Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Sep 1.
Published in final edited form as: Surgery. 2020 May 18;168(3):478–485. doi: 10.1016/j.surg.2020.04.010

Inhibition of TREM-1 with an eCIRP-derived Peptide Protects Mice from Intestinal Ischemia-reperfusion Injury

Naomi-Liza Denning 1,2,3, Monowar Aziz 1,3, Mahendar Ochani 1, Jose M Prince 1,2,4, Ping Wang 1,2,3,*
PMCID: PMC7483826  NIHMSID: NIHMS1585952  PMID: 32439208

Abstract

Introduction:

Intestinal ischemia-reperfusion (I-I/R) injury results in morbidity and mortality from both local injury and systemic inflammation and acute lung injury (ALI). Extracellular cold-inducible RNA-binding protein (eCIRP) is a damage associated molecular pattern (DAMP) that fuels systemic inflammation and potentiates ALI. We recently discovered triggering receptor expressed on myeloid cells-1 (TREM-1) serves as a novel receptor for eCIRP. We developed a 7-aa peptide, named M3, derived from the CIRP protein, which interferers with CIRP’s binding to TREM-1. Here, we hypothesized that M3 protects mice against I-I/R injury.

Methods:

Intestinal ischemia was induced in C57BL/6 mice via clamping of the superior mesenteric artery for 60 min. At reperfusion, mice were treated intraperitoneally with M3 (10 μg/kg body weight (BW)) or normal saline vehicle. Mice were sacrificed 4 h after reperfusion and blood and lungs were collected for various analysis. A 24 h survival after I-I/R was assessed.

Results:

Serum levels of organ injury markers aspartate aminotransferase (AST), alanine aminotransferase (ALT), lactate dehydrogenase (LDH), and lactate were increased with I-I/R, while treatment with M3 significantly decreased their levels. Serum, intestinal, and lung levels of proinflammatory cytokines and chemokines were also increased by I-I/R, and treatment with M3 significantly reduced these values. I-I/R caused significant histological intestinal and lung injuries which were mitigated by M3. Treatment with M3 improved the survival rate from 40% to 80% after I-I/R.

Conclusions:

Inhibition of TREM-1 by an eCIRP-derived small peptide (M3) decreased inflammation, reduced lung injury, and improved survival in I-I/R injury. Thus, blocking the eCIRP-TREM-1 interaction is a promising therapeutic avenue for mitigating I-I/R injury.

We successfully implemented M3, an eCIRP-derived TREM-1 inhibitor, as a therapeutic agent in a murine pre-clinical model of intestinal ischemia-reperfusion injury. This work highlights the importance of eCIRP and TREM-1 in ischemia-reperfusion mediated lung injury.

Introduction

Intestinal ischemia-reperfusion (I-I/R) injury, which occurs when blood flow is restored to previously ischemic bowel, arises in several conditions including thrombo-embolic disease, low-flow/shock states, cardiopulmonary bypass, intestinal volvulus, trauma, strangulated hernias, and small bowel transplantation.1 Mortality is high and ranges from 60 to 80%.2 However, morbidity and mortality after I-I/R stems not only from visceral compromise but also from systemic inflammation and acute lung injury (ALI). Impairment of intestinal blood supply compromises the oxygen supply required for normal cellular function. This results in impaired endothelial cell barrier function with increased vascular permeability and leakage,3 as well as intensified generation of superoxide resulting in local tissue damage and the overzealous influx of neutrophils into the tissues.4

In addition to the damage described above, ischemia-reperfusion injury results in the activation of both innate and adaptive immune responses, including activation of pattern recognition receptors and migration of inflammatory cell types to the diseased tissue.3 Damage associated molecular patterns (DAMPs) are proteins that are normally intracellular.3 However, after ischemic tissue damage and subsequent reperfusion, they are released extracellularly where they function as alarmins, activating the immune system to potentiate a local and systemic inflammatory response.3, 5 I-I/R injury is particularly associated with ALI.6

We have previously identified cold-inducible RNA-binding protein (CIRP) as a DAMP.7 In addition to passive release during necrotic cell death, during times of cellular stress, CIRP has been shown to be released extracellularly from macrophages, translocating from the nucleus to cytoplasmic stress granules before being released to the extracellular space.7, 8

Extracellular CIRP (eCIRP) is known to bind to the toll-like receptor 4/myeloid differentiation factor 2 (TLR4/MD2) complex to promote inflammation. Recently, we have identified that eCIRP is also a ligand of triggering receptor expressed on myeloid cells-1 (TREM-1) and further established that this interaction is functional, promoting inflammation both in vivo and in vitro.9 TREM-1 is an activating, pro-inflammatory innate immune receptor expressed primarily on neutrophils and macrophages.10, 11 TREM-1 activation induces inflammation both independently11 and via synergy with the TLR4 pathway.12

After identification of the ligand/receptor relationship between eCIRP and TREM-1, we subsequently developed a small 7 amino acid peptide (RGFFRGG) to inhibit this interaction. This peptide, called M3, is the first ligand-dependent TREM-1 antagonist.9 M3 has been shown to be effective in macrophages9. M3 treatment was able to inhibit eCIRP-mediated inflammation in mice by decresing the levels of pro-inflammatory cytokines in the serum and lungs.9 In vivo, immune cells are not limited just to macrophages but include other cell types such as neutrophils, suggesting that M3 may also have an affect on other immune cells as TREM-1 has also been shown to be expressed by neutrophils.10 Furthermore, M3 was successfully employed as a therapy to inhibit systemic and pulmonary pro-inflammatory cytokine and chemokine production and attenuate acute lung injury during pre-clinical models of sepsis.9

The novel findings of the eCIRP-TREM-1 interaction, as well as the creation of M3 as an antagonist of this interaction, led us to hypothesize that M3 could be utilized as a therapy in ischemia-reperfusion injury. We have previously shown that CIRP is increased extracellularly in I-I/R injury.5 This, coupled with the fact that TREM-1 signaling has been found to be influential in I-I/R injury13 warrants an investigation into the benefit of M3 in I-I/R injury.

