Skip to main content
PMC home page
The Journal of Poultry Science logoLink to The Journal of Poultry Science
. 2016 Apr 25;53(2):118–123. doi: 10.2141/jpsa.0140071

Expression of Lipid Metabolism-Associated Genes in Male and Female White Feather Chicken

Yunjie Tu 1,✉, Yijun Su 1, Guohui Li 1, Xueyu Zhang 1, Haibing Tong 1
PMCID: PMC7477282  PMID: 32908373

Abstract

Differential lipid metabolic requirements of sexually-mature males and females may influence the regulation of lipid metabolism-associated genes and hence the content of adipose tissue. We measured the expression of eight lipid metabolism-associated genes (fatty acid synthase, FASN; acylglycerol- 3- phosphate O-acyltransferase 9, AGPAT9; peroxisomal proliferator-activated receptor γ, PPARγ; lipoprotein lipase, LPL; carnitine palmitoyl transferase 1 A, CPT1A; carnitine palmitoyl transferase 1 B, CPT1B; acyl-COA dehydrogenase long chain, ACADL; monoglyceride lipase, MGL) in eight tissues (hypothalamus, HYP; liver; heart; pectoralis major muscle, PM; gastrocnemius muscle, GAS; abdominal fat, AF; clavicular fat, CF; subcutaneous fat, SF) of five male and five female white feather chickens using real time PCR at 217 d (when the females were at peak egg production). There were no difference between sexes, nor were there sex by tissue interactions for CPT1A and MGL. In both cases expression was greater for liver than the other tissues. When interactions of sex by tissue were significant, the FASN mRNA abundance in HYP, liver, and PM was greater for females than males. There was no sexual dimorphism for any tissue for PPARγ. Overall values were greater for adipose depots than HYP and liver with muscles intermediate for AGPAT9. LPL mRNA abundance in PM and AF was greater for females than males, with the pattern reversed for heart and SF. CPT1B mRNA abundance in GAS and CF was greater for females than males, with the relationship reversed for liver. ACADL mRNA abundance in HYP, liver, and GAS was greater for females than males, and lower in PM than males. The results demonstrated that expression of lipid metablism–associated genes varies among sexes in mature chickens depending on the gene and the tissue.

Keywords: chickens, gene expression, lipid metablism-associated genes, metabolism path way, real time PCR

Introduction

The triglyceride content of a cell is regulated by the balance between fat deposition (lipogenesis) and hydrolysis (lipolysis). Accumulation of adipocytes through enhanced rates of cellular differentiation, a process known as adipogenesis, also influences the neutral lipid content of a tissue. Lipid-metabolic genes, including those involved in lipogenesis, can influence the rate of these processes and hence the content of tissue fat. Because of high growth rate and large deposition of fat in the abdomen, the chicken has been used as a model organism for understanding lipid metabolism, fattening and growth (Stern, 2005; Lee et al., 2008). Because egg production causes major changes in the metabolism of lipids to meet the demands of yolk formation (Richards et al., 2003), it is important to understand underlying genetic mechanisms governing lipid metabolism especially at the peak phase of egg production. Birds have the ability to store large quantities of excess energy (in the form of triglycerides) in the liver, adipose tissue and in the yolk of developing oocytes (Hermier, 1997). Lipogenesis takes place primarily in the liver of birds (Leveille et al., 1975) and involves a series of linked enzyme catalyzed reactions including glycolysis, the citric acid cycle and fatty acid synthesis. Fatty acid synthase (FASN) has synthesis of long-chain fatty acids functions in lipid metablism pathways. In chickens, like in humans (Dorn et al., 2010), FASN primarily occurs in the liver (Demeure et al., 2009). Fatty acid esterification includes some holding functional genes such as acylglycerolphosphate acyltransferase 9 (AGPAT9) (Bitou et al., 1999), and peroxisomal proliferator-activated receptor γ (PPARγ) (Wang et al., 2008). Among genes involved in lipid uptake, lipoprotein lipase (LPL) has an important role in chicken and mice (Merkel et al., 1998). Carnitine palmitoyl transferase 1A (CPT1A), carnitine palmitoyl transferase 1B (CPT1B), and acyl-COA dehydrogenase long chain (ACADL) have fatty acid oxidation functions of skeletal muscle in chicken (He et al., 1992; Wu et al., 2012; Lorzadeh et al., 2013), and monoglyceride lipase (MGL) has a role in lipolysis of adipose tissue in chicken and mice (Tashler et al., 2011). Differential metabolic requirements of sexually-mature males and females may influence the regulation of these genes and body composition in the rat (Kushlan et al., 1981; Capel and Smallwood, 1983), fish (Shrestha et al., 2013), and hens (Moradi et al., 2013). Although there are reports on lipid metabolism-associated gene expression of some tissues in chickens (Karpe et al., 1998; Meng et al., 2005; Lorzadeh et al., 2013), data for sexually-mature males and females is scarce. In this study we investigated expression of lipid metabolism-associated genes in different tissues of white feather chicken at the time of peak egg production, a time of considerable lipid activity.

