Genotoxic Effect of Salmonella Paratyphi A Infection on Human Primary Gallbladder Cells

Bacterial infections are increasingly being recognized as risk factors for the development of adenocarcinomas. The strong epidemiological evidence linking Helicobacter pylori infection to stomach cancer has paved the way to the demonstration that bacterial infections cause DNA damage in the host cells, initiating transformation. In this regard, the role of bacterial genotoxins has become more relevant. Salmonella enterica serovars Typhi and Paratyphi A have been clinically associated with gallbladder cancer. By harnessing the stem cell potential of cells from healthy human gallbladder explant, we regenerated and propagated the epithelium of this organ in vitro and used these cultures to model S. Paratyphi A infection. This study demonstrates the importance of the typhoid toxin, encoded only by these specific serovars, in causing genomic instability in healthy gallbladder cells, posing intoxicated cells at risk of malignant transformation.

ABSTRACT

Carcinoma of the gallbladder (GBC) is the most frequent tumor of the biliary tract. Despite epidemiological studies showing a correlation between chronic infection with Salmonella enterica Typhi/Paratyphi A and GBC, the underlying molecular mechanisms of this fatal connection are still uncertain. The murine serovar Salmonella Typhimurium has been shown to promote transformation of genetically predisposed cells by driving mitogenic signaling. However, insights from this strain remain limited as it lacks the typhoid toxin produced by the human serovars Typhi and Paratyphi A. In particular, the CdtB subunit of the typhoid toxin directly induces DNA breaks in host cells, likely promoting transformation. To assess the underlying principles of transformation, we used gallbladder organoids as an infection model for Salmonella Paratyphi A. In this model, bacteria can invade epithelial cells, and we observed host cell DNA damage. The induction of DNA double-strand breaks after infection depended on the typhoid toxin CdtB subunit and extended to neighboring, non-infected cells. By cultivating the organoid derived cells into polarized monolayers in air-liquid interphase, we could extend the duration of the infection, and we observed an initial arrest of the cell cycle that does not depend on the typhoid toxin. Non-infected intoxicated cells instead continued to proliferate despite the DNA damage. Our study highlights the importance of the typhoid toxin in causing genomic instability and corroborates the epidemiological link between Salmonella infection and GBC.

INTRODUCTION

Gallbladder cancer (GBC) is an adenocarcinoma with very poor prognosis because early stages are often asymptomatic and few patients can be cured with surgery at initial presentation (1). Although uncommon in Western countries, it has relatively high incidence in the western parts of South America and in the northern part of the Indian subcontinent (2). An intriguing aspect is its putative link to chronic carriage of Salmonella enterica serovar Typhi/Paratyphi A. In these patients, Salmonella resides in the gallbladder (GB) both intracellularly and extracellularly by forming biofilms on gallstones (3–5), which serve as a reservoir from where bacteria are intermittently shed into the duodenum (6). A higher incidence of GBC in chronic carriers was first observed after an outbreak of Salmonella enterica in Aberdeen, Scotland (7), an observation confirmed by subsequent epidemiological studies (8, 9).

Epidemiological associations with cancer have also been shown for several other bacterial pathogens. However, studies that illuminate the underlying mechanisms are only just emerging and suggest that infection can lead to genomic instability, which may contribute to the development of cancer (10). Helicobacter pylori, Escherichia coli, and Chlamydia trachomatis have been shown to induce DNA double-strand breaks (DSBs) in host cells (11–15). Evidence suggests that infection with some species not only causes the production of reactive oxygen species (ROS) that induce DNA damage in the host, but can also modify the DNA damage response and thereby induce error-prone mechanisms of repair (10).

Salmonella enterica provokes direct genotoxicity through the action of a crucial effector, the typhoid toxin (16), which is only expressed by the human-specific serovars Typhi (17) and Paratyphi A (18). It has been hypothesized that Salmonella enterica delivers the typhoid toxin through secreted outer membrane vesicles after internalization into the host cell (19, 20). More recently, it has been found that a specific interaction of a subunit of the typhoid toxin (PtlB) with luminal receptors allows the loading of the toxin from the Salmonella-containing vacuoles into vesicle carriers (21).

Typhoid toxin is able to induce direct DNA DSBs via its CdtB subunit, a DNase that is translocated into the nucleus of the intoxicated cell (19, 20, 22). CdtB also exists as part of another bacterial toxin: the cytolethal distending toxin (CDT), which is produced by multiple Gram-negative bacterial species, including Helicobacter hepaticus (23). Here, as well, it has been directly linked to tumor development in vivo and in vitro (24, 25).

Commonly used cell lines in infection biology are mostly derived from cancerous tissues, limiting their utility for studies of early carcinogenic events, since they are already transformed and have alterations in key cellular signaling pathways. Since the epithelium is the prime target of infections and toxins, the development of organoid-based human primary cell models is an invaluable means for illuminating the molecular mechanisms by which bacteria could promote cancer. While organoid or derivative models of human gastrointestinal epithelia from the small intestine (26), colon (27), stomach (28, 29), and intrahepatic duct (30) are available, such a system was developed for murine (31) and human (32) gallbladders only very recently and has not yet been utilized for infection studies (33, 34). A robust in vitro model that recapitulates the infection dynamics in healthy human gallbladder epithelium would be of immense value in this regard.

Developing from the foregut, the outer lining of the gallbladder consists of a simple columnar epithelium without any gland or crypt structures. The cells tend to moderately produce mucins (35) and transport bile and organic ions (36–38). They share many similarities with the cholangiocytes of the intrahepatic bile duct (39), and therefore the stem cells of the adult gallbladder might express similar markers, such as CD44, CD13, and LGR5 (40, 41) and also depend on activation of the Wnt/β-catenin pathway for their maintenance (30).

Here, we describe the establishment of human gallbladder organoids and their adaptation into more physiological polarized monolayers. We use these systems to study the human-restricted, GBC-associated Salmonella enterica serovar Paratyphi A and, specifically, the effect of the typhoid toxin on healthy cells. These new models will serve as a useful resource to investigate the interaction of Salmonella and its toxin with authentic human tissue.

RESULTS

Maintenance of adult gallbladder epithelial stem cells depends on activation of the Wnt/β-catenin pathway.

Primary epithelial cells from human and murine gallbladder (GB) were isolated and grown in Matrigel supplemented with defined medium (Table 1). After 3 to 5 days, the cells started to form hollow spheres, reaching up to 1 mm in diameter (Fig. 1A for humans; see Fig. S1A in the supplemental material for mice). Organoids were passaged every 7 to 10 days by enzymatic and mechanical shearing, and the resulting cells were seeded in fresh Matrigel for further expansion. Cultures expanded indefinitely for murine cells and for human cells. Fluorescence immunohistochemistry for the proliferation markers Ki67 and PCNA showed randomly distributed positive cells at early and late passages (Fig. 1B for humans; see Fig. S1B in the supplemental material for mice). Since only a small fraction of the cells has the ability to form organoids, we assumed that growing organoids accumulate mainly differentiated cells. We therefore analyzed the transcriptome profile of early (4-day-old) versus late (14-day-old) organoids, which confirmed that only the former were enriched in stem cell markers (42) (Fig. 1C and Table 2), indicating their undifferentiated state.

TABLE 1.

Cultivation medium composition

Reagenta	Supplier	Catalog no.	Working concentration
Human medium
Advanced/DMEM/F-12	Invitrogen	12634-010
R-spondin 1 conditioned medium	In house		25%
B27	Invitrogen	17504-044	1×
N2	Invitrogen	17502-048	1×
Human epidermal growth factor (EGF)	Invitrogen	PHG0311	20 ng/ml
Human noggin	Peprotech	120-10C	150 ng/ml
Human fibroblast growth factor (FGF)-10	Peprotech	100-26	150 ng/ml
Nicotinamide (NIC)	Sigma	N0636	10 mM
A 83-01 (TGF-β type I receptor ALK-5 inhibitor)	Calbiochem	2939	1 μM
Forskolin (FSK)	Tocris	1099	10 μM
Human hepatocyte growth factor (HGF)	Peprotech	100-39	25 ng/ml
Y-27632 (ROCK inhibitor)*	Sigma	Y0503	7.5 μM
Penicillin-streptomycin**	Invitrogen	15140122	1 U/ml
IWP-2***	Merck Millipore	681671	10 μM
Wnt3a conditioned medium***	In house		25%
Murine medium
Advanced/DMEM/F-12	Invitrogen	12634-010
R-spondin 1 conditioned medium	In house		25%
B27	Invitrogen	17504-044	1×
N2	Invitrogen	17502-048	1×
Murine epidermal growth factor (mEGF)	Invitrogen	PMG8044	50 ng/ml
Murine noggin	Peprotech	250-38	100 ng/ml
Nicotinamide (NIC)	Sigma	N0636	10 mM
A 83-01 (TGF-β type I receptor ALK-5 inhibitor)	Calbiochem	2939	1 μM
Y-27632 (ROCK inhibitor)*	Sigma	Y0503	7.5 μM
Penicillin-streptomycin**	Invitrogen	15140122	1 U/ml

^a*, Added only for the first 4 days after seeding; **, not added in infection experiments; ***, only if mentioned.

FIG 1.

Cultivation of human gallbladder organoids and dependence on the Wnt/β-catenin pathway activation. (A) Gallbladder epithelial cells were isolated and grown as described in Materials and Methods. Pictures were taken 0, 4, and 8 days after seeding and at passages 1, 3, 5, 8, and 10. Scale bar, 1 mm. (B) Gallbladder organoids were fixed 7 days after seeding. Organoids were paraffinized, sectioned, and immunostained for the proliferation marker Ki67 (green), β-catenin (red). DRAQ5 was used to stain the nuclei (blue). (C) Gene set enrichment analysis of human pluripotent stem cell genes published by Mallon et al. (42) among genes regulated in early versus late organoids, as identified by microarray. Adjusted P value = 0.00039, enrichment score = 0.6, normalized enrichment score = 1.9. (D) Organoids at passage 1 were split to single cells and seeded, and the number of resulting organoids was counted 5 to 7 days later (i.e., at passage 2), in media + or − Wnt3A and + or − Rspo1. The organoids were kept in culture and the procedure was repeated after 8 passages (i.e., at passage 10). *, P < 0.05 (t test). (E) Organoids were split to single cells which were seeded in Matrigel and provided with media + or − the Wnt inhibitor IWP-2 and + or − 25% of Wnt3a conditioned medium. The number of resulting organoids was counted 5 to 7 days later. *, P < 0.05; ****, P < 0.00005. (F) Change in expression levels of Wnt family members observed in a microarray comparing early versus late organoids. Only transcripts with an average log₂ expression of >6 are shown. *, P < 0.05 (t test). (G) Gene set enrichment analysis of β-catenin targets published by Herbst et al. (44) among genes regulated in early versus late organoids as identified by microarray. Adjusted P value = 0.0015, enrichment score = 0.61, normalized enrichment score = 1.8. (H) Lineage tracing of murine organoids derived from the Lgr5 reporter mouse, Lgr5-EGFP-IRES-CreERT2, ROSA-mTmG^floxed after HT induction. The number of organoids derived from Lgr5⁺ cells (green) and Lgr5^– cells (red) was counted at each passage 5 to 7 days after seeding. The plot shows the percentage of each population compared to the total number of organoids. Bars indicate the standard deviations (SD).

TABLE 2.

List of differentially regulated stem cell related genes in early organoids versus late organoids

