Abstract
The chaperonin containing TCP-1 complex protein 1 subunit zeta (CCT6A) is the only cytosolic chaperonin in eukaryotes assisting in the folding of cytoplasmic proteins. Previous study revealed that the mRNA expression of chicken CCT6A gene was remarkably elevated in the sexually mature ovaries. However, the mechanism underlying chicken CCT6A expression changes remains largely unknown. In this study, haplotypes caused by two single nucleotide polymorphisms (SNPs) of chicken CCT6A gene promoter (g.−2215 T>C and g.−1959 T>C) were identified and their associations with egg production traits as well as effects on gene expression were analyzed. Altogether four haplotypes including A (C−2215-T−1959), B (C−2215-C−1959), C (T−2215-T−1959) and D (T−2215-C−1959) were detected in all of the five chicken populations. Diplotypes AA, AD and DD were predominant in Xinyang brown hens, among which diplotype AD was associated with higher egg number at the age of 28 weeks old (E28) (P<0.05). In addition, diplotype AD was also predominant in Xinyang brown and Hy-line brown chicken populations with high egg production; whereas in Wenchang and Shouguang chicken populations which are Chinese indigenous chicken breeds and relatively lower in egg production, diplotype AA was predominant. Compared with diplotypes AA and DD, the mRNA expression of CCT6A in diplotype AD birds is the highest in F1, F5, and POF1 follicles of Hy-line brown hens (P<0.05). These results suggest that the two SNPs in chicken CCT6A promoter region are potential DNA marker for improving egg production trait.
Keywords: chaperonin containing TCP-1 complex protein 1 subunit zeta, chicken, egg production traits, Haplotype, polymorphisms, promoter
Introduction
Chaperonin containing TCP-1 complex (CCT) plays a fundamental role in the folding of cytoplasmic proteins, i.e. actin, tubulin, cyclin E, myosin, transducin and the Von Hippel Lindau tumor suppressor (Sternlicht et al., 1993; Satish et al., 2010). It contains eight different homologous proteins, including alpha, beta, gamma, delta, epsilon, eta, theta and zeta (Rommelaere et al., 1993; Kubota et al., 1994, 1995; Hynes et al., 1995). The zeta subunit of CCT encoded by CCT6A gene is the only cytosolic hetero-oligomeric molecular chaper one assisting in the folding of cytoplasmic proteins. Human CCT6A gene is expressed in ten human tumor cell lines (Myung et al., 2004) and is up-regulated in an endometrial adenocarcinoma cell line after treatment with megestrol acetate (Zhang and Lin, 2006). In mice, it was detected on the surface of spermatozoa (Dun et al., 2011).
The chicken CCT6A gene is located on chromosome 19 and consists of 14 exons. Our previous studies on chicken CCT6A gene indicated that, compared with sexually immature Jining Bairi hens, the expression of CCT6A mRNA was remarkably elevated in the ovaries of sexually mature hens; its expression in ovary was significantly increased from 70-day-old to 300-day-old hens, and decreased dramatically to 500-day-old hens (Kang et al., 2012). During follicle growth, chicken CCT6A mRNA expression was increased rapidly from pre-hierarchy follicles to F5 follicles and subsequently declined in pre-ovulatory and post-ovulatory follicles in Hy-line brown hens (Wei et al., 2013), which implies that CCT6A is involved in follicle recruitment from pre-hierarchy follicles. We also found that the expression of chicken CCT6A in granulosa cells was regulated by progesterone and follicle-stimulating hormone and identified a progesterone response element in the distal promoter region of chicken CCT6A gene (Wei et al., 2013).
Egg production traits, such as age at first egg (AFE), egg number, egg weight and interval between oviposition time, are among the most important economic traits in egg-laying poultry (Kim et al., 2004). Up to date, polymorphisms in the chicken CCT6A gene and its association with egg production traits were not reported. Due to the fact that the tempospatial expression of chicken CCT6A is consistent with sexual maturation, follicle growth and ovary function, and that deletion from −2534 to −1549 of chicken CCT6A gene promoter region cause up-regulation in luciferase activity (Wei et al., 2013), therefore, in this study, we set out to find polymorphisms in this promoter region of chicken CCT6A and further analyze their genetic effects on egg production traits and mRNA expression level.
