Abstract
Background:
Salmonella enteritidis causes infections in humans and animals. Antibiotics are used to eliminate bacterial infections, which become resistant to antibiotics after a while. This study aimed to isolate S. enteritidis from cattle feces samples and also to evaluate the frequency of genes associated with multi-drug resistance (MDR).
Methods:
One hundred ten fecal samples of cattle were collected from Jul to Dec, 2017 in Khuzestan Province, southern Iran. Bacterial culture and molecular methods were used to isolate and identify S. enteritidis. Disk diffusion method was used to assess antibiotic susceptibility. Then Polymerase chain reaction (PCR), assay was used for definitive diagnosis of S. enteritidis and resistance genes.
Results:
Overall, 101 (91.81%) samples were detected to be contaminated with Salmonella genus and 86 samples (85.14%) were identified as S. enteritidis. The highest and lowest antibiotic resistance were belonged to gentamicin (n=70, 81.39%), and tetracycline (n=6, 6.97%). Besides, 64 samples (74.42%) had 2–10 drugs resistance patterns. Moreover, the highest and the least resistance were related to blaIMP-1 (n=73, 84.88%) and tet(B) (n=49, 56.97%) genes respectively.
Conclusion:
The drug-induced genes in S. enteritidis have a high frequency. Therefore, antibiotic resistance and high MDR to antibiotics can be due to the incorrect use of antibiotics and the lack of health monitoring in Cattle farms.
Keywords: Salmonella enteritidis, Resistance gene, Multi-drug resistance, Cattle
Introduction
Salmonella is one of the most important members of the Enterobacteriaceae family. This bacterium is a facultative intercellular, gram-negative, rod-shaped, bacilli-shaped, spore-free, aerobic and anaerobic pathogen (1). Most of the pathogenic Salmonella species that cause human disease belong to the S. enterica species, which live on the host gastrointestinal tract. S. enteritidis (S. enteritidis) is among the most important disease-causing serotypes. So far, more than 2,500 Salmonella serovars have been identified based on flagellar and somatic antigens, most of which are pathogenic to humans and animals (2,3).
Salmonella in humans causes diseases such as salmonellosis, intestinal or typhoid fever, septicemia and gastroenteritis. In this regard, S. enteritidis plays a significant role in the development of these infections (4,5). Diseases transmitted through food are the most important health issues. Salmonella is often found in food, meat and dairy products, related to the livestock industry (6,7).
The use of antibiotics for humans and animals causes major health problems, including the presence of antibiotic residues in body tissues and livestock products and the resistance of pathogens to antibiotics, leading to the selection of pathogenic bacteria resistant to multiple drugs (4,8). Multi-drug resistance (MDR) in bacteria is caused by various mechanisms, including reactive changes of the target protein and the enzymatic inactivation of the drug. Enzymatic inactivation is a common resistance mechanism for natural antibiotics such as aminoglycosides and β-lactams (9–11).
Due to increasing rate of MDR bacterium, the purpose of this study was to use PCR as a precise method for detecting S. enteritidis and also to determine the frequency of resistance genes of this bacterium in cattle samples in Iran.
Materials and Methods
Sampling
The present study was conducted from Jul to Dec 2017 in Khuzestan Province, southern Iran. Overall, 110 cattle feces samples were collected randomly and used for detection of Salmonella.
Isolation and Culture of Salmonella
The feces samples were transferred to concentrated peptone water and incubated at 37 °C for 24 h. Then, the samples were transferred to Rappaport Vassiliadis (RV) and incubated again at 43 °C for 24 h. The isolated bacteria were cultured on Salmonella Shigella Agar (SSA). Black and gray colonies were considered as suspected Salmonella. Complementary assays and differential microbial tests (i.e., IMViC and urease) and culturing on Triple Sugar Iron Agar (TSI) according to Bergey’s manual were used to detect Salmonella strain. The lysine decarboxylation was performed on isolated bacteria by culturing in lysine decarboxylase broth to identify the Salmonella family. Sulfide Indole Motility medium (SIM) was used for direct detection of Salmonella spp. by sulfide production, indole formation, and motility.
