Skip to main content
PMC home page
eLife logoLink to eLife
. 2020 Aug 24;9:e58042. doi: 10.7554/eLife.58042

Long-term potentiation is independent of the C-tail of the GluA1 AMPA receptor subunit

Javier Díaz-Alonso 1,†,✉, Wade Morishita 2, Salvatore Incontro 1, Jeffrey Simms 3, Julia Holtzman 3, Michael Gill 3, Lennart Mucke 3,4, Robert C Malenka 2, Roger A Nicoll 1,✉
Editors: Linda Overstreet-Wadiche5, Richard W Aldrich6
PMCID: PMC7500950  PMID: 32831170

Abstract

We tested the proposal that the C-terminal domain (CTD) of the AMPAR subunit GluA1 is required for LTP. We found that a knock-in mouse lacking the CTD of GluA1 expresses normal LTP and spatial memory, assayed by the Morris water maze. Our results support a model in which LTP generates synaptic slots, which capture passively diffusing AMPARs.

Research organism: Mouse, Rat

Introduction

Long-term potentiation (LTP) requires the activity-dependent trafficking of AMPA receptors (AMPARs) to the synapse (Collingridge et al., 2004; Malinow and Malenka, 2002; Nicoll, 2017). Most AMPARs in CA1 pyramidal cells are heterotetramers of either GluA1/GluA2 subunits or GluA2/GluA3 subunits, although other complexes can also occur (Zhao et al., 2019). The prevailing, receptor centric, LTP model, posits that LTP-mediated covalent modification of the intracellular carboxy-terminal domain (CTD, also referred to as C-tail) of GluA1 results in the capture of these modified GluA1 containing receptors by preexisting ‘slots’ in the postsynaptic density (PSD) (Hayashi et al., 2000; Huganir and Nicoll, 2013; Malinow and Malenka, 2002; Shi et al., 2001), either by increasing the surface pool of AMPARs or the docking of AMPAR at the PSD. The nature of these slots is unclear, but it is thought to involve binding sites on postsynaptic scaffolding proteins, such as PSD-95. Two phosphorylation sites in the GluA1 CTD, S831 and S845, have received most of the attention. However, the occurrence of S831 and S845 phosphorylation in vivo is a matter of debate. A recent study found the relative abundance of phosphorylated GluA1 to be ‘almost negligible’ (Hosokawa et al., 2015), but see Diering et al., 2016. The replacement by alanine of either of these residues does not affect LTP (Lee et al., 2010), and only adult double phosphomutant mice have partially impaired LTP (Lee et al., 2003). In order to determine the minimal requirement for the GluA1 CTD during LTP, a previous study Granger et al., 2013 used a conditional genetic knockout approach coupled with molecular replacement of AMPAR subunits. The Cre recombinase was transfected in CA1 pyramidal neurons in the hippocampus of Gria1, Gria2 and Gria3 floxed mice (Gria1-3fl/fl), in order to delete all endogenous AMPARs in Lu et al., 2009. We then expressed various modified GluA subunits upon this AMPAR null background. In the most relevant experiment in our study, we expressed a heteromeric receptor containing the GluA1 subunit lacking the CTD (GluA1ΔC) as well as GluA2, and observed normal basal trafficking and LTP at CA1 synapses in acute hippocampal slices. We therefore concluded that AMPAR lacking the GluA1 subunit CTD can traffic normally to the synapse and enable normal LTP (Granger et al., 2013). These findings appear to be incompatible with the receptor centric model and the requirement of the GluA1 CTD for LTP.

A recent study has resurrected the receptor centric model of LTP (Zhou et al., 2018). The authors generated a knock-in (KI) mouse, in which they replaced the endogenous GluA1 with a chimeric GluA1 subunit that contains the CTD of GluA2 (GluA1A2CTD). They found that, while basal synaptic transmission was normal in this mouse, LTP was absent. Furthermore, a complementary chimeric AMPAR subunit, GluA2A1CTD, fully rescued LTP. Thus, the authors concluded that the CTD of GluA1 is ‘necessary and sufficient’ for NMDAR dependent LTP. What could explain this seeming contradiction? The present study addresses the discrepancy between the previous works (Granger et al., 2013; Zhou et al., 2018).

Results

To address this discrepancy, we aimed to replicate the key experiments in Zhou et al. using overexpression and molecular replacement strategies (Díaz-Alonso et al., 2017; Granger et al., 2013). We previously showed that replacement of endogenous GluA2 subunits with GluA1/A2CTD resulted in functional AMPARs, which supported homeostatic synaptic scaling (Ancona Esselmann et al., 2017). Furthermore, overexpression of this construct in hippocampal slice cultures generated rectifying synaptic responses (Figure 1—figure supplement 1A,B), confirming that this construct forms functional homomeric receptors which traffic to the synapse constitutively. We next replaced all endogenous AMPARs with heteromeric GluA1/A2CTD-GluA2 receptors in hippocampal CA1 pyramidal neurons. To do so, we electroporated Cre recombinase in utero in Gria1-3f/f mice (where all AMPAR subunits expressed in CA1 pyramidal neurons are floxed) together with GluA1/A2CTD and GluA2(R) (Figure 1A). Acute slices were prepared at P17-P25. Synaptic AMPARs were fully rescued (Figure 1B). Unlike replacement with GluA1/A2CTD alone, which results in strongly rectifying, homomeric AMPARs (Figure 1—figure supplement 2B), synaptic currents were non-rectifying in GluA1/A2CTD-GluA2(R) expressing neurons (Figure 1—figure supplement 2A,C), confirming that the expressed subunits form heteromeric receptors. These receptors exhibit normal LTP (Figure 1C). Trying to replicate the experiments reported by Zhou et al. more closely, we selectively replaced endogenous GluA1, which we deleted using CRISPR/Cas9 technology, with GluA1/A2CTD (Figure 1D). We initially tested the efficacy of the CRISPR/Cas9 guided GluA1 knockdown strategy in a heterologous system, 293 T cells. Co-transfection of a Gria1 gRNA/Cas9 expressing vector in cells expressing GluA1 virtually eliminated the GluA1 protein (Figure 1—figure supplement 3A). We then tested the efficacy of the Gria1 gRNA/Cas9 construct in hippocampal slices. Similar to the results obtained using the conditional KO of GluA1 using Cre-loxP (Granger et al., 2013; Lu et al., 2009), we observed a ~50% loss of AMPAR EPSCs when expressing the Gria1 gRNA/Cas9 in rat slice cultures and mouse acute slices (therefore, data were pooled, Figure 1—figure supplement 3B,C). NMDAR EPSCs remained unchanged (Figure 1—figure supplement 3D). LTP was absent (Figure 1—figure supplement 3E), in agreement with previous results, likely due to the lack of a sufficient reserve pool of receptors (Granger et al., 2013; Zamanillo et al., 1999). The endogenous GluA1 was then replaced with GluA1/A2CTD*, where the sequence recognized by the Gria1 gRNA was replaced by another which translates to the same protein sequence (Figure 1D, Figure 1—figure supplement 3A, Materials and methods). GluA1/A2CTD* expression rescued basal synaptic transmission (Figure 1E) and LTP (Figure 1F). NMDAR EPSCs were normal in transfected cells (Figure 1—figure supplement 3F).

Figure 1. GluA1/A2CTD supports LTP.

(A) Left panel, schematic illustration of the recombinant AMPAR subunits employed to replace endogenous AMPAR: GluA1/A2CTD and (edited) GluA2 (R) in hippocampal CA1 pyramidal neurons from Gria1-3 f/f mice. Note that these two subunits form heteromeric, non-rectifying AMPAR (see Figure 1—figure supplement 2). ATD, amino-terminal domain; LBD, ligand-binding domain; TM, transmembrane domain; CTD, carboxy-terminal domain. Middle panel, summary and timeline of the experiment. Right panel, schematic illustration of the experimental setup with simultaneous whole-cell recordings from control and transfected CA1 pyramidal neurons. (B) Scatterplot measuring the baseline EPSC size at −70 mV in control (X axis) and Cre + GluA1/A2CTD + GluA2 (R) expressing (Y axis) neurons. Open circles represent individual pairs of control and transfected neurons, filled circle represents mean ± SEM. Inset shows sample traces from a control (black trace) and a transfected (green trace) cell. n = 16 pairs. p=0.804, two-tailed Wilcoxon signed-rank test. (C) Plot representing the mean ± SEM EPSC at −70 before and after LTP induction (arrow) normalized by the average baseline EPSC size (dashed gray line) in control (filled circles) and Cre + GluA1/A2CTD + GluA2 (R) expressing (green circles) CA1 pyramidal neurons. Sample traces before and 45’ after LTP induction in control (black traces) and transfected (green traces) CA1 pyramidal neurons are shown to the right of the plot. n initial/final = 13/7 control, 17/10 transfected neurons. p=0.775 (min. 45), unpaired t-test. (D) Left panel, schematic illustration of the recombinant AMPAR subunit employed to replace endogenous GluA1: GluA1/A2CTD in hippocampal CA1 pyramidal neurons from Cas9 KI mice. Middle panel, summary and timeline of the experiment. Right panel, schematic illustration of the experimental setup with simultaneous whole-cell recordings from control and transfected CA1 pyramidal neurons. (E) Scatterplot measuring the baseline EPSC size at −70 mV in control (X axis) and Gria1 gRNA + GluA1/A2CTD expressing (Y axis) neurons. Open circles represent individual pairs of control and transfected neurons, filled circle represents mean ± SEM. Inset shows sample traces from a control (black trace) and a transfected (green trace) cell. n = 12 pairs. p=0.557, two-tailed Wilcoxon signed-rank test. (F) Plot representing the mean ± SEM EPSC at −70 mV before and after LTP induction (arrow) normalized by the average baseline EPSC size (dashed gray line) in control (filled circles) and Gria1 gRNA + GluA1/A2CTD expressing (green circles) CA1 pyramidal neurons. Sample traces before and 45’ after LTP induction in control (black traces) and transfected (green traces) CA1 pyramidal neurons are shown to the right of the plot. Scale bars: 50 pA, 50 ms. n initial/final = 8/8 control, 11/9 transfected neurons. p=0.683 (min 45), unpaired t-test.

Figure 1—source data 1. Contains source data for Figure 1.
GluA1/A2CTD supports LTP.
elife-58042-fig1-data1.xlsx (121.1KB, xlsx)

Figure 1.

Figure 1—figure supplement 1. Chimeric GluA1/A2CTD traffics constitutively to the synapse.

Figure 1—figure supplement 1.

(A) Left, schematic illustration of the chimeric GluA1/A2CTD employed in this experiment. ATD, amino-terminal domain; LBD, ligand-binding domain; TM, transmembrane domain; CTD, carboxy-terminal domain. Right, summary and timeline of the experiment. (B) Synaptic rectification of AMPAR EPSCs measured in control and GluA1/A2CTD overexpressing CA1 pyramidal neurons 2–3 days after transfection in the presence of 0.1 mM AP5. Individual data values and mean ± SEM are indicated. Control (black) and transfected neuron (green) sample traces are shown to the right. n = 12 control, 10 transfected neurons. p<0.001, unpaired t-test. Scale bars: 50 pA, 50 ms.
Figure 1—figure supplement 1—source data 1. Contains source data for Figure 1—figure supplement 1.
Chimeric GluA1/A2CTD traffics constitutively to the synapse.