Materials and Methods
Birds and Trait Measurements
Individuals were randomly sampled from two Chinese indigenous chicken breeds (66 Wenchang chickens, Hainan Province; 49 Shouguang chickens, Shandong Province), one synthetic broiler line (55 Luqin synthetic broiler lines, Shandong Province), one synthetic laying line (194 196-day-old Xinyang brown chickens established by crossing heterozygotes at the polymorphic sites, Shanghai Poultry Breeding co., Ltd) and one commercial egg-laying lines (42 Hy-line brown chickens, Shandong province) used for polymorphism analysis on chicken CCT6A gene promoter region. The Xinyang brown chickens were also used for trait-genotype association analysis. for Xinyang brown chickens, they were randomly sampled and housed individually in laying batteries with free access to feed and water and were exposed to a 16L:8D photoperiod. In addition, the laying pattern of each hen of Xinyang brown chickens was recorded daily, and egg production traits including age at first egg (AFE) and egg number at 28 weeks of age (E28) were collected. Procedures concerning chicken management and slaughter were approved by the Ethics Committee of Laboratory Animals at Shandong Agricultural University.
DNA Extraction and Identification of Nucleotide Changes
Sampling was performed by taking 1 mL blood per hen from wing vein into collection tubes containing heparin sodium and held on ice until delivered to the laboratory. The genomic DNA was extracted from blood sample using DNA Extraction mini kit (Tiangen, Beijing, China) and stored in TE (pH 8.0) at −20°C. Primer set CCT6A-P as shown in Table 1 was designed with DNAMAN software version 7.0 according to the distal promoter sequence of Gallus gallus CCT6A gene (GenBank accession number: NC_006106.3). for identifying polymorphisms in chicken CCT6A promoter region, two DNA pools were obtained by mixing 30 genomic DNA samples randomly with equal concentration from hens of Xinyang brown and Wenchang chicken population, respectively.
Table 1. Primers used for molecular cloning, genotyping and expression analysis of chicken CCT6A gene.
| Primer name | Accession Numbers | Sequences (5′-3′) | Size (bp) | Tm (°C) | Usage |
|---|---|---|---|---|---|
| CCT6A-P-F CCT6A-P-R |
NC_006106.3 | F: GCAGGTGTAGGATGGAAGAT R: CCACAAGTTTGGAGCCTTT |
675 | 61 | Molecular cloning and genotyping |
| qRT-β-actin-F | NM_205518.1 | F: TGGATGATGATATTGCTGC | 253 | 55 | mRNA Expression |
| qRT-β-actin-R | R: ATCTTCTCCATATCATCCC | ||||
| qRT-CCT6A-F | NM_001006216.1 | F: TTCCAGCCTTCCCAAACTA | 128 | 55 | mRNA Expression |
| qRT-CCT6A-R | R:GCCGTAGAATCACACTTTCAG |
Polymerase chain reaction (PCR) amplification was performed in 20 µL volumes containing 2 µL of 10 × Ex-buffer, 1.6 µL (2.5 mM) of dNTPs (TaKaRa, Dalian, China), 0.1 µL (5 U/µL) of Ex-Taq DNA polymerase (TaKaRa, Dalian, China), 0.4 µL (10 µm) of each primer (CCT6A-P-F/R, Table 1), 1 µL genomic DNA pools (50–100 ng) and 14.5 µL of nuclease ddH2O, and run on a Mastercycler gradient (Eppendorf, Germany) according to the following program: 94°C for 4 min, 35 cycles of 94°C for 30 s, annealing at 61°C (CCT6A-P-F/R) for 30 s, and 72°C for 45 s and final extension at 72°C for 10 min. Fragments of 675 bp were resolved by electrophoresis with 1% agarose gel and purified with AxyPrep™ DNA Gel Extraction Kit (Axygen, Union City, CA, USA). The purified PCR product was inserted into pJET1.2/blunt-vector by Clone JET™ PCR Cloning Kit (Fermentas, Vilnius, Lithuania) according to the provided protocols. After being transformed into competent E. coli DH5α cells, the recombinant plasmids were sequenced with BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) by Jinan Bioson Co. Ltd. For each sample, at least 10 clones were sequenced. Sequences were aligned with the distal promoter sequence of Gallus gallus CCT6A gene (GenBank accession number: NC_006106.3) to identify nucleotide changes with DNAMAN v7.0.