Materials and Methods

Chickens and Husbandry

In 1999 a white feather chicken population of 2,800 females and 800 males was introduced from the SASSO Company in France by the Poultry Institute, Chinese Academy of Agricultural Sciences. Since then it has been maintained as a closed population conserved in National Chicken Genetic Resources (NCGR). It belongs to a white feather broiler, and was bred from White Plymouth Rocks. The plumage is recessive white with light yellow skin and shank colors. Eggshell color is a pale brown, and the population is segregating for early and late feathering. The average BW of males and females at 42 d is approximately 1,015 and 865 g, respectively, and at 84 d is approximately 2,340 and 1,891 g, respectively, and they are consistent with those for the population as reported by Wang et al. (2006). The flock of egg production was at 80% when sampled at 217 d. Egg number to 63 w is 175. The white feather chicken has been used as a parent of quality chicken breeding in China.

The procedures for this experiment were approved by the Institutional Animal Care and Use Committee at Chinese Academy of Agricultural Sciences. Management requirements were in accordance with the white feather chicken meat Breeder Management Guidelines. Chicks were reared in sex-intermingled flocks in floor pens with wood shaving for litter. They were weighed, sexed, and moved to separate floor pens with wood shavings litter at 42 d. Chickens were transferred to individual cages at 140 d.

Diets, fed in mash form, were 20% crude protein (CP), 12.12 MJ/kg metabolically energy (ME), 1.0% Ca, 0.5% P, 0.44% Met, and 0.95% Lys from hatch to 42 d, and 14% CP, 11.5 MJ/kg ME, 1.0% Ca, 0.45% P, 0.34% Met, and 0.70% Lys from 42 d to 140 d. Thereafter, the diet consisted of 15% CP, 11.5 MJ/kg ME, 3.2% Ca, 0.45% P, 0.37% Met, and 0.90% Lys. These diets have remained constant during selection and are free of antibiotics.

In chickens, after hatch a dramatic increase in fatty acid oxidation occurs in the heart, which has been attributed to an increase in L-carnitine levels and a switch from the liver to muscle (Lorzadeh et al., 2013). The liver is the major tissue of lipid synthesis, and the lipid is transported to adipose tissue, the major tissue of lipid storage (Demeure et al., 2009). The hypothalamus has the capacity to “talk” with adipose tissue to regulation of energy metabolism (Zhang et al., 2014). Muscle is an important part of the chicken and relevant part thereafter life. Therefore, we chose these 8 kinds of tissue: liver, hypothalamus (HYP), heart, pectoralis major (PM), gastrocnemius muscle (GAS), abdominal fat (AF); clavicular fat (CF), and subcutaneous fat (SF) to investigate the genes expression.

At 217 d, 5 males and 5 females were randomly selected and their BW (g) recorded at 4 h post feed-withdrawal. After cervical dislocation and decapitation, the HYP was isolated following the description of Xu et al. (2011). It was wrapped in aluminum foil, placed in liquid nitrogen and transferred to −80°C for storage until RNA isolation. The body cavity was opened and a 300 mg aliquot of the liver (left lobe), heart, PM, GAS, AF, CF, and SF was removed, immediately frozen in liquid nitrogen, and stored at −80°C for subsequent analysis. CF was the fat above the left side of the clavicle, and SF was obtained from the left side of the chicken from the skin of the peritoneum. The PM was removed from the left side of the keel as a longitudinal strip, while the GAS was isolated from the left leg.

