Skip to main content
NCBI home page
The Journal of Poultry Science logoLink to The Journal of Poultry Science
. 2017 Apr 25;54(2):111–120. doi: 10.2141/jpsa.0160047

Identification of MC1R SNPs and their Association with Plumage Colors in Asian Duck

Hasina Sultana 1,*, Dong-Won Seo 1,*, Hee-Bok Park 1, Nu-Ri Choi 1, Rashedul Hoque 2, Shamsul Alam Bhuiyan 3, Kang-Nyeong Heo 4, Seung-Hwan Lee 1, Jun-Heon Lee 1,✉
PMCID: PMC7477129  PMID: 32908416

Abstract

The melanocortin 1 receptor (MC1R) gene is a candidate functional gene that controls the pigment production in melanocytes. The aim of this study was to identify polymorphisms and investigate the effect of the MC1R gene on plumage coloration in duck breeds, including Korean native ducks. Initially, 34 individuals from seven duck breeds were sequenced, obtaining 12 polymorphisms. Five single nucleotide polymorphisms (SNPs) in the coding region were non-synonymous, with mutations corresponding to amino acid changes. Among these, four SNPs were genotyped using polymerase chain reaction-restriction fragment length polymorphism method in 264 individuals from same seven duck breeds. Fisher's exact test was conducted to identify possible relationships between the MC1R gene polymorphisms and plumage color variations. Four non-synonymous SNPs, c.52A>G (p.Lys18Glu), and c.376 A>G (p.Ile126Val), c.409G>A (p.Ala137Thr) and c.649C>T (p.Arg217Cys), were associated with the two deduced genotypes (i.e., E/E and e+ /e+) based on plumage color phenotypes. In addition, we reconstructed MC1R gene haplotypes, where the haplotype AAGC showed its highest frequency in Nageswari duck breed, which presents an extended black phenotype. Our results indicate that the identified polymorphisms by this study can be used to explore associations with plumage color variations in Asian duck breeds.

Keywords: extended black, Korean native duck, MC1R, plumage color, SNP

Introduction

Melanin pigmentation, which in most vertebrates is regulated by the melanocyte-stimulating hormone (MSH) (Roulin and Ducrest, 2013), plays a vital role in plumage color variation in avian species (Mundy, 2005). The biological functions of MSH in mammals are regulated by five subtype of melanocortin receptors (Mountjoy et al., 1992; Gantz et al., 1993; Desarnaud et al., 1994, Chhajlani, 1996), including the melanocortin 1 receptor (MC1R).

The MC1R gene encodes a G protein-coupled receptor with seven transmembrane domains in the plasma membrane of melanocytes (Chhajlani and Wikberg, 1992; Mountjoy et al., 1992). The MC1R stimulates the adenylate cyclase via binding α-MSH, raising the intracellular cAMP formation, which increases the eumelanin biosynthesis through protein signaling pathways in the melanocytes. In contrast, the inhibition of cAMP production increases pheomelanin synthesis, due the presence of antagonist Agouti genes during hair development in mice (Hoekstra and Nachman, 2003). Extensive studies of melanism and MC1R variation have revealed mutations in cattle (Klungland et al., 1995), pigs (Kijas et al., 1998), chickens (Takeuchi et al., 1998); pocket mice (Nachman et al., 2003); and birds (Theron et al., 2001). The identification of genetic basis for color variation of MC1R gene has been performed in birds. On the other hand, this gene was also associated with growth and disease resistance (Ducrest et al., 2008; Gangoso et al., 2015). The production of melanin pigment is regulated by non-synonymous substitutions in the seven transmembrane domain regions from MC1R, with a major effect when substitutions occur in the first, second, and third domains (Theron et al., 2001; Mundy, 2005). For example, in bananaquits (p.Glu92Lys), lesser snow geese (p.Val185Met) and arctic skuas (p.Arg233His), a single non-synonymous mutation with different substitutions is associated with melanism (Mundy, 2005).

Over 40 loci are involved in controlling plumage color in chickens (Smyth, 1990), from which the extended black (E) locus is one of the most important ones. In mammals, E locus regulates the relative distribution eumelanin and pheomelanin (Takeuchi et al., 1996) which encoded by MC1R gene in human, mice and dog (Barsh, 2007; Robbins et al., 1993; Jackson, 1997). The ancestor of the domestic chickens, red jungle fowl (Gallus gallus) is homozygous for the e+ allele (Smyth, 1990). The recessive white loci have an epistatic effect on the E locus of MC1R gene and might also be located on other plumage color related genes. Therefore, the identification of the causative mutations of recessive white is difficult in white domestic duck breeds (Lancaster, 1990; Yu et al., 2012). Experimental studies on chickens described that E locus of the MC1R gene, located on chromosome 11, is controlling to the plumage color variants (Kerje et al., 2003). In addition, a substitution c.52 G>A of MC1R gene in domestic duck has been associated with E alleles (Yu et al., 2012).