Figure 1—figure supplement 2. GluA1/A2CTD and GluA2(R) form non-rectifying heteromeric AMPAR.

Figure 1—figure supplement 2.

(A) Left, schematic illustration of the chimeric GluA1/A2CTD (left) and GluA2 (R) AMPAR subunits employed to replace endogenous AMPAR in Gria1-3 f/f mice in this experiment. ATD, amino-terminal domain; LBD, ligand-binding domain; TM, transmembrane domain; CTD, carboxy-terminal domain. Middle, summary and timeline of the experiment. Right, schematic illustration of the simultaneous whole cell recording of control and neighboring transfected CA1 neurons and stimulation of the Schaffer collaterals. (B) Synaptic rectification of AMPAR EPSCs measured in control and transfected cells, in which endogenous AMPAR subunits were replaced by GluA1/A2CTD, in the presence of 0.1 mM AP5. Representative traces of control (black, top) and transfected neurons (green, bottom) are shown. n = 5 control, five transfected cells. p<0.001, unpaired t-test. Scale bars: 50 pA, 50 ms. (C) Synaptic rectification of AMPAR EPSCs measured in control and transfected cells, in which endogenous AMPAR subunits were replaced by GluA1/A2CTD together with GluA2, in the presence of 0.1 mM AP5. Representative traces of control (black, top) and transfected neurons (green, bottom) are shown. n = 4 control, four transfected cells. p=0.800, unpaired t-test. Scale bars: 50 pA, 50 ms.
Figure 1—figure supplement 2—source data 1. Contains source data for Figure 1—figure supplement 2.
GluA1/A2CTD and GluA2(R) form non-rectifying heteromeric AMPAR.

Figure 1—figure supplement 3. Validation of the CRISPR-mediated GluA1 deletion.

Figure 1—figure supplement 3.

(A) Validation of the ability of the CRISPR/Cas9-mediated GluA1 deletion. 293 T cells overexpressing GluA1, GluA1/A2CTD and (CRISPR-resistant) GluA1/A2CTD* were co-transfected with a plasmid encoding Cas9 together with either Gria1 gRNA or a Grin1 gRNA as a control. Tested in two biological replicates and several technical replicates. (B) Left, timeline and strategy to delete GluA1 sparsely in the CA1 region of the hippocampus in Cas9 KI mice by in utero electroporation of a specific gRNA targeting mouse Gria1. Right, schematic illustration of the experimental setup with simultaneous whole-cell recordings from control and transfected CA1 pyramidal neurons. (C) Scatterplot measuring the baseline EPSC size at −70 mV in control (X axis) and Gria1 gRNA expressing (Y axis) neurons. Empty circles represent individual pairs of control and transfected neurons, filled circle represents mean ± SEM. Inset shows sample traces from a control (black trace) and a transfected (green trace) cell. The scatterplot combines data obtained using slice culture biolistically transfected and acute slices from in utero electroporated mice. n = 21 pairs. p<0.001, two-tailed Wilcoxon signed-rank test. (D) Scatterplot measuring the baseline EPSC size at +40 mV (measured 150 ms after the stimulation artifact to avoid contamination from AMPAR EPSC) in control (X axis) and Gria1 gRNA expressing (Y axis) neurons. Empty circles represent individual pairs of control and transfected neurons, filled circle represents mean ± SEM. Inset shows sample traces from a control (black trace) and a transfected (green trace) cell. The scatterplot combines data obtained using slice culture biolistically transfected and acute slices from in utero electroporated mice. n = 15 pairs. p=0.348, two-tailed Wilcoxon signed-rank test. (E) Plot representing the mean ± SEM EPSC at −70 mV before and after LTP induction (arrow) normalized by the average baseline EPSC size (dashed gray line) in control (filled circles) and Gria1 gRNA expressing (green circles) CA1 pyramidal neurons. Sample traces before and 45’ after LTP induction in control (black traces) and transfected (green traces) CA1 pyramidal neurons are shown to the right of the plot. n initial/final = 12/7 control, 9/8 Gria1 gRNA cells. p<0.01, unpaired t-test. (F) Left, schematic illustration of the chimeric GluA1/A2CTD. Right, scatterplot measuring the baseline EPSC size at +40 mV (at 150 ms) in control (X axis) and Gria1 gRNA expressing (Y axis) neurons. Open circles represent individual pairs of control and transfected neurons, filled circle represents mean ± SEM. Inset shows sample traces from a control (black trace) and a transfected (green trace) cell. n = 6 pairs. p=0.188, two-tailed Wilcoxon signed-rank test. Scale bars: C, E, 50 pA, 50 ms; D, F, 25 pA, 50 ms. AMPAR EPSCs. **, p<0.01; ***, p<0.001.
Figure 1—figure supplement 3—source data 1. Contains source data for Figure 1—figure supplement 3.
Validation of the CRISPR-mediated GluA1 deletion.
Open in a new tab

The only remaining difference in the experimental approach between our study and that of Zhou et al. is that they used the endogenous promoter to express GluA1/A2CTD, while we used overexpression. Thus, to unequivocally assess the necessity of the GluA1 CTD for LTP, we generated a KI mouse where the endogenous GluA1 CTD is truncated (HA-ΔCTD GluA1, Figure 2A, Figure 2—figure supplement 1, Materials and methods). Any LTP present in this mouse must, therefore, be independent of the GluA1 CTD. A number of experiments confirmed that our KI mouse did, indeed, lack the GluA1 CTD. Western blots were performed using antibodies to the ATD of GluA1, the CTD of GluA1 and the HA tag in synaptosomal-enriched P2 fractions (Figure 2B). The HA tag, which we attached to the truncated C-terminus to identify the ΔCTD GluA1 subunit, is present in both the heterozygous and the homozygous KI mice, but, as expected, is absent from WT mice. The CTD directed antibody labeled the WT and heterozygous, but not the homozygous KI mouse. The ATD-directed antibody demonstrated the presence of GluA1 at normal levels in the KI mouse, where, as expected, the protein size is reduced due to the lack of the C-terminal 77 amino acids. Immunoblot against the GluA2 CTD and NR1 showed normal levels of these synaptic proteins in the KI (Figure 2B). Truncation of the GluA1 CTD was further confirmed with immunofluorescence using a GluA1 CTD antibody, which yielded strong staining in the WT hippocampal CA1 region, but no staining in the KI mouse (Figure 2C). AMPAR responses recorded from somatic outside out patches were unchanged in the KI mouse (Figure 2D). This is particularly important, because LTP expression is critically dependent on the level of extrasynaptic AMPARs (Granger et al., 2013). Furthermore, there was no change in the AMPAR/NMDAR ratio, consistent with a normal number of synaptic AMPARs (Figure 2E). Pairing-induced LTP (2 Hz/90 s. stimuli, while holding the postsynaptic neuron at 0 mV) in these KI mice was no different from WT controls (Figure 2F). To obtain an independent analysis of these mice, we collaborated with another group (R.C. Malenka and W. Morishita, Stanford University) who induced LTP with a different pairing protocol consisting of two stimulus bouts of 100 Hz/1 s. while holding the postsynaptic neuron at 0 mV. Again, no impairment in LTP was observed (Figure 2G).

Figure 2. GluA1 CTD is not required for AMPAR trafficking and LTP.

(A) Schematic illustration of WT GluA1 (left) and transgenic HA-ΔCTD GluA1 (right). The latter has the entire cytoplasmic tail truncated after the fourth amino acid after the last TM helix. ATD, amino-terminal domain; LBD, ligand-binding domain; TM, transmembrane domain; CTD, carboxy-terminal domain. (B) Western blots showing specific and allelic dose-dependent presence of haemmaglutinin (HA) tag only in heterozygous and homozygous HA-ΔCTD GluA1 mice brains, partial and total absence of signal from anti-GluA1 CTD antibody in heterozygous and homozygous HA-ΔCTD GluA1 mice brains, respectively and decreased size of the GluA1 protein as a result of the truncation of the cytoplasmic tail in HA-ΔCTD GluA1 mice brains. GluA2 CTD and NR1 signals did not differ substantially among genotypes. Two biological replicates (mice) are shown. Three more mice per genotype were tested and several technical replicates were performed. (C) Assessment of the GluA1 CTD signal in the hippocampus of WT (top image) and HA-ΔCTD GluA1 (bottom image) mice by immunofluorescence. (D) Surface AMPAR-mediated currents elicited by fast glutamate (1 mM) application in WT (open circles) and HA-ΔCTD GluA1 (filled circles) hippocampal CA1 pyramidal neurons measured in somatic outside-out patches. Individual data values and mean ± SEM are indicated. Sample traces from WT (left) and KI (right) patches are shown to the top of the plot. Scale bars: 25 pA, 2 s. n = 6 WT and 7 HA-ΔCTD GluA1 KI patches. p=0.820, unpaired t-test. (E) AMPAR/NMDAR EPSC ratios measured at −70 mV and +40 mV (at 150 ms), respectively, in WT (open circles) and HA-ΔCTD GluA1 (filled circles) hippocampal CA1 pyramidal neurons. Individual data values and mean ± SEM are indicated. Sample traces from WT (left) and KI (right) neurons are shown to the top of the plot. Scale bars: 50 pA, 50 ms. n = 15 WT, 20 KI cells. p=0.377, unpaired t-test. (F) Plot representing the mean ± SEM EPSC at −70 mV before and after LTP induction (arrow) normalized by the average baseline EPSC size (dashed gray line) in WT (open circles) and HA-ΔCTD GluA1 KI (filled circles) CA1 pyramidal neurons. Sample traces before and 45’ after LTP induction in WT (top) and KI (bottom) CA1 pyramidal neurons are shown to the right of the plot. Scale bars: 50 pA, 50 ms. n initial/final = 16/8 WT, 13/9 KI neurons. p=0.368 (min. 45). Unpaired t-test. (G) Plot representing the mean ± SEM EPSC at −70 mV before and after LTP induction (arrow) with an alternative protocol (2 bursts of 1 s duration at 100 Hz while holding the membrane potential at 0 mV) performed in an independent laboratory normalized by the average baseline EPSC size (dashed black line) in WT (n, cells/mice = 13/7, open circles) and HA-ΔCTD GluA1 KI (n, cells/mice = 15/9, filled circles) CA1 pyramidal neurons. Sample traces before LTP induction and at min. 50 in WT (left) and KI (right) CA1 pyramidal neurons are shown at the top of the plot at the indicated time points. p=0.606 (min 45 post pairing). Unpaired t-test.

Figure 2—source data 1. Contains source data for Figure 2.
GluA1 CTD is not required for AMPAR trafficking and LTP.
elife-58042-fig2-data1.xlsx (102.6KB, xlsx)

Figure 2.

Figure 2—figure supplement 1. Generation of the HA-ΔCTD GluA1 KI mouse line.

Figure 2—figure supplement 1.