RNA Isolation and cDNA Synthesis

Total RNA was isolated from each of the tissues sampled on individual chickens (300 mg of adipose tissue; about 100 mg of all other tissue types) using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The RNA quality was determined by UV absorbance ratio at 260 and 280 nm. Extracted RNA samples were stored at −80°C.

The complementary DNA was synthesized from 20 ng/µL of total RNA by PrimeScript® 125 reverse transcription Master Mix 126 Perfect Real Time (Takara, Dalian, China) according to the manufacturer's protocol. The reaction volume was 20 µL, and contained 2 µL reverse transcription buffer, 2 µL Randomprim ers, 4 µL dNTP at 2.5 mM, 1 µL reverse transcriptase, and 11 µL RNA (20 ng/µL). Reaction conditions for reverse transcription were as follows: 25°C for 10 min, 37°C for 120 min, 85°C for 5s, and the kept at 4°C. The cDNA sample was then diluted 8-fold with nuclease free water and stored at −20°C before proceeding with real time PCR.

Primers

The chicken-specific primers were designed with Primer Express software (Table 1), for lipid metabolism-associated genes including FASN, PPARγ, AGPAT9, LPL, CPT1A, CPT1B, ACADL, and MGL. Primers were synthesized by Sangon Biotech Co., Ltd (Shanghai, China). Primer amplification efficiency was validated for β-actin and all target genes, with efficiencies that ranged from 95 to 105%. Specificities were confirmed by melting curve analyses (60°C) performed on each sample. β-actin was chosen as the housekeeping gene across tissues and between sexes.

Table 1. Primers for real time PCR1.

Gene symbol Sequence 5′→3′ Amplicon size/ bp Location Genbank ID
FASN F: CCATTGCACCAGCACTACTCA 59 785–805 NM_205155
R: ACGAGGCTTAGGGTGTGGAA 824–843
PPARγ F: CACTGCAGGAACAGAACAAAGAA 67 806–828 NM_001001460
R: TCCACAGAGCGAAACTGACATC 851–872
AGPAT9 F: CCCATAGATGCGATCATTTTGA 61 787–808 NM_001031145
R: CGTGAACTTGGCCAACCAT 829–847
LPL F: GACAGCTTGGCACAGTGCAA 62 298–317 NM_205282
R: CACCCATGGATCACCACAAA 340–359
CPT1A F: GCCCTGATGCCTTCATTCAA 60 1807–1826 NM_001012898
R: ATTTTCCCATGTCTCGGTAGTGA 1844–1866
CPT1B F: TGCTGCTTCCAATTCGACG 68 72–90 DQ314726
R: TGCAGCGCGATCTGAATG 140–157
ACADL F: GACATCGGCACTCGGAAGA 60 148–166 NM_001006511
R: CCTGGTGCTCTCCCTGAAGA 188–207
MGL F: GCGGACGAGCGTAGACTCA 55 1597–1615 XM_414365
R: GGGAATAGCCTGGTTTGCAA 1631–1651
β-actin F: GTCCACCGCAAATGCTTCTAA 58 1176–1196 NM_205518.1
R: TGCGCATTTATGGGTTTTGTT 1233–1253
Open in a new tab
1

F: Forward; R: Reverse.

FASN=fatty acid synthase, PPARγ=peroxisomal proliferator-activated receptor γ, AGPAT9=acylglycerol- 3-phosphate O-acyltransferase 9, LPL=lipoprotein lipase, CPT1A=carnitine palmitoyl transferase 1 A, CPT1B=carnitine palmitoyl transferase 1 B, ACADL=acyl-COA dehydrogenase long chain, MGL=monoglyceride lipase.

Real Time PCR

Real time PCR was performed with Fast SYBR Green Master Mix (ABI 4385612, USA), 96-well thin-walled plates (ABI 4346906, USA), and ABI Prismoptical seals (ABI 4311971, USA) using a 7500 FAST system. Reactions were performed in duplicate for each sample in 10 µL volumes, including 5 µL Fast SYBR Green Master Mix, 0.25 µL forward and reverse primers (5 µM stocks), respectively, 3 µL of diluted cDNA, and 1.5 µL of nuclease free water. The real time PCR conditions were 95°C for 20 s, followed by 40 cycles at 95°C for 30 s, 60°C for 30 s, and final steps of 95°C 15 s, 60°C 1 m in, 95°C 15 s for melting curve analysis.