National Institute of Animal Science (NIAS) in Korea has been collected and reared Korean native ducks (KND) mainly on the basis of plumage color and other phenotypic appearance for conservation purposes. NIAS has expanded the breeding scheme of KND as an indigenous genetic resource and investigation has already been performed on their growth, carcass yield and meat quality traits (Kim et al., 2012; Heo et al., 2013). For example, flavor-related compounds of duck meat indicated that there were no significant results among breeds, while significant between sexes (Lee et al., 2015). A total of seven Asian duck populations (Korean native white and black duck populations, three Bangladeshi native duck varieties (Nageswari, Deshi white and common indigenous duck) and two Chinese breeds, Jinding and Peking duck, were used in this study. In this context, DNA markers for plumage color can be useful for breed differentiation. Previously, we identified single nucleotide polymorphisms (SNPs) in four candidate genes of plumage color (ASIP, MITF, DCT, and MC1R), and examined the genetic variations between Korean native black and commercial duck breeds (Sultana et al., 2015). The aim of this study was to identify polymorphisms in MC1R gene and to investigate their association with extended black (E) allele in Asian duck populations.

Materials and Methods

Animals and DNA Isolation

A total of 264 ducks were sampled, consisting 180 Korean ducks from three varieties, and 84 Bangladeshi ducks from four varieties (Table 1). Blood samples of Bangladesh ducks were preserved on Whatman FTA® cards (Whatman® Inc.), and genomic DNA was extracted using PrimePrep™ Genomic DNA Isolation Tissue Kit (GeNetBio, Korea), following the provided instructions. Moreover, Korean native duck (KND) blood samples were processed to isolate DNA by using PrimePrep™ Genomic DNA Isolation Blood Kit (GeNetBio, Korea). Concentration of isolated DNA was measured using NanoDrop2000 (Thermo Scientific, USA), and then each sample was diluted for adjustment at 25 ng/µl. Finally, isolated DNAs were stored at −20°C. Thirty-four samples (three Korean native black duck, three commercial white duck, eight Korean native white duck, and 20 samples of Bangladeshi duck, five from each variety) were used to verify plumage color polymorphisms.

Table 1. Sample information for the seven Asian duck populations.

Duck breed/Variety No. of sample Sample code Origin of sample Location of sample collection site
White Korean native duck 92 WKND South Korea Yongin, Gyeonggi Province, and Chungnam National University farm, Korea
Black Korean native duck 68 BKND South Korea NIAS and Chungnam National University farm, Korea
Commercial (Peking) duck 20 CD South Korea Cherry Valley, Korea
Common Indigenous duck 13 BaL Bangladesh Sherpur and Mymensingh districts, Bangladesh
Deshi white 20 BaW Bangladesh BLRI, Dhaka, Bangladesh
Jinding 15 BaJ Imported from China CDBF, Narayanganj, Bangladesh
Nageswari (Deshi black) 36 BaB Bangladesh BLRI, Dhaka; CDBF, Narayanganj; Kishoreganj and Mymensingh districts, Bangladesh
Total 264
Open in a new tab

PCR Reaction and DNA Purification

Three pairs of primers were used (Table 2), from which two (P1 and P3) were designed via Primer3 program 0.4.0 (http://frodo.wi.mit.edu/primer3/) based on reference sequence data (GenBank Acc: HQ190952) from National Center for Biotechnology Information (NCBI). A total of 1,174 bp linear DNA sequences were used for designing the primer set (P1) used to scan SNPs, and one primer pair (P2) was used by following Yu et al. (2012) for genotyping. Polymerase chain reaction (PCR) was carried out in 20 µl volume containing approximately 50 ng genomic DNA, 10 µl of HS Premix 10× buffer (GeNet Bio, Korea), and 0.4 µl of 10 pmol of each primer. PCR reactions were performed in My-Genie 96 Thermal Block (Bioneer, Korea) with the following steps: pre-denaturation at 95°C for 10 min, 35 cycles of 30 s at 95°C, 30 s at 63°C annealing temperature, 30 s at 72°C, and a final extension step at 72°C for 10 min. After finishing the PCR reaction, products were confirmed by electrophoresis on 2% agarose gels stained with ethidium bromide (GenetBio, Korea). Each PCR fragment was purified using an AccuPrep® PCR Purification Kit (Bioneer, Korea), following the manufacturer's instruction. Purified PCR products were also confirmed by electrophoresis with agarose gels and sequencing.