(A) 2 crRNAs where tested to generate the KI mice. Both of them were able to disrupt the expression of overexpressed GluA1 in 293 T cells, so half of the oocytes were injected with each of them. Tested in two biological replicates and several technical replicates. (B) Overview of the strategy to generate the HA-ΔCTD GluA1 allele. The sequence recognized by the Gria1 gRNA 1 (CAUCGCUCAGCUUCGCCUAC) is indicated. Also indicated is the sequence of the ssDNA co-injected to serve as a template for HDR 3’ of the 4 initial amino acids (EFCY) after the last TM helix in the Gria1 gene, which encodes the influenza haemagglutinin (HA) tag sequence followed by four Stop codons to ensure truncation of the remainder CTD of the protein, flanked by 60 nt-long 5’ and 3’ homology arms. (C) Sequencing of Gria1 in homozygous WT (top chromatogram) and HA-ΔCTD GluA1 (bottom chromatogram). The HA-tandem stop codon insertion site is indicated with an arrow.
Open in a new tab

In a final series of experiments, we tested hippocampal spatial learning and memory in these mice using the Morris water maze, a behavioral test that was shown to be impaired in GluA1A2CTD mice (Zhou et al., 2018). No statistically significant difference between WT and HA-ΔCTD GluA1 mice was found in either the distance travelled to find the hidden platform during training (Figure 3A), or in the ability to remember the position of the platform 24 hr after the last training session (Figure 3B, Figure 3—figure supplement 1C). HA-ΔCTD GluA1 mice showed a reduced swim speed across the training and test sessions (Figure 3—figure supplement 1A,E), which increased their latency to find the platform during training (Figure 3—figure supplement 1B), and resulted in a not significant trend toward increased latency to the first platform crossing in the probe trial (Figure 3—figure supplement 1D).

Figure 3. GluA1 CTD is not essential for spatial learning and memory.

(A) Learning curves showing the distance covered to find a hidden platform in the Morris water maze per training day (average of 4 trials/day) in WT (open circles) and HA-ΔCTD GluA1 KI (filled circles) mice. Mixed effects analysis revealed that the distance necessary to find the platform decreased during training in both groups (day effect, p<0.0001). Although there was only a trend toward a genotype effect (p=0.0539), there was a significant interaction between day and genotype (p<0.05). Distance covered to find a cued platform across 2 days (C1 and C2) is shown in the right side of the plot and showed a significant effect of day (p<0.01) but not genotype (p=0.259), and there was no significant day x genotype interaction (p=0.511). n = 12 WT, 15 KI. (B) Probe trial results showing the number of crossings over the location under which the platform was hidden in the target quadrant during training (circles, empty bars) and over equivalent positions in non-target quadrants (squares, patterned bars) in a 60-s trial performed the day after the last training session. WT mice are represented by empty shapes and HA-ΔCTD GluA1 KI by filled shapes. n = 12 WT, 14 KI. Both genotypes showed a clear preference for the target location vs non-target locations (WT, p=0.0010, KI, p=0.0012,). WT and KI mice did not differ significantly in how many times they crossed the target location (p=0.582 by Mann-Whitney U test). **p<0.01; ***p<0.001 by Wilcoxon paired t-test. Individual mouse values and mean ± SEM are indicated.

Figure 3—source data 1. Contains source data for Figure 3.
GluA1 CTD is not essential for spatial learning and memory.

Figure 3.

Figure 3—figure supplement 1. Additional Morris water maze measurements.

Figure 3—figure supplement 1.

(A) Average swim speed (cm/s) in the Morris water maze (average of 4 trials/day) in WT (empty dots) and HA-ΔCTD GluA1 KI (filled dots) mice. Mixed effects analysis revealed a significant effect of genotype (p<0.01) and day (p<0.0001) during both the hidden and cued training but no significant genotype x day interaction for either training phase (p=0.455, hidden platform, p=0.722 cued platform). (B) Latency (s) to find a hidden platform in the Morris water maze (average of 4 trials/day) in WT (empty circles) and HA-ΔCTD GluA1 KI (filled circles) mice. Mixed effects analysis showed that the time it took mice to find the platform decreased by day (p<0.0001), with a clear effect of genotype (p<0.01) but no significant day x genotype interaction (p=0.205). Latency to find a cued platform across two training days (C1 and C2) is shown in the right side of the plot. Mixed effects analysis revealed a significant effect of day (p<0.0001) and genotype (p<0.01), but only a trend toward a day x genotype interaction (p=0.063). (C) Percent time spent in the target quadrant, where the platform used to be during the training phase (circles and empty bars), and in the other quadrants (squares and patterned bars) during the probe trial performed 24 hr after the last training session. Blue dotted line indicates the expected time spent in each quadrant if there were no preference for any particular quadrant (25%). WT mice are represented by empty shapes and HA-ΔCTD GluA1 KI by filled shapes. n = 12 WT, 14 KI. Mice of either genotype showed a preference for the target quadrant vs the other quadrants. (D) Latency to the first platform crossing (s) in the probe trial in WT (empty circles) and HA-ΔCTD GluA1 KI (filled circles) mice. (E) Swim speed (cm/s) in the probe trial in WT (empty circles) and HA-ΔCTD GluA1 KI (filled circles) mice. *, p<0.05 by paired t-test (C) or unpaired t-test with Welch correction (E). n.s., not significant by Mann-Whitney U test. Bars show mean ± SEM and scatterplots indicate individual mice.
Figure 3—figure supplement 1—source data 1. Contains source data for Figure 3—figure supplement 1.
Additional Morris water maze measurements.
Open in a new tab

Discussion

This study addressed whether the CTD of GluA1 is required for LTP and spatial memory, as recently reported (Zhou et al., 2018). We were unable to replicate these previous LTP results when we replaced endogenous GluA1 with GluA1/A2CTD using in utero electroporation. To test whether the high expression levels of the GluA1/A2CTD construct achieved by overexpression were masking LTP deficits, we generated a more conclusive KI mouse model. Instead of knocking in GluA1/A2CTD, as was done in the previous study, we truncated the CTD of the endogenous GluA1 (HA-ΔCTD GluA1) after the EFCY sequence following the last transmembrane helix of the polypeptide. Of note, this sequence is homologous in GluA1 and GluA2, so there is virtually no GluA1-specific CTD in this mouse. No defect in basal synaptic transmission, LTP, or spatial memory was found. What could account for the different results? By design, our LTP induction protocol is nearly-saturating, so that we can identify key, essential components of LTP. It is possible that a weaker induction protocol could reveal some subtle defects caused by the lack of the GluA1 CTD. However, Zhou et al. used a protocol similar to ours (cesium based internal solution with 100 Hz/1 s. tetanus repeated four times, see their Figure 7b). This LTP induction protocol would be at least as strong as ours, but they found no LTP in their GluA1A2CTD KI mouse.

Given that GluA1 KO mice show no spatial learning defects in the Morris water maze (Zamanillo et al., 1999), it is not surprising that mice lacking the GluA1 CTD did not show a spatial learning impairment in our study either. The severe deficits found in spatial learning and memory in GluA1/A2CTD KI mice are, therefore, puzzling. Of note, both GluA1 KO (Zamanillo et al., 1999) and HA-ΔCTD GluA1 (Figure 3—figure supplement 1A,E) mice show decreased swim speed compared to their WT controls, a possible confounding factor suggesting that the GluA1 CTD might be involved in this locomotor function. Future research will allow the dissection of the precise role played by the GluA1 CTD in locomotion and spatial memory, as well as other physiological and behavioral functions.

A large body of research has suggested that the GluA1 CTD modulates AMPAR trafficking and synaptic plasticity. We refer to these findings as the ‘receptor centric’ model of LTP, in which the LTP signaling pathway, presumed to involve CaMKII, targets the receptor, increasing the capture of modified receptors by preexisting slots in the PSD. Although we failed to find a fundamental requirement for the GluA1 CTD in AMPAR synaptic transmission, LTP and spatial memory, it has previously been shown that posttranslational modifications targeting this domain are involved in the modulation of these phenomena, particularly LTP. Multiple reasons might explain the apparent conflict between our results and previous research. Perhaps, the well-established phosphorylation of GluA1 C-tail residues (particularly S831 and S845) (Barria et al., 1997; Esteban et al., 2003; Hayashi et al., 2000; Lee et al., 2003; Mammen et al., 1997; Roche et al., 1996) is crucial to relieve some, yet unidentified, negative modulatory effect exerted by other part(s) of the GluA1 C-tail, this negative modulation being absent in HA-ΔCTD GluA1 mice and in cells expressing GluA1/A2CTD. Our study was designed to assess the necessity of the GluA1 CTD in hippocampal LTP. Our data indicate that LTP does not require the GluA1 CTD and is, therefore, consistent with a model where LTP can occur independently of the subunit composition of AMPAR, in agreement with a previous study (Granger et al., 2013). More broadly, our results suggest an alternative model, which we refer to as the ‘PSD centric model’ for LTP, in which the LTP signal creates/unmasks new slots in the PSD that capture passively diffusing, unmodified AMPARs.

Based on recent findings from us and others (Díaz-Alonso et al., 2017; Sheng et al., 2018; Watson et al., 2017; Watson et al., 2020; Zeng et al., 2019), we propose that constitutive and activity-dependent AMPAR trafficking has two essential requirements. On one hand, the multivalent interaction between transmembrane AMPAR regulatory proteins (TARPs) and PSD scaffolding proteins (the intracellular slot). On the other hand, the presence of the GluA1 amino-terminal domain and its interaction with yet to be identified extracellular synaptic cleft moieties (the extracellular slot). This emerging model predicts that the activity-regulated availability of both intracellular and extracellular slots can modulate the abundance of functional AMPARs at the synapse.

Materials and methods

Key resources table.