Gene Amplification
Genomic DNA was extracted using QIAamp mini kit (Qiagen, GmbH, Germany). PCR method using specific oligonucleotide primers for 16S rRNA gene was performed for the direct detection of Salmonella family. In the next step, Salmonella-encoded fimbria (sefA) gene was targeted for specific detection of S. enteritidis from other Salmonella strains. The primer sequences used in the present study are shown in Table 1. PCR reactions were performed in a total volume of 25 μL in 0.2 ml tubes containing 2 μL of template DNA, 1 μM of each primer, 2 mM MgCl2, 5 μL of 10X PCR buffer AMS, 200 μM dNTPs, and 1 unit of Taq DNA polymerase (CinnaClon Co, Iran). The PCR assay was performed at 95 °C for 5 min and then for 32 cycles of 94 °C for 1 min, annealing temp according to Table 1 for 40 sec, 72 °C for 40 sec, and a final extension at 72 °C for 5 min, with a final hold at 10 °C in a thermal cycler (Mastercycler gradient, Eppendorf, Germany). The PCR amplified products were detected in 2% EtBr stained agarose gel electrophoresis.
Table 1:
Primer sequence of resistance genes and related information in S. enteritidis
| Resistance Genes | Nucleotide sequence (5′ to 3′) | Annealing Temperature | Size (bp) | Reference |
|---|---|---|---|---|
| aadA1 | F:CTCCGCAGTGGATGGCGG | 65 | 311 | 3 |
| R:GATCTGCGCGCGAGGCCA | ||||
| aadA2 | F:CATTGAGCGCCATCTGGAAT | 65 | 432 | 3 |
| R:ACATTTCGCTCATCGCCGGC | ||||
| aadB | F:CTAGCTGCGGCAGATGAGC | 62 | 219 | 3 |
| R:CTCAGCCGCCTCTGGGCA | ||||
| aadD | F:TATATCCGTGTCGTTCTGTCCA | 55 | 419 | 12 |
| R:CTCTATTTTGCCGATTTATGATTC | ||||
| strA | F:TGGCAGGAGGAACAGGAGG | 62 | 608 | 3 |
| R:AGGTCGATCAGACCCGTGC | ||||
| strB | F:GCGGACACCTTTTCCAGCCT | 65 | 256 | 3 |
| R:TCCGCCATCTGTGCAATGCG | ||||
| blaTEM-1 | F:CAGCGGTAAGATCCTTGAGA | 55 | 643 | 13 |
| R:ACTCCCCGTCGTGTAGATAA | ||||
| blaCMY-2 | F:TGGCCGTTGCCGTTATCTAC | 55 | 870 | 13 |
| R:CCCGTTTTATGCACCCATGA | ||||
| blaIMP-1 | F:TGAGGCTTACCTAATTGACA | 55 | 324 | 13 |
| R:TCAGGCAACCAAACCACTAC | ||||
| blaCTX-M1 | F:AACCGTCACGCTGTTGTTAG | 55 | 766 | 13 |
| R:TTGAGGCTGGGTGAAGTAAG | ||||
| blaOXA-1 | F:AATGGCACCAGATTCAACTT | 55 | 595 | 13 |
| R:CTTGGCTTTTATGCTTGATG | ||||
| blaPSE-1 | F:TGCTTCGCAACTATGACTAC | 55 | 438 | 13 |
| R:AGCCTGTGTTTGAGCTAGAT | ||||
| sul1 | F:TTTCCTGACCCTGCGCTCTAT | 55 | 793 | 14 |
| R:GTGCGGACGTAGTCAGCGCCA | ||||
| sul2 | F:CCTGTTTCGTCCGACACAGA | 55 | 667 | 14 |
| R:GAAGCGCAGCCGCAATTCAT | ||||
| tet(A) | F:TTGGCATTCTGCATTCACTC | 55 | 494 | 14 |
| R:GTATAGCTTGCCGGAAGTCG | ||||
| tet(B) | F:CAGTGCTGTTGTGTCATTAA | 55 | 571 | 14 |
| R:GCTTGGAATACTGAGTGTAA | ||||
| tet(G) | F:GCTCGGTGGTATCTCTGCTC | 55 | 550 | 14 |
| R:CAAAGCCCCTTGCTTGTTAC | ||||
| cat1 | F:AACCAGACCGTTCAGCTGGAT | 55 | 549 | 14 |
| R:CCTGCCACTCATCGCAGTAC | ||||
| cat2 | F:AACGGCATGAACCTGAA | 55 | 547 | 14 |
| R:ATCCCAATGGCATCGTAAAG | ||||