Table 2. Primers for PCR amplification and restriction enzyme information for genotyping of the MC1R gene in Asian ducks.

Primer no. Primer sequences (5′ to 3′) Primer size (bp) Location Annealing Temp (°C) Use Restriction enzyme
P1 F: CCATGTCCCCTTGACCTCG
R: CCACTGCAAAGAGCCTTTATTCG		 1221 −141 to +1080 63 Direct sequencing
P2 F: GCTGAGGTCGGGGCCATGT
R: CCGTGGCGTTGCTCTGGTTG		 91 −15 to +76 63 c.52A>G
Genotyping		 MnlI
P3 F: GCTCTTCATGCTGCTGATGG
R: GGCAGGTGACGATGAGGATG		 515 +278 to +793 63 c.376A>G, c.409A>G, c.649C>T, Genotyping Hpy991
BclI
BspMI
Open in a new tab

Sequencing and SNP Genotyping

Initially, 34 samples were selected from seven different duck varieties of Korean and Bangladeshi duck populations for DNA fragment amplification. To identify the polymorphisms, direct sequencing method was applied for sequencing the purified DNA fragments by Cosmogenetech company (www.cosmogenetech.com). PCR-restriction fragment length polymorphism (RFLP) for all of samples was applied for genotyping (Table 2), for which approximately 15 µL of PCR product was digested with two units of each restriction enzyme in 20 µL reaction volumes, based on the recommended protocol (New England Biolabs® Inc., UK). After digestion, RFLP fragments were confirmed by electrophoresis in 3% agarose gels stained with ethidium bromide to identify genotype variations, and DNA fragments were visualized under ultraviolet light (Fig. 1).

Fig. 1.

Fig. 1.

Open in a new tab

Identification of MC1R gene polymorphisms and conformation of PCR-RFLP genotyping among four (A, B, C, and D) coding SNPs in Asian ducks.

Determination of Proposed Genotypes Deduced from Plumage Colors

In this study, we found five pigmentation phenotypes among the seven Asian duck populations, and divided them into three groups on the basis of E locus (Yu et al., 2012). Nageswari (an indigenous black duck variety of Bangladesh) which is locally called “Nagi” because of snake deity head with black bill and bean (Fig. 2). The color of the plumage, shank and web of this duck is black or penciled black and white color extended from neck to the breast. Nageswari is predicted to be homozygous for E allele and compiled as the extended black (E/E) group (Lancaster, 1990). Common indigenous (Bangladeshi duck), Jinding, and Black Korean native ducks are assumed to be wild type and homozygote for e+ allele. These latter three duck breeds are assembled as non-extended black (e+/e+) group (Table 4). Commercial (Peking), white Korean native, and Deshi white ducks are arranged as recessive white (E/e+) group.

Fig. 2.

Fig. 2.

Open in a new tab

Pigmentation phenotypes for the Asian duck populations.

Statistical Analysis

Fisher's exact test was conducted to assess associations between the genotypes deduced from plumage colors and SNP genotypes of the MC1R gene, using SAS 9.3 (SAS Institute, NC), with P-values<0.05 as statistically significant. The haplotype frequencies among four SNPs from the seven duck populations were explored using Haploview software (Barrett et al., 2005).

Results

Identification of Polymorphisms and Genotyping

In this study, we identified a total of 12SNPs of MC1R gene consisting of single exon (945 bp) and flanking regions (5′ and 3′). These variations were detected from exon to downstream. Among the 12SNPs, five were detected in the exon, while seven were detected in the 3′-untranslated region of the gene (Table 3) from the samples of seven duck varieties. In addition, Table 3 showed the amino acid changes for the polymorphisms and their effects on protein types and functions. The amino acid substitution effects on protein function were investigated by PROVEN (http://provean.jcvi.org/seq_submit.php). According to the PROVEN score (Choi et al., 2012), two variants, K18E and I126V, may have neutral effects on protein function, whereas other three variants (A137T, R217C, R217H) have the deleterious effects. All substitutions in the exon region were found non-synonymous, and four A↔G transition substitutions were identified among five exonic SNPs (Fig. 1). Two adjacent SNPs at position c.649C>T c.650G>A were identified from the sequenced samples of duck varieties where the SNP c.649C>T was only considered for genotyping of all samples. Finally, haplotype reconstruction was performed based on the identified four SNPs c.52A>G, c.376A>G c.409A>G and c.649C>T.

Table 3. Identified polymorphisms in MC1R gene from seven duck populations.