Genotyping and Haplotype Analysis
Sequence alignment of chicken CCT6A promoter region revealed T>C mutations at sites −2215 and −1959 respectively (position designated according to translational initiation codon ATG). Using primer set CCT6A-P (Table 1), the polymorphisms caused by the two mutations were detected in Xinyang brown (n=194), Hy-line brown (n=42), Shouguang chicken (n=49), Wenchang chicken (n=66) and Luqin synthetic broiler line hens (n=55). The PCR procedure was described above. The PCR products were resolved on 1% agarose gel, purified with AxyPrep™ DNA Gel Extraction Kit (Axygen, Union City, CA, USA) and sequenced with BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, FosterCity, CA, USA) by Jinan Bioson Co. Ltd. Genotyping of each bird at the −2215 and −1959 sites in the distal promoter region of chicken CCT6A gene was carried out by checking the sequencing results. Haplotypes were constructed in the five chicken populations using the PHASE v2.0 program (Stephens et al., 2001).
Tissues, RNA Isolation and cDNA Synthesis
To characterize the mRNA expression of chicken CCT6A gene of individuals with different genotypes, F1 (the biggest hierarchy follicle with mean diameter of about 33.75 mm), F5 (the smallest hierarchy follicle with mean diameter of about 12.60 mm) and POF1 (the newly post-ovulatory follicle) of 200-day-old Hy-line brown hens of each genotype were collected from chicken ovaries and stored in liquid nitrogen for total RNA extraction.
Total RNA was extracted from follicle tissues using TRIzol® Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. The concentration of total RNA was measured with a spectrophotometer (Eppendorf, Hamburg, Germany). Its integrity was checked by using 1% agarose gel electrophoresis. The first strand cDNA was synthesized by PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China) from 1 µg of total RNA mixed with 1 µL of oligo (dT)18 primers, 1 µL of PrimerScript® RT Enzyme Mix I, 4 µL of 5 × Prime Script Buffer, 11 µL of RNase free ddH2O and incubated at 37°C for 15 min and 85°C for 5 s. The resultant cDNA samples were stored at −20°C.
Real-time Quantitative PCR
The mRNA expression of CCT6A of individuals with different diplotypes was determined by real-time quantitative PCR (qRT-PCR), which was conducted on an Mx3000P (Stratagene, La Jolla, CA, USA) in a 15 µL volume containing 7.5 µL of 2 × SYBR® Premix Ex Taq™ (TaKaRa, Dalian, China), 0.3 µL of 50 × ROX Reference Dye II (TaKaRa, Dalian, China), 0.3 µL (10 µm) (for CCT6A and β-actin) of each forward or reverse primers (Table 1), 4.6 µL of ddH2O, 2 µL of cDNA at a dilution of 1:9 according to the following program: 95°C for 30 s to activate the reaction and 95°C for 5 s, 55°C for 20 s and 72°C for 20 s for 40 cycles. The qRT-PCR efficiency was determined by the analysis of 3-fold serial dilutions of cDNA. Each qRT-PCR reaction was performed with a non-template negative control to check primer-dimers. The Ct in each reaction was determined by the baseline adjustment method of the MX3000 software (Stratagene, La Jolla, CA, USA). The 2 −ΔΔCt method was applied for calculating the relative gene expression levels under the condition that the efficiencies were nearly 100% (Livark and Schmittgen, 2001). The β-actin gene was used as the internal control with primers shown in Table 1. All samples were amplified in triplicate, and the obtained data were normalized to β-actin gene expression.
Statistical Analysis
The associations of CCT6A genotypes with egg production traits including AFE and E28 were analyzed in Xinyang brown chicken populations using the following General Linear Model of SAS (version 9.2; Cary, NC, USA), and the estimated genotype values were compared by Duncan's Multiple Range Test (SAS; version 9.2): Yij=µ+Gi+eij, in which Yij is phenotypic value of traits, µ is the population mean, Gi is the fixed effect of genotype, eij is the random error effect. The difference between genotype effect were considered as significant when P<0.05. The Hardy-Weinberg equilibrium (HWE) and heterozygosity were analyzed according to Nei's methods (Nei, 1973). Polymorphism information content (PIC) was calculated according to Botstein's methods (Botstein et al., 1980). ForqRT-PCR analysis, General Linear Model of SAS (version 9.2; Cary, NC, USA) was used to examine the difference of mRNA expression of chicken CCT6A gene among different haplootypes and when P<0.05 the difference was considered as significant.
