Abstract
Chicken egg white ovotransferrin (OTF) has been reported to exist in three electrophoretic variants (OTFA, OTFB and OTFC). In this report, we identified a causal polymorphism between the OTFB and OTFC variants in Japanese and Taiwanese native chickens and compared the antibacterial activity between these two variants. The cDNA sequence analyses from Satsumadori oviducts revealed that three non-synonymous SNPs T1809G (Ser52Ala), A2258G (Ile96Val) and G7823A (Asp500Asn) corresponded to the OTF electrophoretic phenotypes. Of the three SNPs, the G7823A mutation perfectly corresponded to the electrophoretic phenotypes OTFB (G/G, Asp500Asp), OTFB/C (G/A, Asp500Asn) and OTFC (A/A, Asn500Asn) in three chicken populations. The variants OTFB and OTFC exhibited similar antibacterial potency against Gram-positive and Gram-negative bacteria. This study provides, for the first time, molecular information on polymorphism of OTFB and OTFC variants of chicken ovotransferrin and its effect on the antimicrobial activity of the respective variants.
Keywords: antibacterial activity, chicken egg white, electrophoretic variant, ovotransferrin, SNP
Introduction
Transferrin (TF) is an iron-binding glycoprotein mainly present in serum and egg white. Egg white TF is called ovotransferrin (OTF) or conalbumin. OTF is synthesized in the oviduct and secreted into the egg white (Stevens, 1991). OTF constitutes the second major protein (12% of the total proteins) in hen egg white. OTF plays a key role in the antibacterial activity of egg albumen (Valenti et al., 1983; Ibrahim et al., 1998, 2000; Baron et al., 1999) and exerts antiviral activity towards the Marek's disease virus (MDV) (Giansanti et al., 2002, 2005).
In chickens, three OTF variants (OTFA, OTFB and OTFC) have been demonstrated by starch or polyacrylamide gel electrophoresis and are believed to be controlled by three alleles (OTFA, OTFB and OTFC) at a single OTF locus (Baker, 1968; Baker et al., 1970). The OTFB is a major allele and is commonly found in many improved breeds and native chicken populations (Kinoshita et al., 2002). The OTFA and OTFC alleles were observed at very low frequencies in limited improved chicken populations and Asian native populations. In our previous study, the allele frequencies of OTFA, OTFB and OTFC in 27 populations including improved breeds and Asian native populations were observed in the range of 0.00–0.18, 0.73–1.00 and 0.00–0.23, respectively (Kinoshita et al., 2002). In addition, OTFA variant was not found in seven Japanese chicken populations (Myint et al., 2010). Although the electrophoretic variants have been thought to arise from the three OTF alleles, the difference of these variants on the primary structure of the protein and the antibacterial activity is yet to be unraveled. The objective of this study is to examine the contribution of the two OTF variants (OTFB and OTFC) to the different electrophoretic mobility (surface charge) and their effect on antibacterial activity
Materials and Methods
Ethics Statement
Animal care and all experimental procedures were approved by the Animal Experiment Committee, Graduate School of Bioagricultural Sciences, Nagoya University (approval no 2014021202), and the experiments were conducted according to Regulations on Animal Experiments at Nagoya University.
Egg White Samples
A total of 395 fresh egg white samples were collected from two Japanese natives (Satsumadori, n=155; Ehime-jidori, n=50), three Taiwanese natives (Tsin-Yi n=35, Hua-Tung n=21 and Ju-Chi n=34) and two commercial populations (White egg layer n=50 and Brown egg layer n=50). One Satsumadori population (n=48) and Ehime-jidori were kept in Kagoshima University (KU). Three Taiwanese natives were kept in Chung Hsing University. The other Satsumadori (n=107) and two commercial populations were kindly provided from Kagoshima Prefectural Institute for Agricultural Development (KPI). Ehime-jidori is a Japanese native chicken that is newly found in the southwest region of Ehime Prefecture around the 1990s (Tanabe et al., 2000).
Screening of the Chicken OTF Electrophoretic Variants
Chicken OTF variants were examined by using 8% non-denaturing polyacrylamide gel electrophoresis (Native-PAGE) (Davis 1964) as described below. The egg white samples were diluted 8 times by volume with dilution buffer [2 ml of 0.5 M Tris-HCl (pH 6.8), 1.6 ml glycerol, and 0.4 ml of 0.05% (wt/vol) bromophenol blue] and electrophoresis was conducted at 3.5 mA/cm constant current in 8% Native-PAGE with Tris/glycine buffer [25 mM Tris base, 192 mM glycine (pH 8.3)]. Each gel slab was stained with 0.125% (wt/vol) coomassie brilliant blue R-250 (CBB-R250) in methanol-acetic acid-water (40:7:53), destained in methanolacetic acid-water (25:10:65) and the OTF phenotypes judged based on mobility shift of OTF bands.