Nucleotide position Amino acid change Effect on protein due to amino acid change Effect on protein function due to substitution*
c.52A>G Missense, p.Lys18Glu Basic to acidic 0.753, Neutral
c.376A>G Missense, p.Ile126Val Non-polar to Non-polar −0.074, Neutral
c.409G>A Missense, p. Ala 137Thr Non-polar to Polar (uncharged) −3.935, Deleterious
c.649C>T Missense, p.Arg217Cys Polar (positively charged) to Polar (uncharged) −5.893, Deleterious
c.650G>A Missense, p.Arg217His Polar (positively charged) to Polar (positively charged) −3.047, Deleterious
g.1019C>T Not applicable
g.1020A>G Not applicable
g.1023C>T Not applicable
g.1024A>G Not applicable
g.1028A>G Not applicable
g.1033A>G Not applicable
g.1038A>G Not applicable
Open in a new tab
*

Variants with a score above −2.5 are considered “neutral” and variants with a score equal to or below −2.5 are considered “deleterious” (Choi et al., 2012)

The identified genotype data of the SNPs in different Korean and Bangladeshi duck varieties are presented together with proposed genotypes based on phenotypic classification in Table 4. Birds having AA genotypes for c.52A>G SNP present higher frequencies in extended black group phenotype, while ducks having GG genotypes present the highest frequency within the e+/e+ proposed genotype group. Similar genotypic patterns for E/E and e+/e+ groups were detected in c.376A>G and c.52A>G SNP. On the other hand, the highest GG genotype-frequency among extended black duck phenotype is described in c.409 G>A SNP, and the highest frequency of CC genotype is present in the extended black duck phenotype (in c.649 C>T SNP) (Table 4). All associations between the missense substitutions and the proposed genotype groups were found significant (Fisher's exact test, P<0.001; Table 5).

Table 4. Genotype distribution of the SNPs in MC1R gene in different colored duck breeds.

Breed/Varity No. of bird Proposed genotypes* Phenotype Genotype (Number of bird)
c.52 A>G
AA AG GG
Black Korean native duck (BKND) 68 e+/e+ Wild- type 0 7 61
Commercial(Peking) duck (CD) 20 E/e+ Recessive white 3 5 12
White Korean native duck (WKND) 92 E/e+ Recessive white 1 20 71
Common Indigenous duck (BaL) 13 e+/e+ Wild- type 0 1 12
Jinding (BaJ) 15 e+/e+ Wild- type 0 2 13
Deshi white (BaW) 20 E/e+ Recessive white 0 8 12
Nageswari (BaB) 36 E/ E Extended black 24 11 1
c.376 A>G
AA AG GG
Black Korean native duck (BKND) 68 e+/e+ Wild- type 0 17 51
Commercial(Peking) duck (CD) 20 E/e+ Recessive white 4 6 10
White Korean native duck (WKND) 92 E/e+ Recessive white 3 31 58
Common Indigenous duck (BaL) 13 e+/e+ Wild- type 1 6 6
Jinding (BaJ) 15 e+/e+ Wild- type 0 0 15
Deshi white (BaW) 20 E/e+ Recessive white 3 9 8
Nageswari (BaB) 36 E/ E Extended black 27 9 0
c.409 G>A
AA AG GG
Black Korean native duck (BKND) 68 e+/e+ Wild- type 3 15 50
Commercial(Peking) duck (CD) 20 E/e+ Recessive white 0 1 19
White Korean native duck (WKND) 92 E/e+ Recessive white 2 20 70
Common Indigenous duck (BaL) 13 e+/e+ Wild- type 1 6 6
Jinding (BaJ) 15 e+/e+ Wild- type 12 3 0
Deshi white (BaW) 20 E/e+ Recessive white 0 2 18
Nageswari (BaB) 36 E/ E Extended black 0 3 33
c.649 C>T
CC CT TT
Black Korean native duck (BKND) 68 e+/e+ Wild- type 14 30 24
Commercial(Peking) duck (CD) 20 E/e+ Recessive white 5 10 5
White Korean native duck (WKND) 92 E/e+ Recessive white 24 51 17
Common Indigenous duck (BaL) 13 e+/e+ Wild- type 5 6 2
Jinding (BaJ) 15 e+/e+ Wild- type 14 1 0
Deshi white (BaW) 20 E/e+ Recessive white 4 10 6
Nageswari (BaB) 36 E/ E Extended black 30 5 1
Open in a new tab
*

E/ E- homozygous allele for extended black, e+/e+- homozygous allele for non-extended black

Table 5. Association analysis of the SNPs in MC1R gene between genotype groups.