| floR | F:ATGACCACCACACGCCCCG | 55 | 198 | 14 |
| R:AGACGACTGGCGACTTCTTCG | ||||
| cmlA | F:GGCCTCGCTCTTACGTCATC | 55 | 662 | 14 |
| R:GCGACACCAATACCCACTAGC | ||||
| sefA | F:TGCTATTTTGCCCTGTACACTGC | 58 | 214 | 15 |
| R:TTCGGGGGAGACTATACCTACAG | ||||
| 16s rRNA | F:AACCGACTCACTCTGGCAG | 58 | 214 | 15 |
| R:TAACGCGATAGCGCTTC |
Antimicrobial drug susceptibility tests
The colonies were cultured on Nutrient Agar (Merck, Darmstadt, Germany) at 37 °C for 24 h after detection of positive S. enteritidis samples from other Salmonella strains. Then, the colonies were sub-cultured into Nutrient Broth (Merck, Germany) and incubated at 37 °C in a shaking incubator for 14 h. McFarland 0.5 turbidity standards were used for bacterial turbidity. After standardization, 100 μL of bacterial suspensions were cultured on Mueller-Hinton agar medium (Merck, Darmstadt, Germany). Drug resistance testing was performed using standard Bauer-Kirby disk diffusion method for all samples (positive culture) according to CLSI protocols for determination of antibiotic susceptibility patterns of S. enteritidis isolated from feces specimens and the cultures were incubated at 37 °C for 24 h. The antibiotic disks were used for determination of antibiotic susceptibility patterns of S. enteritidis isolated from feces specimens.
Detection of antibiotic resistance genes
The PCR was performed for identification of resistance genes. The primers were blasted at the NCBI using the experimental GENINFO BLAST Network Service to assess degree of homology between these primers and other reported sequences and at the end were obtained from CinnaClon Co, Iran. The specific oligonucleotide primers for gene amplification of antimicrobial resistance genes in isolated S. enteritidis and the sequences of primers are available in Table 1. The PCR was run in final reaction volumes of 25 μL containing the following reagents: 0.2 ml tubes containing 2 μL of template DNA, 1 μM of each primer, 2 mM MgCl2, 5 μL of 10X PCR buffer AMS, 200 μM dNTPs, and 1 unit of Taq DNA polymerase (CinnaClon Co, Iran). Reactions were initiated at 95 °C for 5 min, followed by 32 cycles of 94 °C for 1 min, annealing temp according to Table 1 for 40 sec, 72 °C for 40 sec and a final extension step at 72 °C for 5 min, with a final hold at 10 °C in a thermal cycler (Mastercycler gradient, Eppendrof, Germany). Detection of PCR products was performed by the method mentioned earlier.
Statistical Analysis
All statistical tests were performed using Graph Pad Prism statistical software, ver. 7.00 (Graph Pad, San Diego, CA, USA). For all tests, P-value <0.05 was considered statistically significant.
Results
Identification of bacteria
Out of 110 samples, 101 (91.81%) samples were positive for Salmonella by detecting 258 bp band of 16S rRNA gene. Furthermore, the numbers of 86 (85.14%) specimen were sefA gene positive (488 bp).