Total RNA Extraction from Oviduct and cDNA Synthesis, OTF cDNA Cloning
Oviduct tissues were collected from three egg-laying Satsumadori hens identified as the electrophoretic phenotypes OTFB, OTFB/C and OTFC. Total RNA was extracted with TRIzol reagent, following manufacturer instructions (Life Technologies, Carlsbad, CA, USA). One µg of RNA was then incubated with 50 pmoles of oligo dT primers for 10 minutes at 65°C, and then subjected to a reverse transcriptase (RT) reaction. The final reaction volume was 20 µl, containing 1×RT buffer (20 mM Tris-HCl, pH 8.4, 50 mM KCl), 5 mM MgCl2, 10 mM dithiothreitol, 500 µM of each dNTP, 40 units of RNaseOUT (Life Technologies Japan Ltd.) and 200 units of SuperScript II RNase H Reverse Transcriptase (Life Technologies). Oviduct cDNAs were synthesized at 37°C for 50 min following inactivation of Super-Script II by heating at 70°C for 15 min. To remove template mRNAs, samples were treated with 1 unit of RNase H at 37°C for 20 min.
On the basis of the sequence of the chicken OTF gene (accession no. Y00407) available in the NCBI database, three pairs of PCR primers were designed (Table 1), enabling the amplification of the chicken OTF cDNA. Three overlapping fragments of the OTF cDNA for each phenotype OTFB, OTFB/C and OTFC of Satsumadori were amplified and directly sequenced using primers that are shown in Table 1. The PCR mixture contained 40 ng of oviduct cDNA, PCR buffer containing 2 mM MgCl2, 200 µM of each dNTP, 10 µM each of forward and reverse primers and 1 unit of Ex Taq DNA polymerase (TaKaRa Bio Inc., Otsu, Japan) in a final volume of 20 µl. The PCR reactions were performed on a GeneAmp PCR system 9700 (Life Technologies) with the following profile: initial denaturation of 3 min at 94°C, 35 cycles of 94°C for 30 s, 60–62°C for 30 s, and 72°C for 1 min, and a final elongation step of 7 min at 72°C.
Table 1. Oligonucleotide primers used in this study.
| Primer | Primer sequence (5′ to 3′) | Nucleotide position1 | PCR product (bp) |
|---|---|---|---|
| PCR amplification and sequencing | |||
| TF1 (fwd)2 | 5′- GACGGTCTGTGACCAACACCGCTG -3′ | 284–307 | 720 or 3508 |
| TF2 (rev.)2 | 5′- TGGAAAGCTCCAGAATATCCAGAA -3′ | 3792-3769 | 720 or 3508 |
| TF3 (fwd) | 5′- GCTCCACAACCAGCTACTATGCTG -3′ | 3275–3298 | 1026 |
| TF4 (rev.) | 5′- CTGGTCGTTCATCTGTTTTGCTGC -3′ | 7034-7011 | 1026 |
| TF5 (fwd)2 | 5′- AAAGGTGAAGCAGATGCTGTTGCC -3′ | 6690–6713 | 906 or 3960 |
| TF6 (rev.)2 | 5′- CACGAGAGGAGTCATGGCGCGAAG -3′ | 10709–10686 | 906 or 3960 |
| cDNA sequencing | |||
| TFex8F (fwd) | 5′- AGTGACTTTGGCGTGGACACCAAG -3′ | 5018–5040 | |
| TFex8R (rev.) | 5′- CTTTTCCGCATGCTCTGGATGGCAC -3′ | 5214-5181 | |
| Genomic sequencing | |||
| TFex2F (fwd) | 5′- CAAGTCAGTCATCAGATGGTG -3′ | 1721–1741 | |
| TFint3R (rev.) | 5′- CTCTCATATCTGCCGCTCATTCAG -3′ | 2328–2351 | |
| TFint12F (fwd) | 5′- TATGCTGCACGTAGATGCCCTCTG -3′ | 7569–7592 | |
Nucleotide positions are defined according to the chicken OTF gene (NCBI accession number Y00407).