Groups* c.52A>G
 P-value c.376 A>G
 P-value c.409 G>A
 P-value c.649 C>T
 P-value
AA AG GG AA AG GG AA AG GG CC CT TT
E/ E 24 11   1 <0.001 27   9   0 <0.001   0   3 33 <0.001 30   5   1 <0.001
e+/e+   0 10 86   1 23 72 16 24 56 33 37 26
Open in a new tab
*

E/ E- homozygous allele group for extended black, e+/e+- homozygous allele group for non-extended black

The position of the substitution p.Lys18Glu is in the N-terminus extracellular membrane of the MC1R protein of duck is shown in Fig. 3. No substitutions were found in the second transmembrane domain, and two substitutions (p.Ile126Val and p.Ala137Thr) took place in the third one. The 4th and 5th missense mutations occurred at the same site with different substitutions (p.Arg217Cys and p.Arg217His, respectively) in the third intracellular loop.

Fig. 3.

Fig. 3.

Open in a new tab

Hypothetical structure of the MC1R amino acid variants in birds and domestic animals. Substitutions are shown using single letter amino acid code and solid colors show substitutions linked with melanism. We assessed the five substitutions (A, B, C, D, and E) of MC1R for duck. This figure is based on the references of MC1R diversity in birds (Theron et al., 2001; Kerje et al., 2003; Mundy et al., 2005; Nadeau et al., 2006; Yu et al., 2012; San-José et al., 2015) and in mouse (Majerus & Mundy, 2003).

Haplotype Frequency

The haplotypes and their frequencies of the four missense SNPs from seven Asian duck varieties are described in Table 6, with the detection of 13 haplotypes. Haplotype AAGC showed the highest frequency (75.5%) in Nageswari, and lowest frequencies in commercial (Peking) (27.5%), white Korean native (12%), Deshi white (11%) and black Korean native ducks (5.1%). The haplotype AAGC was absent in Jinding and common indigenous ducks (Bangladesh). Haplotype GGGT presented a high frequency in black Korean native (56.4%), Deshi white (48.4%), commercial (Peking) (46.1%), and in white Korean native ducks (45.5%), and low frequencies in common indigenous ducks (Bangladesh) (5.3 %), Jinding (3.3%), and Nageswari (2.3%). The GGGT and GGGC were the only two haplotypes found in all seven duck breeds. The common indigenous duck (Bangladesh) presented the highest number of haplotypes, and the highest frequency of haplotype GGAC was identified in Jinding ducks (86.5%).

Table 6. Reconstructed haplotypes and their frequencies for the MC1R gene in seven duck breeds*.

Haplotype Haplotype frequencies (%)
BKND WKND CD BaB BaW BaJ BaL
GGGT 56.4 45.5 46.1 2.3 48.4 3.3 5.3
GGGC 15.7 21.3 16.4 6.1 5.1 3.5 39.3
GGAC 15.4 12.4 2.5 4.2 — 86.5 10.3
GAGC 6.4 8.2 3.6 4.6 24.0 — 5.9
AAGC 5.1 12.0 27.5 75.5 11.0 — —
AAGT — — — 6.5 — — —
GAGT — — 3.9 — 2.6 — 18.8
AGAC — — — — 5.0 3.5 —
AGGT — — — — 4.0 — —
AGGC — — — — — 3.2 —
GGAT — — — — — — 14.4
AAAC — — — — — — 3.8
GAAC — — — — — — 2.3
Open in a new tab
*

WKND -White Korean native duck, BKND- Black Korean native duck, CD- Commercial (Peking) duck, BaB- Nageswari (Deshi black), BaW- Deshi white, BaJ- Jinding, BaL- Common Indigenous duck.

Discussion

MC1R gene is associated with extended black feather color (Yu et al., 2012). We observed four non-synonymous substitutions (p.Lys18Glu, p.Ile126Val, p.Thr137Ala, and p.Arg217Cys) in the MC1R gene in Asian ducks (Xia 2008; Huang 2010; Yu et al., 2012), and p.Arg217His substitution was observed exclusively in Bangladeshi duck breeds. Recently, Yu et al. (2012) reported that one non-synonymous substitution (p.Glu18Lys) was highly associated with the extended black variant for plumage color variations in domestic ducks. In Korean native chickens, the c.376G>A SNP causes p.Val126Ile substitution and a high frequency of GG genotype observed in Korean native black chicken, and AA genotype frequency high in White Leghorn (Hoque et al., 2013). In this study, we observed the same substitution, with a high frequency of the AA genotype in Nageswari, extended black duck, and a high frequency of the GG genotype in wild type and recessive white duck breeds (Table 4). The most relevant finding presented in Table 4 is that two non-synonymous SNPs, c.52A>G and c.376 A>G (p. Lys18Glu and p. Ile126Val, respectively), seem to have a major responsibility on the extended black type mutation.