Methods

Experimental animals

Healthy C57BL/6 eight to twelve-week-old male mice were purchased from Charles River Laboratories (Wilmington, MA) and used in all experiments. Mice were randomly assigned to sham, vehicle, or treatment group. All experiments were performed in accordance with the guidelines for the use of experimental animals by the NIH and were approved by the Institutional Animal Care and Use Committee of the Feinstein Institutes for Medical Research.

Only male mice were used in this study. Sex-based disparities in intestinal ischemia-reperfusion injury have been well established in both rodent and human studies.14–16 Female hormones have been demonstrated to be protective, both in reducing inflammation and preserving endothelial integrity. Furthermore, it has been shown that the inflammatory response and microcirculatory disfunction after I-I/R occurs more rapidly and more robustly in male mice.16 Additionally, chemical or physical castration of mice was demonstrated to be protective in I-I/R injury.17 Given the impact of sex on the pathogenesis of I-I/R injury, in order to generate reliable and consistent findings, only male mice were used.

Animal model of intestinal ischemia-reperfusion

Mice were anesthetized with inhaled isoflurane and the abdomen was shaved and disinfected. Similar to previous descriptions18, an upper midline laparotomy was performed, and the superior mesenteric artery was isolated. The superior mesenteric artery was occluded with a vascular clip resulting in 60 min of ischemia time. After 60 min, the vascular clip was removed to allow reperfusion. Mice were randomly allocated to treatment or vehicle group. Treatment mice received an intraperitoneal instillation of 10 mg/kg body weight (BW) M3 at the time of reperfusion. Vehicle groups received an equivalent volume of normal saline. Sham animals underwent a laparotomy with the same 1 h of anesthesia time without arterial occlusion. The abdomen was closed in layers and mice were resuscitated with 1 ml of normal saline injected subcutaneously. At 4 h after reperfusion, mice were euthanized, and serum and tissue collected for analysis. For the survival study, mice were evaluated every 4 h for 24 h.

M3 Peptide

M3 (RGFFRGG) was synthesized by GenScript (Piscataway, NJ) and fully dissolved in 0.9% normal saline prior to in vivo administration. An in vivo dose of M3 of 10 μg/kg BW was used as previously described.9

Determination of organ injury markers

Hepatocellular dysfunction is known to be associated with intestinal reperfusion.19 Alanine aminotransferase (ALT), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH) are ischemic organ injury markers released primarily by the liver, but also by myocardial and skeletal muscle, kidneys, brain, and red blood cells.20 As such, they can also be used as markers of global tissue injury. Elevated levels of lactate are seen in bowel ischemia and, although nonspecific, can be used clinically to alert providers to the potential of ischemic bowel.21 Lactate clearance has been correlated with increased survival after the development of mesenteric ischemia22 or other inflammatory conditions such as sepsis.23 Given this, serum levels of AST, ALT, LDH, and lactate were determined using specific colorimetric enzymatic assays (Pointe Scientific, Canton, MI) according to the manufacturer’s instructions.

Enzyme-linked immunosorbent assay (ELISA)

Serum was analyzed according to the manufacturer’s instructions using ELISA kits for interleukin (IL)-6 and tumor necrosis factor-α (TNF-α) (BD Biosciences, San Jose, CA). Lung tissue was flash frozen in liquid nitrogen and then crushed. Equal weights of powdered tissues (~50 mg) were dissolved in 500 μl of lysis buffer (10 mM Hepes, pH 7.4, 5 mM MgCl2, 1 mM DTT, 1% Triton X-100, and 2 mM each of EDTA and EGTA) and sonicated on ice. Protein concentration was determined by the BioRad protein assay reagent (Hercules, CA). Equal amounts of proteins (250–500 μg) were loaded into respective ELISA wells for the assessment of IL-6, IL-1β (Invitrogen, Carlsbad, CA), TNF-α, and macrophage inflammatory protein-2 (MIP-2) (R&D Systems, Minneapolis, MN).

Intestinal and Lung Histology

Lung and intestinal tissue were fixed in 10% formalin, embedded in paraffin, cut into 5 μm sections, and stained with hematoxylin and eosin (H&E). Lung and intestinal sections were evaluated under light microscopy to evaluate the degree of injury in a blinded fashion. Lung scoring was done using a system created by the American Thoracic Society.24 Scores ranged from zero to one and were based on the presence of proteinaceous debris in the airspaces, neutrophil infiltration in the alveolar and interstitial spaces, the degree of septal thickening, and the presence of hyaline membranes. The scores were calculated per field at 400X magnification and then averaged. Intestinal tissue injury was scored using a system previously created specifically for murine intestinal injury after ischemia/reperfusion.25 Scores range from zero to 4 and consider several factors including degree of necrosis, vilious blunting and vilious to crypt ratio, and inflammatory changes.