Statistical Analysis

The average of the duplicate Ct values were analyzed using the 2−ΔΔCt method (Livak and Schmittgen, 2001), where beta actin Ct data were used to calculate ΔCt (Cttarget−Ctbeta actin) with the mean of liver for males used as the calibrator sample to calculate ΔΔCt (ΔCtX group−ΔCtcalibrator) within a gene. Relative quantity (RQ) was calculated (2−ΔΔCt).

Data were analyzed using ANOVA and JMP Version 9.2 (SAS Institute, Inc., Cary, NC, USA). The statistical model included the main effects of tissue, sex, and the interaction between them. The statistical model was yij=μ+Si+Tj+(ST)ij+εij, where yij was the dependent variable of gene mRNA abundance, Si, Tj and (ST)ij were the fixed effect of sex, tissues, and the two way interaction, respectively, with εij as the random error. Tukey's test was used as a post-hoc test for pairwise comparisons and differences considered significant at P<0.05. Body weights were compared by one-way ANOVA with sex as the main variable. When tissue by sex interactions was significant comparisons were by the Paired sample T-test using SPSS 16.0 version. All values were shown as means±SEM.

Results

Body Weights

There was sexual dimorphism for BW (P<0.05) at 217 d. Means and SEM for BW at 217 d were 3,009±150 g and 2,257±180 g for males and females, respectively.

Lipid Metabolism-associated Factor mRNA Abundance in Different Tissues of Males and Females

The UV absorbance ratio at 260 and 280 nm of total RNA was 1.8–2.0. Of the eight genes studied there were significant sex by tissue interactions for all but CPT1A and MGL. For these two genes, values were similar for males and females (Table 2). Among tissues, CPT1A values for liver were significantly higher than those for the other tissues which did not differ and for MGL value for heart was highest (Table 2).

Table 2. Least squares means±SEM in mRNA abundance of genes in tissues where there were no sexual dimorphism or sex by tissue interactions.

Tissue Gene
Carnitine palmitoyl transferase 1 A Monoglyceride lipase
Hypothalamus 0.25b 0.35b
Liver 2.09a 1.28a
 
Heart 0.78b 1.38a
Ppectoralis major muscle 0.39b 0.17b
Ggastrocnemius muscle 0.34b 0.17b
 
Abdominal fat 0.27b 0.07b
Clavicular fat 0.28b 0.13b
Subcutaneous fat 0.45b 0.27b
SEM 0.12 0.11
Open in a new tab
a, b

Different lower case letters within a column indicates a significant difference between tissues (P<0.05).

When interactions of sex by tissue were significant (Table 3) the FASN mRNA abundance in HYP, liver, and PM was greater (P<0.05) for females than males, with no difference between sexes for any of the other tissues. Within males there was consider overlapping among tissues with a clear significance of HYP>PM. In contrast for females there were clear differences with liver>HYP> the remaining tissues.

Table 3. Least squares means±SEM of mRNA abundance of genes where tissue by sex interactions were significant.

Fatty acid synthase Peroxisomal proliferator-activated receptor γ Acylglycerol- 3-phosphate O-acyltransferase 9 Lipoprotein lipase Carnitine palmitoyl transferase 1 B Acyl-COA dehydrogenase long chain
Tissue Male Female Male Female Male Female Male Female Male Female Male Female
Hypothalamus 1.25a* 2.90b 0.14c 0.45bc 0.71c 0.84c 0.05c 0.12d 5.60c 9.63b 1.56cd* 5.99b
Liver 0.76abc* 7.72a 0.43c 0.49bc 1.22bc 0.64c 0.37c 0.24cd 3.85c* 0.06c 3.71bc* 7.56b
 
Heart 1.01ab 0.93c 1.39c 0.39c 1.39bc 1.18bc 11.69a* 6.23a 59.50a 73.46a 5.60b 2.49c
Pectoralis major muscle 0.04c* 0.24c 0.32c 0.73bc 3.30ab 1.57bc 0.04c* 0.30d 46.24ab 68.30a 1.18cd* 0.23c
Gastrocnemius muscle 0.99ab 0.52c 4.72bc 1.89bc 1.60bc 1.56bc 0.49c 0.28cd 45.21ab* 534.47b 9.48a* 15.01a
 