Reagent type
(species) or
resource		 Designation Source or
reference		 Identifiers Additional
information
Gene (Mus musculus) Gria1 GenBank #14799
Strain, strain background (Mus musculus, strain C57BL6) HA-ΔCTD GluA1 This paper N/A
Strain, strain background (Mus musculus, strain FVB) Rosa26-Cas9 KI The Jackson Laboratory #026558; RRID:IMSR_JAX:026558
Strain, strain background (Mus musculus, strain C57BL6) Gria1-3f/f Lu et al., 2009 N/A
Strain, strain background (Rattus norvegicus, strain CD Sprague Dawley IGS) WT Charles River #001
Cell line (Homo sapiens) 293T ATCC #CRL-3216; RRID:CVCL_0063
Recombinant DNA reagent (plasmid) pCAGGS-GluA1/A2 CTD-IRES-GFP This paper N/A Expression of chimeric GluA1/A2 CTD and GFP (under IRES).
Recombinant DNA reagent (plasmid) pCAGGS-GluA1/A2 CTD-IRES-mCherry* This paper N/A Gria1 CRISPR-resistant expression of chimeric GluA1/A2 CTD and mCherry (under IRES)
Recombinant DNA reagent (plasmid) pCAGGS- IRES-mCherry Incontro et al., 2014 N/A Expression of mCherry (under IRES)
Recombinant DNA reagent (plasmid) pFUGW-Cre:GFP Díaz-Alonso et al., 2017 N/A Expression of Cre:GFP fusion protein
Recombinant DNA reagent (plasmid) px458- Gria1-CRISPR This paper N/A Expression of Gria1 gRNA, Cas9 and GFP. Derived from px458 vector (Addgene #48138 RRID:Addgene_48138)
Recombinant DNA reagent (plasmid) px458- Grin1-CRISPR Incontro et al., 2014 N/A Expression of Grin1 gRNA, Cas9 and GFP. Derived from px458 vector (Addgene #48138); RRID:Addgene_48138
Recombinant DNA reagent ssDNA encoding HA tag and stop codons flanked by 60 bp long homology arms for HDR This paper N/A Obtained from IDT. Injected in fertilized zigotes for HA-ΔCTD GluA1 KI mouse generation (see Materials and methods for sequence)
Other (Recombinant RNA reagent) Gria1 1 gRNA This paper N/A Obtained from IDT. Injected in fertilized zigotes for HA-ΔCTD GluA1 KI mouse generation (see Materials and methods for sequence)
Other (Recombinant RNA reagent) Gria1 2 gRNA This paper N/A Obtained from IDT. Injected in fertilized zigotes for HA-ΔCTD GluA1 KI mouse generation (see Materials and methods for sequence)
Antibody Rabbit polyclonal anti-GluA1 C-tail Synaptic Systems #182–003; RRID:AB_2113441 IF (1:500)
WB (1:1000)
Antibody Rabbit polyclonal anti-GluA2 C-tail Synaptic Systems #182–103; RRID:AB_2113732 WB (1:1000)
Antibody Mouse monoclonal anti-GluA1 ATD Millipore #MAB 2263; RRID:AB_11212678 WB (1:1000)
Antibody Mouse, monoclonal anti-NR1 Millipore #05–432; RRID:AB_390129 WB (1:1000)
Antibody Rabbit polyclonal anti-HA Thermo Fisher Scientific #71–5500; RRID:AB_2533988 WB (1:1000)
Antibody Rabbit polyclonal anti-alpha tubulin Cell Signaling #2144; RRID:AB_2210548 WB (1:1000)
Antibody HRP conjugated anti-mouse secondary antibody GE Healthcare #NA931; RRID:AB_772210 WB (1:5000)
Antibody HRP conjugated anti-rabbit secondary antibody GE Healthcare #NA934; RRID:AB_772206 WB (1:5000)
Antibody Alexa-488 conjugated anti-rabbit secondary antibody Thermo Fisher Scientific #A11034; RRID:AB_2576217 IF (1:500)
Chemical compound, drug D(-)−2-amino-5-phosphonovaleric acid (AP5) Hello Bio #HB0225 0.1 mM
Chemical compound, drug Picrotoxin TCI #C0375 0.1 mM
Chemical compound, drug Bicuculline Sigma-Aldrich #14340 0.02 mM
Chemical compound, drug 2-Chloroadenosine Sigma-Aldrich #C5134 2 mM
Commercial assay, kit Helios Gene Gun Kit Bio-Rad #1652411 Used for biolistic transfection of hioppocampal slice cultures
Commercial assay, kit In fusion HD cloning kit Takara Bio #639647 Used for clonning of GluA1/A2 CTD in pCAGGS vectors
Commercial assay, kit NheI New England Biolabs #R0131 Restriction enzyme. Used for clonning of GluA1/A2 CTD in pCAGGS vectors
Commercial assay, kit XhoI New England Biolabs #R0146 Restriction enzyme. Used for clonning of GluA1/A2 CTD in pCAGGS vectors
Commercial assay, kit BbsI New England Biolabs #R3539 Restriction enzyme. Used for clonning of gRNA in px458 vectors
Commercial assay, kit T4 DNA ligase New England Biolabs #M0202L Ligase. Used for clonning of gRNA in px458 vectors
Commercial assay, kit MycoAlert PLUS Mycoplasma Detection Kit Lonza #LT07-701 Mycoplasma contamination assay
Commercial assay, kit Lipofectamine 2000 Thermo Fisher Scientific #11668027 Transfection reagent for 293 T cells
Software, algorithm Prism Graph Pad https://www.graphpad.com/scientific-software/ prism/; RRID:SCR_002798
Software, algorithm Igor Pro Wavemetrics https://www.wavemetrics.com/products/igorpro; RRID:SCR_000325
Software, algorithm ImageJ NIH https://imagej.nih.gov/ij/; RRID:SCR_003070
Open in a new tab

Animals

All animal procedures were approved by the Institutional Animal Care and Use Committee at the University of California, San Francisco (protocol numbers AN170318 and AN183289) and Stanford (protocol number 10322). All animals were maintained in 12 hr light/dark schedule and with access to food and water, ad libitum.

Generation of HA-ΔCTD GluA1 mice

Super-ovulated female C57BL/6 mice (4 weeks old) were mated to C57BL/6 stud males. Fertilized zygotes were collected from oviducts and injected with Cas9 protein (30 ng/µl), crRNA (20 ng/µl) tracrRNA (20 ng/µl), and ssDNA (10 ng/µl) into the pronucleus of fertilized zygotes. Two different crRNA sequences were designed using the gRNA design tool and purchased from Integrated DNA Technologies Inc:

  1. CAUCCGCUUCGACUCGCUAC.

  2. UUUGUAGCAGAACUCGAUUA.

Half of the embryos were injected with each one of the gRNAs and both generated transgenic mice. Therefore, we selected as founder a mouse modified with CAUCCGCUUCGACUCGCUAC, which had slightly better selectivity rating in the IDT gRNA design tool.

A ssDNA encoding the influenza haemagglutinin (HA) tag sequence followed by four Stop codons flanked by 60 nt long 5’ and a 3’ homology arms was designed to provide a template for homology-directed repair (HDR) in CRISPR/Cas9-edited zygotes and purchased from Integrated DNA Technologies Inc with the following sequence: TACATCCTGATTGGAGGGCTGGGATTGGCCATGCTGGTTGCCTTAATCGAGTTCTGCTACTACCCATACGATGTTCCAGATTACGCTTAATAGTGATAAAAATCCCGTAGCGAGTCGAAGCGGATGAAGGTGGCATCGTCTTCCCGGATCTTTTCCCTA (HA sequence is bolded and stop codons are in italics).

Injected zygotes were implanted into oviducts of pseudopregnant CD1 female mice. Successful transgenesis was assessed in the F1 mice by sequencing and genotyping. Several heterozygous F1 mice were identified where insertion of the HA-Stop sequence had happened in the appropriate site. One was chosen as the founder of the colony and backcrossed at least three generations before used for experiments. Genotyping was performed by TransnetYX INC. USA, after assessing that their assay provided results 100% identical to sequencing. For electrophysiology experiments, male and female mice 17–25 days of age (Nicoll lab) and 30–45 days of age (Malenka lab) were used. For behavior experiments, 3–4 months of age male littermates and cage mates generated by heterozygous breedings and homozygous WT and HA-ΔCTD GluA1 KI breedings, respectively, were used. For western blot and immunofluorescence, 90 day-old males and females were used.

Gria1-3 f/f mice used in AMPAR replacement experiments were generated and genotyped as described previously (Lu et al., 2009).

Rosa26-Cas9 KI mice used in GluA1 replacement experiments were purchased from The Jackson Laboratory and maintained as previously described (Platt et al., 2014).

P6-8 rat pups were employed to generate the organotypic hippocampal slice cultures employed in GluA1/A2CTD overexpression experiments as described previously (Stoppini et al., 1991).

Cells

293 T cells were purchased from ATCC and maintained in DMEM (Gibco) with 10% FBS (GenClone). Cells were passaged a maximum of four times after thawing the original vial from ATCC. Mycoplasma infection was assessed with MycoAlert PLUS Mycoplasma Detection Kit (Lonza).

Constructs

The gRNA for acute deletion of Gria1 was designed as previously described (Incontro et al., 2014), using the MIT online design tool CRISPR/Cas9 (http://crispr.mit.edu) and subcloned into the human codon-optimized Cas9 and chimeric gRNA expression plasmid px458 (Addgene, Ran et al., 2013) using T4 DNA ligase. The gRNA sequence selected (forward, 5’ to 3’: GACCATAACCTTGGTCCGGG; reverse, 5’ to 3’: CCCGGACCAAGGTTATGGTC) is specific for Gria1 and shared by rat and mouse. px458 Grin1 gRNA (Incontro et al., 2014) was used as a control.

GluA1/A2CTD was subcloned into a pCAGGS-IRES-GFP and pCAGGS-IRES-mCherry vectors from a pFUGW used in previous work (Ancona Esselmann et al., 2017) using the In-Fusion HD Cloning System (Takara Bio, USA, Inc). CRISPR-resistant pCAGGS-GluA1/A2CTD*-IRES-mCherry was generated by replacing by PCR the rat/mouse Gria1 gRNA targeting sequence ACCATAACCTTGGTCCGG with the ACAATTACAATAGTGCGC sequence, which translates to the same amino acid sequence, expresses at similar levels and is not recognized by the Gria1 gRNA (Figure 1—figure supplement 3A).

Neuronal transfection

Biolistic transfection of organotypic slice cultures was performed as previously described (Schnell et al., 2002). In brief, 1-μm-diameter gold particles (Bio-Rad) were coated with 50 μg of pCAGGS-GluA1/A2CTD-IRES-GFP for overexpression experiments or px458 Gria1 together with pCAGGS-IRES-mCherry to facilitate identification of transfected cells (GFP signal from the px458 construct is dim in our hands) for GluA1 knock-down experiments in 0.5 mM spermidine. DNA was then precipitated with 0.1 mM CaCl2, and then gold particles washed three times in 100% ethanol. The gold particles were loaded onto PVC tubing (BioRad) and dried using ultra-pure N2 gas. DNA-coated gold particles were shot with a Helios GeneGun (Bio-Rad). Expression of recombinant GluA1/A2CTD was confirmed by GFP fluorescence.

In utero electroporation and in vivo AMPAR replacement. In utero electroporation was performed as previously described (Díaz-Alonso et al., 2017; Navarro-Quiroga et al., 2007). Briefly, E15.5 pregnant Gria1-3 f/f or Cas9 KI female mice were anesthetized with 2% isoflurane in 02. Buprenorphine (Reckitt Benckiser Healthcare) and meloxicam (Boehringer Ingelheim) were administered subcutaneously. 1.5 µl of plasmid DNA with Fast Green (Sigma Aldrich) were injected into the lateral ventricles. In AMPAR replacement experiments, pFUGW-Cre:GFP was diluted to approximately 0.5 µg/µl and mixed with 2 µg/µl of the replacement pCAGGS-GluA1/A2CTD-IRES-GFP and pCAGGS-GluA2(R)-IRES-GFP plasmids. In GluA1 knock-down experiments, px458 Gria1 gRNA was diluted to approximately 0.5 µg/µl and mixed with 2 µg/µl pCAGGS-IRES-mCherry (pCAGGS-GluA1/A2CTD*-IRES-mCherry in replacement experiments). Then, 5 × 40 V pulses of 50 ms. were delivered at 1 Hz, using platinum tweezertrodes in a square-wave pulse generator (BTX Harvard Apparatus). The positive electrode was placed in the lower right hemisphere and the negative electrode placed in the upper left hemisphere to direct transfection preferentially to the CA1 region of the hippocampus (Navarro-Quiroga et al., 2007). Following electroporation, embryos were returned to the abdominal cavity and abdominal muscle and skin were sutured. Complete recovery was ensured before returning females to their cage.