Real-time quantitative polymerase chain reaction (qPCR)

To examine I-I/R associated lung and intestinal inflammation, lung and intestinal mRNA expression of IL6, TNF-α, IL-1 β, and MIP-2 were assessed. Total RNA was extracted from tissue using Trizol reagent (Invitrogen, Carlsbad, CA). cDNA was synthesized using MLV reverse transcriptase (Applied Biosystems, Foster City, CA). PCR reactions were carried out in 20 μl of a final volume of 0.05 μM of each forward and reverse primer, water, cDNA, and SYBR Green PCR master mix (Applied Biosystems). Amplification was conducted in a Step One Plus real-time PCR machine (Applied Biosystems). Mouse β-actin mRNA was used as an internal control for amplification and relative gene expression levels were calculated using the ΔΔCT method. Relative expression of mRNA was expressed as fold change in comparison with sham tissues that were standardized to one. The sequence of primers for this study is listed as follow: IL-6 (NM_031168), forward (CCGGAGAGGAGACTTCACAG) and reverse (CAGAATTGCCATTGCACAAC); IL-1β (NM_008361), forward (CAGGATGAGGACATGAGCACC) and reverse (CTCTGCAGACT-CAAACTCCAC); MIP-2 (NM_009140), forward (CCCTGGTTCAGAAAATCATCCA) and reverse (GCTCCTC-CTTTCCAGGTCAGT), TNF-α (NM_012675), forward (AGACCCTCACACTCAGATCATCTTC) and reverse (TTG CTACGACGTGGGCTACA), and β-actin (NM_007393), forward (CGTGAAAAGATGACCCAGATCA) and reverse (TGGTACGACCAGAGGCATACAG).

Statistical analysis

Data represented in the figures are expressed as mean ± SE. All data was checked for normality. ANOVA was used for one-way comparison among multiple groups and the significance was determined by the Tukey method. The unpaired Student t test was applied for two-group comparisons. Significance was considered for p ≤ 0.05 between study groups. Data analyses were carried out using GraphPad Prism graphing and statistical software (GraphPad Software, San Diego, CA).

Results

Treatment with M3 attenuated organ injury and disease severity in I-I/R injury

AST and ALT were increased by 7.9 and 3.8-fold in I-I/R ( p ≤ 0.001, Fig 1A, B). M3 improved these organ injury markers by 60.1% and 65.7%, respectively (p = 0.03 and p < 0.0001, respectively, Fig 1A, B). Similarly, 4 h after I-I/R, serum levels of LDH were increased 57.9fold, from 13.9 ± 1.7 in sham animals to 804.2 ± 111.5 in the vehicle group (p < 0.001). M3 attenuated this increase by 40.7% (p = 0.06, Fig 1C). Lactate increased 3.4-fold by 4 h after I-I/R (p < 0.001). M3 reduced this elevation by 46.6% ( p = 0.002, Fig 1D).

Figure 1: Treatment with M3 attenuates organ injury markers after I-I/R.

Figure 1:

Open in a new tab

Mice were randomly assigned to sham laparotomy, treatment or vehicle group. I-I/R was introduced in mice via SMA occlusion for sixty minutes. Treatment mice received an intraperitoneal instillation of 10 mg/kg BW M3 at the time of reperfusion. Vehicle groups received an equivalent volume of normal saline. Four hours after recovery from anesthesia, mice were sacrificed, and serum and tissue collected for analysis. (A) AST, (B) ALT, (C) LDH, and (D) lactate were determined using specific colorimetric enzymatic assays. Data are expressed as means ± SE. n=5–8 mice/group. The groups were compared by one-way ANOVA and Tukey method (*p<0.05 vs. sham and #p<0.05 vs. vehicle mice).

M3 treatment decreased pro-inflammatory cytokines after I-I/R injury

We assessed serum levels of pro-inflammatory cytokines (IL-6 and TNF-α) in sham and I-I/R injured mice treated with either vehicle or M3. Intestinal I/R significantly increased the serum levels of IL-6 and TNF-α by 12.4 and 7.5-fold, respectively, in vehicle mice as compared to sham mice (p = 0.0002 and p = 0.02, in that order, Fig 2A, B). M3 treatment significantly reduced these markers of systemic inflammation by 40.9% and 77.4%, respectively (p = 0.03 and p = 0.02, respectively, Fig 2A, B).

Figure 2: Treatment with M3 decreases pro-inflammatory cytokines in blood after I-I/R.

Figure 2:

Open in a new tab

After 60 minutes of intestinal ischemia and four hours of reperfusion, serum (A) IL-6 and (B) TNF-α were measured by ELISA. Data are expressed as means ± SE. n=5–8 mice/group. The groups were compared by one-way ANOVA and Tukey method (*p<0.05 vs. sham and #p<0.05 vs. vehicle mice).

M3 ameloriates intestinal inflammation after I-I/R injury

Four hours after reperfusion, we assessed proinflammatory cytokines IL-6 and TNF-α in the intestinal tissue in an attempt to assess the inflammation associated with reperfusion injury. Because neutrophil infiltration is responsible for a significant percentage of the damage associated with ischemia-reperfusion injury in the intestine,26 we also assessed mRNA and protein levels of the chemokine MIP-2. Intestinal mRNA and protein levels of IL-6, TNF-α and MIP-2 were significantly increased by I-I/R in vehicle mice as compared to sham mice (p = 0.004, p = 0.007, and p< 0.0001, respectively, Fig 3). Conversely, M3 decreaed mRNA levels of IL-6, TNF-α, and MIP-2 by 37.8% (Not significant), 67.5%, (p = 0.02) and 43.8% (p = 0.02), respectively (Fig 3A–C). Analagously, protein levels of IL-6, TNF-α, and MIP-2 were decreased by 81.4% (p = 0.008), 58.7% (p = 0.001), and 68.3% (p< 0.001), respectively (Fig D–F).