Abdominal fat 0.35bc 0.89c 7.54ab 3.63bc 4.96a 7.23a 0.49c* 2.45bc 23.67abc 16.42b 0.60cd 0.44c
Clavicular fat 0.70abc 1.12c 11.78a 18.00a 1.91bc 3.44bc 4.59b 3.42b 10.10bc* 23.04b 0.94d 1.84c
Subcutaneous fat 0.63abc 0.56c 7.29ab 6.29b 3.35ab 3.81b 0.57c* 0.19d 35.70abc 40.65b 2.43cd 1.80c
SEM 0.18 0.30 1.13 1.27 0.51 0.62 0.75 0.49 8.00 26.69 0.65 0.76
Open in a new tab
a, b, c, d

Values within a column with different superscripts differ significantly (P<0.05).

*

Significant difference (P<0.05) between columns.

Although there was no sexual dimorphism for any tissue for PPARγ, the pattern for males was greater expression in adipose than the other tissues. Although this general pattern existed for females the overlap was greater than for males. As with PPARγ, there was a lack of sexual dimorphism for AGPAT9. Overall values were greater for the adipose depots than HYP and liver with muscles intermediate.

LPL mRNA abundance in PM and AF was greater (P<0.05) for females than males, with the pattern reversed for heart and SF. Within males the pattern was heart>CF>the other tissues, although for females general pattern was the same differences were not as delineated. CPT1B mRNA abundance in GAS and CF was greater (P<0.05) for females than males, with the relationship reversed for liver. Within males abundance was greater for heart, PM, GAS than HYP and liver with adipose tissues intermediate. For females the ordering was GAS>heart, PM, SF, CF, AF, HYP>liver.

Expression of ACADL mRNA abundance was greater in the GAS than any of the other tissues. Although ACADL mRNA abundance in HYP, liver, and GAS was greater (P<0.05) for females than males, in PM it was lower in females than males. For other tissues, males and females were similar. Within males values were greatest for GAS and least for AF with overlapping. In contrast for females the differences were clear with GAS>liver, HYP> the other tissues.

Discussion

In this study the mRNA abundance of eight lipid metabolic genes in eight tissues were compared for males and females, a time when the later were at peak production and lipid metabolism should be great, due to yolk production. FASN mRNA abundance in HYP, liver, and PM was greater for females than males. FASN catalyzes the last step in fatty acid biosynthesis, it is a major determinant of the maximal hepatic capacity to generate fatty acids by de novo lipogenesis (Kusakabe et al., 2000). This is especially relevant in chickens where the liver is the major site of de novo lipogenesis (Demeure et al., 2009), along with a sizable contribution from bone (Yalcin et al., 2012). Consistent with those findings, we observed at peak lay that FASN mRNA abundance in liver was greater for females than males, and with expression in the liver was greater than in the other tissues. While for males, FASN is expressed in HYP, heart as much as in liver. The metabolic requirements of females and males are thus different, and by this age excess fat deposition is essential to support reproduction during peak lay.

PPARγ is a ligand-activated transcription factor that belongs to the steroid receptor superfamily (Tontonoz and Spiegelman, 2008) and is predominantly expressed in adipose tissue where it is a major inducer of differentiation and adipogenesis (Meng et al., 2005; Kilroy et al., 2012). Thus, it is not surprising that its mRNA was relatively more abundant in adipose than other tissues.

Fatty acid esterification enhances TG synthesis and may be associated with increased content of muscle fat (Ji et al., 2012). Lysophosphatidic acid is further acylated at the sn-2 position by AGPAT to form phosphatidic acid (Bitou et al., 1999). In the next step, the phosphate group is removed by phosphatidate phosphohydrolase to produce diacylglycerol. Accordingly, in females AGPAT9 mRNA abundance in adipose depots was greater than in the other tissues measured.

Among lipid uptake genes, the mRNA abundance of the LPL gene was highly expressed in the hearts of males. Lipoprotein lipase is a rate-limiting enzyme for the hydrolysis of the triacylglycerol (TG) core of circulating TG-rich lipoproteins, chylomicrons, and very-low-density lipoprotein (VLDL). LPL-catalyzed reaction products, fatty acids, and monoacylglycerol are transported into adipose tissue and skeletal muscle and stored as neutral lipids (Wang and Eckel, 2009). Our results that abundance was greatest in expression of LPL in heart were consistent with previous reports (Karpe et al., 1998), although our values were lower in the other tissues.

