PD₅₄₅ was absolutely serum dependent (Fig. 1F), as compared with the fast migrating G6PD₅₁₅, which was expressed even in the serum-free media. Consistently, we found basal G6PD activity in BCASMCs cultured in serum-free condition; however, this activity further increased by addition of serum to the media (Fig. 1G), coinciding with the expression of the slow migrating G6PD₅₄₅.

G6PD Appeared in the Plasma Membrane Fraction and Exhibited Activity in the Caveolae Fraction

We performed a computational subcellular localization analysis of the G6PD protein sequence using the PSORT II prediction tool (28). In silico analysis predicted that G6PD would likely be a peripheral protein with a very high membrane localization score. To determine the subcellular localization of G6PD, ultracentrifugation was performed, using BCA homogenates and the plasma membrane fraction was separated from the microsomal fraction. Western blot analyses were performed on 4–12% gradient gels. G6PD that coeluted in the caveolae fraction along with Na⁺-K⁺ ATPase and caveolin-1 (CAV-1; Fig. 2A) migrated slower than the G6PD that appeared in the cytosolic fraction, suggesting that the two G6PD isoforms had distinct localizations in the cell. Next, we separated the cholesterol-enriched caveolae fraction and the cytoplasmic fraction and measured G6PD activity in both these fractions. Although we found G6PD activity in both the cholesterol-enriched caveolae and the cytoplasmic fraction (Fig. 2B), NADPH levels were higher (P < 0.05) in the caveolae than the cytoplasmic fraction (Fig. 2C).

Fig. 2.

Subcellular localization of glucose-6-phosphate dehydrogenase (G6PD) in the bovine coronary artery (BCA). A: ultracentrifugation of the endothelium and adventitia removed BCA homogenate was performed to separate microsomal and cytosolic fractions. The microsomal fraction was further separated on a Ficol gradient, and Western blot analyses of the caveolae fractions were conducted using 4–12% gel and monoclonal anti-Na⁺-K⁺-ATPase, anti-caveolin-1 (CAV1), and polyclonal anti-G6PD antibody, respectively. LDH was used as a cytosolic marker. The caveolae G6PD migrated slower than the cytosolic G6PD. Representative Western blot of 5 separate experiments is shown. B: the graph represents the G6PD activity measured in the nucleus (fraction 2), mitochondria plus large organelles (fraction 3), submitochondrial particles plus small organelles (fraction 4) and cholesterol-rich caveolae (in yellow box; fraction 5), and cytosolic (fraction 6) fractions. C: the graph represents NADPH levels in the caveolae (triangle) and cytosolic (square) fractions of CAs; n = 20 observation from 5 separate experiments in each group.

G6PD Interacts with Ca_v1.2, a α_1C Subunit of L-type Ca²⁺ Channels

Coelution of G6PD with CAV-1 (Fig. 2A) implied that it might be associated with membrane proteins involved in regulating the intracellular signaling. To test this possibility, we performed immunoprecipitation experiments using BCA lysates with anti-G6PD antibody and IgG (control), followed by LC-MALDI-TOFF. In lysates immunoprecipitated with anti-G6PD antibody, but not IgG, G6PD was found to be associated with the subunits of voltage-gated Ca²⁺ channel (Table 1), which is the main gateway for Ca²⁺ entry in VSMCs and regulator of VSM contraction (7).

To confirm the LC-MALDI-TOFF results, coimmunoprecipitation experiments were performed using anti-G6PD antibody. We found that the pore-forming α_1C-subunit of L-type Ca²⁺ channel, Ca_v1.2, formed a complex with G6PD (Fig. 3A,i and Supplemental Fig. S2). We further confirmed G6PD-Ca_v1.2 interaction using antibodies that recognized the dihydropyridine (DHP) binding site of Ca_v1.2 (DHPα₂; Fig. 3A,ii and Supplemental Fig. S2). Interestingly, Ca_v1.2 did not coimmunoprecipitate with other metabolic enzymes, such as glucose kinase (GK; Fig. 3B), suggesting that the interaction between G6PD and Ca_v1.2 was specific.