Figure 3: M3 treatment reduces inflammatory cytokines and chemokines in the intestine after I-I/R.

Figure 3:

Open in a new tab

After 60 minutes of intestinal ischemia and four hours of reperfusion, intestinal tissues were collected from sham, vehicle, and M3 treatment mice. Expression of (A) IL-6, (B) TNF-α and (C) MIP-2 at their mRNA levels in lungs was assessed by real-time PCR. Equal amount of total intestinal protein were loaded into respective ELISA wells for assessment of lung protein levels of (D) IL-6, (E) TNF-α and (F) MIP-2. Data are expressed as means ± SE. n = 5–8 mice/group. The groups were compared by one-way ANOVA and Tukey method (*p<0.05 vs. sham and #p<0.05 vs. vehicle-treated mice).

To ascertain the impact of M3 on intestinal tissue after I/R, intestinal tissue was subjected to H&E staining (Fig 4A). Tissue injury was scored using a system adapted by Stallion et al.25 Intestinal sections from M3 treated mice displayed less villus blunting and improvement to absence of transmural necrosis which was reflected in an intestinal injury score that was improved by 60.7% (p < 0.0001, Fig 4B).

Figure 4: M3 decreases histologic injury score in the intestine after I-I/R.

Figure 4:

Open in a new tab

Four hours after reperfusion, intestinal tissues were collected for histological analysis. (A) Representative images of H&E stained intestinal tissue at 100×. Scale bar: 100 μm. (B) Intestinal injury scores calculated from zero to four. Data are expressed as means ± SE and compared by one-way ANOVA and Tukey method. N = 4 mice/group with 10 sections/group. (*p<0.05 vs. sham and #p<0.05 vs. vehicle mice).

M3 protects mice from lung injury after I-I/R injury

I-I/R is well known to be associated with acute lung injury.6 As such, we measured the gene expression and protein levels of the proinflammatory cytokines IL-6, IL-1β and chemokine MIP-2, in the lung tissue after I-I/R. Lung mRNA and protein levels of IL-6, IL-1β, and MIP-2 were significantly increased by I-I/R in vehicle mice as compared to sham mice (all mRNA p < 0.05, all protein p< 0.0001, Fig 5). Consistent with M3’s effect systemically, M3 dramatically reduced lung mRNA expression levels of IL-6, IL-1β, and MIP-2 by 81.5%, 96.1%, and 88.7%, respectively, in treated mice (p ≤ 0.05 for all, Fig 5A–C). Analogously, M3 reduced lung protein levels of IL-6, IL-1β, and MIP-2 by 45.2%, 55.5%, and 45%, respectively (p = 0.01, p = 0.008, and p < 0.0001, respectively, Fig 5D–F).

Figure 5: M3 treatment improves inflammatory cytokines and chemokines in the lung after I-I/R.

Figure 5:

Open in a new tab

After 60 minutes of intestinal ischemia and four hours of reperfusion, lung tissues were collected from sham, vehicle, and M3 treatment mice. Expression of (A) IL-6, (B) IL-1β, and (C) MIP-2 at their mRNA levels in lungs was assessed by real-time PCR. Equal amount of total lung protein (250–350 μg) were loaded into respective ELISA wells for assessment of lung protein levels of (D) IL-6, (E) IL-1β, and (F) MIP-2. Data are expressed as means ± SE. n = 5–8 mice/group. The groups were compared by one-way ANOVA and Tukey method (*p<0.05 vs. sham and #p<0.05 vs. vehicle-treated mice).

Histological images of lung tissue displayed increased levels of alveolar congestion, exudate, interstitial and alveolar cellular infiltrates, intra-alveolar capillary hemorrhages, and damage of the epithelial architecture, in mice who underwent intestinal I/R compared to sham mice. M3 treatment dramatically improved these histological injury parameters in intestinal I/R injured mice (Fig 6A). These histological changes were reflected by a 65% decrease in lung tissue injury scores in M3-treated compared to vehicle-treated mice (p = 0.005, Fig 6B).

Figure 6: M3 protects mice from acute lung injury caused by I-I/R.

Figure 6:

Open in a new tab

4 hours after reperfusion, lung tissues were collected for histological analysis. (A) Representative images of H&E stained lung tissue at 200×. Scale bar: 100 μm. (B) Lung injury scores calculated at 400× ranged from zero to one were based on the presence of proteinaceous debris in the airspaces, the degree of septal thickening, and neutrophil infiltration in the alveolar and interstitial spaces. Data are expressed as means ± SE and compared by one-way ANOVA and Tukey method. N = 3 mice/group with 10 sections/group. (*p<0.05 vs. sham and #p<0.05 vs. vehicle mice).

M3 improves survival after murine I-I/R injury

Because the above results demonstrated the protective effect of M3 in I-I/R injury, we performed a survival experiment. Analogous to the four-hour experiments, mice were allocated to sham, vehicle (normal saline), or treatment group. Vehicle and treatment mice received M3 or vehicle at the time of reperfusion, then all mice were monitored for survival for 24 hours. M3 doubled the 24-hour survival rate after I-I/R, from 40% to 80% (Fig 7).

Figure 7: M3 improves survival after I-I/R.

Figure 7:

Open in a new tab

Kaplan-Meier survival curve generated from treatment (M3) and vehicle I-I/R mice during the 24 h monitoring period is shown. n=10 mice in each group, *p<0.05 vs. vehicle, determined by the log-rank test.