Probe	Gene symbol	RefSeq	Entrez ID	logFC	Avg expression	t score	P
A_23_P374844	GAL	NM_015973	51083	5.55	9.38	23.45	0.00
A_24_P225616	RRM2	NM_001034	6241	4.23	9.90	26.43	0.00
A_24_P397107	CDC25A	NM_001789	993	3.39	10.26	23.07	0.00
A_32_P194264	CHAC2	NM_001008708	494143	2.75	10.21	9.17	0.01
A_33_P3286208	LRR1	NM_203467	122769	2.61	8.83	20.53	0.00
A_33_P3332126	SCLY	ENST00000409736	51540	2.45	9.74	17.13	0.00
A_33_P3387856	CENPN	NM_001100625	55839	2.42	6.42	6.88	0.01
A_23_P88740	CENPN	NM_018455	55839	2.22	12.96	12.74	0.00
A_24_P83678	MMS22L	NM_198468	253714	2.14	8.86	8.09	0.01
A_23_P325040	TMPO	NM_003276	7112	2.14	8.95	13.02	0.00
A_23_P56553	METTL8	NM_024770	79828	2.07	10.98	12.13	0.00
A_33_P3253707	LRR1	NM_152329	122769	2.06	12.60	14.00	0.00
A_33_P3379886	FGF2	NM_002006	2247	1.99	6.35	3.18	0.07
A_23_P217637	TIMM8A	NM_004085	1678	1.94	11.61	11.10	0.00
A_33_P3419696	FGF2	NM_002006	2247	1.92	7.69	4.99	0.03
A_24_P49747	HMGB3P24	ENST00000433260	NAa	1.89	6.61	15.70	0.00
A_33_P3489737	NLN	NM_020726	57486	1.86	10.59	5.83	0.02
A_24_P244699	NUDT15	NM_018283	55270	1.81	9.55	6.06	0.02
A_24_P178093	TOMM40	NM_006114	10452	1.77	8.62	10.80	0.00
A_32_P95914	MMS22L	NM_198468	253714	1.75	9.70	6.71	0.01
A_23_P143958	RPL22L1	NM_001099645	200916	1.66	16.39	8.91	0.01
A_24_P336853	PNO1	NM_020143	56902	1.61	10.31	12.46	0.00
A_33_P3357082	METTL8	NM_024770	79828	1.59	9.10	13.84	0.00
A_23_P82823	PINX1	NM_017884	54984	1.57	10.41	10.49	0.00
A_23_P209337	METTL21A	NM_145280	151194	1.56	10.87	6.70	0.01
A_33_P3250861	ZIC3	ENST00000370606	7547	1.29	4.62	1.57	0.24
A_23_P144337	CCRN4L	NM_012118	25819	1.29	3.26	6.09	0.02
A_32_P25273	HSPD1	NM_002156	3329	1.24	17.11	11.51	0.00
A_23_P150092	SEPHS1	NM_012247	22929	1.21	12.66	7.32	0.01
A_21_P0000006	TOMM40	NM_001128917	10452	1.21	13.86	9.57	0.01
A_33_P3412613	TMPO	NM_001032283	7112	1.18	5.82	6.27	0.02
A_23_P202143	NOLC1	NM_004741	9221	1.13	12.02	4.96	0.03
A_33_P3619171	PMAIP1	NM_021127	5366	1.09	10.98	4.95	0.03
A_24_P253215	EMG1	NM_006331	10436	1.07	12.98	6.16	0.02
A_32_P71788	FKBP4	NM_002014	2288	1.06	8.96	9.26	0.01
A_24_P357266	GRPR	NM_005314	2925	1.01	4.42	1.66	0.22
A_23_P136504	SLC25A21	NM_030631	89874	1.01	5.54	3.14	0.07
A_24_P297888	MTAP	NM_002451	4507	1.00	9.97	7.12	0.01
A_33_P3256425	BICD1	NM_001714	636	0.94	6.25	2.98	0.08
A_23_P345065	SCLY	NM_016510	51540	0.93	10.96	3.47	0.06
A_23_P160881	SMPDL3B	NM_001009568	27293	0.93	9.95	2.62	0.10
A_23_P27167	RNASEH1	NM_002936	246243	0.93	11.31	5.67	0.02
A_23_P365060	MDN1	NM_014611	23195	0.92	6.39	7.63	0.01
A_33_P3388135	MKKS	NM_170784	8195	0.92	13.58	3.97	0.04
A_23_P164141	PSME3	NM_176863	10197	0.89	10.79	7.38	0.01
A_23_P156842	EEF1E1	NM_004280	9521	0.89	13.42	7.96	0.01
A_33_P3287815	DDX21	NM_004728	9188	0.87	13.48	8.11	0.01
A_23_P43726	NUP160	NM_015231	23279	0.86	11.39	6.96	0.01
A_21_P0011842	EEF1E1	NM_001135650	9521	0.86	13.35	5.47	0.02
A_23_P131954	SNX5	NM_014426	27131	0.86	15.01	4.18	0.04
A_23_P148484	RLIM	NM_016120	51132	0.86	10.97	3.37	0.06
A_23_P252362	MRPS30	NM_016640	10884	0.86	10.49	6.46	0.01
A_24_P134727	TFAM	NM_003201	7019	0.83	9.21	7.42	0.01
A_23_P214907	MTHFD1L	NM_015440	25902	0.82	9.75	2.11	0.15
A_23_P256148	AKIRIN1	NM_024595	79647	0.81	11.04	3.58	0.05
A_33_P3287502	MSH2	NM_000251	4436	0.77	11.49	5.50	0.02
A_23_P128991	SLIRP	NM_031210	81892	0.77	14.35	2.63	0.10
A_33_P3285444	TERF1	NM_017489	7013	0.76	4.75	1.48	0.26
A_24_P50458	TERF1	NM_017489	7013	0.76	12.20	3.75	0.05
A_33_P3242659	KIF13A	NM_022113	63971	0.70	5.56	3.56	0.05
A_33_P3329108	MTAP	NM_002451	4507	0.69	11.71	3.99	0.04
A_23_P333951	DNAH14	NM_144989	127602	0.67	9.74	2.67	0.10
A_23_P137484	L1TD1	NM_019079	54596	0.67	5.12	5.21	0.02
A_23_P128372	FKBP4	NM_002014	2288	0.65	12.78	4.38	0.04
A_33_P3294404	AKIRIN1	NM_024595	79647	0.64	10.32	3.56	0.05
A_23_P216149	TERF1	NM_017489	7013	0.64	11.57	1.77	0.20
A_23_P102471	MSH2	NM_000251	4436	0.59	12.22	5.40	0.02
A_24_P854913	METTL21A	NM_001127395	151194	0.56	11.08	1.39	0.28
A_23_P54540	EIF2AK4	NM_001013703	440275	0.55	11.76	3.94	0.04
A_23_P94636	RC3H2	NM_018835	54542	0.49	9.40	4.46	0.03
A_23_P146997	TXLNG	NM_018360	55787	0.48	9.65	1.61	0.23
A_33_P3389188	TFAM	NM_003201	7019	0.47	12.74	1.88	0.18
A_33_P3354267	AKIRIN1	NM_024595	79647	0.47	11.81	3.21	0.07
A_33_P3283906	NIP7	NM_016101	51388	0.46	12.12	3.33	0.06
A_33_P3345504	RC3H2	NM_018835	54542	0.45	7.47	4.19	0.04
A_33_P3299776	NODAL	NM_018055	4838	0.45	3.81	1.54	0.25
A_32_P220696	TERF1	NM_017489	7013	0.45	10.55	1.81	0.19
A_23_P213908	PHAX	NM_032177	51808	0.44	13.19	3.43	0.06
A_24_P192434	TERF1	NM_017489	7013	0.44	10.44	1.56	0.24
A_33_P3241786	ADD2	NM_017482	119	0.40	3.31	1.34	0.29
A_32_P87531	DNAH14	NM_001145154	127602	0.35	8.81	1.17	0.35
A_33_P3269453	BPTF	ENST00000342579	2186	0.34	10.51	1.74	0.20
A_21_P0000013	TIMM8A	NM_001145951	1678	0.34	10.14	2.88	0.08
A_33_P3278118	CASP3	NM_004346	836	0.32	8.43	0.86	0.47
A_23_P134008	USP45	ENST00000472914	85015	0.31	9.59	1.34	0.29
A_33_P3297978	MYO1E	NM_004998	4643	0.30	14.27	2.24	0.13
A_24_P127691	DNAH14	ENST00000495456	127602	0.29	4.94	1.91	0.18
A_33_P3289996	USP45	NM_001080481	85015	0.27	7.74	2.52	0.11
A_24_P281975	GNPTAB	NM_024312	79158	0.25	11.60	1.16	0.35
A_24_P215407	DDX6	NM_004397	1656	0.25	8.91	2.20	0.14
A_33_P3289995	USP45	ENST00000369232	85015	0.24	4.91	2.23	0.14
A_33_P3409506	C9orf85	NM_182505	138241	0.20	8.88	1.66	0.22
A_32_P104478	FGD6	NM_018351	55785	0.17	11.00	0.86	0.47
A_33_P3418294	DNAH14	NM_001373	127602	0.15	3.15	1.24	0.32
A_24_P51118	MTAP	NM_002451	4507	0.14	10.15	0.28	0.80
A_23_P214354	EXOC2	NM_018303	55770	0.11	8.27	0.33	0.77
A_33_P3235340	DDX18	NM_006773	8886	0.11	13.07	0.98	0.42
A_33_P3269976	GAL	ENST00000538401	51083	0.10	2.93	0.84	0.48
A_23_P86504	C10orf76	NM_024541	79591	0.10	11.60	0.74	0.53
A_33_P3291976	TERF1	ENST00000518695	7013	0.07	5.35	0.46	0.69
A_23_P92410	CASP3	NM_004346	836	0.06	14.49	0.52	0.65
A_32_P44775	C9orf85	NM_182505	138241	0.05	9.97	0.38	0.73
A_33_P3414669	RLIM	NM_183353	51132	0.04	6.26	0.40	0.72
A_23_P351215	SKIL	NM_005414	6498	0.04	7.47	0.34	0.76
A_24_P152404	C10orf76	ENST00000311122	79591	0.03	10.23	0.16	0.89
A_32_P135243	MTHFD1L	NM_015440	25902	0.03	10.60	0.11	0.92
A_32_P80255	DDX6	NM_004397	1656	0.03	10.53	0.15	0.89
A_32_P528967	RTP1	NM_153708	132112	0.02	3.05	0.18	0.87
A_21_P0013574	MTHFD1L	NM_001242767	25902	0.02	11.20	0.10	0.93
A_33_P3378972	UNC5D	NM_080872	137970	0.01	3.02	0.12	0.92
A_32_P741851	GLB1L3	NM_001080407	112937	0.01	2.96	0.11	0.92
A_23_P140362	VRTN	NM_018228	55237	0.01	2.86	0.11	0.92
A_33_P3241782	ADD2	NM_001617	119	0.01	2.76	0.08	0.94
A_23_P72817	GDF3	NM_020634	9573	0.01	2.91	0.05	0.96
A_23_P329798	CER1	NM_005454	9350	0.00	2.67	0.04	0.97
A_23_P5370	RPRM	NM_019845	56475	0.00	2.84	0.03	0.98
A_23_P327910	ZIC3	NM_003413	7547	0.00	2.83	0.03	0.98
A_33_P3419632	GLB1L3	ENST00000389887	112937	0.00	3.57	0.01	1.00
A_23_P216118	UNC5D	NM_080872	137970	0.00	2.95	0.02	0.99
A_21_P0014207	LOC100506507	XR_108853	NA	0.00	2.66	0.01	0.99
A_23_P380526	DPPA4	NM_018189	55211	0.00	2.81	−0.04	0.97
A_23_P421436	ADD2	NM_017488	119	−0.01	2.84	−0.05	0.96
A_19_P00318232	SHISA9	NM_001145205	729993	−0.01	2.81	−0.06	0.96
A_33_P3280729	SHISA9	NM_001145204	729993	−0.01	2.88	−0.06	0.96
A_23_P137573	LEFTY2	NM_003240	7044	−0.01	2.87	−0.06	0.96
A_24_P235049	MTHFD1L	NM_015440	25902	−0.02	11.42	−0.10	0.93
A_32_P213091	SHISA9	NM_001145205	729993	−0.03	4.56	−0.26	0.82
A_23_P375147	RC3H2	ENST00000373670	54542	−0.05	11.16	−0.18	0.87
A_24_P380132	G3BP2	NM_203505	9908	−0.06	14.44	−0.28	0.80
A_23_P70168	TARS	NM_152295	6897	−0.11	14.69	−0.58	0.61
A_23_P79962	MKKS	NM_170784	8195	−0.11	12.65	−0.85	0.47
A_23_P84070	LARP7	NM_016648	51574	−0.11	12.56	−0.98	0.42
A_33_P3297245	RRAS2	NM_012250	22800	−0.12	14.04	−1.06	0.38
A_24_P332230	LARP7	NM_016648	51574	−0.12	13.09	−0.72	0.54
A_24_P943922	CACHD1	NM_020925	57685	−0.14	4.65	−0.18	0.87
A_33_P3307775	DENR	NM_003677	8562	−0.14	7.10	−0.44	0.69
A_33_P3862375	USP45	NM_001080481	85015	−0.14	9.20	−0.32	0.78
A_33_P3234317	RRAS2	NM_012250	22800	−0.15	13.91	−1.31	0.30
A_33_P3378644	PHC1	NM_004426	1911	−0.19	7.01	−1.11	0.37
A_23_P47058	CUZD1	NM_022034	50624	−0.22	8.19	−1.04	0.39
A_23_P215484	CCL26	NM_006072	10344	−0.26	4.06	−1.35	0.29
A_23_P427217	JMJD1C	NM_032776	221037	−0.46	9.97	−3.89	0.05
A_23_P346265	GNPTAB	NM_024312	79158	−0.47	9.02	−1.41	0.28
A_24_P940125	CNOT6	NM_015455	57472	−0.50	11.75	−4.61	0.03
A_33_P3295523	RAC3	NM_005052	5881	−0.50	12.37	−3.43	0.06
A_23_P25587	LECT1	NM_007015	11061	−0.51	4.69	−1.91	0.18
A_24_P347624	SNURF	NM_022804	8926	−0.52	13.32	−1.90	0.18
A_23_P204246	PHC1	NM_004426	1911	−0.55	4.48	−0.98	0.42
A_23_P259127	ESRP1	NM_017697	54845	−0.60	11.38	−1.91	0.18
A_23_P366376	TDGF1	NM_003212	6997	−0.65	7.90	−2.86	0.08
A_24_P144601	POU5F1	NM_002701	5460	−0.66	7.98	−2.07	0.15
A_23_P156809	METTL21A	NM_001127395	151194	−0.66	11.71	−5.71	0.02
A_24_P104538	BPTF	ENST00000342579	2186	−0.67	9.15	−2.77	0.09
A_21_P0000084	SLC25A21	NM_030631	89874	−0.68	3.26	−1.42	0.27
A_23_P72770	USP44	NM_032147	84101	−0.79	7.71	−7.30	0.01
A_33_P3309206	GABRB3	ENST00000556166	2562	−0.87	4.56	−7.79	0.01
A_23_P59138	POU5F1	NM_002701	5460	−0.99	12.96	−6.27	0.02
A_33_P3227506	BPTF	NM_182641	2186	−1.01	9.64	−6.30	0.02
A_33_P3277075	GABRB3	NM_000814	2562	−1.04	8.28	−9.63	0.01
A_24_P52921	BCAT1	NM_005504	586	−1.06	3.48	−4.10	0.04
A_24_P314477	TUBB2B	NM_178012	347733	−1.14	7.23	−10.24	0.01
A_23_P323094	PHC1	NM_004426	1911	−1.24	6.06	−4.36	0.04
A_33_P3242014	PHC1	NM_004426	1911	−1.26	10.65	−9.28	0.01
A_23_P204640	NANOG	NM_024865	79923	−1.66	7.94	−7.10	0.01
A_24_P935986	BCAT1	NM_005504	586	−1.77	9.14	−9.18	0.01
A_23_P160336	LEFTY1	NM_020997	10637	−2.93	4.40	−21.49	0.00

^aNA, not applicable.

We next tested whether the activation of the Wnt/β-catenin pathway is essential for maintenance of GB epithelial stem cells since they are phenotypically similar to adult cholangiocytes of the intrahepatic duct, which require activation of the LGR5 receptor by the Wnt agonist R-spondin for long-term culture (30). The fraction of cells able to give rise to new organoids remained at 3 to 4% for at least 10 passages for human cells only if R-spondin was added, irrespective of the presence of Wnt3A in the culture medium (Fig. 1D), and at 7 to 9% for 19 passages for murine organoids (see Fig. S1C) (30). Since R-spondins usually act synergistically with Wnt ligands, we next tested whether the epithelial cells themselves produce such ligands. Blocking Wnt ligand secretion through addition of the porcupine inhibitor IWP2 inhibited organoid formation from single cells (Fig. 1E). Organoid formation was partially rescued by the addition of exogenous Wnt3a, suggesting that GB epithelial cells or a subset of them might secrete Wnt agonists. Such a mechanism has been shown in mouse small intestinal organoids, where Paneth cells produce Wnt ligands, supporting organoid growth in the absence of exogenous Wnt agonists (43). Whether a similar subpopulation of cells is responsible for Wnt ligand production in the gallbladder is currently not known.

