Abstract
The emergence and persistence of antibiotic resistance remain formidable health challenges. This study aimed at detecting and profiling antibiotic resistance of bacterial contaminants in vended food and the environment. Seventy antibiotic-resistant bacterial isolates were isolated from fried fish, African sausages, roasted meat, smokies, samosa, chips (potato fries), vegetable salads, and soil samples collected from Embu Town and Kangaru Market in Embu County, Kenya. The antibiotic susceptibility test, morphological and biochemical characterization, antibiosis assay, polymerase chain reaction-based detection of antibiotic resistance genes, and sequencing of the 16S rRNA gene were done. Analysis of variance on all measured data was done, and Tukey's honest test was used to compare and separate mean diameters of zones inhibition. Resistance of bacterial isolates to antibiotics was chloramphenicol (90%), cefotaxime (84.29%), nalidixic acid (81.43%), tetracycline (77.14%), amoxicillin (72.86%), gentamycin (48.57%), streptomycin (32.86%), and trimethoprim + sulphamethoxazole (30%). Isolate KMP337, Salmonella spp., exhibited highly significant antibiosis against S. aureus recording a mean inhibition diameter and standard error (SE) of 16.33 ± 0.88 mm, respectively, at P=0.001. The 70 bacterial isolates belonged to Bacillus, Paraclostridium, Lysinibacillus, Virgibacillus, and Serratia genera. The study isolated Bacillus wiedmannii (KC75) which is a risk group 2 as well as Serratia marcescens (KMP95) and Bacillus anthracis (KS606) which are risk group 3 organisms. The presence of antibiotic resistance genes Tet A, BlaTEM, StrB, Dfr A, Amp, and FloR genes was confirmed by a polymerase chain reaction. Samples from Kangaru Market recorded a higher (88.57%) proportion of resistant isolates as compared to isolates from Embu Town (11.43%). The study confirmed the presence of antibiotic-resistant bacteria in vended fast food and the soil in Embu Town and Kangaru Market. This study calls for continuous monitoring of bacterial status and hygienic handling of vended food.
1. Introduction
Urban centers in developing countries face socioeconomic challenges that can adversely affect health standards. Foodborne diseases, particularly those of microbial origin, are a major health problem and contribute to reduced economic growth [1]. Street foods are popular in urban areas because of their availability, convenience, and affordability. However, the hygiene aspects of sales operations are a major source of concern for the health of both handlers and consumers [2]. Running surface water, inadequate sanitation, and the disposal of untreated wastewater provide an environment conducive to the growth of pathogenic microbes. Besides, street foods are prone to cross-contamination due to lack of personal hygiene, sharing of contaminated utensils, and free movement of flies that sporadically land on the food.
Food and environmental samples are reservoirs of foodborne pathogens such as Listeria monocytogenes, Vibrio parahaemolyticus, Escherichia coli, Salmonella spp., Vibrio cholerae, and Staphylococcus aureus [1, 3]. In addition to antibiotic resistance in bacterial pathogens, commensal bacteria and the environment are also reservoirs of antibiotic resistance. The release of animal and human waste into the environment results in the subsequent release of antibiotics into water and soil, which encourages further spread of antibiotic resistance [4]. Bacterial resistance to commonly used antibiotics has been associated with enteric pathogens such as E. coli, Salmonella spp., Shigella spp., Klebsiella spp., and V. cholerae [5].
A cross-sectional study conducted in 2014–2016 in 22 of Kenya's 47 counties diagnosed 11,033 people with cholera [6]. An outbreak of cholera was reported in Embu County in 2019 [7]. Waterborne diseases in Embu County have been attributed to poor sanitation and contamination of water sources [8]. Despite efforts to report the prevalence of food- and waterborne pathogens in Embu County, data on their susceptibility to antibiotics are scarce, so this study focused on the isolation and characterization of antibiotic-resistant bacteria in food sold in Embu Town and the nearby Kangaru Market.
2. Materials and Methods
2.1. Study Site and Sampling
Samples consisting of fried fish, African sausages, roasted meat, smokies, samosa, chips (potato fries), vegetable salads, and soil were purposively collected from 176 out of the 324 licensed food vendors in the densely populated Central Business District of Embu Town and the nearby Kangaru Market (latitude: 0°31′58.80″N and longitude: 37°27′0.00″) (Figure 1). Samples were collected aseptically and transported to the Microbiology Laboratory at the University of Embu where they were stored in a refrigerator at 4°C. Treated water from Embu Water and Sanitation Company (EWASCO) was also sampled.
2.2. Preparation of Inoculum and Subculturing
The samples were incubated in eight selective media, namely, MacConkey agar, Salmonella Shigella agar, brain-heart infusion agar, phenylalanine agar, Pseudomonas fluorescens agar, brilliant green agar, eosin ethidium bromide agar, and deoxycholate agar. The standard cultivation method for bacterial food contaminants isolation was carried out as recommended by the International Organization for Standardization (ISO) 6579 [9]. The plates were incubated at 37°C for 24 hours, in an inverted position, after which single colonies were subcultured on fresh media.
2.3. Characterization and Identification of Bacterial Isolates
The isolates were characterized as described in [10]. The ability of the isolates to ferment sugars, utilize citrate, and produce catalase enzyme and phenyl-pyruvic acid was determined as previously described [11, 12]. The isolates were screened for their ability to produce amylase, protease, cellulase, and esterase using the methods described in [13, 14]. Probable identification of the isolates was done using Bergey's manual of determinative bacteriology and confirmed by partial sequencing of the 16S rRNA gene of some isolates.