Results
Identification of Nucleotide Substitutions in the Distal Promoter Region of Chicken CCT6A Gene
A DNA fragment of 675 bp of the distal promoter region of chicken CCT6A gene was amplified from the DNA pools mixed from Xinyang brown and Wenchang hens, respectively. Sequence alignment of 10 clones from Xinyang brown chicken pool and 10 clones from Wenchang chicken pool indicates that two nucleotide substitutions exist between these two chicken breeds, i.e. g.−2215 T>C and g.−1959 T>C, respectively (position designated according to translational initiation codon ATG). Four haplotypes and six diplotypes were detected (GenBank accession numbers: KJ 481888 to KJ481891) and shown in Fig. 1.
Fig. 1.
Six diplotypes detected at −2215 and −1959 sites in the distal promoter region of chicken CCT6A gene in five hen populations. A=C−2215-T−1959; B=C−2215-C=−1959; C=T−2215-T−1959; D=T−2215-C−1959.
Alleles, Genotypes and Genetic Diversity
For the two polymorphisms located at g.−2215 T>C and g.−1959 T>C loci, totally 406 hens from five chicken breeds (lines) including Xinyang brown, Hy-line brown, Shouguang, Wenchang and Luqin synthetic broiler line were genotyped. For the polymorphism at g.−2215 T>C loci, allele T was predominant in Hy-line brown and Luqin synthetic broiler line, moderate in Xinyang brown, Wenchang and Shouguang hens, and deviation from HWE were observed in Xinyang brown, Hy-line brown and Luqin synthetic broiler lines (P<0.05). For the polymorphism at −1959 site, allele C was moderate in Xinyang brown and Hy-line brown, relatively lower in Luqin synthetic broiler line and much lower in Shouguang and Wenchang chickens, and deviation from HWE was only observed in Xinyang brown line (Table 2).
Table 2. Genotype and allelic frequencies of chicken CCT6A gene's promoter region in five hen populations.
| SNPs | Population (number) | Genotype | Allele Frequencies | χ2 (P value) | PIC | He | |||
|---|---|---|---|---|---|---|---|---|---|
| g.−2215 T>C | CC | CT | TT | T | C | ||||
| Xinyang brown (194) | 0.39 | 0.28 | 0.33 | 0.47 | 0.53 | χ2=34.68 | 0.3740 | 0.5000 | |
| (P=9.999e-05) | |||||||||
| Hy-line brown (42) | 0.06 | 0.20 | 0.74 | 0.84 | 0.16 | χ2=3.69 | 0.2357 | 0.2759 | |
| (P=0.0209) | |||||||||
| Luqin (55) | 0.11 | 0.22 | 0.67 | 0.78 | 0.22 | χ2=7.15 | 0.2830 | 0.3443 | |
| (P=0.0164) | |||||||||
| Wenchang (66) | 0.20 | 0.44 | 0.36 | 0.58 | 0.42 | χ2=0.61 | 0.3680 | 0.4898 | |
| (P=0.4555) | |||||||||
| Shouguang (49) | 0.24 | 0.62 | 0.14 | 0.45 | 0.55 | χ2=2.76 | 0.3724 | 0.5000 | |
| (P=0.1417) | |||||||||
| g.−1959 T>C | CC | CT | TT | C | T | ||||
| Xinyang brown (194) | 0.28 | 0.28 | 0.44 | 0.42 | 0.58 | χ2=30.75 | 0.3680 | 0.4875 | |
| (P=9.999e-05) | |||||||||
| Hy-line brown (42) | 0.31 | 0.52 | 0.17 | 0.57 | 0.43 | χ2=0.17 | 0.3707 | 0.4968 | |
| (P=0.7751) | |||||||||
| Luqin (55) | 0.09 | 0.38 | 0.53 | 0.28 | 0.72 | χ2=0.18 | 0.3229 | 0.4085 | |
| (P=0.7577) | |||||||||
| Wenchang (66) | 0.05 | 0.15 | 0.80 | 0.12 | 0.88 | χ2=5.50 | 0.1903 | 0.2147 | |
| (P=0.0517) | |||||||||
| Shouguang (49) | 0 | 0.16 | 0.84 | 0.08 | 0.92 | χ2=0.39 | 0.1387 | 0.1515 | |
| (P=1.0000) | |||||||||
Haplotype Analysis of Chichen CCT6A Gene
Four haplotypes including A (C−2215-T−1959), B (C−2215-C−1959), C (T−2215 -T−1959) and D (T−2215 -C−1959) wer e detected in all of the five chicken populations (Table 3), and the frequency of haplotype B was the lowest, only detected in Luqin synthetic broiler line. In Xinyang brown, haplotypes A and D were more common than C. Haplotype D was predominant in Hy-line brown hens and haplotype C was predominant in Luqin synthetic broiler line hens. The distribution of haplotypes in Wenchang and Shouguang hens, which are two Chinese indigenous chicken breeds, was similar: haplotypes A and C account for > 85% in the two populations.