FIG S1

Cultivation of murine gallbladder organoids. (A) Murine gallbladder epithelial cells grown as organoids at 1, 2, and 4 days after seeding, and at passages 1, 5, 10, 16, and 19. Scale bar, 1mm. (B) Organoids on day 7 after seeding, fluorescently labeled with antibodies against the proliferation marker PCNA (green) and β-catenin (red); nuclei were stained with DRAQ5 (blue). Scale bar, 50 μm. (C) Organoids at passage 0 were split to single cells, seeded, and the number of resulting organoids was counted 5 to 7 days later (i.e., at passage 1). The organoids were kept in culture, and the procedure was repeated after 18 passages (i.e., at passage 19). Bars represent means ± the SD. (D) Lineage tracing of organoids derived from Lgr5-EGFP-IRES-CreERT2, ROSA-mTmG^floxed reporter mice after HT induction. Organoids derived from Lgr5⁺ cells express mGFP, while those derived from Lgr5⁻ cells express mTomato. Scale bar, 200 μm. Download FIG S1, TIF file, 2.1 MB ^{(2.1MB, tif)} .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

We next found that WNT3, -4, -7A, -7B, and -11 were expressed in GB organoids, but only WNT7A and WNT7B were significantly overexpressed in the stem cell-enriched early organoids, whereas late organoids were enriched in WNT4 (Fig. 1F). This indicates that different types of cells are secreting specific Wnt proteins and that WNT7A and B might play a specific role in stem cell maintenance, since they are abundantly expressed in early organoids (Fig. 1F).

Since the activation of the Wnt/β-catenin pathway is essential for stem cell maintenance we expected to find higher levels of target gene transcription in stem cells. We compared a published list of β-catenin target genes (44) with the results of our microarray (Table 3) and observed a dramatic enrichment of such genes in early organoids compared to older, more differentiated organoids (Fig. 1G). The most relevant differentially regulated genes were the secreted Wnt inhibitors Dickkopf-1 (DKK1) and DKK4, the transcription factor binding to nuclear β-catenin LEF1, and LGR5. In differentiated organoids, we observed upregulated expression of the intracellular Wnt inhibitor AXIN2, which may play a role in inhibiting the pathway in more differentiated cells (Table 3).

TABLE 3.

List of differentially regulated β-catenin target genes in early organoids versus late organoids

Probe	Gene symbol	RefSeq	Entrez ID	logFC	Avg expression	t score	P
A_23_P118815	BIRC5	NM_001012271	332	4.68	13.18	42.25	0.00
A_23_P94275	DKK4	NM_014420	27121	3.40	6.21	16.98	0.00
A_23_P24129	DKK1	NM_012242	22943	3.17	14.38	19.03	0.00
A_24_P20630	LEF1	NM_016269	51176	2.02	5.96	14.91	0.00
A_33_P3329187	DNMT1	NM_001130823	1786	1.69	12.38	10.55	0.00
A_23_P159191	GAST	NM_000805	2520	1.58	7.69	5.45	0.02
A_23_P98974	LGR5	NM_003667	8549	1.54	5.41	8.18	0.01
A_33_P3258392	EDN1	NM_001955	1906	1.49	12.07	3.21	0.07
A_23_P214821	EDN1	NM_001955	1906	1.48	14.90	7.19	0.01
A_23_P202837	CCND1	NM_053056	595	1.44	11.40	3.97	0.04
A_33_P3232828	SRSF3	NM_003017	6428	1.44	13.02	6.81	0.01
A_23_P215956	MYC	NM_002467	4609	1.37	14.06	6.25	0.02
A_23_P24104	PLAU	NM_002658	5328	1.16	14.30	6.33	0.02
A_33_P3306146	PLAU	NM_001145031	5328	1.10	9.48	2.68	0.10
A_23_P160968	LAMC2	NM_018891	3918	1.08	10.17	3.70	0.05
A_23_P413761	SRSF3	NM_003017	6428	1.03	15.83	8.66	0.01
A_33_P3411075	FSCN1	NM_003088	6624	0.99	15.10	7.56	0.01
A_23_P19673	SGK1	NM_005627	6446	0.94	12.66	4.51	0.03
A_23_P135381	SP5	NM_001003845	389058	0.87	13.23	7.77	0.01
A_33_P3381751	TIAM1	NM_003253	7074	0.86	11.85	6.00	0.02
A_33_P3301514	NRCAM	NM_001193582	4897	0.85	6.87	3.77	0.05
A_23_P201636	LAMC2	NM_005562	3918	0.83	15.34	6.35	0.02
A_23_P94800	S100A4	NM_002961	6275	0.81	12.16	7.43	0.01
A_32_P69368	ID2	NM_002166	3398	0.72	12.89	2.62	0.10
A_23_P54144	BMP4	NM_001202	652	0.71	11.68	2.37	0.12
A_23_P201711	S100A6	NM_014624	6277	0.71	17.59	4.76	0.03
A_23_P143143	ID2	NM_002166	3398	0.64	12.84	5.39	0.02
A_23_P16469	PLAUR	NM_001005377	5329	0.64	11.83	2.75	0.09
A_33_P3294509	CD44	NM_000610	960	0.61	15.41	5.07	0.03
A_23_P359245	MET	NM_000245	4233	0.60	15.75	4.42	0.03
A_23_P58788	CDX1	NM_001804	1044	0.58	3.62	4.50	0.03
A_33_P3332414	ABCB1	NM_000927	5243	0.53	9.18	4.36	0.04
A_23_P57784	CLDN1	NM_021101	9076	0.52	13.42	4.78	0.03
A_24_P252364	NRCAM	NM_001037132	4897	0.49	10.83	1.64	0.22
A_24_P303989	BMI1	NM_005180	648	0.41	8.43	3.63	0.05
A_23_P201655	MYCBP	NM_012333	26292	0.39	13.57	2.96	0.08
A_23_P412389	FGF18	NM_003862	8817	0.35	10.37	2.58	0.10
A_23_P210763	JAG1	NM_000214	182	0.35	11.81	3.07	0.07
A_23_P344555	NEDD9	NM_006403	4739	0.34	8.83	1.21	0.33
A_23_P314115	BMI1	NM_005180	648	0.31	10.15	1.20	0.34
A_23_P214681	PPARD	NM_006238	5467	0.31	5.70	1.13	0.36
A_33_P3374443	L1CAM	NM_024003	3897	0.31	4.29	1.05	0.39
A_23_P100883	SUZ12	NM_015355	23512	0.30	13.86	1.12	0.36
A_33_P3323298	JUN	NM_002228	3725	0.28	12.78	2.51	0.11
A_23_P138631	SMC3	NM_005445	9126	0.27	12.56	1.97	0.17
A_23_P82523	ABCB1	NM_000927	5243	0.27	12.31	2.01	0.16
A_24_P207995	L1CAM	NM_000425	3897	0.26	3.50	0.58	0.61
A_32_P171061	ASCL2	NM_005170	430	0.23	9.18	1.38	0.28
A_21_P0000152	CD44	NM_001202557	960	0.21	6.02	0.65	0.57
A_33_P3243857	ADAM10	NM_001110	102	0.19	11.61	1.42	0.27
A_23_P31073	MYB	NM_005375	4602	0.19	12.36	1.03	0.40
A_23_P26847	SOX9	NM_000346	6662	0.16	10.69	1.17	0.35
A_24_P69095	ENC1	NM_003633	8507	0.13	13.73	0.20	0.86
A_33_P3289848	CDX1	NM_001804	1044	0.11	8.23	0.72	0.54
A_23_P402751	COX2	ENST00000361739	4513	0.08	15.40	0.28	0.80
A_33_P3880302	EPHB2	NM_004442	2048	0.06	7.27	0.28	0.80
A_24_P252130	PPARD	NM_006238	5467	0.06	11.98	0.50	0.66
A_33_P3245163	MYC	M13930	4609	0.05	3.06	0.42	0.71
A_33_P3311795	MYB	ENST00000531845	4602	0.02	2.96	0.19	0.86
A_24_P365807	EFNB1	NM_004429	1947	−0.03	15.21	−0.29	0.80
A_24_P82106	MMP14	NM_004995	4323	−0.05	10.03	−0.36	0.75
A_23_P48886	ADAM10	NM_001110	102	−0.06	10.76	−0.55	0.63
A_33_P3370787	EPHB2	NM_004442	2048	−0.18	8.02	−1.69	0.21
A_23_P6596	HES1	NM_005524	3280	−0.19	7.93	−1.74	0.20
A_23_P95060	EPHB3	NM_004443	2049	−0.19	11.52	−0.99	0.41
A_33_P3331376	EPHB2	NM_004442	2048	−0.22	5.58	−1.61	0.23
A_33_P3411628	CDKN2A	NM_000077	1029	−0.33	10.69	−3.01	0.08
A_23_P52207	BAMBI	NM_012342	25805	−0.40	14.60	−3.50	0.06
A_21_P0014167	NEDD9	ENST00000379433	4739	−0.41	4.24	−2.81	0.09
A_23_P27332	TCF4	NM_003199	6925	−0.50	7.67	−3.83	0.05
A_33_P3258824	NOTCH2	NM_001200001	4853	−0.54	12.30	−2.72	0.09
A_24_P298027	AXIN2	NM_004655	8313	−0.56	7.02	−2.16	0.14
A_23_P43490	CDKN2A	NM_058197	1029	−0.60	12.54	−4.48	0.03
A_33_P3368358	NEDD9	NM_182966	4739	−0.64	8.82	−4.65	0.03
A_23_P418373	BCL2L2	NM_004050	599	−0.68	12.42	−6.26	0.02
A_23_P148015	AXIN2	NM_004655	8313	−0.71	10.85	−4.42	0.03
A_23_P200792	NOTCH2	NM_024408	4853	−1.06	13.84	−8.94	0.01
A_23_P52761	MMP7	NM_002423	4316	−1.10	16.35	−5.16	0.02
A_23_P502464	NOS2	NM_000625	4843	−2.40	4.30	−9.83	0.01

Finally, to verify that expansion of GB organoids is driven by Lgr5⁺ cells, we took advantage of a Lgr5^–EGFP-IRES-creERT2:ROSA-mTmG-floxed reporter mouse. In the gallbladder cells of this mouse, Cre-ERT2 is under the control of the Lgr5 promoter. After induction with 4-hydroxytamoxifen (4HT), Lgr5⁺ cells switch from red-Tomato to green-GFP expression. Induction with 4HT during culture of organoids derived from GBs of the reporter mice resulted in the generation of two distinct organoid populations. The majority derived from Lgr5⁻ cells expressing mTomato, while 8.6% originated from Lgr5⁺ cells expressing mGFP (Fig. 1H; see also Fig. S1D in the supplemental material). The proportion of organoids derived from Lgr5⁺ cells steadily increased after the first passage, making up >90% by passage 4, confirming the crucial role of Wnt/β-catenin signaling through the Lgr5 receptor in the long-term maintenance of GB cells in vitro.

Gallbladder organoids are stable and resemble the cell structure and function of the organ in situ.

To confirm that GB organoids maintain their epithelial identity, we examined expression of the epithelial marker E-cadherin by Western blot (Fig. 2A). The levels of the GB markers claudin-2 and cytokeratin-19 did not change between early (passage 1) and late (passage 10 for human, 19 for mouse) passages (see Fig. 2A for humans and see Fig. S2A for mice). Previous attempts to cultivate epithelial primary cells were frustrated by fibroblast outgrowth (45, 46). In our system, we observed that fibroblasts do not grow in Matrigel, and at the end of passage 1 we could not detect the mesenchymal marker Vimentin (Fig. 2B and Fig. S2B). In order to assess the GB identity of organoids, we used fluorescence immunohistochemistry to examine a GB-specific combination of markers and compared their expression to that of GB tissue. The luminal mucosa of the GB consists of a simple columnar epithelium expressing cytokeratin-19 (47). Similarly, the GB organoids consist of an E-cadherin-positive cell monolayer, with apical cytokeratin-19 expression (Fig. 2C for humans and Fig. S2C for mice, left panel) and eccentric nuclei (Fig. 2C for humans and Fig. S2C for mice). These organoids also show luminal junctional expression of claudin-2 (Fig. 2C for humans and Fig. S2C for mice), a tight-junction protein expressed at higher levels in the gallbladder compared to other organs including the cholangiocytes of the bile duct (48). GB epithelial cells also produce mucins, with MUC5B being one of the most abundant (49, 50). As expected, we detected MUC5B expression in both the tissue sample and the organoids (Fig. 2C for humans and Fig. S2C for mice).

FIG 2.

Characterization of human organoids. (A) Western blot analysis of epithelial and gallbladder markers at early (P1) and late (P10) passages. Relative densitometry values, normalized to P1 (=1), are shown above the bands. (B) Western blot analysis as in panel A of the fibroblast marker Vimentin compared to HeLa cells. (C) Immunofluorescence analysis of human gallbladder tissue and organoids 7 days after seeding for the gallbladder markers cytokeratin-19, claudin-2, or mucin5B (red); the epithelial marker E-cadherin (green); and DRAQ5 (blue). Scale bar, 25 μm. (D) Transport assay of rhodamine-123 (green) in gallbladder organoids treated with the multidrug transporter inhibitor verapamil (middle row), and gastric organoids. Scale bar, 100 μm.

FIG S2

Characterization of murine gallbladder organoids. (A) Western blot analysis of murine epithelial and gallbladder markers at early (P1) and late (P19) passages. (B) Western blot analysis as in panel A of the fibroblast marker vimentin compared to HeLa cells. (C) Immunofluorescence analysis of murine gallbladder tissue and organoids at 7 days after seeding for the gallbladder markers cytokeratin-19, claudin-2, or mucin5B (red); the epithelial marker E-cadherin (green); and DRAQ5 (blue). Scale bar, 10 μm. Download FIG S2, TIF file, 1.3 MB ^{(1.3MB, tif)} .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

One of the functions of the GB is to concentrate bile in the lumen (37, 38). The gallbladder expresses the ATP-dependent multidrug transporter MDR1, which transports organic cations back into the lumen (51–53), protecting the organ from high concentrations of potentially toxic organic ions. To test whether gallbladder organoids functionally recapitulate this physiological feature, we added rhodamine-123, a chemical dye substrate of MDR1 often used to monitor organoid function, to the medium (54). Gallbladder organoids actively transported the dye into the lumen, resulting in increased concentration of luminal fluorescence relative to the medium on the outside (Fig. 2D, top panel). Pretreating organoids with the MDR1 inhibitor verapamil prevented luminal dye accumulation (Fig. 2D, middle panel), confirming dependence on MDR1. In contrast, gastric organoids did not accumulate the dye (Fig. 2D, bottom panel).

Salmonella enterica serovar Paratyphi A induces paracrine CdtB-dependent DNA damage in GB organoids.

Since the gallbladder organoids accurately recapitulate the main molecular features of the epithelium of origin, we used them to model infection with S. enterica using the human restricted pathogenic serovar Paratyphi A, which has been epidemiologically linked to gallbladder cancer (7, 55). Previous observations of the genotoxic effects of S. Typhi/Paratyphi A were based on experiments in cell lines, using mostly ectopic expression of recombinant typhoid toxin (19, 20).

Since the genotoxicity of the bacterium resides in the CdtB subunit of the typhoid toxin, we generated a cdtB knockout. Organoids were mechanically sheared to expose the luminal side and cocultured with Salmonella enterica serovar Paratyphi A or with its isogenic cdtB knockout strain, before reseeding in Matrigel, with gentamicin-supplemented medium to eliminate extracellular bacteria. At 3 days post infection, organoids showed foci of infection with intracellular Salmonella (Fig. 3A). After verifying that the ΔcdtB mutant is capable of invading epithelial cells at a rate similar to the wild-type (w.t.) bacteria (Fig. 3B), we examined the induction of DNA damage.

FIG 3.

Infection and paracrine genotoxic effect of CdtB. (A) Reconstruction of whole-mount immunofluorescence labeling of organoids infected with Salmonella Paratyphi A carrying the mCherry-expressing plasmid pLS002 (red) at 3 days post infection, with phalloidin to detect F-actin (white) and Hoechst for DNA (blue). Scale bar, 10 μm. (B) Proportion of cells invaded after infection of organoids with wild-type Salmonella or a cdtB deletion mutant. (C) Whole-mount immunofluorescence labeling of organoids 3 days after infection with Salmonella Paratyphi A w.t. or ΔcdtB carrying the mCherry-expressing plasmid pLS002 using antibodies against γH2AX (green), phalloidin (white), and Hoechst (blue). Scale bar, 20 μm. (D) Model for categorization of uninfected cells according to the distance from the infected cell at position 0 (red). Orange represents the first three rings of non-infected cells (positions 1 to 3), and green represents the next three rings (positions 4 to 6). (E) Percentage of cells positive for the DNA damage marker γH2AX depending on their distance from the infected cell. The dashed blue line represents the average percentage of γH2AX-positive cells in uninfected organoids (SD = 0.97). *, P < 0.05; **, P < 0.01 (compared to uninfected cells). Infected cells are defined as cells with >5 bacteria, and γH2AX-positive cells are cells with >3 foci.

To this end, we tested organoids for phosphorylation of H2AX at serine 139 (γH2AX), a histone variant involved in detection of DSBs and recruitment of repair factors (56), and we quantified and mapped the number of γH2AX-positive cells after infection with the wild type and the ΔcdtB strain. The number of cells experiencing DNA damage was generally higher in the organoids infected with the wild-type strain compared to the ΔcdtB mutant (Fig. 3C). Quantification of the number of γH2AX-positive cells that are infected (defined in the map of Fig. 3D as position 0) revealed that both cells infected with the w.t. or ΔcdtB strain experience DNA damage (Fig. 3E, position 0). However, there is a significantly reduced number of γH2AX-positive cells among the ones infected with the mutant strain (Fig. 3E, position 0, ΔcdtB).

In addition, we noticed that in organoids infected with the wild-type strain, a number of uninfected neighboring cells also contained γH2AX foci (Fig. 3C to E). To quantify this paracrine genotoxic effect, uninfected cells were divided into two groups depending on the distance from the infected cell (Fig. 3D): Positions 1 to 3 include the first three rings of uninfected cells surrounding the infected focus, whereas positions 4 to 6 represent the rings 4 to 6 of the uninfected cells. The proportion of γH2AX-positive cells was higher in positions 1 to 3 than in positions 4 to 6 (Fig. 3E), but only for the organoids infected with wild-type bacteria. This confirms that the typhoid toxin is secreted from infected cells also in the primary polarized cells of the organoids (17) and that its genotoxic effects extend to the neighboring cells in a paracrine manner. In our system, this paracrine effect was limited to the first three rings of cells surrounding the infected one. Since γH2AX is also highly expressed during mitosis, cells that displayed chromosome condensation were excluded from the analysis. Our experiments suggest that infection with Salmonella Paratyphi A causes DNA damage and that a functional typhoid toxin increases the extent of damage in the infected cells and extends it to the neighboring uninfected cells.

Infection with Salmonella Paratyphi A activates transcription programs associated with cell cycle arrest.

The risk of developing gallbladder cancer is higher in patients who are chronic carriers of typhoid Salmonella serovars. Therefore, to understand the fate of the infected cells, we sought to extend the duration of the infection using a more physiological model that mimics chronic infection in vitro. For the infection of the organoids, the cells must be disaggregated, and after 3 days we usually observed an overgrowth of bacteria or of cells, which impaired longer-term analysis. To understand the effect of the infection on a homeostatic gallbladder epithelial barrier and to allow longer term infection, we adapted the gallbladder organoids into mucosoid cultures, as previously done for the human stomach (34). Single cells derived from organoids were seeded on a collagen-coated polycarbonate filter in a standing cell culture insert (Fig. 4A). The cultivation cocktail was identical to that used for organoids and applied both below and above the filter. After 3 days, the apical medium was removed to start air-liquid interface cultivation (Fig. 4A). Primary gallbladder cells can be expanded on a monthly basis by deriving single cells from mucosoid cultures and restarting from the seeding procedure. Gallbladder mucosoids can be infected by applying a suspension of bacteria on top of the filter after removing excess mucus (Fig. 4A). The progress of the infection can be monitored using fluorescent transgenic Salmonella. Presence of intracellular Salmonella was detectable equally for both wild-type and ΔcdtB strains (Fig. 4B), and electron microscopy analysis of non-infected and infected mucosoid cultures revealed that the monolayer and the cell gross morphology remain intact during infection (Fig. 4C).

FIG 4.

Generation of gallbladder mucosoids and long-term infection experiments. (A) Schematic of gallbladder mucosoid cultivation and infection procedure. (From left to right) After seeding, a polarized cell layer of gallbladder cells begins to form on the collagen-coated polycarbonate filter in the transwell insert. Primary cell medium is provided around the cell culture insert and on top of the cells. At day 3, the upper medium is withdrawn, and cells start to produce mucus. From day 10 onward, the culture is stable, and infection experiments can be performed by administering Salmonella on the cell layer. (B) Detailed view of long-term infection of human gallbladder mucosoids with S. enterica Paratyphi A and transmission electron microscopy. Stable long-term infection can be reached with both the wild type and the cdtB deletion mutant by applying gentamicin for 24 h and then withdrawing it again from the medium. Internalization and perinuclear localization of the bacteria within lysosomal structures is visible. Two zoomed-in images of intracellular bacteria are shown. b, bacterium; n, nucleus. Scale bar, 1 μm. (C) Establishment of mucosoids. The development of a polarized monolayer of gallbladder cells in an air-liquid cultivation (“mucosoids”) and transmission electron microscopy images of non-infected control (NI) and infected with S. Paratyphi A w.t. and isogenic ΔcdtB KO strains for 2 days are shown. Scale bar, 10 μm. (D) Top view of infected and non-infected gallbladder mucosoids. Staining was performed for γH2AX (green), Salmonella (red), phalloidin (white), and nuclei (blue). Cultures infected for 6 days show DNA damage, whereas there is no damage visible in the non-infected control. Scale bar, 20 μm. (E) Heat map of manually selected NF-κB target genes. A comparison of w.t. and ΔcdtB infections at 2 and 7 days post infection is shown. The heatmap was plotted using the normalized expression values (log-normalized intensity) relative to the non-infected control at each time point (logFC). (F) Heatmap of normalized enrichment scores from GSEA for genes preferentially expressed in distinct cell cycle phases (58) for comparisons of mucosoid cultures with w.t. or ΔcdtB strain infections at 2 and 7 days post infection relative to non-infected controls.

Similar to what we observed with organoids, in the infected mucosoid cultures, we found that established colonies of w.t. Salmonella induce more DNA damage than the isogenic ΔcdtB strain, as measured using gH2AX staining (Fig. 4D). We performed a microarray analysis to compare the short versus the long-term effect of the infection on the gallbladder epithelial cells. We used gene set enrichment analysis (GSEA) to investigate any statistically significant consistent differences between gene set expression in the culture after infection with the w.t. strain versus infection with the ΔcdtB isogenic mutant. Infection with both strains induced similar expression of NF-κB target genes at 2 days post infection, indicating the expected initiation of an inflammatory response (Fig. 4E). Interestingly, in the cultures infected with the w.t. strain, NF-κB-controlled cytokines and chemokine genes continued to be highly expressed at 7 days, suggesting a role of the typhoid toxin in maintaining inflammation. It has previously been observed that the typhoid toxin reduces inflammation in mice infected with a transgenic Salmonella Typhimurium strain expressing the typhoid toxin (57). Inflammation is the result of a complex interaction between immune cells and the epithelium in the mucosa, and we observed here that typhoid toxin directly or indirectly maintains high transcription of NF-κB target genes in epithelial cells.

Analysis of the cell-cycle related gene sets (58) during infection (Table 4) revealed a strong underrepresentation of transcriptional programs related to each cell cycle phase (G₁/S, S, G₂, and G₂/M) (Fig. 4F). As those genes are usually accumulated only in a specific phase of the cell cycle, the downregulation of all the G₁/S, S, G₂, and G₂/M transcription programs implies that a proportion of cells in the infected mucosoids are not replicating (58, 59). This effect of the infection in stopping cell replication is particularly strong at 2 days after infection, but is attenuated after 1 week, indicating that an increasing number of cells are cycling again (Fig. 4F). The effect of the infection on the cell cycle was either independent from a functional typhoid toxin or any effect of the typhoid toxin on the infected culture was masked by other bacterial effectors.

TABLE 4.

List of differentially regulated genes^a

Probe	Gene symbol	RefSeq	Entrez ID	logFC at:				Cell cycle phaseb
				2 days		7 days
				w.t. vs NI	dCdtB vs NI	w.t. vs NI	dCdtB vs NI
A_23_P39481	ABCA7	NM_019112	10347	−0.22	−0.02	0.20	−0.66	G1_S
A_23_P26375	ACD	NM_022914	65057	−0.11	−0.01	0.10	−0.48	G1_S
A_23_P163143	ACYP1	NM_203488	97	0.05	−0.13	−0.18	0.71	G1_S
A_23_P211039	ADAMTS1	NM_006988	9510	0.46	0.38	−0.08	0.45	G1_S
A_23_P342275	ADAMTS1	NM_006988	9510	0.37	0.16	−0.22	0.48	G1_S
A_24_P283395	ADCK2	NM_052853	90956	−0.25	−0.29	−0.03	−0.55	G1_S
A_24_P291978	ADCK2	NM_052853	90956	0.23	−0.02	−0.26	−0.10	G1_S
A_23_P501547	ADCY6	NM_015270	112	−0.21	0.10	0.31	−0.73	G1_S
A_24_P298077	ANKRD10	NM_017664	55608	0.75	−0.03	−0.78	0.94	G1_S
A_23_P205046	ANKRD10	NM_017664	55608	0.03	0.56	0.53	−0.36	G1_S
A_23_P170331	AP3M2	NM_006803	10947	0.34	0.04	−0.30	0.60	G1_S
A_24_P64039	AP3M2	NM_006803	10947	−0.02	−0.32	−0.30	0.47	G1_S
A_23_P160729	AP4B1	NM_006594	10717	0.31	0.28	−0.03	0.46	G1_S
A_23_P256682	APEX2	NM_014481	27301	−0.22	0.20	0.42	−0.34	G1_S
A_23_P162782	ARGLU1	NM_018011	55082	0.17	−0.09	−0.25	0.74	G1_S
A_24_P159648	BAIAP2	NM_006340	10458	−0.33	−0.03	0.30	−0.93	G1_S
A_23_P315836	BAIAP2	NM_017451	10458	0.16	0.11	−0.06	−0.12	G1_S
A_23_P61810	BAIAP2	NM_017450	10458	−0.07	0.34	0.41	−1.21	G1_S
A_23_P67771	BARD1	NM_000465	580	−1.44	−1.07	0.37	−0.47	G1_S
A_32_P18824	BRD7	NM_013263	29117	0.04	−0.13	−0.17	0.07	G1_S
A_23_P381378	CAPN7	NM_014296	23473	0.00	−0.06	−0.06	0.20	G1_S
A_23_P58898	CASP8AP2	NM_012115	9994	−0.42	−0.45	−0.03	0.12	G1_S
A_32_P180315	CCDC180	NM_020893	1E+08	−0.65	−0.98	−0.33	−0.36	G1_S
A_24_P280706	CCDC180	NM_020893	1E+08	0.27	0.28	0.01	0.50	G1_S
A_23_P209200	CCNE1	NM_001238	898	−0.40	−0.33	0.08	0.17	G1_S
A_23_P215976	CCNE2	NM_057749	9134	−1.03	−0.94	0.10	−0.63	G1_S
A_24_P397107	CDC25A	NM_001789	993	−1.34	−1.13	0.21	−0.75	G1_S
A_23_P121423	CDC25A	NM_001789	993	−0.57	−0.96	−0.38	0.06	G1_S
A_23_P49972	CDC6	NM_001254	990	−1.14	−1.40	−0.26	0.39	G1_S
A_23_P251421	CDCA7	NM_031942	83879	−1.06	−0.35	0.72	−0.88	G1_S
A_24_P171549	CDCA7	NM_031942	83879	−1.00	−0.16	0.84	−1.13	G1_S
A_24_P274795	CDCA7L	NM_018719	55536	−1.39	−0.68	0.71	−0.92	G1_S
A_23_P20752	CDK20	NM_001039803	23552	0.20	0.17	−0.02	−0.03	G1_S
A_24_P53519	CHAF1A	NM_005483	10036	−0.37	−0.42	−0.05	−0.71	G1_S
A_23_P57306	CHAF1B	NM_005441	8208	−0.81	−0.45	0.37	−0.54	G1_S
A_23_P126212	CLSPN	NM_022111	63967	−0.82	−1.06	−0.24	−0.08	G1_S
A_23_P52556	CTSD	NM_001909	1509	−0.32	−0.47	−0.15	−0.61	G1_S
A_23_P139312	DHFR2	NM_176815	200895	−0.54	−0.71	−0.17	0.09	G1_S
A_24_P186065	DHFR2	NM_176815	200895	−0.05	0.11	0.16	−0.33	G1_S
A_24_P219024	DIS3	NM_014953	22894	0.08	0.00	−0.08	0.31	G1_S
A_23_P48416	DIS3	NM_014953	22894	0.05	0.17	0.12	−0.27	G1_S
A_24_P395317	DIS3	NM_014953	22894	0.01	−0.06	−0.07	−0.29	G1_S
A_23_P36962	DNAJC3	NM_006260	5611	0.10	0.13	0.03	0.34	G1_S
A_23_P10385	DTL	NM_016448	51514	−2.06	−1.93	0.13	−1.18	G1_S
A_23_P80032	E2F1	NM_005225	1869	−1.89	−1.24	0.65	−1.39	G1_S
A_23_P408955	E2F2	NM_004091	1870	−2.73	−1.92	0.80	−2.19	G1_S
A_23_P125990	E2F2	NM_004091	1870	−0.11	−0.52	−0.40	0.71	G1_S
A_23_P44932	EIF2A	NM_032025	83939	0.33	0.14	−0.19	0.46	G1_S
A_32_P197524	EIF2A	NM_032025	83939	0.17	−0.18	−0.35	0.32	G1_S
A_23_P87964	ESD	NM_001984	2098	−0.33	−0.23	0.11	0.29	G1_S
A_24_P841662	ESD	AK093643	2098	−0.38	−0.21	0.17	−0.17	G1_S
A_24_P332314	FAM111B	NM_198947	374393	−2.21	−2.52	−0.31	−0.18	G1_S
A_23_P409516	FAM122A	NM_138333	116224	0.03	−0.28	−0.31	0.34	G1_S
A_23_P71644	FANCG	NM_004629	2189	−0.62	−0.62	−0.01	−0.03	G1_S
A_23_P141146	FBXL20	NM_032875	84961	0.56	0.06	−0.49	0.23	G1_S
A_32_P318086	FLAD1	NM_025207	80308	−0.63	−0.30	0.33	−0.11	G1_S
A_32_P6917	FLAD1	NM_025207	80308	−0.68	−0.18	0.50	0.02	G1_S
A_23_P34527	FLAD1	NM_025207	80308	−0.67	−0.05	0.62	−0.18	G1_S
A_23_P118246	GINS2	NM_016095	51659	−3.12	−2.76	0.36	−1.06	G1_S
A_23_P152136	GINS3	NM_022770	64785	−0.67	−0.65	0.02	0.09	G1_S
A_24_P159323	GINS3	NM_022770	64785	0.12	0.26	0.14	−0.05	G1_S
A_23_P19712	GMNN	NM_015895	51053	−0.77	−0.85	−0.08	0.45	G1_S
A_23_P99579	GON7	NM_032490	84520	−0.62	−0.44	0.18	0.05	G1_S
A_24_P567952	HCG18	NR_024052	414777	−0.54	−0.06	0.48	−0.46	G1_S
A_24_P934162	HCG18	A_24_P934162	NA	0.28	−0.15	−0.43	0.48	G1_S
A_32_P181722	HCG18	NR_024052	414777	−0.15	0.07	0.22	−0.19	G1_S
A_24_P567944	HCG18	NR_024052	414777	−0.07	0.23	0.30	−0.14	G1_S
A_32_P199884	HORMAD1	NM_032132	84072	0.28	0.03	−0.25	0.24	G1_S
A_24_P416370	HOXB4	NM_024015	3214	−0.84	−0.78	0.06	−0.48	G1_S
A_24_P305067	HOXB4	NM_024015	3214	−0.09	0.18	0.27	−0.62	G1_S
A_23_P98183	HRAS	NM_005343	3265	0.32	0.49	0.17	−0.12	G1_S
A_32_P9963	HSF2	NM_004506	3298	0.28	−0.09	−0.37	0.80	G1_S
A_23_P111360	HSF2	NM_004506	3298	0.21	−0.23	−0.44	0.62	G1_S
A_23_P43079	INTS8	NM_017864	55656	0.04	0.25	0.21	0.64	G1_S
A_23_P391506	IVNS1ABP	NM_006469	10625	−0.60	−0.45	0.15	−0.49	G1_S
A_23_P137514	IVNS1ABP	NM_006469	10625	−0.36	−0.18	0.18	0.63	G1_S
A_24_P324787	KANK2	NM_015493	25959	−0.33	0.05	0.38	−0.90	G1_S
A_23_P50426	KANK2	NM_015493	25959	−0.35	0.16	0.51	−1.00	G1_S
A_23_P55897	KANK2	NM_015493	25959	−0.05	0.24	0.29	−0.50	G1_S
A_23_P12079	KCNC4	NM_153763	3749	−0.37	−0.04	0.33	−0.43	G1_S
A_23_P404821	KIAA1147	NM_001080392	57189	−0.25	0.09	0.34	−0.52	G1_S
A_24_P101047	KIAA1586	NM_020931	57691	−0.24	0.03	0.27	−0.25	G1_S
A_24_P230965	KIAA1586	NM_020931	57691	−0.20	−0.22	−0.02	0.24	G1_S
A_24_P237559	LNPEP	AK096804	4012	0.41	0.10	−0.31	0.64	G1_S
A_23_P144677	LNPEP	ENST00000231368	4012	−0.29	−0.02	0.27	−0.56	G1_S
A_24_P132019	LNPEP	ENST00000231368	4012	0.21	0.36	0.15	−0.16	G1_S
A_23_P156061	LNPEP	NM_005575	4012	−0.09	−0.07	0.02	0.24	G1_S
A_32_P69475	LNPEP	ENST00000231368	4012	0.03	0.05	0.02	−0.30	G1_S
A_23_P207445	MAP2K6	NM_002758	5608	−2.10	−0.61	1.49	−1.44	G1_S
A_23_P408996	MBOAT1	NM_001080480	154141	−0.45	−0.03	0.42	−0.57	G1_S
A_32_P103633	MCM2	NM_004526	4171	−1.61	−1.56	0.06	−1.32	G1_S
A_23_P132277	MCM5	NM_006739	4174	−1.85	−1.65	0.20	−1.36	G1_S
A_23_P90612	MCM6	NM_005915	4175	−1.27	−1.79	−0.52	0.06	G1_S
A_23_P204782	MDM1	NM_020128	56890	−0.85	−0.55	0.29	−0.15	G1_S
A_23_P413180	MDM1	NM_017440	56890	−0.66	−0.11	0.55	−0.69	G1_S
A_23_P105730	MDM1	NM_020128	56890	−0.14	−0.02	0.12	0.24	G1_S
A_24_P313678	MED31	NM_016060	51003	0.18	0.08	−0.11	0.78	G1_S
A_23_P341443	MNT	NM_020310	4335	0.68	0.66	−0.02	−0.28	G1_S
A_24_P350969	MNT	AF318360	4335	0.08	−0.20	−0.28	0.56	G1_S
A_32_P6015	MNX1	NM_005515	3110	−0.33	−0.42	−0.10	−0.36	G1_S
A_23_P253331	MNX1	NM_005515	3110	−0.07	−0.33	−0.26	0.05	G1_S
A_24_P279797	MRI1	NM_001031727	84245	0.01	0.11	0.10	0.38	G1_S
A_23_P102471	MSH2	NM_000251	4436	−0.38	−0.39	−0.02	−0.28	G1_S
A_23_P34800	NASP	NM_172164	4678	−0.92	−0.57	0.34	−0.26	G1_S
A_32_P28365	NASP	NM_172164	4678	−0.70	−0.46	0.24	−0.15	G1_S
A_24_P926760	NKTR	NM_005385	4820	0.53	0.36	−0.17	0.78	G1_S
A_23_P212002	NKTR	NM_005385	4820	0.38	0.32	−0.06	0.47	G1_S
A_24_P171601	NKTR	NM_005385	4820	0.37	0.20	−0.16	0.83	G1_S
A_23_P203013	NPAT	NM_002519	4863	−0.59	−0.36	0.23	−0.18	G1_S
A_24_P273823	NPAT	NM_002519	4863	−0.22	−0.31	−0.09	0.27	G1_S
A_24_P29641	NSUN5P2	NM_148936	260294	0.05	0.12	0.07	0.46	G1_S
A_23_P161324	NUDT13	NM_015901	25961	−0.39	−0.32	0.07	−0.01	G1_S
A_32_P41471	NUDT13	NM_015901	25961	−0.19	−0.31	−0.11	0.29	G1_S
A_24_P200761	NUP43	NM_198887	348995	−0.37	−0.10	0.27	−0.24	G1_S
A_23_P31055	NUP43	NM_198887	348995	−0.21	0.02	0.22	0.16	G1_S
A_23_P45799	ORC1	NM_004153	4998	−0.91	−0.95	−0.04	−0.48	G1_S
A_24_P371053	ORMDL1	NM_016467	94101	−0.59	−0.20	0.39	−0.10	G1_S
A_23_P120194	ORMDL1	NM_016467	94101	−0.01	0.07	0.08	0.25	G1_S
A_32_P220762	OSBPL6	ENST00000190611	114880	0.10	−0.19	−0.29	0.11	G1_S
A_23_P108823	OSBPL6	NM_032523	114880	0.00	−0.27	−0.28	0.17	G1_S
A_24_P414446	OTULIN	NM_138348	90268	−0.16	−0.55	−0.39	0.09	G1_S
A_23_P353106	OTULIN	NM_138348	90268	0.13	−0.25	−0.38	0.12	G1_S
A_24_P142885	PANK2	ENST00000497424	80025	−0.56	−0.16	0.41	−0.45	G1_S
A_23_P79942	PANK2	NM_153638	80025	−0.12	0.06	0.17	−0.25	G1_S
A_24_P299911	PASK	NM_015148	23178	−0.45	−0.28	0.18	−0.39	G1_S
A_23_P28886	PCNA	NM_002592	5111	−1.10	−0.88	0.22	−0.11	G1_S
A_24_P280029	PDXP	NM_020315	57026	0.09	−0.20	−0.28	0.81	G1_S
A_23_P61180	PLCXD1	NM_018390	55344	0.64	0.69	0.06	0.14	G1_S
A_23_P99582	PNN	NM_002687	5411	0.46	0.30	−0.16	1.13	G1_S
A_32_P182439	POLD3	NM_006591	10714	−0.43	−0.01	0.42	−0.26	G1_S
A_24_P75056	POLD3	NM_006591	10714	−0.26	0.19	0.45	−0.45	G1_S
A_23_P70794	RAB23	NM_016277	51715	−0.48	−0.19	0.29	−0.27	G1_S
A_23_P71558	RECQL4	NM_004260	9401	−1.56	−0.91	0.65	−0.90	G1_S
A_23_P353717	RMI2	NM_152308	116028	−1.49	−1.51	−0.02	−1.39	G1_S
A_23_P258071	RNF113A	NM_006978	7737	0.21	−0.05	−0.26	0.49	G1_S
A_23_P254970	RNPC3	AK057799	55599	−0.24	−0.35	−0.11	0.31	G1_S
A_24_P341504	RNPC3	NM_017619	55599	0.23	0.13	−0.10	0.71	G1_S
A_23_P34396	RSRP1	NM_020317	57035	0.66	0.09	−0.57	0.97	G1_S
A_24_P34155	RUNX1	NM_001122607	861	1.03	0.33	−0.71	0.67	G1_S
A_24_P96403	RUNX1	NM_001001890	861	−0.68	0.18	0.87	−1.35	G1_S
A_23_P16944	SDC1	NM_001006946	6382	−0.69	−0.50	0.19	−1.07	G1_S
A_24_P97129	SDC1	NM_001006946	6382	−0.35	−0.44	−0.08	0.50	G1_S
A_23_P357856	SEC62	NM_003262	7095	−0.56	−0.28	0.28	−0.71	G1_S
A_23_P144224	SEC62	NM_003262	7095	0.54	0.07	−0.47	0.48	G1_S
A_24_P285880	SEC62	NM_003262	7095	−0.35	−0.26	0.10	0.05	G1_S
A_23_P357860	SEC62	NM_003262	7095	−0.52	0.04	0.56	−1.67	G1_S
A_24_P251704	SEC62	NM_003262	7095	−0.05	0.04	0.09	−0.96	G1_S
A_23_P55632	SERPINB3	NM_006919	6317	1.00	1.78	0.78	1.52	G1_S
A_23_P156310	SKP2	NM_032637	6502	−0.38	−0.75	−0.37	0.37	G1_S
A_23_P7101	SLBP	NM_006527	7884	0.21	0.00	−0.21	0.23	G1_S
A_23_P40896	SLC25A36	NM_018155	55186	0.27	−0.15	−0.42	0.91	G1_S
A_23_P408455	SLC25A36	NM_001104647	55186	0.24	−0.37	−0.61	0.85	G1_S
A_24_P136725	SPIN3	NR_027139	169981	−0.07	0.34	0.40	0.01	G1_S
A_24_P494454	SPIN3	NM_001010862	169981	0.01	0.06	0.05	1.15	G1_S
A_32_P222961	SPIN4	NM_001012968	139886	0.33	0.38	0.06	0.30	G1_S
A_24_P467371	SPIN4	NM_001012968	139886	0.29	0.10	−0.19	−0.42	G1_S
A_24_P222911	SRSF7	NM_001031684	6432	−0.81	−0.73	0.08	−0.35	G1_S
A_23_P39704	SRSF7	NM_001031684	6432	−0.58	−0.60	−0.02	−0.01	G1_S
A_23_P155229	SSR3	NM_007107	6747	0.53	−0.06	−0.58	0.94	G1_S
A_24_P319942	SSR3	NM_007107	6747	−0.06	−0.23	−0.18	−0.01	G1_S
A_24_P928068	TAF15	DB509819	NA	0.46	0.45	0.00	0.02	G1_S
A_23_P159305	TAF15	NM_139215	8148	0.11	0.26	0.15	−0.66	G1_S
A_32_P56525	TCAF1	NM_014719	9747	0.28	0.46	0.18	−1.13	G1_S
A_24_P380628	TCAF1	NM_014719	9747	−0.08	0.10	0.18	−0.69	G1_S
A_24_P368023	TCAF1	ENST00000479870	9747	−0.03	0.26	0.29	−1.42	G1_S
A_23_P99930	TIPIN	NM_017858	54962	0.17	−0.46	−0.63	0.86	G1_S
A_23_P157283	TMEM243	NM_024315	79161	0.17	0.30	0.14	−0.37	G1_S
A_23_P159390	TOPBP1	NM_007027	11073	−0.46	−0.26	0.21	−0.01	G1_S
A_23_P31389	TRA2A	NM_013293	29896	−0.67	−0.32	0.34	−0.04	G1_S
A_23_P218879	TREX1	NM_016381	11277	−0.44	−0.10	0.34	−0.38	G1_S
A_24_P339858	TSPEAR-AS2	NR_026547	114043	0.36	0.72	0.36	−0.13	G1_S
A_24_P910854	TTC14	NM_001042601	151613	0.51	0.21	−0.30	−0.10	G1_S
A_23_P212511	TTC14	NM_001042601	151613	−0.10	−0.25	−0.14	0.52	G1_S
A_24_P159094	UBR7	NM_175748	55148	−0.97	−0.65	0.33	−0.45	G1_S
A_23_P205393	UBR7	NM_175748	55148	−0.43	−0.63	−0.21	0.41	G1_S
A_23_P208880	UHRF1	NM_013282	29128	−2.52	−1.75	0.77	−1.77	G1_S
A_32_P101235	UHRF1	NM_013282	29128	−0.47	−0.43	0.04	−0.15	G1_S
A_24_P398585	UNG	NM_003362	7374	−0.28	0.01	0.29	−0.27	G1_S
A_24_P137522	USP53	NM_019050	54532	0.46	0.26	−0.20	0.60	G1_S
A_32_P128701	USP53	NM_019050	54532	0.40	0.15	−0.25	0.38	G1_S
A_23_P115215	VPS72	NM_005997	6944	−0.35	−0.10	0.25	0.01	G1_S
A_23_P129075	WDR76	NM_024908	79968	−0.19	−0.48	−0.29	−0.09	G1_S
A_24_P158385	ZMYND19	NM_138462	116225	−0.29	−0.28	0.01	−0.38	G1_S
A_32_P183218	ZNF367	NM_153695	195828	−1.12	−0.76	0.35	−0.53	G1_S
A_23_P410625	ZNF367	NM_153695	195828	−0.41	−0.50	−0.09	−0.08	G1_S
A_23_P340922	ZNF414	NM_032370	84330	−0.35	0.32	0.68	−0.93	G1_S
A_32_P85978	ZNF414	NM_001146175	84330	0.21	0.26	0.05	−0.48	G1_S
A_23_P85521	ZRANB2	NM_203350	9406	0.36	0.09	−0.27	0.81	G1_S
A_24_P242299	ZRANB2	NM_005455	9406	0.30	0.10	−0.20	0.57	G1_S
A_23_P120784	TRMT2A	NM_022727	27037	−0.61	−0.27	0.34	−0.58	G1_S,G2
A_24_P305662	TRMT2A	NM_022727	27037	−0.33	−0.12	0.21	−0.20	G1_S,G2
A_23_P370989	MCM4	NM_005914	4173	−1.44	−1.07	0.36	−0.90	G1_S,G2_M
A_24_P59596	ATAD2	NM_014109	29028	−1.00	−1.55	−0.55	0.22	G1_S,S
A_23_P216068	ATAD2	NM_014109	29028	−0.82	−0.97	−0.15	−0.21	G1_S,S
A_23_P387943	CASP2	NM_032982	835	−0.26	0.15	0.41	−0.75	G1_S,S
A_24_P269398	CASP2	NM_032982	835	−0.17	0.04	0.21	−0.43	G1_S,S
A_23_P215701	CASP2	NM_032982	835	−0.13	0.18	0.31	−0.40	G1_S,S
A_23_P203645	CREBZF	NM_001039618	58487	0.69	0.06	−0.63	0.90	G1_S,S
A_23_P252740	DSCC1	NM_024094	79075	−1.22	−1.25	−0.04	−0.64	G1_S,S
A_23_P162579	HSPB8	NM_014365	26353	1.38	0.02	−1.35	1.06	G1_S,S
A_23_P170110	NEAT1	AW806882	NA	0.73	0.39	−0.34	1.00	G1_S,S
A_24_P290999	NEAT1	NR_028272	283131	0.77	−0.15	−0.92	1.04	G1_S,S
A_24_P566916	NEAT1	NR_028272	283131	0.38	0.03	−0.34	0.03	G1_S,S
A_23_P160518	TRIM45	NM_025188	80263	−0.40	−0.18	0.22	−0.16	G1_S,S
A_23_P160523	TRIM45	NM_025188	80263	−0.22	−0.20	0.02	−0.47	G1_S,S
A_23_P14543	ALKBH1	NM_006020	8846	0.21	0.05	−0.16	0.40	G2
A_23_P108135	AP3D1	NM_003938	8943	0.58	0.63	0.05	−0.50	G2
A_23_P119526	AP3D1	NM_003938	8943	0.46	0.51	0.05	−0.18	G2
A_24_P30034	ARHGEF39	NM_032818	84904	−0.48	−0.49	−0.01	0.19	G2
A_23_P216517	ARHGEF39	NM_032818	84904	−0.48	−0.91	−0.43	0.45	G2
A_32_P234827	ARMC1	NM_018120	55156	0.00	−0.04	−0.05	0.23	G2
A_23_P415015	ATL2	NM_022374	64225	0.40	0.35	−0.05	0.17	G2
A_23_P209619	ATL2	NM_022374	64225	0.07	0.40	0.33	−0.17	G2
A_23_P130182	AURKB	NM_004217	9212	−1.55	−1.32	0.24	−0.60	G2
A_24_P89512	BCLAF1	NM_014739	9774	−0.94	−0.52	0.43	−0.39	G2
A_24_P80915	BCLAF1	NM_014739	9774	−0.85	−0.89	−0.04	−0.03	G2
A_23_P111343	BCLAF1	NM_014739	9774	−0.56	−0.34	0.22	0.35	G2
A_23_P25626	BORA	NM_024808	79866	−1.02	−0.89	0.12	0.28	G2
A_23_P145016	BRD8	NM_006696	10902	−0.13	0.02	0.15	−0.28	G2
A_23_P81280	BTNL9	NM_152547	153579	0.42	0.29	−0.14	0.18	G2
A_32_P187951	BTNL9	NM_152547	153579	−0.29	−0.38	−0.09	−0.48	G2
A_23_P46924	BUB3	NM_001007793	9184	−0.66	−0.53	0.13	−0.08	G2
A_23_P202316	BUB3	NM_001007793	9184	−0.63	−0.34	0.29	−0.25	G2
A_23_P320658	BUB3	NM_004725	9184	0.20	−0.10	−0.29	0.52	G2
A_24_P413941	C2orf69	NM_153689	205327	−0.24	−0.07	0.17	−0.37	G2
A_23_P142918	C2orf69	NM_153689	205327	0.10	0.06	−0.04	−0.04	G2
A_23_P92410	CASP3	NM_004346	836	−0.51	−0.13	0.38	−0.08	G2
A_24_P664995	CBX5	NM_001127322	23468	−0.34	0.24	0.57	−1.23	G2
A_24_P620621	CBX5	NM_001127322	23468	−0.15	−0.02	0.13	−0.14	G2
A_23_P2355	CBX5	NM_012117	23468	−0.17	−0.29	−0.12	0.49	G2
A_24_P193592	CCNF	NM_001761	899	−0.89	−0.41	0.48	−0.46	G2
A_23_P37954	CCNF	NM_001761	899	−0.74	−0.22	0.52	−0.94	G2
A_23_P88083	CDC16	NM_003903	8881	−0.36	−0.13	0.23	0.02	G2
A_23_P70249	CDC25C	NM_001790	995	−2.28	−1.87	0.41	−0.78	G2
A_23_P385861	CDCA2	NM_152562	157313	−1.95	−1.77	0.18	−0.24	G2
A_24_P323434	CDCA2	NM_152562	157313	−1.36	−1.32	0.04	−0.07	G2
A_23_P375	CDCA8	NM_018101	55143	−2.04	−1.76	0.29	−0.84	G2
A_23_P138507	CDK1	NM_001786	983	−2.95	−2.22	0.73	−0.84	G2
A_24_P282343	CDKL5	NM_003159	6792	0.14	−0.06	−0.20	−0.28	G2
A_24_P81841	CDKN1B	NM_004064	1027	−0.70	−0.55	0.15	−0.73	G2
A_23_P204696	CDKN1B	NM_004064	1027	−0.41	−0.54	−0.13	0.24	G2
A_23_P85460	CDKN2C	NM_078626	1031	−0.61	−1.44	−0.82	−0.04	G2
A_23_P126120	CENPL	NM_033319	91687	−0.75	−0.56	0.19	−0.24	G2
A_24_P930100	CENPL	AK056348	91687	0.01	−0.68	−0.69	0.61	G2
A_23_P201816	CEP350	NM_014810	9857	−0.25	−0.13	0.12	−0.12	G2
A_23_P119562	CFD	NM_001928	1675	−0.36	−0.22	0.13	−0.26	G2
A_23_P109452	CHEK2	NM_001005735	11200	−0.96	−0.67	0.28	0.01	G2
A_23_P250313	CIP2A	NM_020890	57650	−0.85	−0.77	0.08	0.01	G2
A_24_P351466	CIP2A	NM_020890	57650	0.02	−0.40	−0.42	0.14	G2
A_23_P388812	CKAP2L	NM_152515	150468	−2.34	−2.03	0.31	−0.35	G2
A_23_P213745	CXCL14	NM_004887	9547	−2.26	−1.16	1.10	−2.35	G2
A_23_P2181	CYB5R2	NM_016229	51700	0.31	−0.19	−0.49	1.01	G2
A_23_P119377	CYTH2	NM_004228	9266	−0.42	−0.11	0.31	−0.64	G2
A_23_P422268	DCAF7	NM_005828	10238	0.32	0.42	0.10	−0.21	G2
A_24_P916141	DCAF7	NM_005828	10238	−0.20	0.23	0.44	−1.47	G2
A_24_P91222	DCAF7	NM_005828	10238	0.13	0.10	−0.02	−0.15	G2
A_23_P26836	DCAF7	NM_005828	10238	0.10	0.41	0.31	−1.19	G2
A_32_P430743	DET1	AK125793	NA	1.07	0.74	−0.33	0.27	G2
A_23_P26184	DET1	NM_017996	55070	0.04	0.07	0.03	0.09	G2
A_23_P124224	DHX8	NM_004941	1659	0.03	0.04	0.02	0.16	G2
A_23_P119478	EBI3	NM_005755	10148	4.87	4.24	−0.63	4.69	G2
A_24_P370201	EBI3	NM_005755	10148	1.35	0.70	−0.65	1.40	G2
A_23_P117580	ENTPD5	NM_001249	957	0.12	0.09	−0.03	0.16	G2
A_23_P32707	ESPL1	NM_012291	9700	−0.40	−1.11	−0.70	0.46	G2
A_32_P119007	ESPL1	NM_012291	9700	0.48	1.80	1.33	−0.18	G2
A_24_P278637	FADD	NM_003824	8772	−0.41	−0.08	0.33	−0.18	G2