2.4. Antibiotic Susceptibility Assay
The Kirby Bauer disc diffusion method using Mueller-Hinton agar was used for antimicrobial susceptibility testing [15]. Antimicrobial discs with amoxicillin (20 µg), cefotaxime (30 µg), gentamicin (10 µg), streptomycin (10 µg), tetracycline (30 µg), nalidixic acid (30 µg), trimethoprim + sulphamethoxazole (1.25/23.75 µg), and chloramphenicol (30 µg) were used. Klebsiella pneumoniae 1792880 and E. coli 35218 were used as quality control strains. Bacterial suspensions of pure isolates were prepared based on 0.5 McFarland Turbidity Standard. The plates were incubated in an inverted position at 37°C for 24 hrs. The diameter of the zones of inhibition (in millimeters) was measured and interpreted as either susceptible, intermediate, or resistant according to the Guidelines of CLSI [16].
2.5. Antibiosis Test
Standardized bacterial suspensions were prepared based on 0.5 McFarland turbidity [17]. The antibiosis test was performed as previously described [18]. The isolates were incubated at 37°C and monitored routinely after every 24 hours for two days. The diameter of the zones of inhibition was recorded. The antibiotic-resistant bacteria were tested for antibiosis against six laboratory bacteria strains, namely, Staphylococcus aureus ATCC 1026, Klebsiella pyrope 1792880, E. coli ATCC 35218, Streptococcus pneumoniae ATCC 49619, S. aureus BAA 976, and K. pneumoniae 1792880.
2.6. DNA Extraction from Antibiotic-Resistant Bacteria
The bacterial isolates were grown overnight in Luria Broth for 24 hours, and DNA was extracted using the phenol-chloroform method with some modifications [19]. To isolate plasmid DNA, bacterial isolates were grown overnight in Luria Broth. Plasmids were extracted using a protocol modified from [20].
2.7. Partial Sequencing of Bacterial 16S rRNA Gene
The 16S rRNA gene sequence was amplified by PCR using bacterial universal primers 8F (5′-AGCTTTGATCCTGGCTCAG-3′) and 1492R (5′-CGGCTACCTTGTTACGACTT-3′) for all selected bacterial isolates according to [21] using Phusion-High fidelity PCR Kit (New England and Biolabs Inc). The PCR amplicons were checked by gel electrophoresis, labeled, and shipped to Inqaba Biotech African's Genomics Company in South Africa for sequencing. The sequence outputs were edited, analyzed, and deposited in GenBank for assignment of accession numbers.
2.8. PCR Amplification of Antibiotic Resistance Genes
Genes encoding resistance to tetracycline, streptomycin, and beta-lactam antibiotics such as ampicillin, chloramphenicol, and trimethoprim were detected using the primer specific PCR approach (Table 1) as described in [22]. The presence of a target gene was confirmed by the presence of a band on the gel.
Table 1.
Primer | Sequence (5′ to 3′) | Target gene | Amplicon size (bp) | Annealing temperature (°C) | Resistance to antibiotics |
---|---|---|---|---|---|
Flor-F | TTATCTCCCTGTCGTTCCAGCG | FloR | 450 | 57.5 | Chloramphenicol |
Flor-R | CCTATGAGCACACGGGGAGC | ||||
| |||||
strB-F | GGCACCCATAAGCGTACGCC | Str B | 400 | 61 | Streptomycin |
strB-R | TGCCGAGCACGGCGACTACC | ||||
| |||||
DfrA1-F | CGAAGAATGGAGTTATCGGG | Dfr A | 200 | 55 | Trimethoprim |
DfrA1-R | TGCTGGGGATTTCAGGAAAG | ||||
| |||||
TEM-F | GCGGTATCATTGCAGCACTG | BlaTEM | 1000 | 55 | Beta-lactam |
TEM-R | TGCTTAATCAGTGAGGCACC | ||||
| |||||
Amp-F | ATGCACACGCTGATCGGATT | Amp | 268 | 65 | Ampicillin |
Amp-R | GCGGACGCAGACTTCACTAA | ||||
| |||||
Tet-F | AACCGGCATTGAGAGCATCA | Tet A | 699 | 60 | Tetracycline |
Tet-R | TTGTCTCCTCTCCCTTGGCT |
2.9. Data Analysis
Data on antibiosis, extracellular enzymatic activity, and antibiotic sensitivity were recorded in excel sheets. The general linear model (PROC GLM) procedure of SAS software version 9.1 (SAS Institute, Cary, NC) was used to perform analysis of variance (ANOVA). Tukey's honest significant difference (HSD) test was used to compare and separate the means of the diameter of zones of inhibition. Correlation profiles of zones of clearance on different substrates and zones of inhibition were visualized as a heatmap generated by a hierarchical clustering R script using R version 3.3.1 software. The genetic affiliation of the sequenced genes of the isolates was deduced from a phylogenetic tree generated using MEGA X. The analysis involved 20 nucleotide sequences. The evolutionary distances were computed using the maximum composite likelihood method and were recorded as units of the number of base substitutions.
3. Results
3.1. Effect of Antibiotics on Bacteria Isolated from Food and Soil
Antibiotic sensitivity test assays revealed that 70 out of 345 bacterial isolates were resistant to at least three (multiple resistant) antibiotics that were tested. Isolate KMP253 affiliated to Salmonella spp., TF152 affiliated to E. coli, and KS120 affiliated to Bacillus subtilis were resistant to all the antibiotics that were tested and were all isolated from Kangaru Market (Table 2). Hierarchical clustering showed that trimethoprim + sulphamethoxazole was the most effective antibiotic, while chloramphenicol was the least effective antibiotic. Isolate KVS120 was resistant to the highest number of antibiotics (Figure 2). The occurrence of antibiotic-resistant bacteria varied among different food samples. Smokies from both sites had the lowest number of resistant bacterial isolates (1.43%) compared to the other food samples. Fish sold in Kangaru Market had the highest proportion of resistant isolates (18.57 %), as shown in Figure 3. No bacteria were recovered from treated water provided by EWASCO.
Table 2.