To demonstrate the G6PD-Ca_v1.2 interaction in situ, we performed the Duolink Proximity Ligation Assay (PLA) in fixed BCASMCs. G6PD interacted with Ca_v1.2 (speckled red fluorescence seen on the cell surface and perinuclear regions) in the presence (Fig. 3C,ii) but not in the absence (Fig. 3C,i) of anti-G6PD antibody (Fig. 3C), further substantiating a direct interaction between G6PD and Ca_v1.2. To identify modulators of the G6PD-Ca_v1.2 interaction, we treated BCASMCs with epiandrosterone [EPI; an uncompetitive inhibitor of G6PD (12) that inhibits G6PD activity in VSMC (1, 13)] for an hour before performing the PLA. Surprisingly, EPI disrupted G6PD-Ca_v1.2 interaction endogenously, as demonstrated by the absence of speckled red fluorescence, in the cells, even in the presence of G6PD antibody (Fig. 3C).

To further confirm the G6PD-Cav1.2 interaction, we designed G6PD₅₄₅ constructs with a RFP tag at the NH₂-terminus (N-G6PD_545; COOH-terminal free) or at the COOH-terminus (C-G6PD_545; NH₂-terminal free) of G6PD₅₄₅; a G6PD₅₁₅ construct with a RFP tag at the COOH-terminus (C-G6PD₅₁₅; NH₂-terminal free); and a Ca_v1.2 construct with a GFP tag at its COOH-terminus (Ca_v1.2-GFP; NH₂-terminal free) (Fig. 3D). To determine whether the ectopically overexpressed RFP-tagged G6PD isoforms were enzymatically active, we overexpressed C-G6PD₅₄₅ and C-G6PD₅₁₅, in HEK293-T17 cells, respectively. The immunocomplexes (35 μL) obtained after immunoprecipitation of these cell lysates with an anti-RFP antibody were then used to estimate the G6PD activity. Both isoenzymes reduced NADP⁺ to NADPH. Interestingly, C-G6PD₅₄₅ exhibited a 1.65-fold higher V_max than C-G6PD₅₁₅ (Fig. 3E), suggesting that both isoforms were enzymatically active. HEK293-17T cells were then separately cotransfected with Ca_v1.2-GFP + N-G6PD₅₄₅; Ca_v1.2-GFP + C-G6PD₅₄₅; or Ca_v1.2-GFP + C-G6PD₅₁₅, respectively. FRET analyses of the cotransfected cells revealed stronger FRET signals in cells cotransfected with Ca_v1.2-GFP + C-G6PD₅₄₅ than in cells cotransfected with Ca_v1.2-GFP + N-G6PD₅₄₅ (Fig. 3F). Furthermore, we observed very weak FRET signals in cells cotransfected with Ca_v1.2-GFP + C-G6PD₅₁₅, suggesting that G6PD₅₁₅ did not (or weakly) interact with Ca_v1.2.

G6PD Modulated L-type Ca²⁺ Channel Function

To determine whether the G6PD-Ca_v1.2 interaction modulates L-type Ca²⁺ channel function, we ectopically overexpressed Ca_v1.2-GFP alone, Ca_v1.2-GFP + N-G6PD₅₄₅, or Ca_v1.2-GFP + C-G6PD₅₄₅, respectively, in HEK293-17T cells and recorded the I_Ca,L (Fig. 4). The I-V relationship revealed coexpression of C-G6PD₅₄₅ with Ca_v1.2 induced a larger I_Ca,L,peak than that of N-G6PD₅₄₅ (Fig. 4A). Moreover, Ca_v1.2-GFP+N-G6PD₅₄₅ cotransfected cells exhibited a smaller I_Ca,L,peak compared with those expressing of Ca_v1.2-GFP alone (Fig. 4A). Simulation of I-V with the Botlzmann's equation of activation revealed a small but significant shift of V_0.5 to the right by N-G6PD₅₄₅ compared with Ca_v1.2 alone (Table 2). Coexpression of Ca_v1.2-GFP + N-G6PD₅₄₅ and Ca_v1.2-GFP + C-G6PD₅₄₅ significantly increased maximal conductance (G_max) compared with the expression of Ca_v1.2-GFP alone, and the extent of the G_max increase was significantly higher with C-G6PD₅₄₅ compared with N-G6PD₅₄₅ (Table 2). N-G6PD₅₄₅ coexpression slightly shifted the quasi-steady-state inactivation curve (f_∞-V) to the left compared with Ca_v1.2 and C-G6PD₅₄₅ (Fig. 4B and Table 3); c₁, noninactivating component of f_∞-V, was significantly increased with C-G6PD₅₄₅ than with Ca_v1.2 alone and N-G6PD₅₄₅ (Table 3), suggesting that C-G6PD₅₄₅ and Ca_v1.2 interaction downregulated voltage-dependent inactivation of the channel.