Table 3. The distribution of haplotypes in five different hen populations.
| Population (number) | A (C-T) | B (C-C) | C (T-T) | D (T-C) |
|---|---|---|---|---|
| Xinyang brown (194) | 0.5274 | 0 | 0.0576 | 0.4150 |
| Hy-line brown (42) | 0.1631 | 0 | 0.2717 | 0.5652 |
| Luqin (55) | 0.2091 | 0.0091 | 0.5091 | 0.2727 |
| Wenchang (66) | 0.4091 | 0 | 0.4545 | 0.1364 |
| Shouguang (49) | 0.5511 | 0 | 0.3673 | 0.0816 |
Association of Diplotypes with Egg Production Traits
Associations between the polymorphisms at −2215 and −1959 sites of chicken CCT6A gene and egg production traits (AFE and E28) were analyzed in Xinyang brown chicken population (Table 4). The results indicated that individuals with diplotype AD laid more eggs at 28 weeks (E28) than the ones with diplotype AA and DD (P<0.05), however its effect on AFE was not significant (P>0.05) (Table 4).
Table 4. Least squares means for age at first egg (AFE) and egg number at 28 weeks of age (E28) among diplotypes in the promoter region of the CCT6A gene in Xinyang brown hens.
| Diplotypes | No. of birds | AFE | E28 |
|---|---|---|---|
| AA (C-T/C-T) | 72 | 161.7±0.9 | 25.3±0.9b |
| AD (C-T/T-C) | 50 | 158.4±1.7 | 29.8±1.1a |
| DD (T-C/T-C) | 58 | 161.7±1.4 | 26.8±1.3ab |
| P value | 0.0863 | 0.0182 |
Data with different superscript letters are significantly different (P<0.05).
Comparison of mRNA Expression of CCT6A Gene in Follicles from Hens with Different Haplotypes
The mRNA expression of chicken CCT6A gene in F1, F5 and POF1of 200-day-old Hy-line brown hens was analyzed and compared among hens carrying diplotypes AA, AD and DD. The results indicated that, CCT6A mRNA level was the highest in birds carrying diplotype AD than that in the ones carrying diplotypes AA and DD, respectively (P<0.05) (Fig. 2).
Fig. 2.
Comparison of mRNA expression of chicken CCT6A gene in F1 (the biggest hierarchy follicle with mean diameter of about 33.75 mm), F5 (the smallest hierarchy follicle with mean diameter of about 12.60 mm) and POF1 (the newly post-ovulatory follicle) of 200-day-old Hy-line hens with diplotypes AA (n=3), AD (n=4) and DD (n=4). Means±SD were calculated for each diplotype. Bars with different superscript letters (a, b or A, B) mean significantly different (P <0.05 or P<0.01).
Discussion
The reported function of CCT6A, as a hetero-oligomeric molecular chaper one, is to assist the folding of cytoplasmic proteins. Studies showed that its expression is related to tumor in human cancer cell lines (Myung et al., 2004; Zhang and Lin, 2006) and reproduction in mice (Dun et al., 2011). Its role in bird reproduction was primarily recognized by two studies from our group finding that its expression is consistent with follicle growth and ovulation (Kang et al., 2012; Wei et al., 2013). We also found that the expression of chicken CCT6A is regulated by progesterone and follicle stimulating hormone, and a progesterone response element was located in its distal promoter region (Wei et al., 2013). In this study, the polymorphisms in chicken CCT6A promoter region and their genetic effects on egg production and mRNA expression were further analyzed.