Isolate | Probable identity | Location | Sample | Strep | Genta | Amox | Tetra | Chlo | Tri-sul | Cefotax | Nalid | Resistant to antibiotics (n) |
---|---|---|---|---|---|---|---|---|---|---|---|---|
KS7 | Providencia spp. | Kangaru | Soil | R | I | R | R | I | I | I | R | 4 |
KF27 | Shigella spp. | Kangaru | Fish | S | R | R | R | R | R | R | R | 7 |
KRM34 | E. coli | Kangaru | Roasted meat | S | I | R | R | R | I | R | R | 5 |
KFR38 | Bacillus pacificus | Kangaru | Fruit | I | S | R | R | R | R | R | R | 6 |
KFR42 | Bacillus amyloliquefaciens | Kangaru | Fruit | I | R | R | R | R | I | R | R | 6 |
KMP45 | Pseudomonas spp. | Kangaru | African sausage | R | I | I | I | R | I | R | S | 3 |
KFR52 | Bacillus megaterium | Kangaru | Fruit | I | I | R | R | R | I | R | R | 5 |
KSM63 | Shigella sonnei | Kangaru | Smokies | R | S | I | R | I | I | R | I | 3 |
KS65 | Bacillus wiedmannii | Kangaru | Soil | I | S | R | S | R | I | R | S | 3 |
KC67 | Pseudomonas aeruginosa | Kangaru | Chips | S | S | R | R | I | S | R | R | 4 |
KVS68 | Enterobacter spp. | Kangaru | Vegetable salad | S | R | R | R | R | R | S | S | 5 |
KVS75 | Bacillus wiedmannii | Kangaru | Vegetable salad | I | S | S | R | R | S | R | S | 3 |
TVS81 | Bacillus thuringiensis | Kangaru | Vegetable salad | S | S | R | R | R | I | R | R | 5 |
KVS82 | Serratia marcescens | Kangaru | Vegetable salad | S | R | R | S | R | S | R | R | 5 |
KVS85 | Serratia marcescens | Kangaru | Vegetable salad | S | S | R | S | R | S | I | R | 3 |
KMP95 | Serratia marcescens | Kangaru | African sausage | R | S | I | R | R | R | R | R | 6 |
KF101 | Bacillus velezensis | Kangaru | Fish | S | S | S | R | R | S | R | R | 4 |
KS104 | Virgibacillus phasianinus | Kangaru | Soil | S | R | I | S | R | S | S | R | 3 |
KS109 | Lysinibacillus parviboronicapiens | Kangaru | Soil | R | R | R | R | R | I | R | R | 7 |
KS116 | Providencia spp. | Kangaru | Soil | R | R | R | R | R | R | R | R | 8 |
KVS120 | Bacillus subtilis | Kangaru | Vegetable salad | R | R | R | R | R | R | R | R | 8 |
KC122 | Pseudomonas spp. | Kangaru | Chips | S | S | I | I | R | S | R | R | 3 |
KFR131 | Pseudomonas spp. | Kangaru | Fruit | R | I | R | R | R | I | R | R | 6 |
KVS147 | Staphylococcus aureus | Kangaru | Vegetable salad | R | R | R | S | R | S | S | R | 5 |
KF148 | Shigella spp. | Kangaru | Fish | I | S | R | S | R | S | S | R | 3 |
TF152 | E. coli | Town | Fish | R | R | R | R | R | R | R | R | 8 |
KMP159 | Salmonella spp. | Kangaru | African sausage | I | R | I | S | R | S | S | R | 3 |
KS160 | Citrobacter spp. | Kangaru | Soil | R | R | R | R | R | I | R | R | 7 |
KF169 | Proteus spp. | Kangaru | Fish | R | R | R | S | R | S | S | R | 5 |
KMP188 | Aerobacter aerogenes | Kangaru | African sausage | R | R | R | S | R | S | S | R | 5 |
KFR200 | Enterobacter spp. | Kangaru | Fruit | S | I | S | R | R | I | R | I | 3 |
KFR204 | Pseudomonas spp. | Kangaru | Fruit | S | I | R | R | R | I | R | R | 5 |
KVS214 | S. pneumoniae | Kangaru | Vegetable salad | R | R | R | R | S | R | R | R | 7 |
KFR217 | Klebsiella spp. | Kangaru | Fruit | R | S | S | R | R | S | R | R | 5 |
KFR222 | Bacillus mobilis | Kangaru | Fruit | S | S | R | R | R | S | R | R | 5 |
KC231 | S. pneumoniae | Kangaru | Chips | S | S | I | S | R | S | R | R | 3 |
KFR245 | P. aeruginosa | Kangaru | Fruit | S | S | I | I | R | I | R | R | 3 |
KF246 | S. pneumoniae | Kangaru | Fish | I | S | I | R | R | I | R | R | 4 |
KVS249 | Pseudomonas spp. | Kangaru | Vegetable salad | I | R | R | R | R | R | R | R | 7 |
KMP253 | Salmonella spp. | Kangaru | African sausage | R | R | R | R | R | R | R | R | 8 |
KS260 | E. coli | Kangaru | Soil | I | R | S | R | R | I | R | R | 5 |
KS267 | Bacillus wiedmannii | Kangaru | Soil | I | R | R | R | R | R | R | R | 7 |
KVS271 | Pseudomonas spp. | Kangaru | Vegetable salad | I | R | I | R | R | I | R | R | 5 |
KFR285 | Hafnia spp. | Kangaru | Fruit | S | R | I | S | R | S | S | R | 3 |
KFR286 | Pseudomonas spp. | Kangaru | Fruit | I | S | R | R | R | S | R | R | 5 |
KFR301 | Salmonella spp. | Kangaru | Fruit | I | R | R | R | R | R | R | R | 7 |
KF317 | Streptococcus pneumoniae | Kangaru | Fish | R | S | I | R | R | I | R | R | 5 |
KMP321 | Bacillus wiedmannii | Kangaru | African sausage | R | R | R | R | R | I | R | R | 7 |
TFR329 | Bacillus proteolyticus | Town | Fruit | S | R | R | R | R | R | R | R | 7 |
KVS330 | Citrobacter freundii | Kangaru | Vegetable salad | S | R | I | R | R | R | R | I | 5 |
KMP337 | Salmonella spp. | Kangaru | African sausage | I | I | I | R | R | I | R | R | 4 |
KRM349 | Pseudomonas spp. | Kangaru | Roasted meat | I | I | R | R | R | I | R | R | 5 |
KS376 | E. coli | Kangaru | Soil | S | R | R | R | R | R | R | R | 7 |