Fig. 4.

Effect of glucose-6-phosphate dehydrogenase (G6PD) on L-type Ca²⁺ channel current (I_Ca,L) recorded from HEK293-17T cells transfected with Ca_v1.2. HEK293-17T cells were transfected with Ca_v1.2 alone or cotransfected with 1) Ca_v1.2 + C-G6PD₅₄₅ or 2) Ca_v1.2 + N-G6PD₅₄₅, respectively. A: typical images of the transfected HEK293-17T cells are shown on the top. Calibration bar = 20 µm. Current-voltage (I-V) relationship. a–c: Specimen records obtained by 500-ms-voltage pulses. a: From transfection by Ca_v1.2 alone; b: Ca_v1.2 and C-G6PD₅₄₅; c: Ca_v1.2 and N-G6PD₅₄₅. d: I-V relationship of peak current density of I_Ca,L from cells transfected by Ca_v1.2 (n = 32), Ca_v1.2 and C-G6PD₅₄₅ (n = 33), and Ca_v1.2 and N-G6PD₅₄₅ (n = 21). Time calibration indicates 100 ms, and vertical calibration gives 2 pA/pF. As indicated in voltage-step protocols, black traces indicate current swipes from −40 mV to 0 mM and gray traces indicate current swipes from +10 mV to +40 mV (Aa–Ac), and black traces indicate current swipes from −80 mV to −30 mV and gray traces indicate current swipes from −20 mV to +20 mV (Ba–Bc). Means ± SE are plotted. *P < 0.05; **P < 0.01; ***P < 0.001, compared C-G6PD₅₄₅ vs. N-G6PD₅₄₅. #P < 0.05, compared Ca_v1.2 vs. N-G6PD₅₄₅. Curve fittings were performed with the Boltzmann's equation of activation (see materials and methods) with parameters shown in Table 2. B: quasi-steady-state inactivation curve (f_∞-V) relationships. a–c: Specimen records to obtain the availability curves with pulses shown at top. a: from cells with Ca_v1.2 alone; b: from cells with Ca_v1.2 and C-G6PD₅₄₅; c: from cells with Ca_v1.2 and N-G6PD₅₄₅. d: quasi-steady-state inactivation curves. Availability (f_∞)-voltage (V) relationship from cells transfected by Ca_v1.2 alone (n = 13), Ca_v1.2 and C-G6PD₅₄₅ (n = 7), and Ca_v1.2 and N-G6PD₅₄₅ (n = 7). Curves were fitted to the Boltzmann's equation of inactivation. Table 3 gives actual parameters for the fitting. Arrows indicate the half activation potential (V_0.5).

Table 3.

Effect of G6PD-binding on parameters of the f_∞-V relationship

	n	c1	c0	V0.5, mV	k, mV
Cav1.2	13	0.05 (0.02)	0.99 (0.02)	−26.0 (0.9)	14.0 (0.9)
C-G6PD545	7	0.12 (0.03)****	0.96 (0.03)	−27.1 (1.6)	13.4 (1.7)
N-G6PD545	7	0.06 (0.04) ###	1.01 (0.05)	−31.1 (2.3)****,####	16.0 (2.7)*,##

Values are means (SD); n, number of experiments. G6PD, glucose-6-phosphate dehydrogenase; c₁, voltage-independent component; c₀, maximal availability; V_0.5, voltage to produce 50% inactivation of the voltage-dependent component; k, slope factor. Statistical comparison of the parameters was performed using one-way ANOVA, followed by Turkey’s multiple comparison test.

^*P < 0.05,

^****P < 0.0001, compared with control.

^##P < 0.01,

^###P < 0.001,

^####P < 0.0001, compared with C-G6PD.