Discussion

Acute mesenteric ischemia remains a life threating event, with treatment currently focused on restoration of blood flow, resection of necrotic bowel, and supportive measures.2 Despite the need to revascularize, bowel reperfusion exacerbates damage already done by local hypoxia.27 Multi-organ dysfunction, particularly in the lung and the cardiovascular system, are responsible for the major mortality related to intestinal ischemia-reperfusion injury.28 In the present study, we demonstrated that I-I/R resulted in systemic inflammation, intestinal damage, and acute lung injury, characterized both by altered lung morphology and the presence of inflammatory mediators. Mice treated with the CIRP-derived peptide M3 had diminished inflammatory responses, both systemically and in the intestines and the lung. Furthermore, M3 improved 24h survival after I-I/R.

I-I/R in mice is characterized by local intestinal pathology as well as remote lung injury and systemic inflammation.29 Acute lung injury resulting from intestinal ischemia-reperfusion injury is multifactorial and stems from inflammatory mediators including reactive oxygen species, chemokines, and cytokines, as well as from circulating DAMPs released from ischemic tissue.29–31 We have previously demonstrated that eCIRP is involved in the pathogenesis of I-I/R-induced acute lung injury.5, 31 eCIRP is a potent mediator of lung inflammation, as it has been shown to cause endothelial cell activation, promote vascular leakage, increase edema, and cause endoplasmic reticulum stress.32, 33 In addition, eCIRP increases cytokine and leukocyte production in the lungs and activates the Nlrp3 inflammasome.32, 33

The TREM-1 receptor is well known as a potent transducer of inflammation in both sterile and infectious inflammation, as well as in acute and chronic disease.10, 11, 34, 35 Its role in sepsis-associated ALI has been well studied36–38 and TREM-1 inhibition has improved sepsis survival in several rodent studies.11, 35, 39 To our knowledge, the role of TREM-1 in I-I/R injuryinduced ALI has never been studied. Previously, Gibot et al demonstrated that inhibition of TREM-1 with a decoy peptide LP17 improved systemic and hepatic inflammation as well as cardiovascular dysfunction after I-I/R, however, the impact on the pulmonary system was not examined.13

The interaction of eCIRP and TREM-1 in ischemia-reperfusion injury has also not been studied before. Both proteins are increased in inflammation; their combined effect is substantial.9 eCIRP binding to TREM-1 increases activation of downstream molecules DAP12 and Syk.9 TREM-1 activation proceeds through phosphorylated DAP12 ultimately activating downstream signaling molecules that regulate NF-κB, culminating in the production of pro-inflammatory cytokines and chemokines.40

We have previously developed a small 7-amino acid peptide M3, derived from the amino acid sequence of CIRP, that inhibited eCIRP mediated inflammation in vivo and in vitro. Furthermore, M3 improved inflammatory parameters and survival in two murine models of sepsis.9 We decided to investigate the effect of M3 in I-I/R injury because the modulation of intestinal ischemia-reperfusion injury is particularly clinically relevant. Unlike sepsis, whose exact onset is insidious, the timing of reperfusion is often controlled or well-approximated. The M3 peptide offers the additional advantage of selectively inhibiting the interaction of eCIRP and TREM-1, as opposed to previously developed TREM-1 inhibitors that are non-specific and ligand-independent.41 We chose the dose of M3 in this study based on the previous work showing efficacy of this dose in sepsis without any untoward effects such as immunogenicity or tissue injury.9

Peptides as therapeutic agents present several challenges. These include the short half-life, poor oral bioavability, difficulities with bio-distribution given high conformational flexibility, and the tendancy of peptides to undergo denaturation and aggregation therefore limiting their active concentration in vivo.42, 43 Despite these challenges, peptides remain a good candiadate for drug therapy. They are typically high selective and efficacious with desirable pharmacological profiles while remaining safe and well tolerated.44 Future studies will likely need to focus on the modification of the M3 peptide or multiple dosages. Given the short half-life of small peptides, we anticipate that such adjustments will provide more robust protection against inflammation and further improve survival. Additionally, we have previously reported the use of C23, another CIRP-dervived peptide, in intestinal ischemia-reperfusion injury.5 The C23 peptide targets the TLR4/MD2 complex.7 Future studies on the benfits of M3/C23 combination therapy may be useful; this would allow inhibition of both TREM-1 and TLR4 mediated inflammation.

In this study, M3 was able to reduce pulmonary levels of IL-6 and IL-1β. Both are known to be important inflammatory mediators in ALI caused by I-I/R.45, 46 I-I/R also increased MIP-2, a potent neutrophil chemoattractant, while M3 treatment ameliorated this increase. Neutrophils promote local tissue damage as well as propagate distant inflammation, by increasing microvasculature permeability, cytotoxic enzyme release, and releasing reactive oxygen species (ROS).4 In a murine sepsis model, neutralization of MIP-2 improved sepsis-associated ALI and increased survival after cecal ligation and puncture.47 Additionally, in a rat model of aspiration induced lung injury, MIP-2 blockade reduced neutrophil accumulation in bronchoalveolar lavage fluid, decreased pulmonary vascular leak, and improved both the (A-a)O2 gradient and the PaO2/FiO2 ratio.48

Although ALI is the best studied and typically the most severe manifestation of I-I/R, systemic inflammation and other remote organ injury occurs.49 The high mortality of I-I/R typically cannot be explained by ALI alone. Rather, cardiovascular dysfunction and subsequent multi-organ hypoperfusion as a result of the release of pro-inflammatory mediators including cytokines, chemokines, and DAMPs from damaged intestine are also implicated.49 Elevated levels of LDH, AST,49 ALT, and lactate reflect both local tissue damage and systemic injury. M3 treatment at the time of reperfusion was able to mitigate the severity of organ injury. Additionally, M3 treatment reduced markers of systemic inflammation IL-6 and TNF-α and improved inflammation in the intestinal tissue itself.

We have demonstrated that treatment with M3 ameliorated lung injury as well as reduced intestinal and systemic inflammation after murine I-I/R. Furthermore, these benefits translated to a survival benefit after I-I/R. It is likely that M3 could be used in other kinds of infectious and sterile inflammation. Our recent study has demonstrated outstanding therapeutic potential of M3 in murine model of hemorrhagic shock.50 In our previous work, we found that M3 was not immunogenic and did not alter cell viability. It also may avoid the lymphoid cell dealth-associated immunosuppresion and hyperglycemia that can be seen when steroids are used as an anti-inflammatory.51 The M3 peptide is specific to the eCIRP-TREM-1 interaction. We have previously demonstrated this using several assays including anti-TREM-1 activating antibodies, fluorescence resonance energy transfer, and surface plasmon resonance. Additionally, we have demonstrated that scramble peptides, composed of the same amino acids in a different order, were unable to inhibit eCIRP-mediated inflammation or prevent the eCIRP binding to TREM-1.9 As such, the importance in I-I/R-induced ALI and mortality after treatment with M3 highlights the importance of the eCIRP/TREM-1 interaction in I-I/R. Blocking the eCIRP/TREM-1 interaction provides a promising therapeutic target for the treatment of intestinal ischemia-reperfusion injury.

Acknowledgments

Funding/Support

This study was supported by the National Institutes of Health (NIH) grant R01HL076179 (PW).