Electrophysiology

Voltage-clamp recordings from CA1 pyramidal neurons were obtained using mouse acute hippocampal slices or rat organotypic slice cultures. 300 μm transverse acute slices were prepared with a Microslicer DTK-Zero1 (Ted Pella) in ice-cold high sucrose cutting solution containing (in mM): 2.5 KCl, 7 MgSO4, 1.25 NaH2PO4, 25 NaHCO3, 7 glucose, 210 sucrose, 1.3 ascorbic acid. Slices were then incubated during 30 min at 34°C in artificial cerebrospinal fluid (aCSF) containing (in mM): 119 NaCl, 2.5 KCl, 1 NaH2PO4, 26.2 NaHCO3 and 11 glucose and allowed to recover at room temperature for 45 min. The aCSF was bubbled with carbogen (95% O2/5% CO2). For acute slices, 2.5 mM CaCl2 and 1.3 mM MgSO4 were added to the aCSF, and for organotypic slice cultures 4 mM CaCl2 and 4 mM MgSO4. During recording, slices were transferred to a perfusion stage on an Olympus BX51WI upright microscope and perfused at approx. 2.5 ml / min with aCSF containing 0.1 mM picrotoxin and 0.02 mM bicuculline to block GABAA transmission. 2 mM 2-Chloroadenosine was added to aCSF in experiments with slice cultures to manage epileptiform activity. The internal whole-cell recording solution contained (in mM) 135 CsMeSO4, 8 NaCl, 10 Hepes, 0.3 EGTA, 5 QX-314, 4 Mg-ATP, and 0.3 Na-GTP and 0.1 spermine. Osmolarity was adjusted to 292 mOsm, and pH at 7.4. Synaptic responses were evoked with a bipolar tungsten stimulation electrode (Microprobes) placed in the striatum radiatum, at 0.2 Hz (basal transmission) or 0.1 Hz (LTP experiments). For the Stanford group, acute slice preparation and maintenance were similar with minor differences to the following. Transverse hippocampal slices (225 μm thick) were prepared with a vibratome (Leica VT1000s) in high sucrose cutting solution, which comprised (in mM): 2.5 KCl, 8 MgSO4, 1.25 NaH2PO4, 26.2 NaHCO3, 20 glucose, 225 sucrose, 0.5 CaCl2. Whole-cell recordings were performed in a perfusion chamber mounted on a fixed stage of an Olympus BX 50 WI microscope. Slices were perfused at approx. 1 ml/min with warm (30°C) oxygenated (95% O2/5% CO2) aCSF containing 50 μM picrotoxin. The internal whole-cell recording solution contained (in mM) 135 CsMeSO4, 8 NaCl, 10 HEPES, 0.25 EGTA, 2 MgCl2, 5 phosphocreatine, 4 Mg-ATP and 0.3 Na-GTP (298–301 mOsM, pH 7.4). Membrane holding current, input resistance, and pipette series resistance were monitored throughout recordings. Data were gathered through a MultiClamp 700B amplifier (Axon Instruments), filtered at 2 kHz, and digitized at 10 kHz.

Whole-cell synaptic recordings and LTP

AMPAR-mediated responses were isolated by voltage-clamping the cell at −70 mV, whereas NMDAR-mediated responses were recorded at +40 mV and measured at 150 ms after stimulation to avoid contribution of AMPAR. To calculate synaptic AMPAR rectification, 0.1 mM D(-)−2-amino-5-phosphonovaleric acid (AP5) was washed-in to block NMDARs. Rectification of synaptic responses was calculated as follows: RI = 7(I40 – I0)/4(I0 – I-70) where Ix represent EPSC amplitude at x mV.

Transfected cells were identified by their GFP or mCherry fluorescence. In simultaneous whole cell experiments, control, untransfected cells adjacent to the transfected cells were patched and recorded simultaneously.

LTP was induced, after recording a stable 3–5 min baseline, but not more than 6 min after breaking into the cell, by stimulating Schaffer collateral axons using two alternative protocols. In the Nicoll lab stimulation is at 2 Hz for 90 s, while in the Malenka lab it is 2 × 1 s at 100 Hz, while clamping the cell at 0 mV in both cases.

Behavior

The Morris water maze test was performed as described in Orr et al., 2018. The water maze consisted of a 122 cm-diameter pool filled with water (21 ± 1°C) made opaque with nontoxic white tempera paint. Distinct extra-maze cues surrounded the pool. Before hidden platform training, mice underwent one session of four pre-training trials in which they swam in a rectangular channel (15 cm ×122 cm) and mounted a square platform (14 × 14 cm) hidden 1.5 cm below the water surface in the middle of the channel. Mice that did not mount the platform were guided gently to it by the experimenter and were allowed to sit on it for 10 s before being removed by the experimenter.

Three days after pre-training, mice were trained in the circular water maze. For hidden platform training, the platform was submerged 1.5 cm below the surface. The platform location remained the same throughout training, but the drop location varied randomly among the four daily trials. Mice received two sessions per day (3 hr intersession interval between sessions) for 8 consecutive days. Each session consisted of two trials with a 15-min intertrial interval. The maximum time allowed per trial was 60 s. If a mouse did not find or mount the platform, it was guided to the platform by the experimenter. All mice were allowed to sit on the platform for 10 s after each training trial.

For the probe trial, the platform was removed and each mouse was allowed to swim for 60 s. The drop location for the probe trial was 180° from the platform location used during hidden platform training. After 60 s, mice were guided to the where the platform had been located during hidden training before removal from the pool. Mice were probed 1 day after the completion of hidden platform training.

After probe testing, cued (visible) platform training was performed using new platform locations and a clearly visible cue (a 15 cm striped pole on top of the platform). Mice received three sessions of two cued trials per session across two days (15-min interval between trials and 3-hr interval between sessions). Each cued platform session was to a different location in the pool. All behaviors wer recorded and analyzed with an Ethovision XT video tracking system (Noldus). Escape latencies, distance traveled, swim speeds, platform crossings and proximity to the platform were recorded automatically for subsequent analysis. One mouse was excluded from the probe trial due to extreme floating behavior and two mice were excluded from both training and the probe trial due to procedural learning deficits. Exclusions were done blind to the genotype.

Immunoblotting

48 hr post-transfection with Lipofectamine 2000 (Invitrogen), 293 T cells were washed in PBS, pelleted and re-suspended directly in SDS-containing sample buffer. WT and HA-and GluA1 mice forebrain tissue was processed as previously described (Bemben et al., 2014). Tissue was collected in ice-cold PBS and homogenized in TEVP buffer containing 20 mM Tris-HCl (pH 7.5), 0.3 M sucrose, 5 mM EDTA and protease and phosphatase inhibitors (Roche). After centrifugation at 1000 g for 10 min, the supernatant was centrifuged at 10,000 g for 20 min to obtain the P2 fraction. The P2 fraction was then re-suspended in SDS-containing sample buffer. All samples were run in a PAGE-SDS electrophoresis. PVDF membranes were blocked with 5% blotting grade nonfat milk (Bio-Rad) in tris buffered saline buffer with 0.1% tween 20 (Acros). The following primary antibodies were used (1/1000) in western blot experiments: GluA1 CTD (rabbit Synaptic Systems, #182–003), GluA1 ATD (mouse, Millipore, #MAB 2263), HA (rabbit, Invitrogen, #71–5500), NR1 (mouse, Millipore, #05–432), GluA2 CTD (rabbit, Synaptic Systems; #182–103), α-Tubulin (rabbit, Cell Signaling; #2144). HRP-conjugated secondary antibodies raised against the appropriate species were used. Images were processed using ImageJ.

Immunofluorescence

PFA fixed, 30-μm-thick coronal brain slices were obtained and processed for immunofluorescence analysis. Immunofluorescence was performed, after blockade with 5% goat serum, by overnight incubation at 4°C with a GluA1 CTD primary antibody (rabbit, Synaptic Systems, #182–003) followed by incubation with an Alexa 488 anti-rabbit secondary antibody (Invitrogen). Images were obtained using a Leica DMRB fluorescence microscope and processed with ImageJ.

Sampling and statistics

Summarized data were presented in figures as mean ± SEM with n values representing, in all cases, the number of biological replicates (number of cells, pairs or mice in each data set, as indicated in figure legends). Sample size for all experiments was estimated according to the standards in the field (Díaz-Alonso et al., 2017; Granger et al., 2013; Incontro et al., 2014; Orr et al., 2018). Genotype blinding (masking) was used for behavior experiments. Electrophysiology experiments were performed without masking.

Data analysis was carried out in Igor Pro (Wavemetrics) Excel (Microsoft), and GraphPad Prism (GraphPad Software). Unpaired t-test or Mann-Whitney U test were used to assess statistical significance in experiments involving unpaired data. Two-tailed Wilcoxon signed-rank test for experiments using paired data. For Morris water maze experiments, mixed effects analyses were employed to assess the effect of genotype and training in hidden platform and cued platform location performance and swim speed, while number of platform crossings and % time in quadrant in the 24 hr probe were analyzed using paired t-test and Wilcoxon signed-rank test. For measures directly comparing probe performance between genotypes (latency to first platform crossing and swim speed), Welch’s t-test and Mann-Whitney U test were used. LTP data in molecular replacement experiments was obtained from pairs of control and experimental neurons; however, some cells were lost during the experiment, as indicated in the LTP plot legends and figure legends. Consequently, the resulting datasets are a mix of interleaved and paired data, thus, comparisons were made using unpaired statistics. Statistical significance of LTP in HA-ΔCTD GluA1 vs WT mice experiments was also analyzed with unpaired statistics. All statistical significances were set as *p<0.05, **p<0.01, and ***p<0.001.

Acknowledgements

Samantha Ancona-Esselman (Nicoll lab) for the pFUGW-GluA1/A2CTD construct. Junli Zhang (Gladstone institutes) for technical assistance in the generation of the HA-ΔCTD GluA1 KI mouse line. Eric Dang (Nicoll lab) for technical assistance. The Gladstone Institutes Behavioral Core for behavioral testing of mice. Dr. Argentina Lario-Lago and members of the Nicoll lab for valuable discussion. P Seeburg and R Sprengel for the individual Gria1–3fl/fl mice. David Julius (UCSF) for access to the cryostat and fluorescence microscope. Research was supported by R01MH070957 and R01MH117139 (to RAN), P50MH086403 (to RCM) and K99MH118425 (to JD-A).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Javier Díaz-Alonso, Email: jdiazalo@uci.edu.

Roger A Nicoll, Email: roger.nicoll@ucsf.edu.

Linda Overstreet-Wadiche, University of Alabama at Birmingham, United States.

Richard W Aldrich, The University of Texas at Austin, United States.