The two main isoforms of CPT1 are the liver isoform (CPT1A) and the muscle isoform (CPT1B) (Park et al., 1998). CPT1A is expressed in most tissues, but not in skeletal muscle, whereas CPT1B is expressed in muscles and adipocytes (Cook and Park, 1999; Jackson-Hayes et al., 2003). That mRNA abundance of the CPT1A gene was more strongly expressed in liver was consistent with previous reports. Our results that CPT1B and ACADL mRNA abundance was greatest expression in GAS of females than the other sex and tissue combinations suggest that the subsequent increased fatty acid oxidation may contribute to decreasing lipid deposition in the chicken. CPT1B and ACADL were differentially expressed in GAS and PM. The increased expression in GAS and reduced expression in PM is consistent with an increased food intake in the females and at the same time reduced fatty acid oxidation in PM yielding a net accumulation of fat storage in PM during peak lay. The results presented in this study were consistent with Ka et al. (2013).

Within cells monoglycerides are derived from the hydrolysis of glycerophospholipids or TG. Glycerophospholipids may be degraded by phospholipase C generating sn-1, 2-diacylglycerols, which are further hydrolyzed by sn-1-specific diacylglycerols lipase resulting in the formation of 2-monoglyceride (Gao et al., 2010). The enzyme is expressed in most cell types and is considered the rate-limiting enzyme in the degradation of monoglycerides (Karlsson et al., 2000). Hence, MGL mRNA abundance in liver was greater than all the other tissues except for heart.

In conclusion, our results suggested that FASN, PPARγ, AGPAT9, LPL, CPT1B, and ACADL mRNA abundance was influenced by sex and tissue combinations when hens are at peak lay. Liver FASN plays an important role in the synthesis of fatty acid, and GAS of CPT1B and ACADL are important to fatty oxidation, particularly in laying females.

Acknowledgments

The current research was funded in part by the National Natural Science Foundation of China (31402032), Sixth talent peaks project in Jiangsu Province (2014-NY-004), the National 863 project in China (2011AA100305-J-09), National agricultural science and technology achievement transformation project funds (2011GB2C100006), the National Natural Science Foundation of China (31372277).