Next, we investigated whether the inhibition of G6PD activity and therefore disruption of the G6PD-Ca_v1.2 complex by EPI affected the properties of I_Ca,L in freshly isolated BCASMCs. EPI dose dependently and reversibly decreased I_Ca,L,peak and the terminal current (I₅₀₀) (Fig. 5A) and G_max (Table 4). Application of EPI (100 μM) shifted the f_∞-V relationship to the left and decreased the noninactivating component (c₁) (Fig. 5B and Table 5). The window current (I_WD) of I_Ca,L appeared with marked current noises reflecting the random opening of the channels and was markedly depressed by EPI in a dose-dependent and reversible manner (Fig. 5C). Cd²⁺, an inorganic I_Ca,L inhibitor, completely suppressed I_WD that appeared with a marked current noise.

Fig. 5.

Epiandrosterone (EPI) modulates L-type Ca²⁺ channel (I_Ca,L) function. EPI-induced inhibition of I_Ca,L and window current (I_WD) in bovine coronary artery smooth muscle cells (BCASMCs). A: I_Ca,L. a–d: typical traces: a: control; b: 10 µM EPI; c: 100 µM EPI; d: washout (WO). e: Current-voltage (I-V) relationship of I_Ca,L of peak current (I_Ca,L,peak) and terminal current (I_Ca,L,500). Means ± SE are shown; n =7 except for 5 in WO. *P < 0.05; **P < 0.01, compared with control. #P < 0.05, compared with 100 µM EPI. Data were fitted by the Boltzmann’s equation of activation with parameters partly shown in Table 4. B: quasi-steady-state inactivation curve (f_∞-V) relationships. a–d: Specimen records. Test pulse to 0 mV was applied following 2-s conditioning pulses as shown in the inset. Black sweeps were obtained after conditioning pulses to −30 mV. Means ± SE are shown; n = 7, except for 4 in WO. e: Quasi-steady-state inactivation data were plotted. *P < 0.05; **P < 0.01; ****P < 0.0001, compared with control. #P < 0.05; ##P < 0.01; ####P < 0.00001, compared with 100 µM EPI. Curves show fitting with the Boltzmann's equation of inactivation with parameters shown in Table 5. C: window current (I_WD). a–d: Typical traces obtained a step-like increase of 20-s depolarization step from −80 mV to 20 mV. a: Control; b: 10 µM EPI; c: 100 µM EPI; d: WO; e: 0.5 mM Cd²⁺. Current traces were low-pass filtered at 200 Hz. f: I_WD-V relationship. I_WD values represent the time-averaged current density in each step. Means ± SE are shown; n = 7 for control and 100 µM EPI and 5 for 10 µM EPI and WO. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001, compared with control. #P < 0.05; ###P < 0.001, compared with 100 µM EPI.

Table 4.

Effect of epiandrosterone on parameters of the I-V relationship

Current	n	Gmax, pS/pF
ICa,L,peak
Control	6	137 (11)
10 µM EPI	6	123 (11)*
100 µM EPI	6	99 (7)****,####
Washout	6	134 (8)
ICa,L,500
Control	6	55 (5)
10 µM EPI	6	42 (4)****
100 µM EPI	6	27 (2)****,####
Washout	6	43 (3)****

Values are means (SD); n, number of experiments. G_max, maximal conductance; EPI, epiandrosterone; I-V, current-voltage; I_Ca,L,peak, peak L-type Ca²⁺ channel current; I_Ca,L,500, terminal L-type Ca²⁺ channel current. Statistical comparison of the parameters was performed using one-way ANOVA, followed by Turkey’s multiple comparison test.

^*P < 0.05,

^****P < 0.0001, compared with control;

^####P < 0.0001, compared with WO.

Overexpression of G6PD₅₄₅ Increased KCl-Induced BCA Contraction

Smooth muscle contraction is mediated by Ca²⁺ influx through L-type Ca²⁺ channels. Our findings that G6PD-Ca_v1.2 interaction increased L-type Ca²⁺ channel conductance raised the possibility that the level of G6PD protein/activity might influence smooth muscle contractions. To determine the effects of the G6PD on vascular contraction, we overexpressed adenoviral vector alone with a GFP tag (Ad-GFP-Ctrl) and adeno-GFP-tagged G6PD₅₄₅ (Ad-G6PD₅₄₅-GFP) and G6PD₅₁₅ (Ad-G6PD₅₁₅-GFP) in BCA, and we performed Western blot analyses and measured the activity of Ad-G6PD₅₄₅-GFP and Ad-G6PD₅₁₅-GFP, respectively (Fig. 6, A and B and Supplemental Fig. S3). Overexpression of Ad-G6PD₅₄₅-GFP, but not Ad-G6PD₅₁₅-GFP, significantly increased the KCl-induced contraction of BCA as compared with control (Fig. 6C).