TS378 | Salmonella spp. | Town | Soil | I | R | R | R | R | I | R | R | 6 |
TS380 | Pseudomonas spp. | Town | Soil | R | S | R | R | R | R | R | R | 7 |
KF381 | Micrococcus spp. | Kangaru | Fish | S | R | R | R | R | R | R | R | 7 |
KF389 | Morganella spp. | Kangaru | Fish | I | S | R | I | R | I | R | S | 3 |
KF391 | Serratia marcescens | Kangaru | Fish | R | R | R | R | R | R | R | S | 7 |
KF393 | Yersinia spp. | Kangaru | Fish | S | R | R | R | R | I | R | R | 6 |
KF395 | Pseudomonas aeruginosa | Kangaru | Fish | S | I | R | R | R | S | R | R | 5 |
KF399 | Salmonella enterica | Kangaru | Fish | I | R | R | R | R | R | R | R | 7 |
TS427 | Pseudomonas spp. | Town | Soil | I | R | R | R | R | I | R | S | 5 |
KC430 | Pseudomonas spp. | Kangaru | Chips | I | S | R | R | R | R | R | R | 6 |
KRM435 | Bacillus wiedmannii | Kangaru | Roasted meat | I | S | R | R | I | S | R | R | 4 |
KF463 | Bacillus anthracis | Kangaru | Fish | R | R | R | R | R | I | R | R | 7 |
TS472 | Bacillus cereus | Town | Soil | S | R | R | R | R | R | R | R | 7 |
TS572 | Bacillus subtilis | Town | Soil | S | S | R | R | R | I | R | R | 5 |
KS585 | Enterococcus faecalis | Kangaru | Soil | R | R | R | R | R | R | S | R | 7 |
KS606 | Bacillus anthracis | Kangaru | Soil | R | I | R | R | R | I | R | S | 5 |
TS621 | Proteus spp. | Town | Soil | S | R | R | S | R | I | R | R | 5 |
Strep, streptomycin; Genta, gentamycin; Amox, amoxicillin; tetra, tetracycline; Chlo, chloramphenicol; Tri-Sul, trimethoprim + sulphamethoxazole; Cefotax, cefotaxime; Nalid, nalidixic acid.
3.2. Detection of Antibiotic-Resistant Genes
Antibiotic resistance genes were detected in 36 out of the 70 antibiotic-resistant bacterial isolates (Table 3). The antibiotic resistance genes BlaTEM and Dfr A were frequently detected (Figures 4(a) and 4(b)). Resistance genes were detected at a higher frequency in bacteria isolated from Kangaru Market compared to Embu Town.
Table 3.
Isolate number | Location | Sample | Probable identity | Detected antibiotic resistance genes | |||||
---|---|---|---|---|---|---|---|---|---|
Dfr A | Str B | Tet A | BlaTEM | Amp | FloR | ||||
KFR222 | Kangaru | Fruit | B. mobilis | − | − | − | + | − | − |
KF169 | Kangaru | Fish | Proteus spp. | − | − | − | + | − | − |
KF463 | Kangaru | Fish | B. anthracis | − | + | − | + | − | − |
KMP253 | Kangaru | African sausage | Salmonella spp. | − | + | − | + | − | − |
KFR285 | Kangaru | Fruit | Hafnia spp. | − | − | + | + | − | − |
KF27 | Kangaru | Fish | Shigella spp. | − | − | − | + | − | + |
KMP188 | Kangaru | African sausage | A. aerogenes | − | − | − | + | + | − |
KF148 | Kangaru | Fish | Shigella spp. | − | − | − | + | − | + |
KC67 | Kangaru | Chips | P. aeruginosa | − | − | − | + | − | − |
TS572 | Town | Soil | B. subtilis | − | + | − | + | − | + |
KMP95 | Kangaru | African sausage | S. marcescens | + | − | − | − | − | + |
TFR329 | Town | Fruit | B. proteolyticus | + | − | + | − | − | − |
KFR301 | Kangaru | Fruit | Salmonella spp. | + | − | − | − | + | − |
KVS330 | Kangaru | Vegetable salad | E. coli | + | − | + | − | − | − |
TS380 | Town | Soil | Salmonella spp. | + | − | − | − | − | − |
TVS81 | Town | Vegetable salad | B. thuringiensis | + | − | − | − | + | − |
KF391 | Kangaru | Fish | Morganella spp. | + | + | + | − | − | − |
KS160 | Kangaru | Soil | Citrobacter spp. | − | + | − | − | − | − |
KF169 | Kangaru | Fish | Proteus spp. | − | + | − | − | + | − |
KF317 | Kangaru | Fish | E. faecalis | − | + | − | − | − | − |
KFR131 | Kangaru | Fruit | Pseudomonas spp. | − | + | − | − | − | − |
KFR38 | Kangaru | Fruit | B. pacificus | − | + | − | − | − | − |
KVS85 | Kangaru | Vegetable salad | S. marcescens | − | − | − | − | + | − |
KFR204 | Kangaru | Fruit | Pseudomonas spp. | − | − | − | − | + | − |
KS109 | Kangaru | Soil | L. parviboronicapiens | − | − | − | − | + | − |
KVS214 | Kangaru | Vegetable salad | S. pneumoniae | − | − | − | − | + | − |
KS585 | Kangaru | Soil | B. toyonensis | − | − | − | − | + | + |
KF399 | Kangaru | Fish | P. aeruginosa | − | − | + | − | + | − |
KS267 | Kangaru | Soil | B. wiedmannii | − | − | − | − | + | − |
KS116 | Kangaru | Soil | Providencia spp. | − | − | − | − | + | − |
KC122 | Kangaru | Chips | Pseudomonas spp. | − | − | − | − | − | + |
KFR245 | Kangaru | Fruit | P. aeruginosa | − | − | − | − | − | + |
KS376 | Kangaru | Soil | Pseudomonas spp. | − | − | − | − | − | + |
KVS249 | Kangaru | Vegetable salad | Pseudomonas spp. | − | − | + | − | − | − |
KS606 | Kangaru | Soil | B. anthracis | − | − | + | − | − | − |
KF393 | Kangaru | Fish | S. marcescens | − | − | + | − | − | − |
+ indicates the presence of the resistance genes following amplification by PCR; − indicates the absence of the target resistance genes following amplification by PCR.