Footnotes

COI/Disclosure

One of the authors (PW) is an inventor of patent applications covering the fundamental concept of targeting CIRP for the treatment of inflammatory diseases, licensed by TheraSource LLC. PW is a co-founder of TheraSource LLC. Other authors declared that they have no competing interests.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Mallick IH; Yang W; Winslet MC; Seifalian AM, Ischemia-reperfusion injury of the intestine and protective strategies against injury. Dig Dis Sci 2004, 49 (9), 1359–77. [DOI] [PubMed] [Google Scholar]
  • 2.Clair DG; Beach JM, Mesenteric Ischemia. N Engl J Med 2016, 374 (10), 959–68. [DOI] [PubMed] [Google Scholar]
  • 3.Eltzschig HK; Eckle T, Ischemia and reperfusion--from mechanism to translation. Nat Med 2011, 17 (11), 1391–401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gonzalez LM; Moeser AJ; Blikslager AT, Animal models of ischemia-reperfusion-induced intestinal injury: progress and promise for translational research. In Am J Physiol Gastrointest Liver Physiol, 2015; Vol. 308, pp G63–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.McGinn JT; Aziz M; Zhang F; Yang WL; Nicastro JM; Coppa GF; Wang P, Cold-inducible RNA-binding protein-derived peptide C23 attenuates inflammation and tissue injury in a murine model of intestinal ischemia-reperfusion. Surgery 2018, 164 (6), 1191–1197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Moraes LB; Murakami AH; Fontes B; Poggetti RS; van Rooijen N; Younes RN; Heimbecker AM; Birolini D, Gut ischemia/reperfusion induced acute lung injury is an alveolar macrophage dependent event. J Trauma 2008, 64 (5), 1196–200; discussion 1200–1. [DOI] [PubMed] [Google Scholar]
  • 7.Qiang X; Yang WL; Wu R; Zhou M; Jacob A; Dong W; Kuncewitch M; Ji Y; Yang H; Wang H; Fujita J; Nicastro J; Coppa GF; Tracey KJ; Wang P, Cold-inducible RNA-binding protein (CIRP) triggers inflammatory responses in hemorrhagic shock and sepsis. Nat Med 2013, 19 (11), 1489–1495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Aziz M; Brenner M; Wang P, Extracellular CIRP (eCIRP) and inflammation. J Leukoc Biol 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Denning NL; Aziz M; Murao A; Gurien SD; Ochani M; Prince JM; Wang P, Extracellular CIRP as an endogenous TREM-1 ligand to fuel inflammation in sepsis. JCI Insight 2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bouchon A; Dietrich J; Colonna M, Cutting edge: inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes. J Immunol 2000, 164 (10), 4991–5. [DOI] [PubMed] [Google Scholar]
  • 11.Bouchon A; Facchetti F; Weigand MA; Colonna M, TREM-1 amplifies inflammation and is a crucial mediator of septic shock. Nature 2001, 410 (6832), 1103–7. [DOI] [PubMed] [Google Scholar]
  • 12.Dower K; Ellis DK; Saraf K; Jelinsky SA; Lin LL, Innate immune responses to TREM-1 activation: overlap, divergence, and positive and negative cross-talk with bacterial lipopolysaccharide. J Immunol 2008, 180 (5), 3520–34. [DOI] [PubMed] [Google Scholar]
  • 13.Gibot S; Massin F; Alauzet C; Montemont C; Lozniewski A; Bollaert PE; Levy B, Effects of the TREM-1 pathway modulation during mesenteric ischemia-reperfusion in rats. Crit Care Med 2008, 36 (2), 504–10. [DOI] [PubMed] [Google Scholar]
  • 14.Hundscheid IHR; Schellekens D; Grootjans J; Derikx JPM; Buurman WA; Dejong CHC; Lenaerts K, Females Are More Resistant to Ischemia-Reperfusion-induced Intestinal Injury Than Males: A Human Study. Ann Surg 2018. [DOI] [PubMed] [Google Scholar]
  • 15.Ba ZF; Yokoyama Y; Toth B; Rue LW 3rd; Bland KI; Chaudry IH, Gender differences in small intestinal endothelial function: inhibitory role of androgens. Am J Physiol Gastrointest Liver Physiol 2004, 286 (3), G452–7. [DOI] [PubMed] [Google Scholar]
  • 16.Szabo A; Vollmar B; Boros M; Menger MD, Gender differences in ischemia-reperfusion-induced microcirculatory and epithelial dysfunctions in the small intestine. Life Sci 2006, 78 (26), 3058–65. [DOI] [PubMed] [Google Scholar]
  • 17.Akcora B; Altug E; Kontas T; Hakverdi S; Temiz A, Orchiectomy or testosterone receptor blockade reduces intestinal mucosal damage caused by ischemia-reperfusion insult. Pediatr Surg Int 2008, 24 (3), 337–41. [DOI] [PubMed] [Google Scholar]
  • 18.Cui T; Miksa M; Wu R; Komura H; Zhou M; Dong W; Wang Z; Higuchi S; Chaung W; Blau SA; Marini CP; Ravikumar TS; Wang P, Milk fat globule epidermal growth factor 8 attenuates acute lung injury in mice after intestinal ischemia and reperfusion. Am J Respir Crit Care Med 2010, 181 (3), 238–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wen S; Li X; Ling Y; Chen S; Deng Q; Yang L; Li Y; Shen J; Qiu Y; Zhan Y; Lai H; Zhang X; Ke Z; Huang W, HMGB1-associated necroptosis and Kupffer cells M1 polarization underlies remote liver injury induced by intestinal ischemia/reperfusion in rats. Faseb j 2020, 34 (3), 4384–4402. [DOI] [PubMed] [Google Scholar]
  • 20.Giannini EG; Testa R; Savarino V, Liver enzyme alteration: a guide for clinicians. Cmaj 2005, 172 (3), 367–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Brillantino A; Iacobellis F; Renzi A; Nasti R; Saldamarco L; Grillo M; Romano L; Castriconi M; Cittadini A; De Palma M; Scaglione M; Di Martino N; Grassi R; Paladino F, Diagnostic value of arterial blood gas lactate concentration in the different forms of mesenteric ischemia. Eur J Trauma Emerg Surg 2018, 44 (2), 265–272. [DOI] [PubMed] [Google Scholar]
  • 22.Caluwaerts M; Castanares-Zapatero D; Laterre PF; Hantson P, Prognostic factors of acute mesenteric ischemia in ICU patients. BMC Gastroenterol 2019, 19 (1), 80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ryoo SM; Lee J; Lee YS; Lee JH; Lim KS; Huh JW; Hong SB; Lim CM; Koh Y; Kim WY, Lactate Level Versus Lactate Clearance for Predicting Mortality in Patients With Septic Shock Defined by Sepsis-3. Crit Care Med 2018, 46 (6), e489–e495. [DOI] [PubMed] [Google Scholar]
  • 24.Matute-Bello G; Downey G; Moore BB; Groshong SD; Matthay MA; Slutsky AS; Kuebler WM; Acute Lung Injury in Animals Study, G., An official American Thoracic Society workshop report: features and measurements of experimental acute lung injury in animals. In Am J Respir Cell Mol Biol, United States, 2011; Vol. 44, pp 725–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Stallion A; Kou TD; Latifi SQ; Miller KA; Dahms BB; Dudgeon DL; Levine AD, Ischemia/reperfusion: a clinically relevant model of intestinal injury yielding systemic inflammation. J Pediatr Surg 2005, 40 (3), 470–7. [DOI] [PubMed] [Google Scholar]