Two primer pairs were used for amplification of cDNA and genomic DNA of the OTF gene.
Blood Samples and Genomic DNA Extraction
A total of 29 whole blood samples were aseptically taken from the wing veins of hens. These hens consisted of 12 Satsumadori (3 OTFB, 8 OTFB/C and 1 OTFC), three Ehimejidori (3 OTFB), and 14 Ju-Chi (5 OTFB and 9 OTFB/C). Genomic DNAs were extracted with PUREGENE DNA isolation kit (Gentra Systems, Inc., MN, USA). The purified genomic DNA was used as a template for PCR amplification (exons 1–5 and exons 10–17) of the OTF gene as described below.
PCR Amplification using Genomic DNA
Two segments (3,508 bp of exon 1–5 and 3,960 bp of exon 10–17) of the chicken OTF gene were amplified by using two pairs of primers (TF1 with TF2 and TF5 with TF6) and directly sequenced using three primers (TFex2F, TFint3R and TFint12F) that are shown in Table 1. The sequence of these primers was also adopted from the nucleotide sequence of the chicken OTF gene (NCBI accession no. Y00407). These regions correspond to exons 1–5 and exons 10–17 of the chicken OTF gene. PCR reactions were carried out in a final volume of 50 µl containing 100 ng genomic DNA, 2.5 units of Ex Taq polymerase (TaKaRa Bio Inc.), 1×reaction buffer (supplied with Ex Taq) with 2 mM MgCl2, 200 µM of each dNTP and 10 µM of each primer. The reactions were carried out in a GeneAmp PCR System 9700 with the following profile: initial denaturation of 3 min at 94°C; 35 cycles of 94°C for 30 sec, 60–65°C for 30 sec, and 72°C for 5 min; and final elongation step of 7 min at 72°C.
DNA Sequencing and Mutation Detection
Following the conditions mentioned above, PCR fragments of chicken OTF gene were amplified. After electrophoresis, targets were excised from the agarose gel and purified with Gel-M gel extraction kit (Viogene BioTek, New Taipei City, Taiwan). These purified samples were used as templates for direct sequencing. DNA sequencing reactions were carried out using ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Life Technologies) as recommended by the manufacturer. Briefly, the reaction contained 0.2 µg of PCR product and 3.2 pmoles of either the forward or reverse primers that are shown in Table 1. Sequence analysis was performed by using an ABI PRISM 3100 Genetic Analyzer (Life Technologies) and sequence alignment with the chicken OTF gene sequence (accession no. Y00407) available in the NCBI database was obtained by using CLUSTALW (http://clustalw.genome.ad.jp/) (Thompson et al., 1994).
Isolation of Ovotransferrin from Chicken Egg White
Ovotransferrin was purified from fresh egg white of the respective mutant chickens (one OTFB and one OTFC) through two successive steps on cation exchange chromatography. Briefly, egg white was diluted with 3 volumes of distilled water and the mixture was adjusted to pH 6 with 1 N HCl. The solution was stirred overnight at 2°C to precipitate ovomucin, which was removed by centrifugation at 3000×g for 5 min. The mucin-free supernatant was adjusted to pH 8.0 then applied, through two steps, to cation exchange chromatography on an S Hyper DF column (BioSepra, Cergy-Saint-Christophe, France) that was connected to a BioLogic LP low-pressure chromatography system (BioRad, Hercules, CA, USA). Protein was eluted with a linear gradient of 0.5 M NaCl in 50 mM Tris-HCl buffer (pH 7.5), and monitored at 280 nm. Peaks were collected automatically using an on-line BioFrac Fraction Collector (BioRad). Ovotransferrin peak was re-chromatographed on the same column with a shallow gradient. The collected ovotransferrin peak was finally desalted by dialysis against distilled water and lyophilized. To examine the purity and approximate molecular mass of the purified ovotransferrin, SDS-PAGE was conducted in accordance with the method of Laemmli (1970). Samples were run on a 12% polyacrylamide gel in the presence of 0.1% SDS for 3 h at 20 mA. A protein molecular mass marker (LMW-SDS Marker Kit (14,000–97,000), Nippon Genetics, Tokyo, Japan) was used. Protein bands were visualized by staining with CBB R-250.