3.3. Antibiosis Activity
Eleven out of the 70 antibiotic-resistant bacterial isolates inhibited the growth of at least one of the following laboratory strains of bacteria: S. aureus ATCC 1026, E. coli ATCC 35218, and K. pneumoniae 1792880. Isolate KFR38 affiliated to B. pacificus inhibited two laboratory strains and exhibited large zones of inhibition (Table 4). None of the antibiotic-resistant isolates was able to inhibit the growth of K. pyrope 1792880, S. pneumoniae ATCC 49619, or S. aureus BAA 976.
Table 4.
Isolate Number | Probable identity | Location | Sample | E. coli ATCC 35218 | S. aureus ATCC 1026 | K. pneumoniae ATCC 35218 |
---|---|---|---|---|---|---|
KC430 | Pseudomonas spp. | Kangaru | Chips | 0.00 ± 0.00b | 0.00 ± 0.00b | 14.33 ± 0.33a |
KC67 | P. aeruginosa | Kangaru | Chips | 0.00 ± 0.00b | 0.00 ± 0.00b | 10.00 ± 0.00b |
KF395 | Yersinia spp. | Kangaru | Fish | 0.00 ± 0.00b | 0.00 ± 0.00b | 9.67 ± 0.33b |
KFR217 | Klebsiella spp. | Kangaru | Fruit | 0.00 ± 0.00b | 0.00 ± 0.00b | 7.00 ± 0.00c |
KFR38 | B. pacificus | Kangaru | Fruit | 0.00 ± 0.00b | 8.33 ± 2.33b | 13.67 ± 0.33a |
KMP337 | C. freundii | Kangaru | Meat pie | 0.00 ± 0.00b | 16.33 ± 0.88a | 0.00 ± 0.00d |
KS260 | E. coli | Kangaru | Soil | 7.00 ± 0.00a | 0.00 ± 0.00b | 9.00 ± 0.00bc |
KSM63 | S. sonnei | Kangaru | Samosa | 0.00 ± 0.00b | 0.00 ± 0.00b | 10.33 ± 1.33b |
KVS271 | Pseudomonas spp. | Kangaru | Vegetable salad | 0.00 ± 0.00b | 0.00 ± 0.00b | 7.00 ± 0.00c |
TS380 | Salmonella spp. | Town | Soil | 0.00 ± 0.00b | 0.00 ± 0.00b | 11.00 ± 0.58b |
TS572 | B. subtilis | Town | Soil | 0.00 ± 0.00b | 0.00 ± 0.00b | 14.00 ± 0.58a |
| ||||||
P value | 0.001 | 0.001 | 0.001 | |||
CV | 0.00 | 76.76 | 9.03 | |||
LSD | 0.00 | 3.80 | 2.54 |
Mean with SE for antibiosis activity of the isolates, where the means with the same letters are not significantly different as indicated by Tukey's HSD test (P < 0.05).
3.4. Risk Groups of Antibiotic-Resistant Bacterial Isolates
The 14 antibiotic-resistant bacteria that were successfully sequenced belonged to risk groups 1, 2, and 3. Isolate KS606 affiliated to B. anthracis and isolate KMP95 affiliated to S. marcescens which are risk group 3 organisms that were isolated from food sold in Kangaru Market (Table 5).
Table 5.
Isolate no. | Location | Sample | Identity | % similarity | Resistant to antibiotics (n) | Resistance genes detected by PCR | Riskgroup |
---|---|---|---|---|---|---|---|
KFR42 | Kangaru | Fruit | B. amyloliquefaciens | 99.44 | 6 | — | 1 |
KFR38 | Kangaru | Fruit | B. pacificus | 99.1 | 6 | StrB | 1 |
KS65 | Kangaru | Soil | P. benzoelyticum | 99.57 | 3 | — | 1 |
KC75 | Kangaru | Chips | B. wiedmannii | 99.51 | 3 | — | 2 |
KF101 | Kangaru | Fish | B. velezensis | 97.86 | 4 | — | 1 |
KVS120 | Kangaru | Vegetable salad | B. subtilis | 97.94 | 8 | — | 1 |
KFR222 | Kangaru | Fruit | B. mobilis | 99.83 | 5 | BlaTEM | 2 |
KF463 | Kangaru | Fish | B. anthracis | 99.43 | 7 | StrB, BlaTEM | 1 |
TFR329 | Town | Fruit | B. proteolyticus | 97.18 | 7 | Str B, Dfr A | 1 |
KS109 | Kangaru | Soil | L. parviboronicapiens | 90.83 | 7 | Amp | 1 |
KS104 | Kangaru | Soil | V. phasianinus | 99.31 | 3 | — | 1 |
KMP95 | Kangaru | African sausage | S. marcescens | 95.39 | 6 | Dfr A, FloR | 3 |
KS606 | Kangaru | Soil | B. anthracis | 100 | 5 | Tet A | 3 |
TS572 | Town | Soil | B. subtilis | 97.51 | 5 | Str B, BlaTEM, FloR | 1 |
– ,resistance gene not detected.