Antibiotic susceptibility
The highest antibiotic resistance was observed to gentamicin (n=70, 81.39%) and the lowest antibiotic resistance was observed in tetracycline (n=6, 6.97%). Moreover, while the lowest antibiotic susceptibility belonged to sulfamethoxazole (n=3, 3.48%) (Fig.1). According to the results, 64 samples had 2–10 drugs resistance patterns (Table 2) in cattle (74.42%).
Fig. 1:
The frequency of antibiotic resistance among the S. enteritidis under the study
Table 2:
The prevalence of MDR in cattle specimens
| NO. of MDR | Antibiotics | NO. of Animal (n=86) | Percent | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | S | GM | AM | C | SMX | TE | AN | P | CRO | IPM | 16 | 18.60 |
| 1 | GM | 6 | 6.98 | |||||||||
| 2 | GM | SMX | 7 | 8.14 | ||||||||
| 3 | GM | SMX | CRO | 5 | 5.81 | |||||||
| 4 | S | GM | SMX | CRO | 3 | 3.49 | ||||||
| 5 | S | GM | SMX | AN | CRO | 1 | 1.16 | |||||
| 6 | S | GM | SMX | AN | CRO | IPM | 33 | 38.37 | ||||
| 7 | S | GM | C | SMX | AN | CRO | IPM | 5 | 5.81 | |||
| 9 | S | GM | AM | C | SMX | AN | P | CRO | IPM | 4 | 4.65 | |
| 10 | S | GM | AM | C | SMX | TE | AN | P | CRO | IPM | 6 | 6.98 |
Resistance genes
In the studied samples, the highest resistance belonged to the blaIMP-1 genes (n=73, 84.88%) and the lowest resistance, on the other hand, was for tet(B) (n=49, 56/97%) gene. Detection of resistance genes in isolated S. enteritidis using PCR technique revealed fragments with specific length sizes in Table 1.
Discussion
The results of present study revealed that 91.81% and 85.14% were detected for Salmonella genus and S. enteritidis respectively. blaIMP-1 (84.88%) and tet(B) (56.97%) genes indicated the highest and the lowest frequency in comparison to other studied genes. However, the highest and lowest antibiotic resistances belonged to gentamicin (81.39%), and tetracycline (6.97%) antibiotics.
In Iran, a high prevalence of S. enteritidis (43%) was reported in comparison with S. typhimurium. In contrast, a low Salmonella (1.6%) prevalence was reported in Italy (16–18). The frequency of amino-glycoside resistance genes of aadA1, aadA2, aadB, strA, and strB, of 245 samples were investigated, 62 samples belonged to the S. enteritidis serotype and the frequency of genes was 45.6%, 34.7%, 31.1%, 37.6%, and 22.4%, respectively (3). By comparing the frequency of genes with the present study, the frequencies are consistent. In Egypt, a study was conducted on 1600 samples to evaluate the multi-drug resistance. The β-lactamases encoding genes were identified in 75.4% of isolates. The frequency of blaTEM-1 gene (41.5%) was relatively high. The highest resistance belonged to ampicillin (95.7%), kanamycin (93.6%), spectinomycin (93.6%), streptomycin (91.5%) and sulfamethoxazole (91.5%) (19). In comparison, in the present study, the highest resistance belonged to gentamicin (81.39%). The frequency of aminoglycoside, tetracycline, sulfonamide, and chloramphenicol genes was investigated and showed the frequency of sul1 (76.6%), cat1 (43.3%), tetA (40%) and aadA1 (36.7%) genes (14). Randall et al. conducted some studies on most resistance genes on 397 specimens by culture and molecular methods. They identified resistance to ampicillin (91 isolates), chloramphenicol (85 isolates), gentamicin (2 isolates), streptomycin (119 isolates), tetracycline (108 isolates) and 219 susceptible specimens to all antibiotics (20). In our study, resistance to ampicillin (10 isolates), chloramphenicol (15 isolates), gentamicin (70 isolates), streptomycin (52 isolates) and tetracycline (6 isolates) were identified and 58 isolates were found sensitive to penicillin. Finally, by comparing the two studies, there was a significant relation between the presence of resistance genes and related resistance phenotypes (P<0.001).