The wild type plumage pattern has minor variations, which are responsible for the distinct features and appearance in some duck breeds (Lancaster, 1990). In this study, the four pigmentation phenotypes of our duck breeds were deduced by classical genetics from MC1R genotyping according to the color and pattern of plumage, and the E locus (Lancaster, 1990). The appearance of mallard pattern or wild type duck fully expresses the homozygous e+ allele, meanwhile the extended black duck breeds (e.g., Black Orpington, Black East Indian) expresses the homozygous E allele (Phillips, 1915; Jaap and Milby, 1944). The presence of extended black (E) locus, which is autosomal and dominant to other non-extended black (e+), affects all areas to express solid black color except white spotting. Therefore, the E locus has the complete epistatic effect to the genes for white spotting at the Li and M loci (Lancaster, 1990). Our results from Table 5 between the two genotypes (i.e., E/E and e+ /e+) were provided the significant association of extended black (E) locus and MC1R in plumage color. Here, we found that the AAGC haplotype was mainly observed in the extended black duck group. On the other hand, haplotypes GGGT and GGGC showed higher frequencies in non-extended black and recessive white ducks (Table 6). The constructed haplotypes of this study could be applied in selection of pure stock from their base population for the development of particular breed/varieties with unique phenotypic features.

Robust evidence from domestic animals and birds suggests that most substitutions occur in the second transmembrane domain and nearby the intracellular and extracellular membrane of the MC1R (Robbins et al., 1993; Ling et al., 2003; Majerus and Mundy, 2003). In this study, one substitution (p. Glu18Lys), located in the extracellular N-terminus of MC1R could increase the eumelanin synthesis via stimulating MC1R activity (Yu et al., 2012), while in rock pocket mice it was demonstrated that a different substitution (p.Arg18Cys) at the same site is associated with reduction of eumelanin (Nachman et al., 2003). Yu et al. (2012) reported that p.Glu18Lys substitution might have a salt bridge connection with the N-terminus extracellular membrane and the MC1R protein function, stimulating the eumelanin production. A mutation c.96G>A generated a premature stop codon (p. W32X) occurs in the extracellular N-terminus in turkeys (Vidal et al., 2010), which is near to the p.Lys18Glu substitution observed in ducks. In domestic chickens, mice, Japanese quails, and bananaquits, the p.Glu92Lys substitution is associated in the second transmembrane domain by the vital activation of MC1R gene (Robbins et al., 1993; Ling et al., 2003; Mundy, 2005; Nadeau et al., 2006). In the same site, another single non-synonymous substitution was found in lesser snow geese (p.Val185Met) and in cow and pig (p.Leu99Pro) (Kijas et al., 1998; Klungland et al., 1995; Majerus and Mundy, 2003). Therefore, it is suggested that, at least in ducks, the two missense SNPs, c.52A>G and c.376 A>G (p.Lys18Glu and p.Ile126Val respectively), may have a major effect on the extended black phenotypes. Additionally, the p.Val126Ile substitution in the third transmembrane domain of MC1R is associated with plumage pigmentation in chicken and duck (Kerje et al., 2003; Guo et al., 2010; Yu et al., 2012; Oh et al., 2014).

In this study, we identified SNPs in the MC1R gene, and their association with extended black genotypes deduced from plumage color phenotypes. Among these, the two alleles, c.52A and c.376A that substitute p.Lys18 and p.Ile126, respectively, may have a relevant effect on enhancing MC1R activity and thus the eumelanin deposition in duck plumage. Variations in the plumage color genes were investigated for possible use in breed identification of different colored Korean native ducks.

Acknowledgments

This work was supported by “Cooperative Research Program for Agriculture Science & Technology Development (Project No. 010114012015),” Rural Development Administration (RDA), Republic of Korea.