Antibacterial Assay
Antibacterial assay was performed according to our previous report (Myint et al., 2012). Samples of purified chicken egg white ovotransferrin with the phenotypes OTFB and OTFC were used for antibacterial assay. We tested the antibacterial activity of the samples against two bacterial strains: Staphylococcus aureus (Gram-positive) and Escherichia coli (XL-1 blue; Gram-negative). Bacteria were grown overnight in brain heart infusion broth (BHI; Nissui, Tokyo, Japan) at 37°C. Bacterial cells were suspended in trypticase soy broth (TSB; Nissui, Tokyo, Japan) to give 2×107 colony forming units (cfu)/ml (Ibrahim et al., 1996). Two-fold dilutions of ovotransferrin (1 mg/ml initial concentration) in 1×PBS buffer were prepared in each well of a 96-well microtiter plate and mixed with an equal volume of bacterial suspension in TSB broth to give the required range of concentrations (3.9–250 µg/ml). Controls were incubated with PBS instead of diluted ovotransferrin. The cultures in the microtiter plates were incubated at 37°C for 16 h, during which period the kinetics of inhibition of growth of the test organism was monitored spectrophotometrically every two hours at 620 nm using a Mithras LB940 Multimode Microplate Reader (Berthold Technologies, Bad Wildbad, Germany). All assays were conducted in three experiments performed in duplicate. Bacterial growth at a given time was represented as the average change (ΔOD620) in optical density, using the formula: ΔOD620=OD620 at a given time – OD620 at time zero. The bacterial growth values were subjected to repeated measures analysis of variance (ANOVA) using a general linear model (GLM), with variant as a between subjects variable and incubation time as a within subjects variable. If a significant interaction was detected between a variant and incubation time, significant differences between groups for each time point were detected by using Tukey's HSD (Honestly Significant Difference) test. The statistical analysis was performed in the SAS software (SAS Inst. Inc., Cary, NC).
Results
Electrophoretic Polymorphism of the OTF Protein
Table 2 shows the distributions of electrophoretic phenotypes and gene frequencies of OTF in eight chicken populations. Three OTF phenotypes (OTFB, OTFB/C and OTFC) were observed in two Satsumadori, Hua-Tung and Ju-Chi populations. The allele frequencies of OTFC were 0.104, 0.238, 0.048 and 0.162 in the four populations, respectively. The OTFB allele was fixed in two natives (Ehime-jidori and Tsin-Yi) and two commercial chickens. The OTFA allele was not detected in this study.
Table 2. Distribution of electrophoretic phenotypes and allele frequencies of OTF in eight chicken populations.
| Population | Number of samples | Phenotype | Allele frequency | |||
|---|---|---|---|---|---|---|
| OTFB | OTFB/C | OTFC | OTFB | OTFC | ||
| Japanese native breeds | ||||||
| Satsumadori (KU) | 48 | 40 | 6 | 2 | 0.896 | 0.104 |
| Satsumadori (KPI) | 107 | 64 | 35 | 8 | 0.762 | 0.238 |
| Ehime-jidori | 50 | 50 | 0 | 0 | 1.000 | 0.000 |
| Taiwanese native breeds | ||||||
| Tsin-Yi | 35 | 35 | 0 | 0 | 1.000 | 0.000 |
| Hua-Tung | 21 | 19 | 2 | 0 | 0.952 | 0.048 |
| Ju-Chi | 34 | 23 | 11 | 0 | 0.838 | 0.162 |
| Commercial breeds | ||||||
| White egg layer | 50 | 50 | 0 | 0 | 1.000 | 0.000 |
| Brown egg layer | 50 | 50 | 0 | 0 | 1.000 | 0.000 |
Comparison of the OTF cDNA Sequences for the Three Phenotypes
The OTF cDNA sequences were obtained from oviduct RNAs of three Satsumadori hens with the phenotypes OTFB, OTFB/C and OTFC. The OTF cDNA sequences for the phenotypes OTFB, OTFB/C and OTFC were deposited in the DDBJ database under accession numbers AB215094, AB 222603 and AB215095, respectively. Table 3 showed the nucleotide and deduced amino acid substitutions in three phenotypes from comparison with chicken OTF gene sequence (NCBI accession no. Y00407). Comparison of the protein coding sequences of the three OTF phenotypes revealed seven coding single nucleotide polymorphisms (cSNPs). Out of the seven, three cSNPs: T1809→G changing codon 52 from TCA to GCA (Ser→Ala) in exon 2, A2258→G changing codon 96 from ATT to GTT (Ile→Val) in exon 3, and G7823→A changing codon 500 from GAT to AAT (Asp→Asn) in exon 12, corresponded to the electrophoretic phenotypes. In addition to these seven cSNPs, from the sequence comparisons with Y00407, we found two nonsynonymous sites C3412→A and G10171→A in exon 4 and exon 16 resulting in Leu152→Ile and Ser686→Asn, respectively.