The phenomenon of antimicrobial resistance has been an urgent global problem since the 1990s (21). The excessive and incorrect use of antimicrobial agents and lack of appropriate infection control are the main possible reasons for this alarming phenomenon and development of MDR in bacteria (22).
In a study, the rate of 52% MDR was shown for Cattle (23). Firoozeh et al. in an Iranian study investigated the prevalence of S. enteritidis and the MDR. They identified 77.7% prevalence of S. enteritidis, 81% drug resistance, and 69% two or more resistances. The highest resistance phenotypes were streptomycin (58.3%), ampicillin (21.4%), sulfamethoxazole (17.85%), kanamycin (14.28%) and chloramphenicol (14.2%) (24). However, in present study, the highest resistance phenotypes were streptomycin, gentamicin, sulfamethoxazole, amikacin, chloramphenicol and imipenem antibiotics. Due to the presence of streptomycin and sulfamethoxazole antibiotics and the creation of resistance phenotypes in both studies, care should be taken in their use.
Conclusion
The comparison of the results of present study with others suggests that both the prevalence and the antimicrobial resistance pattern for Salmonella is different based on geographical zones. This study determined the widely spread prevalence of S. enteritidis and MDR in cattle from Khuzestan Province. Efforts that include further implementation of hazard analysis of critical control in livestock production are needed to reduce the incidence of Salmonella.
Ethical considerations
Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.
Acknowledgements
We would like to thank from the “Clinical Research Development Center of Baqiyatallah hospital” for their kindly cooperation.
Footnotes
Funding
Financial support for the study and its publication were provided by the Clinical Research Development Center of Baqiyatallah Hospital, Tehran, Iran (2017).
Conflict of interest
The authors declare that there is no conflicts of interest.
References
- 1.Ranjbar R, Mortazavi SM, Mehrabi Tavana A, et al. (2017). Simultaneous Molecular Detection of Salmonella enterica Serovars Typhi, Enteritidis, Infantis, and Typhimurium. Iran J Public Health, 46(1):103–111. [PMC free article] [PubMed] [Google Scholar]
- 2.Ranjbar R, Naghoni A, Afshar D, et al. (2016). Rapid Molecular Approach for Simultaneous Detection of Salmonella spp., Shigella spp., and Vibrio cholera. Osong Public Health Res Perspect, 7(6):373–377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Doosti A, Mahmoudi E, Jami MS, et al. (2016). Prevalence of aadA1, aadA2, aadB, strA and strB genes and their associations with multi-drug resistance phenotype in Salmonella Typhimurium isolated from poultry carcasses. Thai J Vet Med, 46 (4):691–697. [Google Scholar]
- 4.Crum Cianflone N F. (2008). Salmonellosis and the GI Tract: More than Just Peanut Butter. Curr Gastroenterol Rep, 10(4):424–431. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bula-Rudas FJ, Rathore MH, Maraqa NF. (2015). Salmonella Infections in Childhood. Adv Pediatr, 62(1):29–58. [DOI] [PubMed] [Google Scholar]
- 6.Naghoni A, Ranjbar R, Tabaraie B, et al. (2010). High prevalence of integron-mediated resistance in clinical isolates of Salmonella enterica. Jpn J Infect Dis, 63(6):417–421. [PubMed] [Google Scholar]
- 7.Eng SK, Pusparajah P, Mutalib NSA, et al. (2015). Salmonella: A review on pathogenesis, epidemiology and antibiotic resistance. Frontiers in Life Science, 8(3):284–293. [Google Scholar]
- 8.Chen HM, Wang Y, Su LH, et al. (2013). Nontyphoid Salmonella infection: microbiology, clinical features, and antimicrobial therapy. Pediatr Neonatol, 54(3):147–152. [DOI] [PubMed] [Google Scholar]