References

  1. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics, 21: 263-265. 2005. [DOI] [PubMed] [Google Scholar]
  2. Barsh GS, How the dog got its spots. Nature Genetics, 39: 1304-1306. 2007. [DOI] [PubMed] [Google Scholar]
  3. Chhajlani V, Wikberg JE. Molecular cloning and expression of the human melanocyte stimulating hormone receptor cDNA. FEBS Letters, 309: 417-420. 1992. [DOI] [PubMed] [Google Scholar]
  4. Chhajlani V. Distribution of cDNA for melanocortin receptor subtypes in human tissues. Biochemistry and Molecular Biology International, 38: 73-80. 1996. [PubMed] [Google Scholar]
  5. Choi Y, Sims GE, Murphy S, Miller JR, Chan AP. Predicting the functional effect of amino acid substitutions and indels. PLoS ONE, 7: e46688 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Desarnaud F, Labbe O, Eggerickx D, Vassart G, Parmentier M. Molecular cloning, functional expression and pharmacological characterization of a mouse melanocortin receptor gene. Biochemical Journal, 299: 367-373. 1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ducrest AL, Keller L, Roulin A. Pleiotropy in the melanocortin system, coloration and behavioural syndromes. Trends in Ecology & Evolution, 33: 502-510. 2008. [DOI] [PubMed] [Google Scholar]
  8. Gangoso L, Roulin A, Ducrest AL, Grande JM, Figuerola J. Morph- specific genetics and environmental variation in innate and acquired immune response in a color polymorphic raptor. Oecologia, 174: 1113-1123. 2015. [DOI] [PubMed] [Google Scholar]
  9. Gantz I, Konda Y, Tashiro T, Shimoto Y, Miwa H, Munzert G, Watson SJ, Del Valle J, Yamada T. Molecular cloning of a novel melanocortin receptor. Journal of Biological Chemistry, 268: 8246-8250. 1993. [PubMed] [Google Scholar]
  10. Guo XL, Li XL, Li Y, Gu ZL, Zheng CS, Wei ZH, Wang JS, Zhou RY, Li LH, Zheng HQ. Genetic variation of chicken MC1R gene in different plumage colour populations. British Poultry Science, 5: 734-739. 2010. [DOI] [PubMed] [Google Scholar]
  11. Heo KN, Choo HJ, Kim CD, Kim SH, Kim HK, Lee MJ, Son BR, Choi HC, Hong EC. Changes of fatty acids and amino acids contents of Korean native commercial ducks meats with different raising periods. Korean Journal of Poultry Science, 40: 235-241. 2013. [Google Scholar]
  12. Hoekstra H, Nachman M. Different genes underlie adaptive melanism in different populations of rock pocket mice. Molecular Ecology, 12: 1185-1194. 2003. [DOI] [PubMed] [Google Scholar]
  13. Hoque MR, Jin S, Heo KN, Kang BS, Jo C, Lee JH. Investigation of MC1R single nucleotide polymorphisms and their relationships with plumage colors in Korean native chickens. Asian-Australasian Journal of Animal Science, 26: 625-629. 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Huang H. Study on the molecular markers for plumage color trait in mule duck and their mother duck. Master Thesis, Fujian Agriculture and Forestry University, Fuzhou, China: 2010. [Google Scholar]
  15. Jaap RG, Milby TT. Comparative genetics of blue plumage in poultry. Poultry Science, 23: 3-8. 1944. [Google Scholar]
  16. Jackson IJ. Homologous pigmentation mutations in human, mouse, and other model organisms. Human Molecular Genetics, 6: 1613-1624. 1997. [DOI] [PubMed] [Google Scholar]
  17. Kerje S, Lind J, Schütz K, Jensen P, Andersson L. Melanocortin 1-receptor (MC1R) mutations are associated with plumage colour in chicken. Animal Genetics, 34: 241-248. 2003. [DOI] [PubMed] [Google Scholar]
  18. Kijas JM, Wales R, Tornsten A, Chardon P, Moller M, Andersson L. Melanocortin receptor 1 (Mc1r) mutations and coat color in pigs. Genetics, 150: 1177-1185. 1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim HR, Kwon HJ, Oh ST, Yun JG, Choi YI, Choo YK, Kang BS, Kim HK, Hong EC, Kang CW, An BK. Effect of dietary metabolizable energy and crude protein concentrations on growth performance and carcass characteristics of Korean native ducks. Korean Journal of Poultry Science, 39: 167-175. 2012. [Google Scholar]
  20. Klungland H, Vage DI, Gomez-Raya L, Adalsteinsson S, Lien S. The role of melanocyte-stimulating hormone (MSH) receptor in bovine coat color determination. Mammalian Genome, 6: 636-639. 1995. [DOI] [PubMed] [Google Scholar]
  21. Lancaster FM. Mutations and major variants in domestic ducks. In: Poultry Breeding and Genetics (Crawford RD. ed), pp. 381-388. Elsevier; Amsterdam: 1990. [Google Scholar]
  22. Lee HJ, Kim HJ, Yong HI, Khan MI, Heo KN, Jo C. Assessment of breed and sex-based variation in flavor-related compounds of duck meat in Korea. Korean Journal of Poultry Science, 42: 41-50. 2015. [Google Scholar]