Fig. 6.

Overexpression of Ad-G6PD₅₄₅-green fluorescent protein (GFP) increased KCl-induced bovine coronary artery (BCA) contraction. A and B: BCAs were transfected with adenoviral vector (Ad) alone (Ad-Ctrl-GFP; n = 6); Ad-G6PD₅₄₅-GFP (n = 8); and Ad-G6PD₅₁₅-GFP (n = 5). Glucose-6-phosphate dehydrogenase (G6PD) expression was determined by Western blot analyses using anti-GFP antibody and its activity was measured in the BCA homogenates. GAPDH was used as loading control. Unt, untransfected. C: the graph summarizes the peak contractions evoked by 2 concentrations of KCl (30 mmol/L, 30 K and 120 mmol/L, 120 K) in BCAs overexpressing empty Ad-Ctrl-GFP (n = 9 in 30 KCl and 120 KCl each), Ad-G6PD₅₄₅-GFP (n = 5 in 30 KCl and 6 in 120 KCl), and Ad-G6PD₅₁₅-GFP (n = 5 in 30 KCl and 120 KCl each), respectively. *P < 0.05 vs. Ad-Ctrl-GFP.

Overexpression of G6PD₅₁₅ Decreased Hydrogen peroxide Levels in HEK293–17T cells and BCA

G6PD is considered as a significant anti-oxidant that reduces hydrogen peroxide within cells. Hence, we investigated the effects of Ad-G6PD₅₄₅-GFP and Ad-G6PD₅₁₅-GFP overexpression on the levels of hydrogen peroxide, in BCA. Ad-G6PD₅₁₅-GFP, but not Ad-G6PD₅₄₅-GFP, decreased hydrogen peroxide (Table 6), suggesting that the cytosolic G6PD₅₁₅ appears to control hydrogen peroxide levels in the cell.

Table 6.

Effect of G6PD₅₄₅ and G6PD₅₁₅ overexpression on hydrogen peroxide levels

	n	HEK293-17T, AU/mg protein	BCA, AU/mg protein
Wild type	4	683 ± 283	66 ± 9
G6PD545	7	905 ± 281	96 ± 14
G6PD515	3	164 ± 153*,#	37 ± 5*,#

Values are means (SD); n, number of experiments. BCA, bovine coronary artery; G6PD, glucose-6-phosphate dehydrogenase; AU, arbitrary units. Statistical comparison of the parameters was performed using one-way ANOVA, followed by Turkey’s multiple comparison test.

^*P < 0.05, compared with wild type;

^#P < 0.05, compared with G6PD₅₄₅.

Inhibition of G6PD Activity Decreased KCl-induced BCA Contraction

To investigate the effect of EPI-induced inhibition of G6PD activity on contraction, we applied EPI, to BCA precontracted with KCl (30 mM). We found decreased (P < 0.05) G6PD activity in the microsome (Fig. 7A,i) and a dose-dependent relaxation (P < 0.05) of BCAs, precontracted with KCl (Fig. 7A,ii). To emulate this observation in an endogenously G6PD-deficient animal model, G6PD^Def mice that harbor a polymorphism within the 5′-UTR of G6pd gene were used. Previous studies showed that G6PD^Def mice develop less angiotensin-II-mediated hypertension (36). In the present study, G6PD^Def mice expressed less G6PD protein than wild-type mice (Fig. 7B,i and Supplemental Fig. S4), and coronary arteries from G6PD^Def mice generated less KCl-elicited force than wild-type mice (Fig. 7B,ii). Intriguingly, EPI elicited less relaxation of coronary arteries, precontracted with KCl (30 mM), from G6PD^Def mice [EPI (30 μM): −4 ± 13% and EPI (100 μM): −40 ± 32%] compared with wild-type [EPI (30 μM): −79 ± 10% and EPI (100 μM): −96 ± 1%].

Fig. 7.