Funding Information

This paper was supported by the following grants:

  • National Institute of Mental Health K99MH118425 to Javier Díaz-Alonso.

  • National Institute of Mental Health R01MH070957 to Roger A Nicoll.

  • National Institute of Mental Health R01MH117139 to Roger A Nicoll.

  • National Institute of Mental Health P50MH086403 to Robert C Malenka.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Resources, Data curation, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Writing - original draft, Project administration.

Data curation, Formal analysis, Validation, Investigation, Writing - review and editing.

Validation, Investigation.

Data curation, Formal analysis, Investigation, Writing - review and editing.

Formal analysis, Investigation.

Data curation, Formal analysis.

Data curation, Formal analysis, Supervision, Writing - review and editing.

Funding acquisition, Project administration, Writing - review and editing.

Conceptualization, Formal analysis, Supervision, Funding acquisition, Writing - original draft, Project administration.

Ethics

Animal experimentation: The authors declare that this study has been performed strictly following all relevant laboratory animal use regulations according to approved institutional animal care and use committee (IACUC) protocols of the University of California, San Francisco (AN170318 and AN183289), and Stanford University (10322).

Additional files

Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

  1. Ancona Esselmann SG, Díaz-Alonso J, Levy JM, Bemben MA, Nicoll RA. Synaptic homeostasis requires the membrane-proximal carboxy tail of GluA2. PNAS. 2017;114:13266–13271. doi: 10.1073/pnas.1716022114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Barria A, Muller D, Derkach V, Griffith LC, Soderling TR. Regulatory phosphorylation of AMPA-type glutamate receptors by CaM-KII during long-term potentiation. Science. 1997;276:2042–2045. doi: 10.1126/science.276.5321.2042. [DOI] [PubMed] [Google Scholar]
  3. Bemben MA, Shipman SL, Hirai T, Herring BE, Li Y, Badger JD, Nicoll RA, Diamond JS, Roche KW. CaMKII phosphorylation of neuroligin-1 regulates excitatory synapses. Nature Neuroscience. 2014;17:56–64. doi: 10.1038/nn.3601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Collingridge GL, Isaac JT, Wang YT. Receptor trafficking and synaptic plasticity. Nature Reviews Neuroscience. 2004;5:952–962. doi: 10.1038/nrn1556. [DOI] [PubMed] [Google Scholar]
  5. Díaz-Alonso J, Sun YJ, Granger AJ, Levy JM, Blankenship SM, Nicoll RA. Subunit-specific role for the amino-terminal domain of AMPA receptors in synaptic targeting. PNAS. 2017;114:7136–7141. doi: 10.1073/pnas.1707472114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Diering GH, Heo S, Hussain NK, Liu B, Huganir RL. Extensive phosphorylation of AMPA receptors in neurons. PNAS. 2016;113:E4920–E4927. doi: 10.1073/pnas.1610631113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Esteban JA, Shi SH, Wilson C, Nuriya M, Huganir RL, Malinow R. PKA phosphorylation of AMPA receptor subunits controls synaptic trafficking underlying plasticity. Nature Neuroscience. 2003;6:136–143. doi: 10.1038/nn997. [DOI] [PubMed] [Google Scholar]
  8. Granger AJ, Shi Y, Lu W, Cerpas M, Nicoll RA. LTP requires a reserve pool of glutamate receptors independent of subunit type. Nature. 2013;493:495–500. doi: 10.1038/nature11775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hayashi Y, Shi SH, Esteban JA, Piccini A, Poncer JC, Malinow R. Driving AMPA receptors into synapses by LTP and CaMKII: requirement for GluR1 and PDZ domain interaction. Science. 2000;287:2262–2267. doi: 10.1126/science.287.5461.2262. [DOI] [PubMed] [Google Scholar]
  10. Hosokawa T, Mitsushima D, Kaneko R, Hayashi Y. Stoichiometry and phosphoisotypes of hippocampal AMPA-type glutamate receptor phosphorylation. Neuron. 2015;85:60–67. doi: 10.1016/j.neuron.2014.11.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Huganir RL, Nicoll RA. AMPARs and synaptic plasticity: the last 25 years. Neuron. 2013;80:704–717. doi: 10.1016/j.neuron.2013.10.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Incontro S, Asensio CS, Edwards RH, Nicoll RA. Efficient, complete deletion of synaptic proteins using CRISPR. Neuron. 2014;83:1051–1057. doi: 10.1016/j.neuron.2014.07.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lee HK, Takamiya K, Han JS, Man H, Kim CH, Rumbaugh G, Yu S, Ding L, He C, Petralia RS, Wenthold RJ, Gallagher M, Huganir RL. Phosphorylation of the AMPA receptor GluR1 subunit is required for synaptic plasticity and retention of spatial memory. Cell. 2003;112:631–643. doi: 10.1016/S0092-8674(03)00122-3. [DOI] [PubMed] [Google Scholar]
  14. Lee HK, Takamiya K, He K, Song L, Huganir RL. Specific roles of AMPA receptor subunit GluR1 (GluA1) phosphorylation sites in regulating synaptic plasticity in the CA1 region of Hippocampus. Journal of Neurophysiology. 2010;103:479–489. doi: 10.1152/jn.00835.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lu W, Shi Y, Jackson AC, Bjorgan K, During MJ, Sprengel R, Seeburg PH, Nicoll RA. Subunit composition of synaptic AMPA receptors revealed by a single-cell genetic approach. Neuron. 2009;62:254–268. doi: 10.1016/j.neuron.2009.02.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Malinow R, Malenka RC. AMPA receptor trafficking and synaptic plasticity. Annual Review of Neuroscience. 2002;25:103–126. doi: 10.1146/annurev.neuro.25.112701.142758. [DOI] [PubMed] [Google Scholar]
  17. Mammen AL, Kameyama K, Roche KW, Huganir RL. Phosphorylation of the alpha-amino-3-hydroxy-5-methylisoxazole4-propionic acid receptor GluR1 subunit by calcium/calmodulin-dependent kinase II. Journal of Biological Chemistry. 1997;272:32528–32533. doi: 10.1074/jbc.272.51.32528. [DOI] [PubMed] [Google Scholar]
  18. Navarro-Quiroga I, Chittajallu R, Gallo V, Haydar TF. Long-term, selective gene expression in developing and adult hippocampal pyramidal neurons using focal in utero electroporation. Journal of Neuroscience. 2007;27:5007–5011. doi: 10.1523/JNEUROSCI.0867-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Nicoll RA. A brief history of Long-Term potentiation. Neuron. 2017;93:281–290. doi: 10.1016/j.neuron.2016.12.015. [DOI] [PubMed] [Google Scholar]
  20. Orr AG, Lo I, Schumacher H, Ho K, Gill M, Guo W, Kim DH, Knox A, Saito T, Saido TC, Simms J, Toddes C, Wang X, Yu GQ, Mucke L. Istradefylline reduces memory deficits in aging mice with amyloid pathology. Neurobiology of Disease. 2018;110:29–36. doi: 10.1016/j.nbd.2017.10.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. CRISPR-Cas9 knockin mice for genome editing and Cancer modeling. Cell. 2014;159:440–455. doi: 10.1016/j.cell.2014.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nature Protocols. 2013;8:2281–2308. doi: 10.1038/nprot.2013.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Roche KW, O'Brien RJ, Mammen AL, Bernhardt J, Huganir RL. Characterization of multiple phosphorylation sites on the AMPA receptor GluR1 subunit. Neuron. 1996;16:1179–1188. doi: 10.1016/S0896-6273(00)80144-0. [DOI] [PubMed] [Google Scholar]
  24. Schnell E, Sizemore M, Karimzadegan S, Chen L, Bredt DS, Nicoll RA. Direct interactions between PSD-95 and stargazin control synaptic AMPA receptor number. PNAS. 2002;99:13902–13907. doi: 10.1073/pnas.172511199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Sheng N, Bemben MA, Díaz-Alonso J, Tao W, Shi YS, Nicoll RA. LTP requires postsynaptic PDZ-domain interactions with glutamate receptor/auxiliary protein complexes. PNAS. 2018;115:3948–3953. doi: 10.1073/pnas.1800719115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Shi S, Hayashi Y, Esteban JA, Malinow R. Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons. Cell. 2001;105:331–343. doi: 10.1016/S0092-8674(01)00321-X. [DOI] [PubMed] [Google Scholar]
  27. Stoppini L, Buchs PA, Muller D. A simple method for organotypic cultures of nervous tissue. Journal of Neuroscience Methods. 1991;37:173–182. doi: 10.1016/0165-0270(91)90128-M. [DOI] [PubMed] [Google Scholar]
  28. Watson JF, Ho H, Greger IH. Synaptic transmission and plasticity require AMPA receptor anchoring via its N-terminal domain. eLife. 2017;6:e23024. doi: 10.7554/eLife.23024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Watson JF, Pinggera A, Ho H. AMPA receptor anchoring at CA1 synapses is determined by an interplay of N- terminal domain and TARP γ8 interactions. bioRxiv. 2020 doi: 10.1101/2020.07.09.196154. [DOI] [PMC free article] [PubMed]
  30. Zamanillo D, Sprengel R, Hvalby O, Jensen V, Burnashev N, Rozov A, Kaiser KM, Köster HJ, Borchardt T, Worley P, Lübke J, Frotscher M, Kelly PH, Sommer B, Andersen P, Seeburg PH, Sakmann B. Importance of AMPA receptors for hippocampal synaptic plasticity but not for spatial learning. Science. 1999;284:1805–1811. doi: 10.1126/science.284.5421.1805. [DOI] [PubMed] [Google Scholar]
  31. Zeng M, Díaz-Alonso J, Ye F, Chen X, Xu J, Ji Z, Nicoll RA, Zhang M. Phase Separation-Mediated TARP/MAGUK complex condensation and AMPA receptor synaptic transmission. Neuron. 2019;104:529–543. doi: 10.1016/j.neuron.2019.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhao Y, Chen S, Swensen AC, Qian WJ, Gouaux E. Architecture and subunit arrangement of native AMPA receptors elucidated by cryo-EM. Science. 2019;364:355–362. doi: 10.1126/science.aaw8250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Zhou Z, Liu A, Xia S, Leung C, Qi J, Meng Y, Xie W, Park P, Collingridge GL, Jia Z. The C-terminal tails of endogenous GluA1 and GluA2 differentially contribute to hippocampal synaptic plasticity and learning. Nature Neuroscience. 2018;21:50–62. doi: 10.1038/s41593-017-0030-z. [DOI] [PubMed] [Google Scholar]

Decision letter

Editor: Linda Overstreet-Wadiche1
Reviewed by: Linda Overstreet-Wadiche2

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

Long-term potentiation (LTP) is the strengthening of synapses between neurons that is a cellular mechanism of memory formation. Classical LTP is mediated by trafficking of glutamate receptors into the synapse, but there has been debate about how this occurs. The authors use multiple genetic approaches to show that the cytoplasmic tail of a glutamate receptor subunit, the GluA1 AMPAR subunit, which has been implicated in the past, is not essential for LTP. These results provide insight into the fundamental requirements for LTP and helps differentiate between models of receptor trafficking.