  23. Ling MK, Lagerstrom MC, Fredriksson R, Okimoto R, Mundy NI, Takeuchi S, Schioth HB. Association of feather colour with constitutively active melanocortin 1 receptors in chicken. European Journal of Biochemistry, 270: 1441-1449. 2003. [DOI] [PubMed] [Google Scholar]
  24. Majerus ME, Mundy NI. Mammalian melanism: natural selection in black and white. Trends in Genetics, 19: 585-588. 2003. [DOI] [PubMed] [Google Scholar]
  25. Mountjoy KG, Robbins LS, Mortrud MT, Cone RD. The cloning of a family of genes that encode the melanocortin receptors. Science, 257: 1248-1251. 1992. [DOI] [PubMed] [Google Scholar]
  26. Mundy NI. A window on the genetics of evolution: MC1R and plumage colouration in birds. Proceeding of the Royal Society B: Biological Sciences, 272: 1633-1640. 2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nachman MW, Hoekstra HE, D'Agostino SL. The genetic basis of adaptive melanism in pocket mice. Proceeding of the National Academy of Sciences of the United States of America, 100: 5268-5273. 2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nadeau NJ, Minvielle F, Mundy NI. Association of a Glu92Lys substitution in MC1R with extended brown in Japanese quail (Coturnix japonica). Animal Genetics, 37: 287-289. 2006. [DOI] [PubMed] [Google Scholar]
  29. Oh D, Hyeong K, Lee Y. Vall126ile mutation within third transmenbrane domain of the melanocortin 1 receptor (MC1R) is associated with a pigmentation of plumage color in chicken. Asian Journal of Animal and Veterinary Advances, 9: 321-322. 2014. [Google Scholar]
  30. Phillips JC. Experimental studies of hybridization among pheasants and ducks. Journal of Experimental Zoology, 18: 69-144. 1915. [Google Scholar]
  31. Robbins LS, Nadeau JH, Johnson KR, Kelly MA, Roselli-Rehfuss L, Baack E, Mountjoy KG, Cone RD. Pigmentation phenotypes of variant extension locus alleles result from point mutations that alter MSH receptor function. Cell, 72: 827-34. 1993. [DOI] [PubMed] [Google Scholar]
  32. Roulin A, Ducrest AL. Genetics of colouration in birds. Seminers in Cell and Developmental Biology, 24: 594-608. 2013. [DOI] [PubMed] [Google Scholar]
  33. San-José LM, Ducrest AL, Ducret V, Beziers P, Simon C, Wakamatsu K, Roulin A. Effect of the MC1R gene on sexual dimorphism in melanin-based colorations. Molecular Ecology, 24: 2794-2808. 2015. [DOI] [PubMed] [Google Scholar]
  34. Smyth JR, Jr., Genetics of plumage, skin and eye pigmentation in chickens. In: Poultry Breeding and genetics (ed. R. Crawford). (Crawford RD. ed), pp. 109-167. Elsevier: Amsterdam; 1990. [Google Scholar]
  35. Sultana H, Seo DW, Park HB, Cahyadi M, Jin S, Hoque MR, Kim YS, Heo KN, Jo C, Gotoh T, Lee JH. Identification of polymorphisms in plumage color related genes in Korean native duck. Journal of the Faculty of Agriculture Kyushu University, 60: 119-126. 2015. [Google Scholar]
  36. Takeuchi S, Suzuki H, Hirose S, Yabuuchi M, Sato C, Yamamoto H, Takahashi S. Molecular cloning and sequence analysis of the chick melanocortin 1-receptor gene. Biochimica et Biophysica Acta, 1306: 122-126. 1996. [DOI] [PubMed] [Google Scholar]
  37. Takeuchi S, Suzuki H, Yabuuchi M, Takahashi S. A possible involvement of melanocortin 1-receptor in regulating feather color pigmentation in the chicken. Biochimica et Biophysica Acta, 1308: 164-168. 1998. [DOI] [PubMed] [Google Scholar]
  38. Theron E, Hawkins K, Bermingham E, Ricklefs RE, Mundy NI. The molecular basis of an avian plumage polymorphism in the wild: a melanocortin-1-receptor point mutation is perfectly associated with the melanic plumage morph of the bananaquit, Coereba flaveola. Current Biology, 11: 550-557. 2001. [DOI] [PubMed] [Google Scholar]
  39. Vidal O, Viñas J, Pla C. Variability of the melanocortin 1 receptor (MC1R) gene explains the segregation of the bronze locus in turkey (Meleagris gallopavo). Poultry Science, 89: 1599-1602. 2010. [DOI] [PubMed] [Google Scholar]
  40. Xia B. The relationship between MC1R mutation and plumage colour variation in duck. Master Thesis, Sichuan Agricultural University, Ya'an, China: 2008. [Google Scholar]
  41. Yu W, Cui W, Qingwu X, Shijun L, Yanping F, Xiuli P, Yanzhang G. Non-synonymous SNPs in MC1R gene are associated with the extended black variant in domestic ducks (Anas platyrhynchos). Animal Genetics, 44: 214-216. 2012. [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Poultry Science are provided here courtesy of Japan Poultry Science Association

RESOURCES