Two novel SNPs in the distal promoter of chicken CCT6A gene (g.−2215 T>C and g.−1959 T>C) were observed in five chicken breeds (lines). Totally four haplotypes and six diplotypes were detected in these populations. The distribution of haplotypes A, B, C and D were remarkably different in high-egg-production chicken breed (Hy-line brown and Xinyang brown), broilers (Luqin synthetic broiler line) and two Chinese indigenous chicken breeds (Wenchang and Shouguang). To analyze associations of diplotypes with egg production traits, we obtained a population by crossing heterozygous Xinyang brown chickens at these two polymorphic sites. The results showed that, compared with diplotypes AA and DD, diplotype AD was associated with higher E28 and lower AFE, suggesting that dominant effect exists at these two sites of chicken CCT6A gene. Complex quantitative traits of animals are affected not only by single SNP, but also by SNP-SNP interactions of candidate genes (Huang et al., 2011). Because the two SNPs identified in this study are located at −2215 and −1959 of chicken CCT6A gene, they might affect transcription level via altering the thanscription factor binding capacity, and, the higher expression of CCT6A mRNA in diplotype AD hens is likely caused by the interactions between transcription factors binding to these two sites. Consistently, diplotype AD was also predominant in commercial laying hens with high egg production, i.e. Xinyang brown and Hy-line brown chicken populations.
We further compared the mRNA expression of chicken CCT6A gene in follicles among Hy-line brown hens of different diplotypes as neither ovary nor follicle tissues of Xinyang brown hens were available. In the F1, F5, and POF1 follicles, significant differences in CCT6A mRNA expression were detected among diplotypes AA, AD and DD, the mRNA expression of CCT6A being the highest in diplotype AD birds and the lowest in diplotype DD birds. The mRNA expression of CCT6A in the F1, F5, and POF1 follicles is consistent with its effect on egg production at 28 weeks (E28). In our previous study, the highest mRNA level of chicken CCT6A gene was also found in Hy-line brown ovary during peak egg laying stage (Kang et al., 2012). In another study, we found a significant higher expression of CCT6A mRNA in theca cells than in granulosa cells of chicken ovarian follicle, and in theca cells, knock-down of CCT6A decreased Bcl-2 expression (Yang et al., 2015), suggesting that CCT6A likely affect egg production by stimulating the proliferation of theca cells. Wei et al. (2013) found that progesterone can activate CCT6A transcription by the progesterone response element (PRE) located from −2056 to −2051 of chicken CCT6A gene promoter. The two mutations at −2215 and −1959 sites reported by this study were located at the 5′-and 3′-flanking regions of PRE of the distal promoter of chicken CCT6A gene, respectively; therefore, may interfere the binding of PGR or other transcriptional factors to the promoter, or interact with other polymorphisms regulating CCT6A gene expression, which requires further studies.
In conclusion, haplotypes caused by two single nucleotide polymorphisms (SNPs) at the −2215 and −1959 sites of chicken CCT6A gene promoter were revealed. The frequencies of haplotypes and diplotypes were different between chicken breeds (lines) differing in egg production. Individuals with diplotype AD laid more eggs at 28 weeks than the ones with diplotypes AA and the mRNA expression of CCT6A in diplotype AD birds is the highest in F1, F5, and POF1 follicles of Hy-line brown hens. These results suggest that the two SNPs in the distal promoter region of chicken CCT6A gene could be used as DNA markers in chicken breeding to improve egg production trait.
Acknowledgments
This work was supported by the National Natural Science Foundation of China (No. 31272435), Agricultural Elite Breeds Project of Shandong Province (2015) and the Innovation and Application Research of Poultry Grant of Shandong province. We appreciate the help from Huaxiang Yan and Changsuo Yang for collecting Xinyang brown chicken samples.