References

  1. Bitou N, Ninomiya M, Tsujita T, Okuda H. Screening of lipase inhibitors from marine algae. Lipids, 34: 441-445. 1999. [DOI] [PubMed] [Google Scholar]
  2. Capel ID, Smallwood AE. Sex differences in the glutathione peroxidase activity of various tissues of the rat. Research Communications in Chemical Pathology and Pharmacology, 40: 367-378. 1983. [PubMed] [Google Scholar]
  3. Cook GA, Park EA. Expression and regulation of carnitine palmitoyltransferase-Iα and -Iβ genes. Aminal Journal of Medicine Sciences, 318: 43-48. 1999. [DOI] [PubMed] [Google Scholar]
  4. Demeure O, Duby C, Desart C, Assaf S, Hazard D, Guillou H, Lagarrigue S. Liver X receptor α regulates fatty acid synthase expression in chickens. Poultry Science, 88: 2628-2635. 2009. [DOI] [PubMed] [Google Scholar]
  5. Dorn C, Riener MO, Kirovski G, Saugspier M, Steib K, Weiss TS, Gäbele E, Kristiansen GK, Hartmann A, Hellerbrand C. Expression of fatty acid synthase in nonalcoholic fatty liver disease. International Journal of Clinical and Experimental Pathology, 3: 505-514. 2010. [PMC free article] [PubMed] [Google Scholar]
  6. Gao Y, Vasilyev DV, Goncalves MB, Howell FV, Hobbs C, Reisenberg M, Shen R, Zhang MY, Strassle BW, Lu P, Mark L, Piesla MJ, Deng K, Kouranova EV, Ring RH, Whiteside GT, Bates B, Walsh FS, Williams G, Pangalos MN, Samad TA, Dohery P. Loss of retrograde endocannabinoid signaling and reduced adult neurogenesis in diacylglycerol lipase knock-out mice. Journal of Neuroscience, 30: 2017-2024. 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. He XY, Yang SY, Schulz H. Inhibition of enoyl-CoA hydratase by long-chain L-3-hydroxyacyl-CoA and its possible effect on fatty acid oxidation. Archives of Biochemistry and Biophysics, 298: 527-531. 1992. [DOI] [PubMed] [Google Scholar]
  8. Hermier D. Lipoprotein metabolism and fattening in poultry. Journal of Nutrition, 127: 805S-808S. 1997. [DOI] [PubMed] [Google Scholar]
  9. Jackson-Hayes L, Song S, Lavrentyev EN, Jansen MS, Hillgartner FB, Tian L, Wood PA, Cook GA, Park EA. A thyroid hormone response unit formed between the promoter and first intron of the carnitine palmitoyltransferase-I α gene mediates the liver-specific induction by thyroid hormone. Journal of Biological Chemistry, 278: 7964-7972. 2003. [DOI] [PubMed] [Google Scholar]
  10. Ji B, Ernest B, Gooding JR, Das S, Saxton AM, Simon J, Dupont J, Metayer-Coustard S, Campagna SR, Voy BH. Transcriptomic and metabolomic profiling of chicken adipose tissue in response to insulin neutralization and fasting. BMC Genomics, 13: 441 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ka S, Markljung E, Ring H, Albert FW, Harun-Or-Rashid M, Wahlberg P, Garcia-Roves PM, Zierath JR, Denbow DM, Pääbo S, Siegel PB, Andersson L, Hallböök F. Expression of carnitine palmitoyl-CoA transferase-1B is influenced by a cis-acting eQTL in two chicken lines selected for high and low body weight. Physiological Genomics, 45: 367-76. 2013. [DOI] [PubMed] [Google Scholar]
  12. Karlsson M, Tornqvist H, Holm C. Expression, purification, and characterization of histidine-tagged mouse monoglyceride lipase from baculovirus-infected insect cells. Protein Expression and Purification, 18: 286-292. 2000. [DOI] [PubMed] [Google Scholar]
  13. Karpe F, Olivercrona T, Olivercrona G, Samra JS, Summers LKM, Humphreys SM, Frayn KN. Lipoprotein lipase transport in plasma: role of muscle and adipose tissues in regulation of plasma lipoprotein lipase concentrations. Journal of Lipid Research, 39: 2387-2393. 1998. [PubMed] [Google Scholar]
  14. Kilroy G, Kirk-Ballard H, Carter LE, Floyd ZE. The ubiquitin ligase siah2 regulates PPARγ activity in adipocytes. Endocrinology, 153: 1206-1218. 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kusakabe T, Maeda M, Hoshi N, Sugino T, Watanabe K, Fukuda T, Suzuki T. Fatty acid synthase is expressed mainly in adult hormone-sensitive cells or cells with high lipid metabolism and in proliferating fetal cells. Journal of Histochemistry and Cytochemistry, 48: 613-622. 2000. [DOI] [PubMed] [Google Scholar]
  16. Kushlan MC, Gollan JL, Ma WL, Ocher RK. Sex differences in hepatic uptake of long chain fatty acids in single-pass perfused rat liver. Journal of Lipid Research, 22: 431-436. 1981. [PubMed] [Google Scholar]
  17. Lee KY, Jung KC, Jang BG, Choi D, Jeon JT, Lee JH. Identification of differentially expressed proteins at four growing stages in chicken liver. Asian Australia Journal of Animal Sciences, 10: 1383-1388. 2008. [Google Scholar]