A_23_P86917	FADD	NM_003824	8772	−0.33	0.05	0.37	−0.32	G2
A_23_P386241	FAM110A	NM_001042353	83541	0.01	0.38	0.37	−0.66	G2
A_23_P323751	FAM83D	NM_030919	81610	−1.23	−1.77	−0.54	0.09	G2
A_23_P377888	FAN1	NM_014967	22909	0.24	0.15	−0.09	0.33	G2
A_23_P345678	FANCD2	NM_033084	2177	−0.61	−1.11	−0.50	−0.17	G2
A_32_P24165	FANCD2	NM_001018115	2177	−0.59	−0.68	−0.09	−0.10	G2
A_23_P143994	FANCD2	NM_001018115	2177	−0.59	−0.56	0.03	−0.90	G2
A_23_P142333	FZR1	NM_016263	51343	0.40	0.18	−0.22	0.12	G2
A_23_P142325	FZR1	NM_001136198	51343	0.41	0.05	−0.35	0.11	G2
A_24_P944291	FZR1	ENST00000395095	51343	0.04	0.25	0.21	−0.49	G2
A_24_P318836	FZR1	NM_016263	51343	−0.04	0.02	0.06	−0.53	G2
A_23_P106280	GABPB1	NR_026891	55056	−0.85	−0.42	0.43	−0.95	G2
A_23_P205789	GABPB1	NM_002041	2553	1.27	0.43	−0.84	1.47	G2
A_24_P176255	GABPB1	NM_005254	2553	−0.14	−0.02	0.12	0.16	G2
A_23_P83134	GAS1	NM_002048	2619	0.50	−0.71	−1.21	0.26	G2
A_24_P38895	H2AFX	NM_002105	3014	−1.09	−0.78	0.31	−0.88	G2
A_23_P141965	HAUS8	NM_033417	93323	−0.41	−0.45	−0.04	0.18	G2
A_32_P85500	HCP5	NM_006674	10866	0.72	0.39	−0.32	0.76	G2
A_23_P111126	HCP5	L06175	10866	0.55	0.24	−0.31	0.80	G2
A_24_P17870	HCP5	NM_006674	10866	0.52	0.14	−0.37	0.70	G2
A_24_P238609	HCP5	NM_006674	10866	0.28	0.09	−0.19	0.40	G2
A_23_P145574	HINT3	NM_138571	135114	0.38	0.18	−0.20	0.80	G2
A_24_P681011	HIPK2	NM_022740	28996	0.20	0.72	0.52	−2.31	G2
A_23_P169756	HIPK2	NM_022740	28996	0.20	0.39	0.19	−1.41	G2
A_24_P500621	HIPK2	NM_022740	28996	0.10	0.39	0.29	−1.71	G2
A_23_P169766	HIPK2	NM_022740	28996	−0.02	0.20	0.22	−1.50	G2
A_23_P149301	HIST3H2A	NM_033445	92815	0.15	0.07	−0.08	0.79	G2
A_24_P257099	HJURP	NM_018410	55355	−2.18	−1.32	0.86	−1.01	G2
A_23_P155765	HMGB2	NM_002129	3148	−0.77	−2.05	−1.29	0.90	G2
A_23_P88303	HSPA2	NM_021979	3306	1.00	0.29	−0.71	0.23	G2
A_23_P17633	IFNAR1	NM_000629	3454	0.54	0.11	−0.43	0.40	G2
A_23_P113803	KATNA1	NM_007044	11104	0.17	−0.33	−0.50	0.62	G2
A_23_P77286	KATNBL1	NM_024713	79768	−0.55	−0.37	0.18	−0.19	G2
A_32_P58163	KATNBL1	NM_024713	79768	−0.34	−0.15	0.20	−0.11	G2
A_24_P12539	KBTBD2	NM_015483	25948	0.20	−0.15	−0.35	0.37	G2
A_23_P70951	KBTBD2	NM_015483	25948	0.06	0.00	−0.07	0.06	G2
A_23_P74446	KDM4A	NM_014663	9682	−0.20	0.07	0.27	−0.48	G2
A_24_P227091	KIF11	NM_004523	3832	−2.63	−1.71	0.93	−1.86	G2
A_23_P52278	KIF11	NM_004523	3832	−1.24	−0.93	0.31	−0.76	G2
A_23_P54622	KIF22	NM_007317	3835	−1.46	−1.13	0.33	−0.79	G2
A_23_P133956	KIFC1	NM_002263	3833	−2.20	−1.79	0.41	−1.11	G2
A_24_P252739	KLF6	NM_001300	1316	−1.45	−1.02	0.43	−0.96	G2
A_24_P932981	KLF6	NM_001300	1316	0.59	−0.18	−0.77	−0.30	G2
A_24_P69654	KLF6	NM_001300	1316	0.81	−0.29	−1.10	0.00	G2
A_23_P63798	KLF6	NM_001300	1316	0.57	−0.29	−0.86	−0.26	G2
A_23_P125265	KPNA2	NM_002266	3838	−1.25	−0.63	0.62	−0.25	G2
A_23_P342744	LIX1L	NM_153713	128077	0.56	0.04	−0.52	0.40	G2
A_24_P687594	LIX1L	ENST00000369308	128077	0.30	−0.02	−0.31	−0.45	G2
A_23_P258493	LMNB1	NM_005573	4001	−1.90	−1.59	0.31	−1.26	G2
A_24_P264790	LTBP3	NM_021070	4054	−0.85	−0.57	0.28	−0.36	G2
A_24_P298360	LTBP3	NM_021070	4054	0.36	−0.16	−0.51	−0.64	G2
A_23_P92441	MAD2L1	NM_002358	4085	−1.86	−1.58	0.28	−0.36	G2
A_24_P873659	MALAT1	NR_002819	378938	0.29	−0.40	−0.69	1.76	G2
A_23_P21143	MALAT1	NR_002819	378938	−0.19	−0.44	−0.25	0.80	G2
A_24_P829261	MALAT1	NR_002819	378938	0.11	0.03	−0.08	0.27	G2
A_24_P497244	MALAT1	NR_002819	378938	0.07	−0.32	−0.40	1.05	G2
A_23_P94422	MELK	NM_014791	9833	−3.11	−2.07	1.04	−1.29	G2
A_23_P42626	MEPCE	NM_019606	56257	−0.18	0.15	0.32	−0.74	G2
A_24_P312189	MEPCE	NM_019606	56257	−0.16	0.24	0.40	−0.71	G2
A_23_P145844	MET	NM_000245	4233	0.51	0.41	−0.10	0.86	G2
A_23_P145846	MET	NM_000245	4233	0.27	0.27	0.00	0.71	G2
A_23_P359245	MET	NM_000245	4233	0.22	0.30	0.08	0.11	G2
A_23_P65558	MGAT2	NM_002408	4247	−0.19	−0.39	−0.20	1.27	G2
A_32_P128656	MID1	NM_000381	4281	−0.31	0.14	0.46	−0.59	G2
A_23_P170037	MID1	NM_033290	4281	−0.01	0.50	0.50	−0.87	G2
A_23_P133123	MND1	NM_032117	84057	−2.67	−2.06	0.61	−1.08	G2
A_23_P360605	MTCL1	NM_015210	23255	−1.12	−0.38	0.74	−1.41	G2
A_23_P137856	MUC1	NM_002456	4582	−0.29	0.17	0.46	−1.61	G2
A_32_P71447	NCAPD3	NM_015261	23310	−0.92	−0.59	0.32	−0.53	G2
A_23_P415443	NCAPH	NM_015341	23397	−2.82	−2.15	0.67	−1.02	G2
A_23_P50108	NDC80	NM_006101	10403	−3.12	−2.49	0.64	−0.69	G2
A_24_P14156	NDC80	NM_006101	10403	−1.90	−1.59	0.31	−0.41	G2
A_23_P155711	NEIL3	NM_018248	55247	−0.52	−0.51	0.02	0.19	G2
A_24_P356830	NFIC	AK129956	4782	0.20	0.15	−0.06	−0.83	G2
A_23_P131115	NFIC	NM_005597	4782	−0.18	0.31	0.49	−0.92	G2
A_24_P180383	NIPBL	NM_015384	25836	−0.12	0.22	0.33	−0.46	G2
A_23_P213883	NIPBL	NM_133433	25836	0.09	−0.04	−0.13	−0.15	G2
A_24_P357688	NIPBL	NM_015384	25836	0.10	−0.05	−0.16	0.70	G2
A_24_P213161	NLRP2	NM_017852	55655	−0.78	−0.17	0.61	−1.33	G2
A_23_P88522	NMB	NM_021077	4828	1.35	0.91	−0.44	2.12	G2
A_23_P127584	NNMT	NM_006169	4837	−0.01	0.25	0.27	−0.30	G2
A_24_P787914	NR3C1	U25029	2908	1.13	0.58	−0.55	1.02	G2
A_23_P214059	NR3C1	NM_001018077	2908	0.83	0.19	−0.64	0.56	G2
A_24_P214754	NR3C1	NM_001018077	2908	0.80	0.04	−0.76	1.23	G2
A_24_P216968	NUCKS1	NM_022731	64710	−0.40	−0.39	0.01	−0.04	G2
A_24_P145122	NUCKS1	NM_022731	64710	−0.35	−0.36	−0.01	−0.07	G2
A_24_P216964	NUCKS1	NM_022731	64710	−0.23	−0.48	−0.25	−0.15	G2
A_24_P374652	NUCKS1	NM_022731	64710	0.09	−0.04	−0.14	0.21	G2
A_23_P149724	NUCKS1	NM_022731	64710	−0.02	−0.24	−0.22	0.07	G2
A_23_P162120	NUMA1	NM_006185	4926	0.11	0.39	0.28	−0.38	G2
A_23_P17471	PCED1A	NM_022760	64773	−0.13	−0.27	−0.14	0.08	G2
A_23_P416468	PIF1	NM_025049	80119	−2.16	−1.63	0.53	−0.08	G2
A_23_P323749	PIF1	NM_025049	80119	−0.37	0.19	0.56	−0.14	G2
A_23_P323743	PIF1	NM_025049	80119	−0.19	−0.27	−0.08	0.04	G2
A_24_P196534	PKNOX1	NM_004571	5316	0.32	0.19	−0.14	0.10	G2
A_23_P211299	PKNOX1	NM_004571	5316	0.20	0.25	0.05	0.49	G2
A_24_P378907	PKNOX1	NM_004571	5316	−0.23	0.25	0.48	−0.15	G2
A_23_P333998	POLQ	AF090919	10721	−1.90	−1.42	0.48	−1.15	G2
A_23_P218827	POLQ	NM_199420	10721	−2.19	−1.69	0.49	−1.00	G2
A_24_P63109	PPP1R2	NM_006241	5504	0.30	−0.18	−0.48	0.89	G2
A_32_P17133	PPP1R2	NM_006241	5504	0.11	−0.21	−0.31	0.63	G2
A_24_P174367	PPP1R2	NM_006241	5504	−0.06	−0.17	−0.11	0.34	G2
A_23_P46539	PSRC1	NM_032636	84722	−0.92	−0.66	0.26	−0.48	G2
A_23_P106439	RCCD1	NM_033544	91433	−0.52	−0.10	0.41	−0.66	G2
A_23_P106433	RCCD1	NM_033544	91433	−0.23	−0.05	0.17	−0.62	G2
A_23_P25684	RDH11	NM_016026	51109	−0.39	−0.19	0.20	−0.56	G2
A_24_P377775	RGS3	NM_017790	5998	0.85	0.37	−0.48	0.24	G2
A_23_P219197	RGS3	NM_134427	5998	−0.03	−0.04	−0.01	−0.43	G2
A_23_P134714	RIDA	NM_005836	10247	−0.54	−0.12	0.42	−0.41	G2
A_23_P121602	SAP30	NM_003864	8819	−0.39	−0.22	0.16	0.11	G2
A_23_P147647	SGCD	NM_000337	6444	0.23	−0.19	−0.41	0.51	G2
A_23_P136254	SGCD	NM_172244	6444	0.17	0.37	0.20	−0.63	G2
A_32_P4595	SGCD	NM_000337	6444	0.05	−0.38	−0.43	0.33	G2
A_23_P340909	SKA3	BC013418	221150	−3.76	−2.71	1.05	−1.64	G2
A_23_P327643	SMC4	A_23_P327643	NA	0.61	0.07	−0.53	0.40	G2
A_23_P91900	SMC4	NM_005496	10051	−0.46	−0.37	0.09	−0.62	G2
A_23_P87049	SORL1	NM_003105	6653	0.07	0.31	0.24	−0.86	G2
A_23_P56630	STAT1	NM_007315	6772	0.35	0.58	0.23	−0.36	G2
A_24_P274270	STAT1	NM_139266	6772	0.16	0.43	0.28	−0.09	G2
A_24_P214231	STIL	NM_001048166	6491	−0.73	0.04	0.78	−0.96	G2
A_23_P154367	STK17B	NM_004226	9262	−0.33	−0.57	−0.24	0.27	G2
A_24_P636882	STK17B	NM_004226	9262	−0.30	0.07	0.37	−0.78	G2
A_23_P100022	SV2B	NM_014848	9899	−0.25	0.02	0.27	0.33	G2
A_23_P431381	TEDC1	NM_001134875	283643	−0.52	−0.16	0.37	−0.24	G2
A_32_P14187	TFAP2A	NM_001032280	7020	0.71	0.16	−0.56	0.26	G2
A_23_P62115	TIMP1	NM_003254	7076	0.09	0.06	−0.03	0.27	G2
A_23_P24716	TMEM132A	NM_017870	54972	0.30	0.29	0.00	−0.74	G2
A_24_P210244	TMPO	NM_001032283	7112	−0.85	−0.65	0.20	0.42	G2
A_23_P325040	TMPO	NM_003276	7112	−0.33	−0.59	−0.26	−0.17	G2
A_24_P44891	TNPO2	NM_013433	30000	0.63	0.13	−0.50	1.02	G2
A_23_P354953	TNPO2	NM_013433	30000	−0.43	0.05	0.48	−0.11	G2
A_23_P170491	TRAIP	NM_005879	10293	−0.48	−0.61	−0.12	0.31	G2
A_23_P407718	TRIM59	NM_173084	286827	−0.89	−0.76	0.13	−0.13	G2
A_32_P72341	TRIM59	NM_173084	286827	−0.44	−0.58	−0.14	0.05	G2
A_23_P48826	TRIM69	NM_182985	140691	0.42	0.05	−0.38	0.44	G2
A_24_P50543	TRIM69	A_24_P50543	NA	−0.04	−0.01	0.03	0.21	G2
A_23_P254193	TTC38	NM_017931	55020	−0.45	0.19	0.64	−0.76	G2
A_24_P156388	TTC38	NM_017931	55020	−0.35	0.01	0.36	−0.53	G2
A_32_P168388	TTF2	AK123765	8458	−0.21	−0.18	0.03	−0.40	G2