References
- Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics, 32: 314 1980. [PMC free article] [PubMed] [Google Scholar]
- Dun MD, Smith ND, Baker MA, Lin M, Aitken RJ, Nixon B. The chaperonin containing TCP1 complex (CCT/TRiC) is involved in mediating sperm-oocyte interaction. Journal of Biological Chemistry, 286: 36875-36887. 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang Y, He H, Wang J, Li Z, Lan X, Lei C, Zhang E, Zhang C, Wang J, Shen Q. Sequence variants in the bovine nucleophosmin 1 gene, their linkage and their associations with body weight in native cattle breeds in China. Animal Genetics, 42: 556-559. 2011. [DOI] [PubMed] [Google Scholar]
- Hynes G, Kubota H, Willison KR. Antibody characterisation of two distinct conformations of the chaperonin-containing TCP-1 from mouse testis. FEBS Letters, 358: 129-132. 1995. [DOI] [PubMed] [Google Scholar]
- Kang L, Zhang Y, Zhang N, Zang L, Wang M, Cui X, Jiang Y. Identification of differentially expressed genes in ovaries of chicken attaining sexual maturity at different ages. Molecular Biological Report, 39: 3037-3045. 2012. [DOI] [PubMed] [Google Scholar]
- Kim M, Seo D, Ko Y. Relationship between egg productivity and insulin-like growth factor-I genotypes in Korean native Ogol chickens. Poultry Science, 83: 1203-1208. 2004. [DOI] [PubMed] [Google Scholar]
- Kubota H, Hynes G, Carne A, Ashworth A, Willison K. Identification of six Tcp-1-related genes encoding divergent subunits of the TCP-1-containing chaperonin. Current Biology, 4: 89-99. 1994. [DOI] [PubMed] [Google Scholar]
- Kubota H, Hynes G, Willison K. The eighth Cct gene, Cctq, encoding the theta subunit of the cytosolic chaperonin containing TCP-1. Gene, 154: 231-236. 1995. [DOI] [PubMed] [Google Scholar]
- Livark K, Schmittgen T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods, 25: 402-408. 2001. [DOI] [PubMed] [Google Scholar]
- Myung JK, Afjehi-Sadat L, Felizardo-Cabatic M, Slavc I, Lubec G. Expressional patterns of chaperones in ten human tumor cell lines. Proteome Science, 2: 8 2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nei M. Analysis of gene diversity in subdivided populations. Proceedings of the National Academy of Science of the United States of America, 70: 3321-3323. 1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rommelaere H, Van Troys M, Gao Y, Melki R, Cowan NJ, Vandekerckhove J, Ampe C. Eukaryotic cytosolic chaperonin contains t-complex polypeptide 1 and seven related subunits. Proceedings of the National Academy of Science of the United States of America, 90: 11975-11979. 1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Satish L, Johnson S, Wang JH, Post JC, Ehrlich GD, Kathju S. Chaperonin containing T-complex polypeptide subunit eta (CCT-eta) is a specific regulator of fibroblast motility and contractility. PLoS One, 5: e10063 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stephens JC, Schneider JA, Tanguay DA, Choi J, Acharya T, Stanley SE, Jiang R, Messer CJ, Chew A, Han J-H. Haplotype variation and linkage disequilibrium in 313 human genes. Science, 293: 489-493. 2001. [DOI] [PubMed] [Google Scholar]
- Sternlicht H, Farr GW, Sternlicht ML, Driscoll JK, Willison K, Yaffe MB. The t-complex polypeptide 1 complex is a chaperonin for tubulin and actin in vivo. Proceedings of National Academy of Science of the United States of America, 90: 9422-9426. 1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wei Q, Zhu G, Cui X, Kang L, Cao D, Jiang Y. Expression of CCT6A mRNA in chicken granulosa cells is regulated by progesterone. General and Comparative Endocrinology, 189: 15-23. 2013. [DOI] [PubMed] [Google Scholar]
- Yang C, Du Y, Jiang Y. The effect of CCT6A on the expression of Bcl-2 and caspase-3 in theca cells of chicken follicles. Chinese Journal of Biochemistry and Molecular Biology (in Chinese), 31: 763-769. 2015. [Google Scholar]
- Zhang Y, Lin Q. Progesterone-modulated proteins in human endometrial cancer cell line Ishikawa. Nan Fang Yi Ke Da Xue Xue Bao (in Chinese), 26: 1110-1113. 2006. [PubMed] [Google Scholar]