Decision letter after peer review:

Thank you for submitting your article "Long-term potentiation and spatial memory are independent of the C-tail of the GluA1 AMPA receptor subunit" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Linda Overstreet-Wadiche as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Richard Aldrich as the Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As the editors have judged that your manuscript is of interest, but as described below that additional experiments or major revisions are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)

Summary:

This is an important study investigating a central question in synaptic neuroscience about mechanisms of AMPAR trafficking in LTP. Using three genetic approaches the authors convincingly show that the cytoplasmic tail of the GluA1 AMPAR subunit, which has been implicated in the past, is not essential. The reviewers agreed that the electrophysiological experiments are sophisticated, carefully executed, and informative. However, the behavioral tests are not as thorough as needed to support the claim that spatial memory is independent of the C-terminal domain. The authors should remove these data and claims, or provide additional experiments to make them more convincing.

Essential revisions:

1) Although the manuscript is clearly written, the authors need to provide more background to make this work accessible to a wider audience. In its current format one needs to be well-versed in the field and familiar with the Zhou et al. study to appreciate the new data. Please add explanation of “receptor slots”, more background on receptor-centric vs PSD-centric model (perhaps cite their recent review), the Malinow model, the role of receptor availability and the passive role for AMPARs in synaptic plasticity.

2) While the authors state that a widely held viewpoint is that covalent modifications of the GluA1 C-terminus results in GluA1 capture and anchoring at the postsynaptic site, this isn't necessarily the most prevalent model. Another view (not contradictory to the authors viewpoint that AMPARs in a reserve pool is critical for LTP) is that C-terminal modifications augment trafficking of GluA1-containing AMPAR to the postsynaptic site where via other mechanisms AMPAR become trapped to augment their postsynaptic functional availability. Framing the debate strictly in terms of receptor versus PSD centric models doesn't account for all views.

3) The text should be modified to clarify that the authors have not actually replicated the key experiments of Zhou et al., since they did not analyze the same mutations (replacing the GluA1 C-term with that of GLuA2 versus truncation) nor most of the same protocols (LTP of fEPSPs with inhibition intact, AMPAR conductance). Framing the current work primarily as addressing discrepancies with prior studies is not really satisfying when the discrepancies have not been explained.

4) There is no question that simultaneously mutating S831 plus S845 to alanine residues in the C-terminus of GluA1 in KI mice affects LTP induced by a so-called theta burst protocol as well as a pairing protocol, the latter similar to the protocols used in the current work (Lee et al., 2003, as cited). Apparently, when the GluA1 C-terminus is largely intact except for these two phosphorylation sites, then phosphorylation of one of the two sites is important for LTP (and learning as also tested in Lee et al., 2003). A possible explanation is that truncating the GluA1 C-terminus creates a situation in which such phosphorylation might be less important. For instance, perhaps non-phosphorylated GluA1 is held back from surface insertion or lateral diffusion to the postsynaptic site and phosphorylation of either S831 or S845 releases GluA1 to traffic to the postsynaptic site for anchoring there by means independent of S831 or S845 phosphorylation. When the C-terminus is removed as in the current manuscript than this inhibition is also removed. In order to put their results in context of prior work, the authors should discuss these possibilities and that the results depend on the exact mutations that are analyzed, and further the A2C-tail could also be an important factor.

5) There are several issues with the behavior data that raise concerns with the strong conclusion about spatial memory. The authors should remove these data and claims, or provide additional experiments to make them more convincing.

First, it would be more convincing to assess additional tests of spatial memory beyond MWM (such as novel object location and Y maze novel arm entry), especially in light of the swim speed confound.

Second, there are clear differences in performance during the training sessions in the MWM that warrant careful consideration. While the KI mice demonstrate gross learning day-over-day (Figure 3A), the WT mice clearly outperform the KI mice in days 2-7 and then WTs appear to rebound from their previous best performance on day 8. Eight training days is longer than the usual 6 days, and with the addition the four pre-trials with guidance to the platform by a rectangular channel, one could argue that this training schedule results in overtraining. Because WT outperform the KI mice on days 2-7 during training trials, additional experiments will be required to test performance in test trials on days 3 or 4 and day 6. Although decreased swim speed could in part explain the longer latencies for KI mice to reach platform, on day 8 it seems they had caught up arguing somewhat against the notion that the decrease in swim speed would fully explain the difference in training performance. It seems to me that the differences in latencies in Figure 3—figure supplement 1 actually are substantially larger than would be expected from the more modest reduction in swim speed shown in Figure 5A.

Third, that WT mice perform worse than the KI mice on day 1 is surprising. It would be important to analyze he trial-by-trial breakdown of this day, especially between trials 1/2 and 3/4, since 1/2 they were run several hours apart from 3/4, during which time memory could already begin to affect performance on subsequent trials.

Fourth, the quantification of discrimination of target vs. other quadrants in Figure 5C is unusual (one-way t-test against 25% chance line). A better depiction would be the usual analysis which shows time spent in each quadrant (not lumping all three non-target quadrants together) and perhaps also the distance accumulated in each quadrant due to the obvious difference in swim speed which will have consequences for dwell time in any region of the pool.

Finally, please clarify that heterozygous breeders were used to obtain litter matched WT and KI mice because even minor differences in the genetic background could affect performance. Also clarification is needed about the mice excluded for "procedural learning deficits" after they were run through training and the probe.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for resubmitting your article "Long-term potentiation and spatial memory are independent of the C-tail of the GluA1 AMPA receptor subunit" for consideration by eLife. Your revised article has been considered by Linda Overstreet-Wadiche (Reviewing Editor) and Richard Aldrich as the Senior Editor.

The Reviewing Editor has drafted this decision to help you prepare a revised submission.

We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data.

Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in eLife, either of which would be linked to the original paper.

Summary:

This is an important study investigating a central question in synaptic neuroscience about mechanisms of AMPAR trafficking in LTP. Using three genetic approaches the authors convincingly show that the cytoplasmic tail of the GluA1 AMPAR subunit, which has been implicated in the past, is not essential for LTP. The reviewers agreed that the electrophysiological experiments are sophisticated, carefully executed, and convincing. However, the behavioral tests are not as thorough and extensive as needed to support the claim that spatial memory is independent of the C-terminal domain.

Revisions for this paper:

1) Essential Revisions Point 4. Please more specifically address this concern within the manuscript, since the topic of a modulatory role of GluA1 CTD on synaptic plasticity does not seem beyond the scope of the work. This could involve a more explicit explanation of possible scenarios that the authors consider to fall under the "receptor centric" model (as also mentioned in Pt 2) that might be helpful in differentiating the contrasting models for a general audience.

2) Essential Revisions Point 5. The authors have clarified a number of concerns related to MWM data, but there remains a confound related to swim speed. Due to Covid-19 issues the authors are unable to perform additional experiments to strengthen the overall conclusion about spatial memory. To better reflect the relative strength of the conclusions, agreed upon by all reviewers, the authors should remove reference to spatial memory (and MWM) in the Title and Impact Statement, and qualify "spatial memory assayed by the Morris Water Maze" (or similar) in the Abstract. As stated above, we are asking that the manuscript be revised to limit claims to those supported by data in hand, noting that potential confound to the current behavioral analysis requires additional supporting data from other behavioral tests that might be obtained in the future.

Title:

Please remove reference to spatial memory (and MWM) in the Title and Impact Statement

eLife. 2020 Aug 24;9:e58042. doi: 10.7554/eLife.58042.sa2

Author response

Essential revisions:

1) Although the manuscript is clearly written, the authors need to provide more background to make this work accessible to a wider audience. In its current format one needs to be well-versed in the field and familiar with the Zhou et al. study to appreciate the new data. Please add explanation of “receptor slots”, more background on receptor-centric vs PSD-centric model (perhaps cite their recent review), the Malinow model, the role of receptor availability and the passive role for AMPARs in synaptic plasticity.

We appreciate the reviewer’s suggestion and have expanded the Introduction to frame our study in a broader perspective. This includes providing more detail on the previous studies that form the basis for the current study.

2) While the authors state that a widely held viewpoint is that covalent modifications of the GluA1 C-terminus results in GluA1 capture and anchoring at the postsynaptic site, this isn't necessarily the most prevalent model. Another view (not contradictory to the authors viewpoint that AMPARs in a reserve pool is critical for LTP) is that C-terminal modifications augment trafficking of GluA1-containing AMPAR to the postsynaptic site where via other mechanisms AMPAR become trapped to augment their postsynaptic functional availability. Framing the debate strictly in terms of receptor versus PSD centric models doesn't account for all views.

We appreciate the insightful comment from the reviewer. It is suggested that our framing of the debate is too simplistic and that, following the modification of GluA1, additional steps may be involved in trapping the receptors in the PSD. We would argue that the proposed scenario falls into the receptor centric model, since it is the modification of the receptor that triggers the trafficking to the PSD. Nevertheless, we agree with the reviewer in that several steps may be involved in trapping the receptors in the PSD. We have introduced a new paragraph in the Discussion where we explain our proposed model, based on recent findings, which establishes two essential requirements for AMPAR synaptic trafficking. First, the interactions between TARPs and PSD scaffolding proteins. Second, the presence of the extracellular AMPAR amino-terminal domain.

3) The text should be modified to clarify that the authors have not actually replicated the key experiments of Zhou et al., since they did not analyze the same mutations (replacing the GluA1 C-term with that of GLuA2 versus truncation) nor most of the same protocols (LTP of fEPSPs with inhibition intact, AMPAR conductance). Framing the current work primarily as addressing discrepancies with prior studies is not really satisfying when the discrepancies have not been explained.

We agree with the reviewer that, in order to satisfyingly address the discrepancies between our previous studies and the results reported by Zhou et al., we would ideally have had the chance to examine their KI mice, in which the CTD of GluA1 and GluA2 are swapped. We have repeatedly requested these mice to the corresponding authors of the Zhou et al. study beginning in December 2017. Our request has not been honored to date. Therefore, in our initial attempt to replicate the findings in Zhou et al., we used what we considered to be the closest alternative to the ideal tool (their mice). Identically to their manipulation, we replaced the CTD of GluA1 with that of GluA2 (Figure 1) using two different molecular replacement strategies in hippocampal CA1 pyramidal neurons through in utero electroporation of i) Cre recombinase together with GluA1/A2CTD and edited GluA2 (R) in Gria1-3f/f mice and ii) Gria1 gRNA together with GluA1/A2CTD in Cas9 KI mice.

However, acknowledging the superiority of the KI approach, where the expression of chimeric or truncated AMPAR subunits is under the control of the endogenous promoter and gene expression regulators, we decided to turn to the KI approach. We determined that deleting the CTD of GluA1 was a better tool to address the role of that domain, since this approach prevents possible artifactual gain of function of the swapped CTD. Finally, we address the induction protocols used in the two studies and argue that our protocol closely mimics one of theirs.