Table 3. Nucleotide and deduced amino acid variations in the chicken OTF gene detected in Satsumadori hens.
| Nucleotide position (amino acid position) |
|||||||||
|---|---|---|---|---|---|---|---|---|---|
| Y00407 | T 1809 | A 2258 | C 3354 | C 3412 | G 4734 | C 5812 | G 7823 | G 8604 | G 10171 |
| (Ser52) | (Ile96) | (Thr132) | (Leu152) | (Pro237) | (Ile364) | (Asp500) | (Gly510) | (Ser686) | |
| OTFB | T (Ser) | A (Ile) | C | A (Ile) | G | C/T | G (Asp) | G/A | A (Asn) |
| OTFB/C | T/G (Ser/Ala) |
A/G (Ile/Val) |
C/G | A (Ile) | G/A | C/T | G/A (Asp/Asn) |
G/A | A (Asn) |
| OTFC | G (Ala) | G (Val) | C/G | A (Ile) | G/A | C/T | A (Asn) | G/A | A (Asn) |
| Amino acid change | Ser > Ala | Ile > Val | Thr | Leu > Ile | Pro | Ile | Asp > Asn | Gly | Ser > Asn |
| Exon | Exon2 | Exon 3 | Exon 4 | Exon 4 | Exon 7 | Exon 9 | Exon 12 | Exon 13 | Exon 16 |
Nucleotide positions are defined according to the chicken ovotransferrin gene (NCBI accession number Y00407).
Bold letters indicate the non-synonymous substitutions. Italic letters indicate synonymous substitutions.
Identification of Causal Polymorphism in the Three Non-synonymous cSNPs
To further confirm whether the three non-synonymous cSNPs are causal between OTFB and OTFC variants, additional 29 hens, which had the OTF electrophoretic phenotypes, were selected from Satsumadori, Ehime-jidori and Ju-Chi populations and were genotyped for these cSNPs. These results revealed that the two cSNPs at nucleotide position 1,809 and 2,258 were found in the same phenotype, but the G to A substitution at position 7,823 in exon 12 was the only difference among the phenotypes OTFB, OTFB/C and OTFC and agreed well with the phenotypes OTFB (G/G, Asp500Asp), OTFB/C (G/A, Asp500Asn) and OTFC (A/A, Asn500Asn) (Table 4).
Table 4. Correspondence of three cSNP genotypes to the OTF electrophoretic phenotypes.
| Phenotype | Number of samples | T1809G (Ser52Ala) | A2258G (Ile96Val) | G7823A (Asp500Asn) | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| TT | TG | GG | AA | AG | GG | GG | GA | AA | ||
| OTFB | 11 | 8 | 3 | 0 | 11 | 0 | 0 | 11 | 0 | 0 |
| OTFB/C | 17 | 0 | 15 | 2 | 7 | 10 | 0 | 0 | 17 | 0 |
| OTFC | 1 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | 1 |
Effect of the OTF Variants on the Antibacterial Activity
The OTFB and OTFC variants were purified from egg whites of the homozygous chickens to make results of antibacterial assay clear. SDS-PAGE showed that both of the purified proteins appeared as a single band that was approximately equal in size to 78 kDa. A broth microdilution method was used in this study to determine the antibacterial activity of the purified chicken ovotransferrin variants. A Gram-positive (S. aureus) and Gram-negative (E. coli) bacteria were used as test strains. For clarity of data presentation, the antibacterial activity of the purified ovotransferrin is presented at a concentration of 31.25 µg/ml. As shown in Table 5, the turbidity of the control bacterial cultures increased with incubation time for both types of bacteria. The addition of different variants of the purified ovotransferrin resulted in a decrease in the growth of both S. aureus and E. coli, indicating growth inhibition. The mean (±SE) bacterial growth of the OTFB and OTFC variants and control are shown in Table 5. Repeated measures ANOVA revealed that an interaction between variant and time was significant in both bacteria (P<0.01 in S. aureus and P<0.05 in E. coli). Thus, we analyzed by Tukey's HSD test at each time point in each bacteria. The results showed that significant differences between the variants and control were found from 2 h after incubation (P<0.05 in S. aureus and P<0.01 in E. coli), suggesting that both purified ovotransferrin inhibited bacteria growth. However, no significant differences were found between the two variants in both bacteria (P>0.05).