- 9.Alekshun MN, Levy SB. (2007). Molecular mechanisms of antibacterial multidrug resistance. Cell, 128(6):1037–1050. [DOI] [PubMed] [Google Scholar]
- 10.Ranjbar R, Giammanco GM, Aleo A, et al. (2010). Characterization of the first extended-spectrum beta-lactamase-producing nontyphoidal Salmonella strains isolated in Tehran, Iran. Foodborne Pathog Dis, 7(1):91–95. [DOI] [PubMed] [Google Scholar]
- 11.Ranjbar R, Naghoni A, Yousefi S, et al. (2013). The Study of Genetic Relationship Among Third Generation Cephalosporin-resistant Salmonella enterica Strains by ERIC-PCR. Open Microbiol J, 7:142–145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ma M, Wang H, Yu Y, et al. (2007). Detection of antimicrobial resistance genes of pathogenic Salmonella from swine with DNA microarray. J Vet Diagn Invest, 19(2):161–167. [DOI] [PubMed] [Google Scholar]
- 13.Chen S, Zhao S, White DG, et al. (2004). Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from retail meats. Appl Environ Microbiol, 70(1):1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Adesiji YO, Deekshit VK, Karunasagar I. (2014). Antimicrobial-resistant genes associated with Salmonella spp. isolated from human, poultry, and seafood sources. Food Sci Nutr, 2(4):436–442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Doosti A, Doosti E, Rahimi E, et al. (2017). Frequency of Antimicrobial-Resistant Genes in Salmonella enteritidis Isolated from Traditional and Industrial Iranian White Cheeses. Proc Natl Acad Sci India Sect B Biol Sci, 87(1):73–80. [Google Scholar]
- 16.Afshari A, Baratpour A, Khanzade S, et al. (2018). Salmonella Enteritidis and Salmonella Typhimorium identification in poultry carcasses. Iran J Microbiol, 10(1):45–50. [PMC free article] [PubMed] [Google Scholar]
- 17.Bonardi S, Bruini I, Magnani R, et al. (2017). Low Prevalence of Salmonella Enterica in Cull Dairy Cattle at Slaughter in Northern Italy. Ital J Food Saf, 6(1):6172. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ghaderi R, Moradi Bidhendi S, Khaki P. (2016). Occurrence of multidrug-resistant Salmonella enterica serovar Enteritidis isolates from poultry in Iran. ARI, 71(1):43–49. [Google Scholar]
- 19.Ahmed AM, Shimamoto T, Shimamoto T. (2014). Characterization of integrons and resistance genes in multidrug-resistant Salmonella enterica isolated from meat and dairy products in Egypt. Int J Food Microbiol, 189:39–44. [DOI] [PubMed] [Google Scholar]
- 20.Randall LP, Cooles SW, Osborn MK, et al. (2004). Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J Antimicrob Chemother, 53(2):208–216. [DOI] [PubMed] [Google Scholar]
- 21.Jahandeh N, Ranjbar R, Behzadi P, et al. (2015). Uropathogenic Escherichia coli virulence genes: invaluable approaches for designing DNA microarray probes. Cent European J Urol, 68(4):452–458 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ranjbar R, Haghi-Ashtiani M, Jonaidi Jafari N, et al. (2009). The Prevalence and Antimicrobial Susceptibility of Bacterial Uropathogens Isolated from Pediatric Patients. Iran J Public Health, 38(2):134–138. [Google Scholar]
- 23.Kemal J, Sibhat B, Menkir S, et al. (2015). Antimicrobial resistance patterns of Salmonella in Ethiopia: A review. Afr J Microbiol Res, 9(46):2249–2256. [Google Scholar]
- 24.Firoozeh F, Zahraei-Salehi T, Shahcheraghi F, et al. (2012). Characterization of class I integrons among Salmonella enterica serovar Enteritidis isolated from humans and poultry. FEMS Immunol Med Microbiol, 64(2):237–243. [DOI] [PubMed] [Google Scholar]