Glucose-6-phosphate dehydrogenase (G6PD) inhibition and deficiency decreased KCl-induced bovine coronary artery (BCA) contraction. A: the graphs represent G6PD activity (A,i) and relaxation (A,ii) of BCAs precontracted with KCl (30 mM) and treated with epiandrosterone (EPI) in a dose-dependent manner (n=10 experiments in each group). B,i: Western blot analyses were performed to demonstrate the expression of G6PD in the vascular tissue of G6PD-deficient (G6PD^Def) mice using polyclonal anti-G6PD antibody (B,i; top). β-Actin (ACTB) was used as a loading control (B,i; bottom). B,ii: force generation to KCl (30 mmol/L; n = 5 experiments in each group) by the coronary artery of G6PD^Def mice was measured as compared to wild-type (WT) mice.

Inhibition of G6PD Activity Decreased Blood Pressure in Metabolic Syndrome Rats

To determine whether increased G6PD expression and activity contributes to increased vascular contraction and elevated blood pressure observed in diseases, such as obesity and obesity-induced diabetes or metabolic syndrome, we measured the expression (Fig. 8A,i) and activity (Fig. 8A,ii) of G6PD in human internal mammary arteries (HIMA) from obese diabetics (metabolic syndrome) and obese patients without diabetes, who had undergone coronary artery bypass graft surgery. The expression of G6PD₅₄₅ was augmented by 1.62 ± 0.18-fold and activity of G6PD was >2-fold higher (P < 0.05) in HIMAs from obese-diabetics than obese individuals without diabetes (Fig. 8A,ii). Correspondingly, HIMA from obese-diabetics produced (∼50%) more force than obese patients without diabetes (Fig. 8A,iii). Similarly, in the aorta of metabolic syndrome rats, G6PD activity was more than twofold higher (P < 0.05) compared with control rats (Fig. 8B,i). Furthermore, to investigate the possibility of whether increased G6PD, observed in arteries of metabolic syndrome rats, contributed to increased blood pressure, these rats were treated with EPI (30 mg·kg⁻¹·day⁻¹ sc, since EPI disrupted the G6PD-Ca_v1.2 interaction and relaxed precontracted arteries) for 28 days. Hemodynamic measurements revealed that EPI treatment significantly decreased the mean arterial pressure (MAP; Fig. 8B,ii) and total peripheral resistance (TPR; Fig. 8B,iii) in these rats, suggesting a correlation between elevated levels of G6PD and vasoconstriction.

Fig. 8.

Increased glucose-6-phosphate dehydrogenase (G6PD) expression and activity in arteries from metabolic syndrome patients and rats contributes to increasing blood pressure. A: homogenates from internal mammary arteries of obese patients with (Obese + T2D) and without (Obese − T2D) type 2 diabetes were subjected to Western blot analysis using polyclonal anti-G6PD antibody (A,i, top). β-Actin (ACTB) was used as a loading control (A,i, Bottom). Total G6PD activity (A,ii; n = 3 represents 2 individual patient samples combined out of total 6 individual patient samples in each group) and force generation by different concentrations of Ca²⁺ (A,iii; n = 6 represents 6 individual patient samples) was measured in the arteries from obese patients with and without T2D. B: metabolic syndrome rats (JCR) were treated with epiandrosterone (EPI; 30 mg·kg⁻¹·day⁻¹ sc) and the total G6PD activity [B,i; n = 5 in Sprague-Dawley (SD) and JCR + EPI group and 4 in JCR group], mean arterial pressure (MAP; B,ii; n = 5 in SD; 11 in JCR; and 6 JCR + EPI), and total peripheral resistance (TPR; B,iii; n = 5 in SD; 11 in JCR; and 6 JCR + EPI) was measured in these rats after 28 days.

DISCUSSION

The role of G6PD in regulating glucose metabolism has been well studied in plants, insects, and various mammalian tissues. However, expression of G6PD isozymes in VSMCs or any other excitable mammalian cells has not been identified and studied previously. In the present study, we have demonstrated that the two G6PD isozymes (slow and fast migrating) are expressed in HCASMCs, BCASMCs, HIMA, and BCA. We found that the slow moving G6PD isoform, harboring 545 amino acids (G6PD₅₄₅), was encoded by a 1,638 bp mRNA, consistent with the previous findings (30). Ectopic overexpression of human G6PD₅₄₅ and G6PD₅₁₅ (fast migrating isoform, harboring 515 amino acids), in HEK293-17T cells, demonstrated that both isozymes were enzymatically active, and that G6PD₅₄₅ exhibited higher V_max than G6PD₅₁₅. Identification of two G6PD isozymes raised the possibility that they are differentially localized and have distinct functions within VSMCs. Cell fractionation studies demonstrated that active G6PD₅₄₅ was localized within caveolae fraction, whereas active G6PD₅₁₅ was localized only in the cytosol of BCA. Consistently, Bublitz and Steavenson found two sets of enzymes catalyzing reactions of the PPP, one set in the microsomes (particulate fraction) and another one in cytoplasm from various rat organs (5). Taken together with these studies, our findings imply that compartmentalization or subcellular localization of active G6PD isozymes in VSMCs plays a crucial role in regulating key signaling processes that control different cellular functions.

Proteomic analyses of G6PD immunocomplexes, coimmunoprecipitation assays, and PLA demonstrated that G6PD formed a complex with the ion channel cluster, including α subunit (Ca_v1.2), the pore-forming subunit of the L-type Ca²⁺ channel (7), in BCASMCs and BCA. FRET analyses indicated that the C-G6PD₅₄₅-RFP and Cav_1.2-GFP fusion proteins directly associated with one another, potentially without involvement of a bridging protein. These findings suggested that localization of G6PD₅₄₅ in the caveolae fraction, which is a signal trafficking hub, may play a crucial role in modulating the Ca²⁺ signal transduction within VSMCs. Consistently, coexpression of human Ca_v1.2-GFP and C- or N-G6PD₅₄₅-RFP increased G_max in HEK293-T17 cells compared with the expression of Ca_v1.2-GFP alone. The fact that C-G6PD₅₄₅-RFP increased G_max compared with the expression of Ca_v1.2-GFP alone and coexpression of Ca_v1.2-GFP and N-G6PD₅₄₅-RFP suggests that the site of protein-protein interaction is potentially important to determine the conductance of Ca_v1.2. The small inhibition of I_Ca,L,peak by N-G6PD₅₄₅-RFP in the presence of a significant increase of G_max may be explained by the shift of V_0.5 of activation to the right. L-type Ca²⁺ channels are the main gateway for Ca²⁺ entry into VSMCs. Along with other Ca²⁺ channels and Ca²⁺ stores, they function to increase intracellular Ca²⁺, which is a crucial regulator of vascular smooth muscle contraction and essential in controlling cellular function, including mitochondrial metabolism (7, 10). Therefore, our findings that G6PD₅₄₅ interacts with Ca_v1.2 and, at least partly, regulates L-type Ca²⁺ channel function could have a potential impact on vascular function in physiological and pathophysiological states.

EPI is a lipophilic steroid like cholesterol, which intercalates in the membrane and has been previously shown to inhibit I_Ca,L (41). We found that EPI disrupted the interaction between G6PD and Ca_v1.2 in BCA and decreased I_Ca,L as well as I_WD in BCASMCs, by augmenting voltage-dependent inactivation. Taken together, the data presented in this study, provides compelling evidence that augmentation of the voltage-dependent inhibition and thereby markedly decrease I_Ca,L and I_WD elicited by EPI, is due to a novel mechanism involving the disruption of the G6PD-Ca_v1.2 complex. Furthermore, since the coexpression of C-G6PD₅₄₅ and Ca_v1.2 produced higher c₁, the voltage- and time-independent sustained component of availability of I_Ca,L that potentially underlies I_WD, the binding of G6PD to the COOH-terminal of Ca_v1.2, as evident by FRET signals, is crucial for the maintenance of c₁. We propose that G6PD prevents intrinsic voltage-dependent inactivation process by binding to the COOH-terminal of Ca_v1.2 protein, and EPI-induced the inactivation of I_Ca,L, decreased I_WD by displacing G6PD from the binding site. G6PD binding to the C-terminal of Ca_v1.2 produced sustained increase of influx of Ca²⁺ and intracellular Ca²⁺ in BCASMCs, potentially mediating KCl-induced contraction of BCA. As EPI and other steroid hormone levels decline after the third decade of life (34), the propensity of cardiovascular diseases increases in men and women (45). It is therefore reasonable to propose that reduced steroid levels facilitate G6PD-Ca_v1.2 interaction, which may have paramount ramifications in the deterioration of cardiovascular health.