Table 5. Antibacterial effects of the purified OTFB and OTFC variants against S. aureus and E. coli.
| Time |
S. aureus |
E. coli |
||||
|---|---|---|---|---|---|---|
| Control1 | OTFB | OTFC | Control1 | OTFB | OTFC | |
| 0 h | 0.000±0.000 | 0.000±0.000 | 0.000±0.000 | 0.000±0.000 | 0.000±0.000 | 0.000±0.000 |
| 2 h | 0.032±0.000a | 0.008±0.002b | 0.011±0.003b | 0.018±0.009a | 0.003±0.001b | 0.008±0.002a |
| 4 h | 0.029±0.002a | 0.022±0.001b | 0.021±0.001b | 0.023±0.000a | 0.015±0.001b | 0.017±0.001b |
| 6 h | 0.060±0.000a | 0.051±0.005a | 0.051±0.004a | 0.044±0.002a | 0.035±0.003a | 0.034±0.003a |
| 8 h | 0.108±0.000a | 0.088±0.005b | 0.090±0.002a | 0.080±0.001a | 0.064±0.002b | 0.065±0.002b |
| 10 h | 0.130±0.002a | 0.107±0.005b | 0.111±0.002b | 0.086±0.002a | 0.070±0.000b | 0.073±0.001b |
| 12 h | 0.140±0.001a | 0.119±0.004b | 0.120±0.002b | 0.099±0.001a | 0.079±0.001b | 0.082±0.002b |
| 16 h | 0.185±0.001a | 0.139±0.005b | 0.142±0.002b | 0.131±0.006a | 0.098±0.004b | 0.096±0.002b |
Means (±SE) within a time and bacteria not sharing a common superscript differ (P<0.05). Values indicate the absorbance (A620nm) of the bacterial culture at the given time.
Control was incubated with PBS instead of the purified ovotransferrin.
Discussion
This study investigated the relationship between non-synonymous polymorphisms in the OTF gene and electrophoretic OTF variants and a difference among the variants for antibacterial activity. We focused on the difference between the variants OTFB and OTFC. This was because fresh eggs were necessary for antibacterial assay and no bird with OTFA was obtained in seven Japanese populations (Myint et al., 2010). In addition, we used the homozygous chickens for antibacterial assay to make the results clear. It was thought to be difficult for us to obtain both the OTFA and OTFC homozygous chickens because of low allelic frequencies. The genetic study for the OTFA variant needs to be conducted in the near future.
In this study, we identified one cSNP (G7823A) corresponding to the OTF phenotypes. This SNP was a nonsynonymous substitution that results in conversion of aspartic acid (GAT; allele OTFB) to asparagine (AAT; allele OTFC) at amino acid residue 500. It has been reported that the difference in electrophoretic mobility is attributed mainly to the net surface charge of a protein, and the ratio of detectable amino acid substitution is estimated to be about 25% of the total amino acid substitution (Nei and Chakraborty, 1973). Thus, although conversion of the negatively charged aspartic acid to asparagine at residue 500 decreases the negative charge of the mature protein in the OTFC variant, the other two non-charged amino acid substitutions (Ser52Ala, Ile96Val) had no effect on the protein net surface charge of both variants: These two constitute the polymorphisms among individuals, breeds or strains.
Ovotransferrin is a key antimicrobial protein in avian egg albumen (Ibrahim et al., 1998, 2000). Therefore, it was necessary to evaluate the effect of these variants of ovotransferrin on antibacterial activity. Although the purified OTF variants exhibited considerable growth inhibition of both test strains, there was no statistical significant effect between the two OTF variants in this study. These results suggest that these variants had negligible effect on the antibacterial activity.
The position and chemistry of an amino acid residue affects the structure and biological function of a protein as well as its stability. Ibrahim et al. (1998, 2000) reported the presence of the major antimicrobial peptide within the amino acid sequence from 109 to 200 of ovotransferrin. Three mutations related to the OTF variants in Satsumadori, which are distant from the antibacterial peptide region, were as expected would not influence the antibacterial activity. Ibrahim et al. (2006) reported that OTF underwent self-cleavage thus produced two disulfide kringle peptides (residues 115–211 and 454–544). These peptides of OTF were reported to possess SOD-like superoxide anion scavenging activity and anticancer activity against human colon and breast cancer cells (Ibrahim et al., 2007; Ibrahim and Kiyono, 2009). The Asp500Asn mutation lies in the kringle peptide of C-lobe (454–544), which increases surface positive charges thus may affect anticancer action of OTF. This would merit further investigation.