3.5. Substrate Utilization by Antibiotic-Resistant Bacteria
The antibiotic-resistant bacterial isolates produced different extracellular enzymes, as shown by the zones of clearance on different substrates. Isolates KF148, KF317, KS116, KS7, and KVS249 exhibited the largest zones of clearance with an average diameter and standard error (SE) of 14.67 ± 0.33 mm, 14.00 ± 0.58 mm, 14.00 ± 0.58 mm, 15.00 ± 0.00 mm, and 14.67 ± 0.33 mm, respectively. B. anthracis (KS606) recorded the largest zone of clearance on cellulose, while KC430 affiliated to Pseudomonas spp. had the largest zone of precipitation on the tween-20 substrate.
3.6. Amplification of 16S rRNA Genes and Phylogenetic Analysis
The 16S rRNA gene was successfully amplified in 47 isolates out of the 70 antibiotic-resistant bacterial isolates (Figure 5).
Phylogenetic analysis of successfully sequenced bacterial isolates revealed that the isolates belonged to five genera, namely, Bacillus, Paraclostridium, Lysinibacillus, Virgibacillus, and Serratia with the similarity of above 90%. The Bacillus clade had the highest number of successfully amplified bacterial isolates distributed in nine subclades with bootstrap values of 98 (Figure 6).
4. Discussion
The present study isolated 70 bacterial isolates that were resistant to at least three antibiotics from vended foods and the soil in Embu Town and Kangaru Market. Higher levels of antibiotic resistance were recorded from bacteria isolated from vended food and soil in Kangaru Market compared to Embu Town. The presence of antibiotic-resistant pathogens in street vended foods has been recently reported in Kisumu, Kenya [23]. An earlier study in Kibera, Kenya, reported that food and the environment are reservoirs of antibiotic resistance [24]. Food contaminated with antibiotic-resistant bacteria is a threat to public health as it encourages persistence and dissemination of resistance determinants [25]. The higher level of antibiotic resistance recorded in the Kangaru Market may be due to laxity in the enforcement of public health measures. Resistance to gentamycin and streptomycin which are administered by intramuscular injection was 48.57% and 32.86%, respectively. The intramuscular mode of administration possibly limits the use of these antibiotics and thus contributes to the preservation of the antimicrobial activity [26]. In the present study, the frequency of antibiotic resistance to oral antibiotics was high and ranged from 72.86% for amoxicillin to 81.43% for nalidixic acid. The high level of resistance to oral antibiotics is possibly due to availability, convenient mode of administration, broad-spectrum activity, and affordability.
Fish samples in the present study had the highest (18.52%) proportion of antibiotic-resistant isolates. The contamination of fish with antibiotic-resistant bacteria has been previously attributed to fecal contamination of water due to the unhygienic disposal of human waste [27]. Earlier studies reported contamination of water with bacteria that were multidrug resistant to sulphamethoxazole/trimethoprim, ampicillin, and tetracycline [24, 28]. The present study confirmed that treated water from EWASCO that is used by most of the people in Embu Town and Kangaru Market was free from contamination by bacteria at the time of sampling. Therefore, it is unlikely that antibiotic resistance in this study originated from EWASCO water.
The current study isolated antibiotic-resistant bacteria from vegetable salad and African sausages, which are mostly homemade. Contamination of smokies, which are also a kind of sausage that is factory made and packed, with antibiotic-resistant bacteria was low. Postharvest contamination of vegetables and cross-contamination of African sausages are a major risk factor for disseminating antibiotic resistance [29, 30]. Soil samples from both Embu Town and Kangaru Market recorded a higher proportion of antibiotic-resistant isolates compared to food samples. In a previous study, anthropogenic activities such as long-term manure application were shown to increase antibiotic-resistant bacteria in soil [31]. Such activities were not deduced in the present study. Isolation of Pseudomonas spp. from both soil and fish in Kangaru Market indicates the possibility of food contamination originating from the environment.
The present study showed that antibiotic resistance was encoded by TetA, BlaTEM, StrB, DfrA, Amp, and FloR genes. In this study, genes encoding streptomycin resistance StrB were detected in only nine out of the 23 isolates that were resistant to streptomycin. The StrB genes are known to be encoded by both transposons and plasmids [32]. The present study did not examine transposon-encoded antibiotic resistance, which could explain the detection of StrB in fewer isolates. Five of the nine isolates positive for FloR genes were isolated from food. This could be due to the use of chloramphenicol for domestic purposes [33]. Contamination of food by antibiotic-resistant bacteria could become a major threat to public health since the antibiotic resistance determinants can be transferred to pathogenic bacteria thus complicating the treatment of bacterial infections.
Sequencing of the 16S rRNA gene revealed that most of the antibiotic-resistant bacterial food contaminants detected in this study belonged to the genus Bacillus. Although previous studies have associated Bacillus with food spoilage [34], isolation of B. wiedmannii, a risk group 2 from food, and B. anthracis, a risk group 3 organism from the soil, is of public health concern. The pathogen B. anthracis can cause the death of both human beings and animals [35] (https://my.absa.org/tiki-index). Since S. marcescens occurs naturally in soil and water, it can cause urinary, respiratory, meningitis, pneumonia, septicemia, and endocarditis infections in man. Isolation of S. marcescens from the African sausage in this study could be a result of contamination during preparation, as African sausages are mostly homemade. The presence of S. marcescens a risk group 3 organism [7] in food is of grave concern.