  18. Leveille GA, Romsos DR, Yeh Y, O’Hea EK. Lipid biosynthesis in the chick. A consideration of site of synthesis, influence of diet and possible regulatory mechanisms. Poultry Science, 54: 1075-1093. 1975. [DOI] [PubMed] [Google Scholar]
  19. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using Real-Time quantitative PCR and the 2−ΔΔCT Method. Methods, 25: 402-408. 2001. [DOI] [PubMed] [Google Scholar]
  20. Lorzadeh S, Doosti A, Nilchian S, Doosti A, Kheiri F. Evaluation of CPT-1 Gene expression with treatment diet of L-Carnitine on broiler chicks using real-time PCR assay. Bulgarian Journal of Agricultural Science, 19: 601-605. 2013. [Google Scholar]
  21. Meng H, Li H, Zhao JG, Gu ZL. Differential expression of peroxisome proliferator-activated receptors alpha and gamma gene in various chicken tissues. Domestic Animal Endocrinology, 1: 105-110. 2005. [DOI] [PubMed] [Google Scholar]
  22. Merkel M, Kako Y, Radner H, Cho IS, Ramasamy R, Brunzell JD, Goldberg IJ, Breslow JL. Catalytically inactive lipoprotein lipase expression in muscle of transgenic mice increases very low density lipoprotein uptake: Direct evidence that lipoprotein lipase bridging occurs in vivo. Journal of Biological Chemistry, 95: 13841-13846. 1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Moradi S, Zaghari M, Shivazad M, Osfoori R, Mardi M. The effect of increasing feeding frequency on performance, plasma hormones and metabolites, and hepatic lipid metabolism of broiler breeder hens. Poultry Science, 92: 1227-1237. 2013. [DOI] [PubMed] [Google Scholar]
  24. Park EA, Steffen ML, Song S, Park VM, Cook GA. Cloning and characterization of the promoter for the liver isoform of the rat carnitine palmitoyltransferase I (L-CPT I) gene. Biochemical Journal, 330: 217-224. 1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Richards MP, Poch SM, Coon CN, Rosebrough RW, Ashwell CM, McMurtry JP. Feed restriction significantly alters lipogenic gene expression in broiler breeder chickens. Journal of Nutrition, 133: 707-715. 2003. [DOI] [PubMed] [Google Scholar]
  26. Shrestha B, Javonillo R, Burns JR, Pirger Z, Vertes A. Comparative local analysis of metabolites, lipids and proteins in intact fish tissues by LAESI mass spectrometry. Analyst, 138: 3444-3449. 2013. [DOI] [PubMed] [Google Scholar]
  27. Stern CD. The chick: A great model system becomes even greater. Development of Cell, 8: 9-17. 2005. [DOI] [PubMed] [Google Scholar]
  28. Tashler U, Radner FPW, Heier C, Schreiber R, Schweiger M, Schoiswohl G, Preiss-Landl K, Jaeger D, Reiter B, Koefeler HC, Wojciechowski J, Theussl C, Penninger JM, Lass A, Haemmerle G, Zechner R, Zimmermann R. Monoglyceride lipase deficiency in mice impairs lipolysis and attenuates dietinduced insulin resistance. Journal of Biological Chemistry, 10: 17467-17477. 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tontonoz P, Spiegelman BM. Fat and beyond: the diverse biology of PPARγ. Annual Review of Biochemistry, 77: 289-312. 2008. [DOI] [PubMed] [Google Scholar]
  30. Wang Y, Mu Y, Li H, Ding N, Wang Q, Wang Y, Wang S, Wang N. Peroxisome Proliferator-Activated Receptor-γGene: A key regulator of adipocyte differentiation in chickens. Poultry Science, 87: 226-232. 2008. [DOI] [PubMed] [Google Scholar]
  31. Wang H, Eckel RH. Lipoprotein lipase: from gene to obesity. Endocrinology and Metabolism: American Journal of Physiology, 297: E271-E288. 2009. [DOI] [PubMed] [Google Scholar]
  32. Wang KH, Gao YS, Lu JX, Tong HB. Early development rule of Recessive White chicken. China Poultry, 28: 20-22. 2006. [Google Scholar]
  33. Wu J, Fu W, Huang Y, Ni Y. Effects of kisspeptin-10 on lipid metabolism in cultured chicken hepatocytes. Asian Australasian Journal of Animal Sciences, 25: 1229-1236. 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Xu PW, Siegel PB, Denbow DM. Genetic selection for body weight in chickens has altered responses of the brain's AMPK systemto food intake regulation effect of ghrelin, but not obestatin. Behavioural Brain Research, 221: 216-226. 2011. [DOI] [PubMed] [Google Scholar]
  35. Yalcin S, Bagdatlioglu N, Yenisey C, Siegel PB, Özkan S, Aksit M. Effect of manipulation of incubation temperature on fatty acid profiles and antioxidant enzyme activities in meat-type chicken embryos. Poultry Science, 91: 3260-3270. 2012. [DOI] [PubMed] [Google Scholar]
  36. Zhang W, Cline MA, Gilbert ER. Hypothalamus-adipose tissue crosstalk: neuropeptide Y and the regulation of energy metabolism. Nutrition and Metabolism, 11: 4-12. 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Poultry Science are provided here courtesy of Japan Poultry Science Association

RESOURCES