Serum TF and egg white OTF are translated by same gene because they have the same amino acid sequence and parallel electrophoretic phenotype (Baker et al., 1970). It is known that both proteins are only different in glycosylated form (Williams 1962, 1968; Jacquinot et al., 1994). The major role of TF is iron transport to other tissues (Keung and Azari, 1982; Oratore et al., 1990). In addition, it is believed that TF plays an important role in developing nervous system and bone formation during embryogenesis (Oh et al., 1986). Examination of the effect of these substitutions on the other functions of TF would merit further investigations.
In this study, non-synonymous substitutions were found, which were classified as the same OTF phenotype. The Ser52Ala and Ile96Val mutations were novel amino acid substitutions. Another mutation (Ile152Leu) was found by comparison of the coding sequences of three Satsumadori hens and database sequences (Y00407). This Ile152Leu mutation may influence the antibacterial activity because the mutation is located within the reported antibacterial peptide region.
In conclusion, we identified a non-synonymous SNP (G→A) at position 7,823 in exon 12 corresponding to the electrophoretic variants. This substitution converts the aspartic acid (Asp) for OTFB variant at amino acid residue 500 to asparagine (Asn) in the OTFC variant. The replacement of Asp500 with Asn500 reflects the difference in electrophoretic mobility between the OTFB and OTFC variants as a consequence of change in net surface charge of the gene products of two alleles, but had no significant effect on the antimicrobial activity. Further research will be required to examine whether these cSNPs have contribution to the other functions of OTF.
Acknowledgments
We express our thanks to Dr. Chih-Feng Chen (Department of Animal Science, National Chung Hsing University) for his preparation of blood and egg white samples of Taiwanese native chickens. We also express thank to Dr. J.J. Rodrigue for editing the English. This investigation was partly supposed by JSPS KAKENHI Grant Number 25450399 (to T.S.).
References
- Baker CMA. Molecular genetics of avian proteins. IX. Interspecific and intraspecific variation of egg white proteins of the genus Gallus. Genetics, 58: 211-226. 1968. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baker CMA, Croizier G, Stratil A, Manwell C. Identity and nomenclature of some protein polymorphisms of chicken eggs and sera. Advances in Genetics, 15: 147-174. 1970. [DOI] [PubMed] [Google Scholar]
- Baron F, Gautier M, Brule G. Rapid growth of Salmonella enteritidis in egg white reconstituted from industrial egg white powder. Journal of Food Protection, 62: 585-591. 1999. [DOI] [PubMed] [Google Scholar]
- Davis BJ. Disc electrophoresis. II. Method and application to human serum proteins. Annals of the New York Academy of Sciences, 121: 404-427. 1964. [DOI] [PubMed] [Google Scholar]
- Giansanti F, Rossi P, Massucci MT, Botti D, Antonini G, Valenti P, Seganti L. Antiviral activity of ovotransferrin discloses an evolutionary strategy for the defensive activities of lactoferrin. Biochemistry and Cell Biology, 80: 125-130. 2002. [DOI] [PubMed] [Google Scholar]
- Giansanti F, Massucci MT, Giardi MF, Nozza F, Pulsinelli E, Nicolini C, Botti D, Antonini G. Antiviral activity of ovotransferrin derived peptides. Biochemical and Biophysical Research Communications, 331: 69-73. 2005. [DOI] [PubMed] [Google Scholar]
- Ibrahim HR, Higashiguchi S, Koketsu M, Juneja LR, Kim M, Yamamoto T, Sugimoto Y, Aoki T. Partially unfolded lysozyme at neutral pH agglutinates and kills Gram-negative and Gram-positive bacteria through membrane damage mechanism. Journal of Agricultural and Food Chemistry, 44: 3799-3806. 1996 [Google Scholar]
- Ibrahim HR, Iwamori E, Sugimoto Y, Aoki T. Identification of a distinct antibacterial domain within the N-lobe of Ovotransferrin. Biochimica et Biophysica Acta, 1401: 289-303. 1998. [DOI] [PubMed] [Google Scholar]