Ectopic overexpression of G6PD₅₄₅ in BCA revealed the involvement of G6PD in augmenting KCl-induced smooth muscle contraction. Consistently, it has been reported that slow migrating G6PD is upregulated within the atherosclerotic plaques in African women (44), suggesting that increased levels of G6PD play a potential role in the pathogenesis of vascular diseases in humans. In contrast, G6PD deficiency decreased the contraction of mice arteries evoked by KCl. It has been observed that individuals who harbor a nonsynonymous single nucleotide polymorphism in the G6PD gene (e.g., the Mediterranean-type mutation) are less likely to develop vascular disease (18). Moreover, G6PD^Def mice are less susceptible to angiotensin II-induced hypertension (36), and progeny from crossbreeding ApoE^−/− and G6PD^Def mice show less arteriosclerosis (37). Furthermore, G6PD inhibition relaxes arteries (19), reduces hypoxic pulmonary vasoconstriction and hypertension (4, 6, 16, 21, 42), and decreases proinflammatory cytokine levels (35), which promotes inflammation of blood vessels in hypertension (9, 24, 25). In this study, we found that G6PD activity was upregulated in the arteries of obese-diabetics compared with obese individuals without diabetes and metabolic syndrome rats and EPI (a G6PD inhibitor that disrupted G6PD-Ca_v1.2 complex to decrease I_Ca,L) decreased elevated blood pressure in metabolic syndrome rats (Fig. 8). These observations suggest that downregulation of G6PD activity could be beneficial in alleviating hypertension and other vasculopathy in humans, potentially by decreasing Ca²⁺ channel function, among other yet unidentified mechanisms.

Overexpression of human G6PD₅₁₅ (a fast migrating protein), but not G6PD₅₄₅ (a slow migrating protein), in BCA reduced hydrogen peroxide (Table 6), suggesting that cytosolic G6PD₅₁₅-derived NADPH supports glutathione reductase system and other enzymes to remove intracellular hydrogen peroxide (49). Furthermore, our results are consistent with transgenic mice overexpressing human G6PD protein (migrating around 50–55 kDa) that show decreased lipid peroxidation, which is elicited by hydrogen peroxide and hydroxyl radicals, in the liver and brain (40). Therefore, we propose that the fast migrating cytosolic G6PD₅₁₅ is involved in regulating the levels of NADPH cofactor for enzymes like reductases (49) that are crucial for healthy heart and blood vessels.

In conclusion, we have shown that VSMCs expresses two G6PD isoforms in different subcellular locations. This is the first report to demonstrate that a novel slow migrating isoform of G6PD (G6PD₅₄₅) interacted with Ca_v1.2 in caveolae to downregulate intrinsic voltage-dependent inactivation of the channel to sustain large VSMC Ca²⁺ influx through L-type Ca²⁺ channels. EPI-induced disruption of the G6PD-Ca_v1.2 interaction shifted Ca_v1.2 to an intrinsically inactivated state, which reduced I_Ca,L, and attenuated blood pressure in metabolic syndrome rats. Consequently, we propose that the two G6PD isoforms (caveolae and cytosolic) in VSMC play a distinct but pivotal signaling role in regulating vascular function. Increased expression of G6PD in the caveolae of vasculature activates maladaptive L-type Ca²⁺ channel-dependent cell signaling and contributes to the pathogenesis of hypertension and potentially to other forms of vascular diseases associated with obesity and diabetes.

Limitations

Although EPI-elicited relaxation of coronary artery depends on G6PD, this 17-ketosteroid may have other nonspecific action in the cell that potentially could contribute to decrease blood pressure in JCR rat. Therefore, these results should be cautiously interpreted before more studies confirm these findings with different G6PD inhibitors or genetic approaches.

GRANTS

This study was supported by National Heart, Lung, and Blood Institute Grants R01-HL-085352 and R0-1HL-132574 (to S.A.G).

DISCLAIMERS

The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

R.G., R.O., and S.A.G. conceived and designed research; R.G., V.D., R.O., and S.A.G. performed experiments; R.G., V.D., R.O., and S.A.G. analyzed data; R.G., R.O., and S.A.G. interpreted results of experiments; R.G., V.D., R.O., and S.A.G. prepared figures; R.G., R.O., and S.A.G. drafted manuscript; R.G., V.D., P.R., R.O., and S.A.G. edited and revised manuscript; R.G., V.D., P.R., R.O., and S.A.G. approved final version of manuscript.