Although isolate TS572 affiliated to B. subtilis was resistant to five antibiotics, it also had antimicrobial activity against K. pneumoniae ATCC 49619. This is not surprising as B. subtilis from soil have been reported to produce antimicrobial agents [36]. KMP337 affiliated to C. freundii recorded the highest antibiosis activity against S. aureus ATCC 1026. Previous studies associated C. freundii with multiple antibiotic resistance but not the production of antimicrobial agents [37]. The present study isolated B. amyloliquefaciens from fruits in Kangaru Market. In a previous study, B. amyloliquefaciens was isolated from banana fruit surfaces and was shown to produce antimicrobial activity against crown root causing pathogens. Thus, B. amyloliquefaciens could be explored further for antimicrobial agents [38]. Isolation of bacteria with antimicrobial activity in the present study supports the need for innovative screening strategies in the search for new antimicrobial agents. Most of the bacteria isolated in the current study were able to produce extracellular enzymes. Other studies have suggested that isolates that exhibit high enzymatic activity also possess high antibiosis activity; thus, these processes could be occurring concurrently [18, 39].
5. Conclusions
This study showed that vended food and the soil in Embu Town and Kangaru Market contain bacterial food contaminants that are resistant to commonly used antibiotics. The study further confirmed that the bacteria harbored antibiotic resistance determinants TetA, BlaTEM, StrB, DfrA, Amp, and FloR. Some of the bacterial food contaminants isolated in this study are risk group 2 and 3 organisms which is a public health concern. More resistance was recorded in the bacteria originating from Kangaru Market as compared to Embu Town. Overall, vended food in Kangaru Market may pose a health risk to the public if mitigating measures are not put in place.
Acknowledgments
This research was supported by the University of Embu.
Data Availability
Additional data for this manuscript have been provided as supplementary material.
Disclosure
A license to conduct the research was obtained from the National Commission for Science, Technology and Innovation (NACOSTI) in Kenya. Authorization to collect samples was granted by the Public Health Ministry of Embu County.
Conflicts of Interest
The authors declare that there are no conflicts of interest in the publication of this paper.
Supplementary Materials
References
- 1.Oladipo I. C., Adejumobi O. D. Incidence of antibiotic resistance in some bacterial pathogens from street vended food in Ogbomoso, Nigeria. Pakistan Journal of Nutrition. 2010;9(11):1061–1068. doi: 10.3923/pjn.2010.1061.1068. [DOI] [Google Scholar]
- 2.Jahan M., Rahman M., Rahman M., et al. Microbiological safety of street-vended foods in Bangladesh. Journal of Consumer Protection and Food Safety. 2018;13(3):257–269. doi: 10.1007/s00003-018-1174-9. [DOI] [Google Scholar]
- 3.Omulo S., Thumbi S. M., Njenga M. K., Call D. R. A review of 40 years of enteric antimicrobial resistance research in Eastern Africa: what can be done better? Antimicrobial Resistance & Infection Control. 2015;4(1):p. 1. doi: 10.1186/s13756-014-0041-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Walsh C. T., Fischbach M. A. New ways to squash superbugs. Scientific American. 2009;301(1):44–51. doi: 10.1038/scientificamerican0709-44. [DOI] [PubMed] [Google Scholar]
- 5.Okeke I. A. N., Kariuki S., Dinant G. J., Driessen C., Stobberingh E. E. Antibiotic resistance of faecal Escherichia coli from healthy volunteers from eight developing countries. Journal of Antimicrobial Chemotherapy. 2004;54(5):952–955. doi: 10.1093/jac/dkh448. [DOI] [PubMed] [Google Scholar]
- 6.Githuka G. Notes from the field: ongoing cholera outbreak—Kenya, 2014–2016. Morbidity and Mortality Weekly Report. 2016;65 doi: 10.15585/mmwr.mm6503a7. [DOI] [PubMed] [Google Scholar]
- 7.ABSA. Risk group database. 2016.
- 8.Njiru Peter K., Omuterema Stanley O., Lilechi D. B. Embu County, Kenya: American Society for Microbiology (ASM); 2016. Sanitation in Relation to Prevalence of Waterborne Diseases in Mbeere. [Google Scholar]
- 9.Hazeleger W. C., Beumer R. R. Microbial quality of raw horse milk. International Dairy Journal. 2016;63:59–61. doi: 10.1016/j.idairyj.2016.07.012. [DOI] [Google Scholar]
- 10.Cappuccino J. G., Sherman N. Techniques for isolation of pure cultures. Cultural and morphological characteristics of microorganisms. 2002;6:13–23. [Google Scholar]
- 11.Ledeboer N. A., Doern G. V. Haemophilus Manual of Clinical Microbiology. 11th. New York, NY, USA: American Society for Microbiology (ASM); 2015. pp. 667–684. [Google Scholar]
- 12.Clesceri L. S., Greenberg A. E., Eaton A. D., Rice E. W., Franson M. A. H. Standard methods for the examination of water and wastewater. Journal of Advanced Biotechnology and Bioengineering. 2005;628 [Google Scholar]
- 13.Sharma T., Sharma A., Kanwar S. S. Purification and characterization of an extracellular high molecular mass esterase from Bacillus pumilus. Journal of Advanced Biotechnology and Bioengineering. 2016;4(1):9–16. [Google Scholar]
- 14.Torres C., Leandro D. O., Jamile P., Pereira Q. Screening of bacteria for protease production and feather degradation. Waste and Biomass Valorization. 2016;4 [Google Scholar]
- 15.Furtado G. L., Medeiros A. A. Single-disk diffusion testing (kirby-bauer) of susceptibility of Proteus mirabilis to chloramphenicol: significance of the intermediate category. Waste and Biomass Valorization. 2015;198 doi: 10.1128/jcm.12.4.550-553.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Standards P., Testing A. S. M100 performance standards for antimicrobial. 2018.