- Ibrahim HR, Sugimoto Y, Aoki T. Ovotransferrin antimicrobial peptide (OTAP-92) kills bacteria through membrane damaging mechanism. Biochimica et Biophysica Acta, 1523: 196-205. 2000. [DOI] [PubMed] [Google Scholar]
- Ibrahim HR, Haraguchi T, Aoki T. Ovotransferrin is a redox-dependent autoprocessing protein incorporating four consensus self-cleaving motifs flanking the two kringles. Biochimica et Biophysica Acta, 1760: 347-355. 2006. [DOI] [PubMed] [Google Scholar]
- Ibrahim HR, Hoq MI, Aoki T. Ovotransferrin possesses SOD-like superoxide anion scavenging activity that is promoted by copper and manganese binding. International Journal of Biological Macromolecules, 41: 631-640. 2007. [DOI] [PubMed] [Google Scholar]
- Ibrahim HR, Kiyono T. Novel anticancer activity of the autocleaved ovotransferrin against human colon and breast cancer cells. Journal of Agricultural and Food Chemistry, 57: 11383-11390. 2009. [DOI] [PubMed] [Google Scholar]
- Jacquinot PM, Leger D, Wieruszeski JM, Coddeville B, Montreuil J, Spik G. Change in glycosylation of chicken transferrin glycans biosynthesized during embryogenesis and primary culture of embryo hepatocytes. Glycobiology, 4: 617-624. 1994. [DOI] [PubMed] [Google Scholar]
- Keung WM, Azari P. Structure and function of ovotransferrin. II. Iron-transferring activity of iron-binding fragments of ovotransferrin with chicken embryo red cells. The Journal of Biological Chemistry, 257: 1184-1188. 1982. [PubMed] [Google Scholar]
- Kinoshita K, Okamoto S, Shimogiri T, Kawabe K, Nishida T, Kakizawa R, Yamamoto Y, Maeda Y. Gene constitution of egg white proteins of native chicken in Asian countries. Asian Australasian Journal of Animal Sciences, 15: 157-165. 2002. [Google Scholar]
- Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227: 680-685. 1970. [DOI] [PubMed] [Google Scholar]
- Myint SL, Shimogiri T, Kawabe K, Hashiguchi T, Maeda Y, Okamoto S. Characteristics of seven Japanese native chicken breeds based on egg white protein polymorphisms. Asian-Australasian Journal of Animal Sciences, 23: 1137-1144. 2010. [Google Scholar]
- Myint SL, Kinoshita K, Shimogiri T, Ibrahim HR, Tsusaki T, Tanoue T, Kawabe K, Maeda Y, Okamoto S. Effect of polymorphism in egg white lysozyme on muramidase and antibacterial activities as well as hatchability in the Japanese quail (Coturnix japonica). Journal of Animal Science, 90: 1747-1755. 2012. [DOI] [PubMed] [Google Scholar]
- Nei M, Chakraborty R. Genetic distance and electrophoretic identity of proteins between taxa. Journal of Molecular Evolution, 2: 323-328. 1973. [DOI] [PubMed] [Google Scholar]
- Oh TH, Markelonis GJ, Royal GM, Bregman BS. Immunocytochemical distribution of transferrin and its receptor in the developing chicken nervous system. Developmental Brain Research, 395: 207-220. 1986. [DOI] [PubMed] [Google Scholar]
- Oratore A, D'Andrea G, D'Alessandro AM, Moreton K, Williams J. Binding and iron delivering of monoferric ovotransferrins to chick-embryo red blood cells (CERBC). Biochemistry International, 22: 111-118. 1990. [PubMed] [Google Scholar]
- Stevens L. Egg white proteins. Comparative Biochemistry and Physiology Part B, 100: 1-9. 1991. [DOI] [PubMed] [Google Scholar]
- Tanabe Y, Kano H, Kinoshita K, Taniwaki O, Okabayashi H. Gene Constitution of a Newly Found Population of Japanese Native Chickens in Southern Region of Ehime Prefecture, Shikoku, Japan. Japanese Poultry Science, 37: 101-107. 2000. [Google Scholar]
- Thompson JD, Higgins DG, Gibson TJ. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673-4680. 1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Valenti P, Antonini G, Von HC, Visca P, Orsi N, Antonini E. Studies of the antimicrobial activity of ovotransferrin. International Journal of Tissue Reactions, 5: 97-105. 1983. [PubMed] [Google Scholar]
- Williams J. A comparison of conalbumin and transferrin in the domestic fowl. Biochemical Journal, 83: 355-364. 1962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Williams J. A comparison of glycopeptides from the ovotransferrin and serum transferrin of the hen. Biochemical Journal, 108: 57-67. 1968. [DOI] [PMC free article] [PubMed] [Google Scholar]