4) There is no question that simultaneously mutating S831 plus S845 to alanine residues in the C-terminus of GluA1 in KI mice affects LTP induced by a so-called theta burst protocol as well as a pairing protocol, the latter similar to the protocols used in the current work (Lee et al., 2003, as cited). Apparently, when the GluA1 C-terminus is largely intact except for these two phosphorylation sites, then phosphorylation of one of the two sites is important for LTP (and learning as also tested in Lee et al., 2003). A possible explanation is that truncating the GluA1 C-terminus creates a situation in which such phosphorylation might be less important. For instance, perhaps non-phosphorylated GluA1 is held back from surface insertion or lateral diffusion to the postsynaptic site and phosphorylation of either S831 or S845 releases GluA1 to traffic to the postsynaptic site for anchoring there by means independent of S831 or S845 phosphorylation. When the C-terminus is removed as in the current manuscript than this inhibition is also removed. In order to put their results in context of prior work, the authors should discuss these possibilities and that the results depend on the exact mutations that are analyzed, and further the A2C-tail could also be an important factor.

We agree with the reviewer, and hope to have made it clear in our paper, that modification in the GluA1 might well have some modulatory effect on different physiological processes, including LTP. For example, we did find a significant decrease in swim speed in HA-ΔCTD GluA1 KI, consistent with previous findings with GluA1 KO mice (Zamanillo et al., 1999). These findings combined suggest that the regulation of swim performance by GluA1 requires its CTD. However, the main goal of our present study is to identify fundamental requirements of LTP, and our results using both molecular replacement and KI strategies argue strongly that the GluA1 CTD is not an absolute requirement for LTP. We feel that the numerous possible scenarios that might explain the modulatory role of the GluA1 CTD in previous results, as well as the possible role of the GluA2 CTD, are beyond the scope of this paper.

5) There are several issues with the behavior data that raise concerns with the strong conclusion about spatial memory. The authors should remove these data and claims, or provide additional experiments to make them more convincing.

First, it would be more convincing to assess additional tests of spatial memory beyond MWM (such as novel object location and Y maze novel arm entry), especially in light of the swim speed confound.

We agree with the reviewer that more spatial memory tests would enhance the conclusion that spatial memory does not require the GluA1 CTD. Unfortunately, following the UCSF IACUC directives, we currently maintain colonies, including that of HA-ΔCTD GluA1 KI mice, to a minimal size. Hence, we do not currently have a large enough colony of HA-ΔCTD GluA1 KI mice to carry out the additional experiments proposed by this reviewer. In the current scenario, it would take many months to generate the required mice. We hope that this point-by-point response satisfies the reviewer’s concerns, and we are convinced that the behavior data that we present in this study is solid and justifies the conclusions that we reach. Since we have not been able to carry out further tests, we would be open to compromise and refer specifically to the water maze test instead of using the more general “spatial memory” in the title. We do believe that the spatial memory assessments in HA-ΔCTD GluA1 KI mice included in this paper constitute a valuable piece of information and we are, therefore, reluctant to remove the data.

Second, there are clear differences in performance during the training sessions in the MWM that warrant careful consideration. While the KI mice demonstrate gross learning day-over-day (Figure 3A), the WT mice clearly outperform the KI mice in days 2-7 and then WTs appear to rebound from their previous best performance on day 8. Eight training days is longer than the usual 6 days, and with the addition the four pre-trials with guidance to the platform by a rectangular channel, one could argue that this training schedule results in overtraining. Because WT outperform the KI mice on days 2-7 during training trials, additional experiments will be required to test performance in test trials on days 3 or 4 and day 6. Although decreased swim speed could in part explain the longer latencies for KI mice to reach platform, on day 8 it seems they had caught up arguing somewhat against the notion that the decrease in swim speed would fully explain the difference in training performance. It seems to me that the differences in latencies in Figure 3—figure supplement 1 actually are substantially larger than would be expected from the more modest reduction in swim speed shown in Figure 5A.

The reviewer has a valid point. However, as differences in the performance of mice on any given day can be influenced by many variables, examining individual training days is less informative in our experience than examining the overall learning curves, with the slope of the entire learning curve providing a robust measure of task acquisition/learning. When we compare the distance measures for the groups using a linear mixed model analysis, the most rigorous and robust statistical approach in our view, we obtain the following p values.

  • Days 1-6, p = 0.1252

  • Days 1-7, p = 0.1313

  • Days 1-8, p = 0.0807

  • Days 2-7, p = 0.0839

Thus, truncating the analysis to 6 days of training, as suggested by the reviewer, actually increases the p value even more. The reviewer’s statement that “the WT mice clearly outperform the KI mice in days 2-7” is also not supported by this analysis, although there is a non-significant trend in this direction. The conclusion to be drawn is that WT and KI mice display spatial learning across the training regardless of how the data is parsed.

Third, that WT mice perform worse than the KI mice on day 1 is surprising. It would be important to analyze he trial-by-trial breakdown of this day, especially between trials 1/2 and 3/4, since 1/2 they were run several hours apart from 3/4, during which time memory could already begin to affect performance on subsequent trials.

When analyzing the data as suggested by the reviewer (see Author response image 1), it is clear that the performance of WT and KI mice was very similar by session 2 (trials 3/4). We therefore consider it unlikely that the difference between these groups in session 1 (trials 1/2) was due to learning, as the task was still unknown to the mice at that time.

Author response image 1.

Author response image 1.

Open in a new tab

Fourth, the quantification of discrimination of target vs. other quadrants in Figure 5C is unusual (one-way t-test against 25% chance line). A better depiction would be the usual analysis which shows time spent in each quadrant (not lumping all three non-target quadrants together) and perhaps also the distance accumulated in each quadrant due to the obvious difference in swim speed which will have consequences for dwell time in any region of the pool.

We apologize for the confusion regarding the statistics used in Figure 5C. The blue line on the graph at 25% was added to illustrate chance performance but was not used for statistical analysis. We performed paired t-test analysis on this data comparing % time in the target quadrant to the average % time in the 3 non-target quadrants for each of the genotypes. As the reviewer mentions, displaying the % time spent in each quadrant is confounded by the slower swim speeds in the KI animals. Therefore, focusing on the path length in each quadrant gives a better approximation of quadrant preference in the present study. We show below the distances the mice swam in each quadrant during the probe trial (see Author response image 2A).

Author response image 2.

Author response image 2.

Open in a new tab

A recent publication warned against comparing groups of mice based on statistical analyses carried out strictly within rather than across groups (Nygaard et al., 2019, Autism Research). To allow for a more direct comparison of WT and KI mice in the probe trial, we divided the path length in the target quadrant by the average path length in the non-target quadrants for each mouse, and then used a Mann-Whitney U test to compare the target preference ratios between groups. This analysis, shown in Author response image 2B, confirms comparable target preferences between WT and KI mice (p = 0.348).

Finally, please clarify that heterozygous breeders were used to obtain litter matched WT and KI mice because even minor differences in the genetic background could affect performance. Also clarification is needed about the mice excluded for "procedural learning deficits" after they were run through training and the probe.

As stated in the Materials and methods section, both littermate and cage mate male mice were used for behavior experiments. The breeding strategy, designed in consultation with the Gladstone Behavior Core, which has extensive experience in these experiments, included both heterozygous x heterozygous breedings and KI and WT homozygous x homozygous breedings. We agree with the reviewer that it is preferable that all mice are littermates. Given a 25% chance of homozygous WT or KI pups from a heterozygous breeding (12.5% of male homozygous pups) and a litter size around 7 pups, which is typical for the C57Bl6 strain, we obtain less than one homozygous WT + KI male mice pair per heterozygous breeding litter. Hence, to ensure that we obtained a sufficient cohort of mice of both genotypes around the same age, we also used homozygous breedings. We now better clarify that both types of breedings were used to generate the mice included in the study in the Materials and methods section.

One KI mouse was excluded from the probe trial due to extreme floating behavior and two mice (one from each genotype) were excluded from both training and probe trial analyses because they showed no evidence for task acquisition at all. Exclusions were done blind to the genotype.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Revisions for this paper:

1) Essential Revisions Point 4. Please more specifically address this concern within the manuscript, since the topic of a modulatory role of GluA1 CTD on synaptic plasticity does not seem beyond the scope of the work. This could involve a more explicit explanation of possible scenarios that the authors consider to fall under the "receptor centric" model (as also mentioned in Pt 2) that might be helpful in differentiating the contrasting models for a general audience.

In the revised manuscript, we have included a more extensive discussion of plausible reasons why we have been unable to find a modulatory role for the GluA1 CTD in our study, in line with the suggestions from reviewers. We have also provided more detail to the explanation of the two contrasting models of LTP.

2) Essential Revisions Point 5. The authors have clarified a number of concerns related to MWM data, but there remains a confound related to swim speed. Due to Covid-19 issues the authors are unable to perform additional experiments to strengthen the overall conclusion about spatial memory. To better reflect the relative strength of the conclusions, agreed upon by all reviewers, the authors should remove reference to spatial memory (and MWM) in the Title and Impact Statement, and qualify "spatial memory assayed by the Morris Water Maze" (or similar) in the Abstract. As stated above, we are asking that the manuscript be revised to limit claims to those supported by data in hand, noting that potential confound to the current behavioral analysis requires additional supporting data from other behavioral tests that might be obtained in the future.

References to spatial memory and MWM have been removed from the Title and Impact Statement. An explicit acknowledgement of the possible confounding effect of the reduced swim speed in the KI, and that future research will be needed to fully understand the role of the GluA1 CTD in spatial memory, has been included.

Title:

Please remove reference to spatial memory (and MWM) in the Title and Impact Statement

We have removed the reference to spatial memory and MWM from the Title and Impact Statement.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Contains source data for Figure 1.

    GluA1/A2CTD supports LTP.

    elife-58042-fig1-data1.xlsx (121.1KB, xlsx)
    Figure 1—figure supplement 1—source data 1. Contains source data for Figure 1—figure supplement 1.

    Chimeric GluA1/A2CTD traffics constitutively to the synapse.

    elife-58042-fig1-figsupp1-data1.xlsx (34.7KB, xlsx)
    Figure 1—figure supplement 2—source data 1. Contains source data for Figure 1—figure supplement 2.

    GluA1/A2CTD and GluA2(R) form non-rectifying heteromeric AMPAR.

    elife-58042-fig1-figsupp2-data1.xlsx (34KB, xlsx)
    Figure 1—figure supplement 3—source data 1. Contains source data for Figure 1—figure supplement 3.

    Validation of the CRISPR-mediated GluA1 deletion.

    elife-58042-fig1-figsupp3-data1.xlsx (77.1KB, xlsx)
    Figure 2—source data 1. Contains source data for Figure 2.

    GluA1 CTD is not required for AMPAR trafficking and LTP.

    elife-58042-fig2-data1.xlsx (102.6KB, xlsx)
    Figure 3—source data 1. Contains source data for Figure 3.

    GluA1 CTD is not essential for spatial learning and memory.

    elife-58042-fig3-data1.xlsx (14.6KB, xlsx)
    Figure 3—figure supplement 1—source data 1. Contains source data for Figure 3—figure supplement 1.

    Additional Morris water maze measurements.

    elife-58042-fig3-figsupp1-data1.xlsx (21.7KB, xlsx)
    Transparent reporting form
    elife-58042-transrepform.docx (248.9KB, docx)

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files.

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES