Skip to main content
New Microbes and New Infections logoLink to New Microbes and New Infections
. 2020 Aug 14;37:100744. doi: 10.1016/j.nmni.2020.100744

Frequency of Mycoplasma pneumoniae, Legionella pneumophila and Chlamydia spp. among patients with atypical pneumonia in Tehran

N Noori Goodarzi 1, MR Pourmand 1,, M Rajabpour 1, M Arfaatabar 2, M Mosadegh 1, SA Syed Mohamad 3
PMCID: PMC7482018  PMID: 32953125

Abstract

Mycoplasma pneumoniae, Legionella pneumophila and Chlamydia pneumoniae are the most common bacterial agents, which account for 15–40%, 2–15% and 5–10% of atypical community-acquired pneumonia (CAP) respectively. These agents are mostly associated with infection in the outpatient setting. The aim of this study was to evaluate the frequency of these pathogens among patients with CAP attending outpatient clinics in Tehran. A cross-sectional study was carried out of 150 patients attending to educational hospitals in Tehran with CAP. M. pneumoniae, L. pneumophila and Chlamydia spp. were detected by PCR assay, targeting the P1 adhesion gene, macrophage infectivity potentiator (mip) gene and 16S rRNA gene respectively from throat swabs obtained from each patient. A total of 86 (57.3%) of 150 patients were women; median age was 50 years (interquartile range, 35–65 years). M. pneumoniae, L. pneumophila and Chlamydia spp. were detected in 37 (24.7%), 25 (16.7%) and 11 (7.3%) patients respectively; of these, 66 patients (44%) were infected at least by one of these three pathogens. The frequency of L. pneumophila was significantly higher among patients over 60 years old (p 0.03). Coinfection was detected in seven patients (4.7%); six were infected by M. pneumoniae and L. pneumophila, and only one was infected by L. pneumophila and Chlamydia spp. M. pneumoniae was the most prevalent agent of atypical CAP, and L. pneumophila was more likely to infect elderly rather than younger people. Further studies on the prevalence of CAP and its aetiologic agents are needed to improve the diagnosis and treatment of CAP patients.

Keywords: Atypical pneumonia, Chlamydia spp., Legionella pneumophila, Mycoplasma pneumoniae, PCR

Introduction

Pneumonia is still a common cause of hospitalization with high mortality. Current clinical guidelines have categorized pneumonia into four types: community acquired (CAP), healthcare associated, hospital acquired [1] and ventilator associated [2]. Among these, CAP is identified as infection in a patient with no recent contact with the healthcare system [3]. Mycoplasma pneumoniae, Chlamydia pneumoniae and Legionella pneumophila are the most common bacterial agents of atypical CAP [4]. M. pneumoniae and L. pneumophila account for 15–40% and 2–15% of atypical CAP in Iran respectively [5,6]. M. pneumoniae and C. pneumoniae are mostly associated with infection in the outpatient setting [7].

M. pneumoniae causes infections in both the upper and lower respiratory tracts. It occurs in all age groups, especially school-age children and young adults [6]. Symptoms of this infection are usually mild, but in some cases it may lead to hospitalization and even death [8]. Moreover, in some cases severe extrapulmonary complications such as neurologic diseases and haemolytic anaemia may occur [9].

C. pneumoniae is more prevalent in children, but cases of serious infection in adults have also been reported [10]. A previous study demonstrated a significant association between the lung cancer and past C. pneumoniae infection [11] as well as an association between this infection and asthma [12,13].

L. pneumophila mainly affects elderly people and more often men than women. This bacterium is rarely differentiated from other atypical pneumonia because it presents similar clinical signs and symptoms [3,10].

The prevalence of these pathogens is usually underestimated as a result of its complex and difficult identification methods [14]. The conventional methods to diagnose these bacteria include culture, rapid antigen testing, serologic methods and molecular techniques [[15], [16], [17]].

M. pneumoniae and L. pneumophila are also two slow-growing bacteria which require complex nutrients for cultivation. Because these bacteria are rarely isolated from specimens, they are neglected in clinical laboratories [7]. In addition to the long incubation time needed to successfully deploy the culture method, M. pneumoniae colonies on agar cannot be differentiated from other mycoplasmas solely by morphology, and further phenotypic tests are required [16].

The reference standard of C. pneumoniae diagnosis by micro immunofluorescence is reported to be time consuming, and it lacks specificity and sensitivity. Serologic kits are commercially available, but these methods also lack specificity and paired sera specimens are required, so they are not optimal for treatment decisions [15,18].

Molecular methods such as PCR are commercially available with high sensitivity and specificity. This method facilitates rapid detection with higher throughput, and results can be obtained in time to guide treatment decisions. Several PCR assays have been developed and have indicated even better sensitivity and specificity than those that use conventional microbiologic methods [19,20].

The aim of this study was to evaluate the frequency of the three most common causes of atypical pneumonia among patients with CAP attending outpatient clinics in Tehran.

Materials and methods

Patient involvement

This study was conducted of patients suspected to have atypical pneumonia who were referred to educational hospitals in Tehran from January to June 2019. The study protocol was approved by the medical ethics committee of Tehran University of Medical Sciences (IR.TUMS.SPH.REC.1397.126), and written informed consent was obtained from all the patients.

Patients were enrolled onto this study according to the physician's decision taking into account the following: relevant results of clinical examination, abnormal breathing sounds, chest radiography, clinical signs and symptoms (nonproductive cough, headache, chest pain, dyspnoea, sore throat, fever or hypothermia, cervical adenopathy, fatigue and myalgia). All patients with a history of hospital-acquired pneumonia and chronic diseases such as lung transplantation, cancer, cystic fibrosis, bronchitis and tuberculosis were excluded.

Specimen collection

Patients were sampled via throat swabbing with a sterile Dacron swab (Deltalab, Barcelona, Spain), which was placed in a tube containing 2 mL phosphate-buffered saline and transferred to the laboratory in cold packs at 4°C within 2 hours of collection. DNA extraction was carried out immediately when the samples arrived.

DNA extraction

The swab specimens were vortexed for 1 minute and the swabs discarded. Genomic DNA was extracted from 1 mL of each sample using the FavorPrep Tissue Genomic DNA Extraction Mini Kit (Favorgen Biotech, Taiwan) following the manufacturer's instructions. DNA was eluted in a final volume of 50 μL, and aliquots were stored at −20°C before performing the PCR assay.

Primer selection

Three sets of primers targeting P1, macrophage infectivity potentiator (mip) and 16S rRNA were selected to identify M. pneumoniae, L. pneumophila and Chlamydia spp. respectively. The specificity and sensitivity of all three sets of primers have been evaluated and approved in previous studies (Table 1) [8,21,22].

Table 1.

Primers used for organism detection

Organism Target gene Oligonucleotide sequence (5′–3′) Product size (bp) Reference
Mycoplasma pneumoniae P1 F: AAAGGAAGCTGACTCCGACA
R: TGGCCTTGCGCTACTAAGTT
450 [21]
Legionella pneumophila Mip F: CAATGGCTGCAACCGATGC
R: GGGATAACTTGTGAAACCTG
487 [8]
Chlamydia spp. 16S rRNA F: GCCTACCGGCTTACCAAC
R: GGCGCAATGATTCTCGAT
230 [22]

PCR assay

The PCR technique for detecting M. pneumoniae was performed with the Primus 96 Advanced Thermocycler (Peqlab Biotechnology, Erlangen, Germany) as follows: the 25 μL reaction mixture contained 3 μL DNA, 0.5 μL (10 pmol) of each primer and 12.5 μL Master Mix (Ampliqon, Odense, Denmark), composed of 1.5 mM MgCl2, 0.2% Tween 20, 0.4 mM dNTPs, 0.05 U/μL Ampliqon Taq DNA polymerase and 8.5 μL distilled water. Cycling conditions were as follows: predenaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 40 seconds, annealing at 58°C for 40 seconds and extension at 72°C for 45 seconds, then final extension at 72°C for 5 minutes.

PCR technique for detection of L. pneumophila was performed as follows: the 25 μL reaction mixture contained 3 μL DNA, 2 μL (10 pmol) of each primer, 12.5 μL Master Mix (Ampliqon) and 5.5 μL distilled water. Cycling conditions were as follows: predenaturation at 95°C for 7 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 58°C for 60 seconds and extension at 72°C for 60 seconds, with final extension at 72°C for 7 minutes.

PCR technique for detection of Chlamydia spp. was performed as follows: the 25 μL reaction mixture contained 3 μL DNA, 2.5 μL (10 pmol) of forward primer and 1.25 μL of reverse primer (10 pmol), 12.5 μL Master Mix (Ampliqon) and 5.75 μL distilled water. Cycling conditions were as follows: predenaturation at 95°C for 2 minutes, followed by 35 cycles of denaturation at 94°C for 45 seconds, annealing at 56°C for 45 seconds and extension at 72°C for 45 seconds, then final extension at 72°C for 3 minutes.

M. pneumoniae ATCC 29342 and L. pneumophila ATCC 33152 were used as positive controls. PCR was performed on one known C. pneumoniae isolate using 16S rRNA primers (Table 1). The PCR product was sequenced and BLASTed via NCBI (National Center for Biotechnology Information Basic Local Alignment Search Tool; https://blast.ncbi.nlm.nih.gov/Blast.cgi) and used as positive control for detection of Chlamydia spp.

Agarose gel electrophoresis was performed as follows: 5 μL of PCR product was thoroughly mixed with 1 μL of FluoroDye DNA Fluorescent Loading Dye (green, 6 × ), then electrophoresed for 90 minutes at 120 V on a 1.5% agarose gel in 0.5 × Tris–borate–EDTA buffer.

Statistical analysis

Analysis of demographic data was carried out by SPSS 24 software (IBM, Armonk, NY, USA). Categorical variables were compared by the Pearson or Fisher exact tests, as appropriate. Univariate analysis was performed to determine any association between variables and positivity of the three agents. Crude odds ratio and 95% confidence interval were calculated. Variables with p ≤ 0.2 in univariate analysis were included in a multivariate logistic regression model. Adjusted odds ratio and its 95% confidence interval were determined, and values of p ≤ 0.05 were considered to be statistically significant.

Results

A total of 150 patients were enrolled onto the study, consisting of 86 women (57.3%) and 64 men (42.3%), with a median age of 50 years old (interquartile range, 35–65 years). Demographic information and clinical manifestations of all the participants are listed in Table 2.

Table 2.

Demographic and clinical characteristics of 150 patients

Characteristic N (%)
Age group
 0–18 years 13 (8.7)
 19–44 years 43 (28.7)
 45–59 years 40 (26.7)
 >60 years 54 (36)
 Total 150 (100)
Sex
 Female 86 (57.3)
 Male 64 (42.7)
Symptom
 Fever 31 (20.7)
 Headache 33 (22)
 Vomit 14 (9.3)
 Sore throat 16 (10.7)
 Dyspnoea 99 (66)
 Chest pain 71 (47.3)
 Sputum production 77 (51.3)
 Nonproductive cough 67 (44.7)
 Fatigue 53 (35.3)

Positive PCR results were reported in 66 patients (44%), of whom seven (4.7%) had a coinfection (six patients by M. pneumoniae and L. pneumophila and one by L. pneumophila and Chlamydia spp.). M. pneumoniae, L. pneumophila and Chlamydia spp. were detected in 37 (24.7%), 25 (16.7%) and 11 (7.3%) patients respectively.

There was no statistically significant difference in the incidence of any of the above infections in both male and female subjects (Table 3, Table 4, Table 5). The prevalence of M. pneumoniae and Chlamydia spp. infections was statistically insignificant with respect to age groups (Table 3, Table 5). Overall, the prevalence of atypical pneumonia was higher among people over the age of 60 (Table 2). Of note is a significant difference in the frequency of L. pneumophila among people over 60 years old compared to other age groups (Table 6).

Table 3.

Demographic and clinical characteristics of 37 patients infected with Mycoplasma pneumoniae

Characteristic N (%) 95% CI p
Age group 0.56
 0–18 years 4 (10.8) Ref.
 19–44 years 10 (27) (0.17–2.69)
 45–59 years 7 (18.9) (0.11–2.00)
 >60 years 16 (43.2) (0.25–3.53)
 Total 37 (100)
Sex 0.36–1.64 0.57
 Female 23 (62.2)
 Male 14 (37.8)
Symptom
 Fever 13 (35.1) 1.23–6.63 0.02∗
 Headache 7 (18.9) 0.31–1.98 0.66
 Vomit 3 (8.1) 0.21–3.11 1
 Sore throat 2 (5.4) 0.09–1.87 0.36
 Dyspnoea 28 (75.7) 0.79–4.27 0.17∗∗
 Chest pain 19 (51.4) 0.59–2.61 0.7
 Sputum production 16 (43.2) 0.31–1.37 0.34
 Nonproductive cough 17 (45.9) 0.51–2.26 1
 Fatigue 12 (32.4) 0.38–1.85 0.7

∗p < 0.05; ∗∗p ≤ 0.2.

Table 4.

Demographic and clinical characteristics of 25 patients infected with Legionella pneumophila

Characteristic N (%) 95% CI p
Age group 0.003*
 0–18 years 1 (4) Ref
 19–44 years 2 (8) 0.05–7.03
 45–59 years 5 (20) 0.18–16.18
 >60 years 17 (68) 0.66–45.9
 Total 25 (100)
Sex 0.45–2.54 1
 Female 14 (56)
 Male 11 (44)
Symptom
 Fever 8 (32) 0.81–5.42 0.17**
 Headache 4 (16) 0.2–1.99 0.6
 Vomit 3 (12) 0.36–5.48 0.7
 Sore throat 1 (4) 0.04–2.43 0.47
 Dyspnoea 18 (72) 0.54–3.6 0.65
 Chest pain 11 (44) 0.36–2.02 0.83
 Sputum production 13 (52) 0.44–2.44 1
 Nonproductive cough 12 (48) 0.5–2.77 0.83
 Fatigue 10 (40) 0.53–3.07 0.65

*p < 0.05; **p ≤ 0.2.

Table 5.

Demographic and clinical characteristics of 11 patients infected with Chlamydia spp.

Characteristic N (%) 95% CI p
Age group 0.97
 0–18 years 1 (9.1) Ref
 19–44 years 3 (27.3) 0.08–9.47
 45–59 years 2 (18.2) 0.05–7.6
 >60 years 5 (45.5) 0.13–11.48
 Total 11 (100)
Sex 0.49–5.75 0.53
 Female 5 (45.5)
 Male 6 (54.5)
Symptom
 Fever 0 0.71–0.85 0.12∗∗
 Headache 5 (45.5) 0.94–11.61 0.65
 Vomit 0 0.85–0.95 0.6
 Sore throat 2 (18.2) 0.39–10.11 0.33
 Dyspnoea 8 (72.7) 0.36–5.55 0.75
 Chest pain 7 (63.6) 0.57–7.32 0.35
 Sputum production 7 (63.6) 0.48–6.16 0.53
 Nonproductive cough 5 (45.5) 0.3–3.55 1
 Fatigue 4 (36.4) 0.29–3.76 1

∗p < 0.05; ∗∗p ≤ 0.2.

Table 6.

Factors associated with positivity of Mycoplasma pneumoniae and Legionella pneumophila

Factor Univariate analysis
Multivariate analysis
COR 95% CI p AOR 95% CI p
Factors associated with positivity of M. pneumoniae
 Fever 2.86 1.23–6.63 0.01 3.04 1.29–7.17 0.01*
 Dyspnoea 0.21 0.79–4.27 0.16 2.00 0.84–4.77 0.12
Factors associated with positivity of L. pneumophila
 Fever 2.09 0.8–5.42 0.13 4.07 1.27–13.04 0.02
 Age group
 0–18 years (Ref)
 19–44 years 0.58 0.05–7.02 0.67 1.08 0.08–13.76 0.95
 45–59 years 1.71 0.18–16.18 0.64 4.25 1.27–13.03 0.24
 >60 years 5.51 0.66–45.9 0.11 13.35 1.35–132.5 0.03

AOR, adjusted odds ratio; CI, confidence interval; COR, crude odds ratio.

*p < 0.05.

Clinical signs and symptoms of patients were statistically analysed. Dyspnoea was the most common sign in our studied population and consequently was the most prevalent among infected patients. Chest pain, sputum production and nonproductive cough were other common signs among patients with positive PCR test results (Table 3, Table 4, Table 5). None of the patients infected with Chlamydia spp. complained of vomiting (Table 5). Significant associations were observed between fever and M. pneumoniae (p 0.01) and L. pneumophila (p 0.02) infection (Table 6).

Discussion

We evaluated the frequency of M. pneumoniae, L. pneumophila and Chlamydia spp. in patients with atypical CAP. Our results demonstrated that 44% of the patients in our studied population were infected by at least one of these atypical pathogens. There are significant regional variations in the atypical aetiology of CAP. In China it has been reported that the atypical agents are responsible for 20% to 40% of CAP cases; however, in this review article, serologic methods are mainly used, which has lower sensitivity and specificity [23]. Meanwhile, in Egypt, among 400 patients with CAP, only 12 patients (3%) were infected with atypical pathogens [24]. Although the progression of atypical pneumonia may be mild, in some cases it can lead to hospitalization. For example, in Turkey only 6% of patients hospitalized for CAP were infected with atypical agents, while in the Netherlands these pathogens were detected in 20.7% of the patients [25,26]. To our knowledge, only limited comprehensive studies have been conducted to evaluate the role of atypical agents in CAP patients in Iran. Our research is thus one of the first studies in this field.

Among bacterial pathogens, M. pneumoniae is known to be the most prevalent atypical agent of pneumonia. In the present study the frequency of M. pneumoniae was highest among other bacteria, a finding that corresponded to the findings of two recent studies in Tehran. The first one was conducted by Arfaatabar et al. [27], who reported a high frequency (26.4%) of this agent in their studied population. The second one was done by our own group and found the rate of M. pneumoniae to be 25.2% [6]. The prevalence of M. pneumoniae varies in different studies of Iran [28], which may be influenced by seasonal differences, target group, outbreaks and diagnostic methods. The prevalence of M. pneumoniae in some Asian countries is much higher than in Europe and the United States. Among US CAP patients only 4% were positive for M. pneumoniae, while in China this pathogen was the most common agent among adults with CAP [1,23]. Also, in other Asian countries such as Saudi Arabia and India high frequencies of M. pneumoniae were previously reported [29,30].

L. pneumophila was detected in 16.7% of patients in our studied population. The water supply system provides crucial potential sources of infection. It has been reported that the prevalence of Legionella spp. are high in water resources in Iran, and that the most prevalent is L. pneumophila [31]. It has been estimated that the pooled prevalence of this pathogen in clinical samples in Iran is 9.6%, ranging from 0.4% to 22.1% [5]. The numbers show that this agent can play an important role in patients with respiratory issues in Iran. Therefore, an effective diagnostic method we can use to treat patients with compatible symptoms would be helpful. Unlike M. pneumoniae, our study showed a much higher frequency of L. pneumophila than other Asian countries. For comparison, only 3.65% of patients with CAP were infected by this bacterium in China [23], and the rate of this pathogen was only 2.4% in Korea, which is not in line with our findings [32]. Our assumption is that the contaminated water source and inefficient diagnostic and controlling strategies might have resulted in this high prevalence.

Few studies have investigated the frequency of Chlamydia spp. in patients with CAP in Iran. However, the role of this pathogen in patients with pneumonia is still unclear in our country. In our research 11 patients (7.3%) were infected with Chlamydia spp. According to the questionnaires they filled out, no patient had a history of close contact with birds. Considering the site of the sample collection, as well as considering the fact that respiratory psittacosis is a rare disease, we assume that all of our positive cases were caused by C. pneumoniae. Previous studies that investigated the frequency of this bacterium in Iran are either too old or the methodology is inadequate (such as serology). Javadi Nia et al. [33] determined the prevalence of C. pneumoniae in children with adenoid hypertrophy concomitant with rhinosinusitis. In their study the pathogen was detected in 13.5% of patients using PCR, but their target group is completely different from ours. One recent study in Ahvaz, south of Iran, showed that the prevalence of C. pneumoniae was approximately 6% in their region, which corresponded to our findings in Tehran [34]. The prevalence of C. pneumoniae in countries neighbouring Iran is not different from our findings. In Jordan and Turkey this pathogen was found in 5% and 8.8% of CAP patients respectively [35,36]. The prevalence of this agent is much lower in developed countries, such as in Norway (3%) and Germany (0.9%) [37,38].

The major clinical manifestations of atypical pneumonia include cough, fever and dyspnoea. We found a significant association between fever and the presence of M. pneumoniae and L. pneumophila; this is not surprising as fever is the common sign in patients infected by these pathogens [39]. The fact that Legionnaires disease poses a high risk to the elderly has long been known [40]. In our study the frequency of L. pneumophila in patients older than 60 was significant. Proper diagnostic and therapeutic approaches in the elderly with typical manifestations could be helpful to reduce this infection's complications.

Some limitations regarding our study were taken into consideration during the planning and interpretation of the results. Lower respiratory secretions are preferred for detecting Legionnaires disease, while in the present study we used throat swabs.

In this study we focused on the three most important atypical agents of pneumonia in a short period of time. Further long-term studies with larger sample sizes and detection of other bacterial and viral pathogens are needed to reach a better understanding of the status of CAP in Iran.

Conclusion

We found M. pneumoniae to be the most prevalent agent of atypical pneumonia, accounting for 24.7% of the study population. However, L. pneumophila was significantly more prevalent among elderly people (>60 years old) compared to other age groups. A more comprehensive study is recommended to assess the prevalence of CAP and its aetiologic agents in order to improve the diagnosis and treatment of CAP patients.

Conflict of interest

None declared.

Acknowledgement

Supported by Tehran University of Medical Sciences, Tehran, Iran (grant 39778).

References

  • 1.Jain S., Self W.H., Wunderink R.G., Fakhran S., Balk R., Bramley A.M. Community-acquired pneumonia requiring hospitalization among US adults. N Engl J Med. 2015;373:415–427. doi: 10.1056/NEJMoa1500245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Burnham J.P., Kollef M.H. CAP, HCAP, HAP, VAP: the diachronic linguistics of pneumonia. Chest. 2017;152:909–910. doi: 10.1016/j.chest.2017.05.002. [DOI] [PubMed] [Google Scholar]
  • 3.Sharma L., Losier A., Tolbert T., Dela Cruz C.S., Marion C.R. Atypical pneumonia: updates on Legionella, Chlamydophila, and Mycoplasma pneumoniae. Clin Chest Med. 2017;38:45–58. doi: 10.1016/j.ccm.2016.11.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Arnold F.W., Summersgill J.T., Ramirez J.A. Role of atypical pathogens in the etiology of community-acquired pneumonia. Semin Respir Crit Care Med. 2016;37:819–828. doi: 10.1055/s-0036-1592121. [DOI] [PubMed] [Google Scholar]
  • 5.Khaledi A., Esmaeili S.A., Vazini H., Karami P., Bahrami A., Sahebkar A. Evaluation of the prevalence of Legionella pneumophila in Iranian clinical samples: a systematic review and meta-analysis. Microb Pathog. 2019;129:93–98. doi: 10.1016/j.micpath.2019.02.008. [DOI] [PubMed] [Google Scholar]
  • 6.Noori Goodarzi N., Pourmand M.R., Arfaatabar M., Azimi G., Masoorian E., Foroushani A.R. First detection and characterization of macrolide-resistant Mycoplasma pneumoniae from people with community-acquired pneumonia in Iran. Microb Drug Resist. 2020;26:245–250. doi: 10.1089/mdr.2019.0223. [DOI] [PubMed] [Google Scholar]
  • 7.Miyashita N., Saito A., Kohno S., Yamaguchi K., Watanabe A., Oda H. Multiplex PCR for the simultaneous detection of Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella pneumophila in community-acquired pneumonia. Respir Med. 2004;98:542–550. doi: 10.1016/j.rmed.2003.11.012. [DOI] [PubMed] [Google Scholar]
  • 8.McDonough E.A., Barrozo C.P., Russell K.L., Metzgar D. A multiplex PCR for detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, and Bordetella pertussis in clinical specimens. Mol Cell Probes. 2005;19:314–322. doi: 10.1016/j.mcp.2005.05.002. [DOI] [PubMed] [Google Scholar]
  • 9.Arfaatabar M., Noori Goodarzi N., Afshar D., Memariani H., Azimi G., Masoorian E. Rapid detection of Mycoplasma pneumoniae by loop-mediated isothermal amplification (LAMP) in clinical respiratory specimens. Iran J Public Health. 2019;48:917–924. [PMC free article] [PubMed] [Google Scholar]
  • 10.Marchello C., Dale A.P., Thai T.N., Han D.S., Ebell M.H. Prevalence of atypical pathogens in patients with cough and community-acquired pneumonia: a meta-analysis. Ann Fam Med. 2016;14:552–566. doi: 10.1370/afm.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhan P., Suo L.J., Qian Q., Shen X.K., Qiu L.X., Yu L.K. Chlamydia pneumoniae infection and lung cancer risk: a meta-analysis. Eur J Cancer. 2011;47:742–747. doi: 10.1016/j.ejca.2010.11.003. [DOI] [PubMed] [Google Scholar]
  • 12.Hahn D.L., Schure A., Patel K., Childs T., Drizik E., Webley W. Chlamydia pneumoniae–specific IgE is prevalent in asthma and is associated with disease severity. PLoS One. 2012;7 doi: 10.1371/journal.pone.0035945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Johnston S.L., Martin R.J. Chlamydophila pneumoniae and Mycoplasma pneumoniae: a role in asthma pathogenesis? Am J Respir Crit Care Med. 2005;172:1078–1089. doi: 10.1164/rccm.200412-1743PP. [DOI] [PubMed] [Google Scholar]
  • 14.Chaudhry R., Valavane A., Sreenath K., Choudhary M., Sagar T., Shende T. Detection of Mycoplasma pneumoniae and Legionella pneumophila in patients having community-acquired pneumonia: a multicentric study from New Delhi, India. Am J Trop Med Hyg. 2017;97:1710–1716. doi: 10.4269/ajtmh.17-0249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Benitez A.J., Thurman K.A., Diaz M.H., Conklin L., Kendig N.E., Winchell J.M. Comparison of real-time PCR and a micro immunofluorescence serological assay for detection of Chlamydophila pneumoniae infection in an outbreak investigation. J Clin Microbiol. 2012;50:151–153. doi: 10.1128/JCM.05357-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Daxboeck F., Krause R., Wenisch C. Laboratory diagnosis of Mycoplasma pneumoniae infection. Clin Microbiol Infect. 2003;9:263–273. doi: 10.1046/j.1469-0691.2003.00590.x. [DOI] [PubMed] [Google Scholar]
  • 17.Tronel H., Hartemann P. Overview of diagnostic and detection methods for legionellosis and Legionella spp. Lett Appl Microbiol. 2009;48:653–656. doi: 10.1111/j.1472-765X.2009.02570.x. [DOI] [PubMed] [Google Scholar]
  • 18.Saikku P. Diagnosis of Chlamydia pneumoniae. Clin Microbiol Infect. 1998;4 4S7–13. [PubMed] [Google Scholar]
  • 19.Dorigo-Zetsma J., Zaat S., Wertheim-van Dillen P., Spanjaard L., Rijntjes J., Van Waveren G. Comparison of PCR, culture, and serological tests for diagnosis of Mycoplasma pneumoniae respiratory tract infection in children. J Clin Microbiol. 1999;37:14–17. doi: 10.1128/jcm.37.1.14-17.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Boman J., Gaydos C.A., Quinn T.C. Molecular diagnosis of Chlamydia pneumoniae infection. J Clin Microbiol. 1999;37:3791–3799. doi: 10.1128/jcm.37.12.3791-3799.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ataee R.A., Golmohammadi R., Alishiri G.H., Mirnejad R., Najafi A., Esmaeili D. Simultaneous detection of Mycoplasma pneumoniae, Mycoplasma hominis and Mycoplasma arthritidis in synovial fluid of patients with rheumatoid arthritis by multiplex PCR. Arch Iran Med. 2015;18(6) [PubMed] [Google Scholar]
  • 22.Condon K., Oakey J. Detection of Chlamydiaceae DNA in veterinary specimens using a family-specific PCR. Lett Appl Microbiol. 2007;45:121–127. doi: 10.1111/j.1472-765X.2007.02169.x. [DOI] [PubMed] [Google Scholar]
  • 23.Zhu Y.G., Tang X.D., Lu Y.T., Zhang J., Qu J.M. Contemporary situation of community-acquired pneumonia in China: a systematic review. J Transl Intern Med. 2018;6:26–31. doi: 10.2478/jtim-2018-0006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.El Basha N.R., Shaaban H.H., El Atroush H.A., Sherif M.M., El Kholy A.A. The use of multiplex PCR for the detection of atypical pathogens in Egyptian children with CAP: a high rate of Bordetella pertussis in early infancy. J Egypt Public Health Assoc. 2019;94:5. doi: 10.1186/s42506-018-0003-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Caglayan Serin D., Pullukcu H., Cicek C., Sipahi O.R., Tasbakan S., Atalay S. Bacterial and viral etiology in hospitalized community acquired pneumonia with molecular methods and clinical evaluation. J Infect Dev Ctries. 2014;8:510–518. doi: 10.3855/jidc.3560. [DOI] [PubMed] [Google Scholar]