- 17.Nuneza K. J. M., Abella D. M. M., Maratas L. L., Nuneza O. M. Antibiotic phenotypic profile of fecal Escherichia coli from pediatric patients of adventist medical center, Iligan city, Philippines. Advances in Environmental Biology. 2015;9:129–138. [Google Scholar]
- 18.Neondo J. O., Alakonya A. E., Kasili R. W. Screening for potential Striga hermonthica fungal and bacterial biocontrol agents from suppressive soils in Western Kenya. BioControl. 2017;62(5):705–717. doi: 10.1007/s10526-017-9833-9. [DOI] [Google Scholar]
- 19.Sambrook J., Russell D. W. Molecular clonning: a laboratory manual. Molecular Clonning: A Laboratory Manual. 2001;62 [Google Scholar]
- 20.Bimboim H. C., Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Research. 1979;7(6):1513–1523. doi: 10.1093/nar/7.6.1513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sambrook J., Fritsch E. F., Maniatis T., Sambrook-Fritsch-Maniatis T. Molecular cloning: a laboratory manual; (prepared for use in the CSH courses on the molecular cloning of eukaryotic genes) Cold Spring Harbor Laboratory Press. 1989;7 [Google Scholar]
- 22.Sambrook J., Russell D. W. 3rd. New York, NY, USA: Cold Spring Harbor Laboratory Press; 2001. Molecular Cloning: A Laboratory Manual. [Google Scholar]
- 23.Onyango D. M. Source tracking and antibiotic resistance patterns of selected pathogenic bacteria isolated from street vended food in Kisumu county, Kenya. EC Pharmacology and Toxicology. 2019;7:585–596. [Google Scholar]
- 24.Muhonja N. C., Budambula N., Kiiru J., Kariuki S. Characterization of antibiotic resistance in environmental enteric pathogens from Kibera slum. EC Pharmacology and Toxicology. 2012;4:46–54. [Google Scholar]
- 25.Disease F., Epidemiology B., Group R. Who estimates of the global burden of foodborne diseases. 2015.
- 26.Muñoz-atienza E. Antimicrobial activity, antibiotic susceptibility and virulence factors of lactic acid bacteria of aquatic origin intended for use as probiotics in aquaculture. 2013. [DOI] [PMC free article] [PubMed]
- 27.Sifuna A. W., Onyango D. M. Source attribution of Salmonella and Escherichia coli contaminating lake victoria fish in Kenya. African Journal of Tropical Hydrobiology and Fisheries. 2018;16(1):39–47. [Google Scholar]
- 28.Too J. K., Kipkemboi Sang W., Ng’ang’a Z., Ngayo M. O. Fecal contamination of drinking water in Kericho District, Western Kenya: role of source and household water handling and hygiene practices. Journal of Water and Health. 2016;14(4):662–671. doi: 10.2166/wh.2016.137. [DOI] [PubMed] [Google Scholar]
- 29.Kutto E. K., Ngigi M. W, Karanja N, et al. Bacterial contamination of Kale (Brassica oleracea acephala) along the supply chain in Nairobi and its environment. East African Medical Journal. 2011;88(2):46–53. [PubMed] [Google Scholar]
- 30.Karoki W. H., Karanja D. N., Bebora L. C., Njagi L. W. Isolation, characterization, and quantification of bacteria from African sausages sold in Nairobi County, Kenya. International Journal of Food Sciences and Nutrition. 2018;2018 doi: 10.1155/2018/3861265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Han L., Cai L., Zhang H., Long Z., Yu Y., Fang H. Development of antibiotic resistance genes in soils with ten successive treatments of chlortetracycline and ciprofloxacin. Environmental Pollution. 2019;253:152–160. doi: 10.1016/j.envpol.2019.07.031. [DOI] [PubMed] [Google Scholar]
- 32.Vanneste J. L., Voyle M. D., Yu J., Cornish D. A., Boyd R. J., Mclaren G. F. Copper and streptomycin resistance in Pseudomonas strains isolated from pipfruit and stone fruit orchards in New Zealand. 2008.
- 33.Lu J. Spread of the florfenicol resistance floR gene among clinical Klebsiella pneumoniae isolates in China, Antimicrob. Antimicrobial Resistance & Infection Control. 2018;7(1):p. 127. doi: 10.1186/s13756-018-0415-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Owusu-Kwarteng J., Wuni A., Akabanda F., Tano-Debrah K., Jespersen L. Prevalence, virulence factor genes and antibiotic resistance of Bacillus cereus sensu lato isolated from dairy farms and traditional dairy products. BMC Microbiology. 2017;17(1):p. 65. doi: 10.1186/s12866-017-0975-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Erickson M. C. Internalization of fresh produce by foodborne pathogens. Annual Review of Food Science and Technology. 2012;3(1):283–310. doi: 10.1146/annurev-food-022811-101211. [DOI] [PubMed] [Google Scholar]
- 36.Torres M. J., Petroselli G., Daz M., Erra-Balsells R., Audisio M. C. Bacillus subtilis subsp. subtilis CBMDC3f with antimicrobial activity against Gram-positive foodborne pathogenic bacteria: UV-MALDI-TOF MS analysis of its bioactive compounds. World Journal of Microbiology and Biotechnology. 2015;31(6):929–940. doi: 10.1007/s11274-015-1847-9. [DOI] [PubMed] [Google Scholar]
- 37.Pepperell C., Kus J. V., Gardam M. A., Humar A., Burrows L. L. Low-virulence Citrobacter species encode resistance to multiple antimicrobials. Antimicrobial Agents and Chemotherapy. 2002;46(11):3555–3560. doi: 10.1128/aac.46.11.3555-3560.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Alvindia D. G., Natsuaki K. T. Biocontrol activities of Bacillus amyloliquefaciens DGA14 isolated from banana fruit surface against banana crown rot-causing pathogens. Crop Protection. 2009;28(3):236–242. doi: 10.1016/j.cropro.2008.10.011. [DOI] [Google Scholar]
- 39.Sicuia O.-A., Grosu I., Constantinescu F., Voaides C., Cornea C. P. Enzymatic and genetic variability in Bacillus spp. strains with plant beneficial qualities. AgroLife Scientific Journal. 2015;4:124–131. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Additional data for this manuscript have been provided as supplementary material.