  • 26.Tahir M; Arshid S; Fontes B; Castro MS; Luz IS; Botelho KLR; Sidoli S; Schwammle V; Roepstorff P; Fontes W, Analysis of the Effect of Intestinal Ischemia and Reperfusion on the Rat Neutrophils Proteome. Front Mol Biosci 2018, 5, 89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bertoni S; Ballabeni V; Barocelli E; Tognolini M, Mesenteric ischemia-reperfusion: an overview of preclinical drug strategies. Drug Discov Today 2018, 23 (7), 1416–1425. [DOI] [PubMed] [Google Scholar]
  • 28.Carden DL; Granger DN, Pathophysiology of ischaemia-reperfusion injury. J Pathol 2000, 190 (3), 255–66. [DOI] [PubMed] [Google Scholar]
  • 29.Kim JH; Kim J; Chun J; Lee C; Im JP; Kim JS, Role of iRhom2 in intestinal ischemia-reperfusion-mediated acute lung injury. In Sci Rep, 2018; Vol. 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang J; He GZ; Wang YK; Zhu QK; Chen W; Guo T, TLR4-HMGB1-, MyD88-and TRIF-dependent signaling in mouse intestinal ischemia/reperfusion injury. World J Gastroenterol 2015, 21 (27), 8314–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Cen C; McGinn J; Aziz M; Yang WL; Cagliani J; Nicastro JM; Coppa GF; Wang P, Deficiency in cold-inducible RNA-binding protein attenuates acute respiratory distress syndrome induced by intestinal ischemia-reperfusion. Surgery 2017, 162 (4), 917–927. [DOI] [PubMed] [Google Scholar]
  • 32.Khan MM; Yang WL; Brenner M; Bolognese AC; Wang P, Cold-inducible RNA-binding protein (CIRP) causes sepsis-associated acute lung injury via induction of endoplasmic reticulum stress. Sci Rep 2017, 7, 41363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yang WL; Sharma A; Wang Z; Li Z; Fan J; Wang P, Cold-inducible RNA-binding protein causes endothelial dysfunction via activation of Nlrp3 inflammasome. In Sci Rep, 2016; Vol. 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tammaro A; Derive M; Gibot S; Leemans JC; Florquin S; Dessing MC, TREM-1 and its potential ligands in non-infectious diseases: from biology to clinical perspectives. Pharmacol Ther 2017, 177, 81–95. [DOI] [PubMed] [Google Scholar]
  • 35.Gibot S; Kolopp-Sarda MN; Bene MC; Bollaert PE; Lozniewski A; Mory F; Levy B; Faure GC, A soluble form of the triggering receptor expressed on myeloid cells-1 modulates the inflammatory response in murine sepsis. J Exp Med 2004, 200 (11), 1419–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Liu T; Zhou Y; Li P; Duan JX; Liu YP; Sun GY; Wan L; Dong L; Fang X; Jiang JX; Guan CX, Blocking triggering receptor expressed on myeloid cells-1 attenuates lipopolysaccharide-induced acute lung injury via inhibiting NLRP3 inflammasome activation. Sci Rep 2016, 6, 39473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Liu N; Gu Q; Zheng YS, Expression of triggering receptor-1 in myeloid cells of mice with acute lung injury. World J Emerg Med 2010, 1 (2), 144–8. [PMC free article] [PubMed] [Google Scholar]
  • 38.Yuan Z; Syed M; Panchal D; Joo M; Bedi C; Lim S; Onyuksel H; Rubinstein I; Colonna M; Sadikot RT, TREM-1-accentuated lung injury via miR-155 is inhibited by LP17 nanomedicine. In Am J Physiol Lung Cell Mol Physiol, 2016; Vol. 310, pp L426–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Gibot S, Clinical review: role of triggering receptor expressed on myeloid cells-1 during sepsis. Crit Care 2005, 9 (5), 485–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Arts RJ; Joosten LA; van der Meer JW; Netea MG, TREM-1: intracellular signaling pathways and interaction with pattern recognition receptors. J Leukoc Biol 2013, 93 (2), 209–15. [DOI] [PubMed] [Google Scholar]
  • 41.Pelham CJ; Pandya AN; Agrawal DK, Triggering receptor expressed on myeloid cells receptor family modulators: a patent review. Expert Opin Ther Pat 2014, 24 (12), 1383–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Lau JL; Dunn MK, Therapeutic peptides: Historical perspectives, current development trends, and future directions. Bioorg Med Chem 2018, 26 (10), 2700–2707. [DOI] [PubMed] [Google Scholar]
  • 43.Haggag Y; Donia A; Osman M; El-Gizawy S, Peptides as Drug Candidates: Limitations and Recent Developmental Prespectives. Biomedical Journal of Scientific and Technical Research 2018, 8 (4), 6659–6662. [Google Scholar]
  • 44.Recio C; Maione F; Iqbal AJ; Mascolo N; De Feo V, The Potential Therapeutic Application of Peptides and Peptidomimetics in Cardiovascular Disease. Front Pharmacol 2016, 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhu Q; He G; Wang J; Wang Y; Chen W, Protective effects of fenofibrate against acute lung injury induced by intestinal ischemia/reperfusion in mice. Sci Rep 2016, 6, 22044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Yuan B; Xiong LL; Wen MD; Zhang P; Ma HY; Wang TH; Zhang YH, Interleukin6 RNA knockdown ameliorates acute lung injury induced by intestinal ischemia reperfusion in rats by upregulating interleukin10 expression. Mol Med Rep 2017, 16 (3), 2529–2537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Tsujimoto H; Ono S; Mochizuki H; Aosasa S; Majima T; Ueno C; Matsumoto A, Role of macrophage inflammatory protein 2 in acute lung injury in murine peritonitis. J Surg Res 2002, 103 (1), 61–7. [DOI] [PubMed] [Google Scholar]
  • 48.Shanley TP; Davidson BA; Nader ND; Bless N; Vasi N; Ward PA; Johnson KJ; Knight PR, Role of macrophage inflammatory protein-2 in aspiration-induced lung injury. Crit Care Med 2000, 28 (7), 2437–44. [DOI] [PubMed] [Google Scholar]
  • 49.Mura M; Andrade CF; Han B; Seth R; Zhang Y; Bai XH; Waddell TK; Hwang D; Keshavjee S; Liu M, Intestinal ischemia-reperfusion-induced acute lung injury and oncotic cell death in multiple organs. Shock 2007, 28 (2), 227–38. [DOI] [PubMed] [Google Scholar]
  • 50.Gurien SD; Aziz M; Cagliani J; Denning NL; Last J; Royster W; Coppa GF; Wang P, An eCIRP-derived small peptide targeting TREM-1 attenuates hemorrhagic shock. J Trauma Acute Care Surg 2020. [DOI] [PubMed] [Google Scholar]
  • 51.Schmidt S; Rainer J; Ploner C; Presul E; Riml S; Kofler R, Glucocorticoid-induced apoptosis and glucocorticoid resistance: molecular mechanisms and clinical relevance. Cell Death Differ 2004, 11 Suppl 1, S45–55. [DOI] [PubMed] [Google Scholar]

RESOURCES