  • 26.Raeven V.M., Spoorenberg S.M., Boersma W.G., van de Garde E.M., Cannegieter S.C., Voorn G.P. Atypical aetiology in patients hospitalised with community-acquired pneumonia is associated with age, gender and season; a data-analysis on four Dutch cohorts. BMC Infect Dis. 2016;16:299. doi: 10.1186/s12879-016-1641-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Arfaatabar M., Aminharati F., Azimi G., Ashtari A., Pourbakhsh S.A., Masoorian E. High frequency of Mycoplasma pneumoniae among patients with atypical pneumonia in Tehran, Iran. Germs. 2018;8:126. doi: 10.18683/germs.2018.1139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ranjbar R., Halaji M. Epidemiology of Mycoplasma pneumoniae prevalence in Iranian patients: a systematic review and meta-analysis. J Med Microbiol. 2019;68:1614–1621. doi: 10.1099/jmm.0.001079. [DOI] [PubMed] [Google Scholar]
  • 29.Chaudhry R., Sharma S., Javed S., Passi K., Dey A.B., Malhotra P. Molecular detection of Mycoplasma pneumoniae by quantitative real-time PCR in patients with community acquired pneumonia. Indian J Med Res. 2013;138:244–251. [PMC free article] [PubMed] [Google Scholar]
  • 30.Marie M.A.M. Incidence and antimicrobial susceptibility of Mycoplasma pneumoniae in Saudi Arabia. J Bacteriol Virol. 2010;40:159–162. [Google Scholar]
  • 31.Khaledi A., Bahrami A., Nabizadeh E., Amini Y., Esmaeili D. Prevalence of Legionella species in water resources of Iran: a systematic review and meta-analysis. Iran J Med Sci. 2018;43:571–580. [PMC free article] [PubMed] [Google Scholar]
  • 32.Sohn J.W., Park S.C., Choi Y.H., Woo H.J., Cho Y.K., Lee J.S. Atypical pathogens as etiologic agents in hospitalized patients with community-acquired pneumonia in Korea: a prospective multi-center study. J Korean Med Sci. 2006;21:602–607. doi: 10.3346/jkms.2006.21.4.602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Javadi Nia S., Zarabi V., Noorbakhsh S., Farhadi M., Ghavidel Darestani S. Chlamydophila pneumoniae infection assessment in children with adenoid hypertrophy concomitant with rhino sinusitis. Jundishapur J Microbiol. 2014;7 doi: 10.5812/jjm.11134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Amin M., Haghparasti F., Savari M., Montazeri E.A. Relative frequency of Chlamydia pneumoniae in patients with respiratory infections using the PCR and ELISA methods in Ahvaz, Iran. Gene Rep. 2019;17:100495. [Google Scholar]
  • 35.Al-Aydie S.N., Obeidat N.M., Al-Younes H.M. Role of Chlamydia pneumoniae in community-acquired pneumonia in hospitalized Jordanian adults. J Infect Dev Ctries. 2016;10:227–236. doi: 10.3855/jidc.6590. [DOI] [PubMed] [Google Scholar]
  • 36.Somer A., Salman N., Yalçın I., Ağaçfidan A. Role of Mycoplasma pneumoniae and Chlamydia pneumoniae in children with community-acquired pneumonia in Istanbul, Turkey. J Trop Pediatr. 2006;52:173–178. doi: 10.1093/tropej/fml017. [DOI] [PubMed] [Google Scholar]
  • 37.Holter J.C., Müller F., Bjørang O., Samdal H.H., Marthinsen J.B., Jenum P.A. Etiology of community-acquired pneumonia and diagnostic yields of microbiological methods: a 3-year prospective study in Norway. BMC Infect Dis. 2015;15:64. doi: 10.1186/s12879-015-0803-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wellinghausen N., Straube E., Freidank H., von Baum H., Marre R., Essig A. Low prevalence of Chlamydia pneumoniae in adults with community-acquired pneumonia. Int J Med Microbiol. 2006;296:485–491. doi: 10.1016/j.ijmm.2006.05.003. [DOI] [PubMed] [Google Scholar]
  • 39.Izumikawa K. Clinical features of severe or fatal Mycoplasma pneumoniae pneumonia. Front Microbiol. 2016;7:800. doi: 10.3389/fmicb.2016.00800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Peiris V., Prasad M.K., Bradley D., Zawistowicz W., Sivayoham S., Naqvi S.N. Legionnaires’ disease in elderly people: the first sign of an outbreak in the community? Age Ageing. 1992;21:451–455. doi: 10.1093/ageing/21.6.451. [DOI] [PubMed] [Google Scholar]

Articles from New Microbes and New Infections are provided here courtesy of Elsevier

RESOURCES