A_23_P97161	TTF2	NM_003594	8458	0.23	−0.05	−0.28	0.25	G2
A_23_P139547	TUBA1A	NM_006009	7846	−0.34	−0.17	0.17	0.19	G2
A_23_P128598	TUBA3C	NM_006001	7278	0.22	0.66	0.44	−0.22	G2
A_23_P154065	TUBA4A	NM_006000	7277	0.66	0.48	−0.18	0.76	G2
A_23_P102109	TUBA4A	NM_006000	7277	0.56	0.48	−0.09	0.81	G2
A_23_P154070	TUBA4A	NM_006000	7277	−0.45	−0.15	0.30	0.06	G2
A_23_P84448	TUBA4A	NM_006000	7277	0.22	0.14	−0.08	0.52	G2
A_23_P387057	TUBB	NM_178014	203068	−0.46	−0.41	0.05	0.07	G2
A_23_P81912	TUBB	NM_178014	203068	−0.37	−0.37	0.00	0.25	G2
A_32_P78528	TUBB	NM_178014	203068	−0.28	−0.16	0.12	0.07	G2
A_23_P19291	TUBB2A	NM_001069	7280	1.18	−0.07	−1.25	0.79	G2
A_23_P501276	TUBB2A	NM_001069	7280	0.42	−0.32	−0.74	0.72	G2
A_23_P26895	TUBD1	NM_016261	51174	−0.02	0.13	0.15	0.14	G2
A_23_P423480	TYSND1	NM_173555	219743	−0.21	−0.16	0.05	0.11	G2
A_24_P290585	UACA	NM_001008224	55075	0.28	0.01	−0.27	1.38	G2
A_23_P360340	UACA	NM_001008224	55075	0.10	−0.23	−0.33	0.55	G2
A_24_P90774	UACA	NM_001008224	55075	0.03	0.11	0.07	−0.41	G2
A_24_P297539	UBE2C	NM_181803	11065	−2.93	−2.50	0.43	−0.57	G2
A_23_P11936	UBXN11	NM_183008	91544	−0.32	−0.37	−0.06	−0.35	G2
A_24_P239811	UBXN11	NM_183008	91544	−0.03	0.00	0.03	0.00	G2
A_23_P428298	UNC5CL	NM_173561	222643	0.48	0.40	−0.08	−0.09	G2
A_23_P66599	VPS25	NM_032353	84313	−0.33	−0.20	0.13	0.02	G2
A_24_P294982	VTA1	NM_016485	51534	−0.42	−0.42	0.00	0.18	G2
A_23_P42368	VTA1	NM_016485	51534	−0.36	−0.20	0.16	−0.24	G2
A_23_P393766	WDR62	NM_173636	284403	0.15	−0.21	−0.36	0.47	G2
A_23_P339705	WDR62	NM_173636	284403	−0.02	−0.17	−0.15	−0.03	G2
A_23_P101281	ZNF587	NM_032828	84914	−0.17	−0.06	0.11	0.19	G2
A_24_P313804	ZNF587	NM_032828	84914	−0.19	−0.14	0.05	0.74	G2
A_24_P373726	ZNF587	NM_032828	84914	−0.01	−0.30	−0.28	0.42	G2
A_23_P329286	ZNHIT2	NM_014205	741	−0.25	−0.03	0.22	−0.41	G2
A_23_P356684	ANLN	NM_018685	54443	−2.41	−2.24	0.17	−0.42	G2,G2_M
A_23_P334845	ARHGAP19	NM_032900	84986	0.51	0.47	−0.04	0.34	G2,G2_M
A_23_P1387	ARHGAP19	NM_032900	84986	0.00	−0.49	−0.49	0.70	G2,G2_M
A_24_P19337	ASXL1	NM_015338	171023	0.61	0.34	−0.26	0.39	G2,G2_M
A_32_P41021	ASXL1	NM_015338	171023	−0.32	0.00	0.32	−0.65	G2,G2_M
A_23_P58321	CCNA2	NM_001237	890	−2.44	−1.76	0.69	−0.71	G2,G2_M
A_24_P218979	CDCA3	NM_031299	83461	−2.19	−2.02	0.17	−0.56	G2,G2_M
A_23_P162476	CDCA3	NM_031299	83461	−1.69	−1.43	0.27	−0.36	G2,G2_M
A_23_P209394	CFLAR	NM_001127184	8837	1.55	0.95	−0.60	2.06	G2,G2_M
A_24_P120115	CFLAR	NM_003879	8837	0.65	0.80	0.15	0.12	G2,G2_M
A_23_P151405	CKAP2	NM_018204	26586	−1.71	−0.85	0.87	−0.82	G2,G2_M
A_24_P99090	CKAP2	NM_018204	26586	−0.17	−0.05	0.12	0.04	G2,G2_M
A_23_P90062	DNAJB1	NM_006145	3337	1.18	0.26	−0.92	0.32	G2,G2_M
A_24_P941759	G2E3	NM_017769	55632	−0.44	−0.47	−0.04	−0.04	G2,G2_M
A_23_P99604	G2E3	NM_017769	55632	0.22	−0.14	−0.36	0.64	G2,G2_M
A_32_P189204	GAS2L3	NM_174942	283431	−0.76	−0.63	0.13	0.22	G2,G2_M
A_32_P37143	GAS2L3	BX649059	283431	−0.46	−0.60	−0.14	0.25	G2,G2_M
A_24_P944616	HP1BP3	NM_016287	50809	−0.33	−0.08	0.25	−0.95	G2,G2_M
A_23_P137630	HP1BP3	NM_016287	50809	−0.28	−0.26	0.02	0.52	G2,G2_M
A_24_P247660	JPT1	NM_001002033	51155	−0.50	−0.45	0.05	−0.64	G2,G2_M
A_23_P100632	JPT1	NM_001002033	51155	−0.11	0.22	0.33	−0.42	G2,G2_M
A_23_P75071	KIF20B	NM_016195	9585	−1.72	−1.70	0.02	−0.31	G2,G2_M
A_23_P86403	KIF5B	NM_004521	3799	0.08	−0.01	−0.09	−0.13	G2,G2_M
A_23_P200493	LBR	NM_002296	3930	−0.26	−0.23	0.03	0.20	G2,G2_M
A_23_P106162	MIS18BP1	NM_018353	55320	−0.89	−0.34	0.55	−0.14	G2,G2_M
A_23_P364107	MIS18BP1	NM_018353	55320	−1.10	−0.59	0.52	−0.69	G2,G2_M
A_23_P315843	NCOA5	NM_020967	57727	−0.63	0.19	0.82	−1.05	G2,G2_M
A_23_P210515	NCOA5	NM_020967	57727	−0.66	0.45	1.12	−1.46	G2,G2_M
A_24_P416079	NUSAP1	NM_016359	51203	−2.70	−2.01	0.69	−0.98	G2,G2_M
A_23_P333420	RANGAP1	NM_002883	5905	0.07	−0.20	−0.27	0.29	G2,G2_M
A_23_P139066	RNF141	NM_016422	50862	0.39	−0.13	−0.53	0.95	G2,G2_M
A_24_P372625	RNF141	NM_016422	50862	0.06	−0.02	−0.08	0.14	G2,G2_M
A_23_P100788	STAT5B	NM_012448	6777	0.68	0.33	−0.34	0.33	G2,G2_M
A_24_P342178	STAT5B	BC020868	6777	0.33	0.08	−0.25	0.46	G2,G2_M
A_32_P187327	TUBB4B	NM_006088	10383	−0.26	0.35	0.60	−0.76	G2,G2_M
A_23_P312863	TUBB4B	NM_006088	10383	−0.21	0.32	0.53	−0.67	G2,G2_M
A_23_P4353	WSB1	NM_015626	26118	1.02	−0.01	−1.03	1.36	G2,G2_M
A_23_P214756	ADGRG6	NM_198569	57211	0.15	0.08	−0.07	0.85	G2,S
A_24_P942945	ADGRG6	NM_020455	57211	−0.14	−0.28	−0.14	−0.14	G2,S
A_24_P411749	ADGRG6	NM_020455	57211	−0.01	−0.21	−0.21	0.28	G2,S
A_23_P118834	TOP2A	NM_001067	7153	−3.63	−2.61	1.02	−1.33	G2,S
A_23_P502314	ADGRE5	NM_078481	976	−0.13	0.18	0.32	−0.67	G2_M
A_23_P502312	ADGRE5	NM_078481	976	0.02	0.39	0.37	−0.76	G2_M
A_23_P30098	ADH4	NM_000670	127	−0.24	0.51	0.75	0.10	G2_M
A_23_P27688	ADM5	NM_001101340	199800	−0.26	−0.26	0.00	0.09	G2_M
A_23_P436353	AFDN	NM_001040001	4301	0.39	0.35	−0.04	−0.39	G2_M
A_23_P256603	AFDN	NM_005936	4301	0.11	−0.83	−0.93	0.75	G2_M
A_24_P943484	AHI1	NM_017651	54806	0.27	0.29	0.01	0.72	G2_M
A_24_P213710	AHI1	NM_017651	54806	−0.24	0.10	0.34	0.06	G2_M
A_24_P38143	AHI1	NM_017651	54806	−0.19	0.11	0.30	0.14	G2_M
A_23_P70746	AHI1	NM_017651	54806	0.07	0.27	0.19	0.16	G2_M
A_23_P428819	AKIRIN2	NM_018064	55122	0.39	0.20	−0.19	−0.07	G2_M
A_23_P428827	AKIRIN2	NM_018064	55122	0.11	−0.07	−0.18	−0.37	G2_M
A_23_P20615	ANP32B	NM_006401	10541	0.43	0.07	−0.36	0.24	G2_M
A_24_P225468	ANP32E	NM_030920	81611	−0.32	−0.68	−0.37	0.30	G2_M
A_23_P160934	ANP32E	NM_030920	81611	0.01	−0.39	−0.41	0.90	G2_M
A_23_P151075	ARHGDIB	NM_001175	397	−0.28	0.41	0.69	0.07	G2_M
A_24_P356218	ARL6IP1	NM_015161	23204	−0.14	−0.27	−0.13	0.08	G2_M
A_23_P118150	ARL6IP1	NM_015161	23204	−0.29	−0.32	−0.03	1.16	G2_M
A_23_P91640	ASPHD2	NM_020437	57168	−0.55	0.19	0.74	−1.23	G2_M
A_24_P245815	ASPHD2	NM_020437	57168	−0.29	0.33	0.62	−1.00	G2_M
A_23_P112950	ATF7IP	NM_018179	55729	0.17	0.54	0.37	−0.51	G2_M
A_24_P923757	ATF7IP	NM_018179	55729	0.26	0.26	0.00	0.25	G2_M
A_23_P48278	ATF7IP	AK001001	55729	−0.01	0.81	0.82	−0.13	G2_M
A_23_P163814	ATXN1L	NM_001137675	342371	0.09	−0.31	−0.40	0.20	G2_M
A_23_P131866	AURKA	NM_198433	6790	−1.56	−1.01	0.56	0.03	G2_M
A_24_P103803	B4GALT1	NM_001497	2683	0.90	0.68	−0.22	−0.45	G2_M
A_23_P135271	B4GALT1	NM_001497	2683	0.49	0.22	−0.27	−0.06	G2_M
A_24_P115774	BIRC2	NM_001166	329	−0.12	−0.28	−0.16	0.32	G2_M
A_23_P118815	BIRC5	NM_001012271	332	−3.41	−2.33	1.08	−1.52	G2_M
A_23_P143331	BMP2	NM_001200	650	1.44	0.57	−0.87	0.93	G2_M
A_23_P124417	BUB1	NM_004336	699	−3.26	−2.47	0.79	−0.75	G2_M
A_23_P163481	BUB1B	NM_001211	701	−3.08	−2.32	0.76	−1.02	G2_M
A_23_P92928	C6	NM_000065	729	−0.19	−0.33	−0.14	−0.46	G2_M
A_23_P28664	CCDC88A	NM_018084	55704	0.71	0.22	−0.49	0.70	G2_M
A_24_P20120	CCDC88A	NM_018084	55704	0.52	0.40	−0.12	0.49	G2_M
A_23_P17269	CCDC88A	NM_018084	55704	0.36	−0.01	−0.37	0.82	G2_M
A_24_P28739	CCDC88A	NM_018084	55704	0.32	−0.17	−0.49	0.41	G2_M
A_23_P122197	CCNB1	NM_031966	891	−2.14	−1.49	0.65	−0.27	G2_M
A_23_P65757	CCNB2	NM_004701	9133	−3.05	−2.42	0.64	−0.70	G2_M
A_32_P72822	CCNB2	AK023404	9133	0.52	0.74	0.22	0.59	G2_M
A_23_P202837	CCND1	NM_053056	595	−0.15	−0.20	−0.05	−0.10	G2_M
A_24_P124550	CCND1	NM_053056	595	−0.03	−0.15	−0.12	−0.75	G2_M
A_24_P193011	CCND1	NM_053056	595	−0.02	0.09	0.11	−1.15	G2_M
A_23_P366908	CCSAP	NM_145257	126731	0.38	−0.19	−0.57	0.18	G2_M
A_24_P930764	CCSAP	BC039241	126731	0.40	−0.35	−0.75	0.71	G2_M
A_32_P83776	CCSAP	NM_145257	126731	0.42	0.13	−0.29	−1.01	G2_M
A_23_P149200	CDC20	NM_001255	991	−1.36	−1.65	−0.28	0.10	G2_M
A_23_P210726	CDC25B	NM_021873	994	−0.75	−0.03	0.72	−0.74	G2_M
A_23_P66777	CDC27	NM_001256	996	0.05	0.25	0.20	0.28	G2_M
A_23_P166453	CDC42EP1	NM_152243	11135	−0.06	0.25	0.31	−0.98	G2_M
A_24_P143032	CDC42EP1	NM_152243	11135	0.06	0.25	0.19	−0.63	G2_M
A_23_P89941	CDKN2D	NM_001800	1032	0.50	−0.51	−1.01	0.79	G2_M
A_24_P413884	CENPA	NM_001809	1058	−2.99	−2.34	0.65	−1.30	G2_M
A_23_P253524	CENPE	NM_001813	1062	−2.90	−1.84	1.06	−1.03	G2_M
A_23_P401	CENPF	NM_016343	1063	−3.83	−2.46	1.37	−1.17	G2_M
A_24_P96780	CENPF	NM_016343	1063	−1.58	−0.86	0.72	−0.66	G2_M
A_23_P115872	CEP55	NM_018131	55165	−2.96	−2.26	0.71	−0.74	G2_M
A_23_P420551	CIT	NM_007174	11113	−2.31	−1.43	0.88	−1.92	G2_M
A_23_P135977	CKAP5	NM_001008938	9793	−0.65	−0.56	0.09	−0.09	G2_M
A_24_P300841	CKAP5	NM_001008938	9793	−0.27	−0.13	0.14	−0.11	G2_M
A_23_P45917	CKS1B	NM_001826	1163	−0.90	−1.00	−0.10	0.48	G2_M
A_32_P206698	CKS1B	NM_001826	1163	−0.79	−0.88	−0.08	0.51	G2_M
A_32_P192430	CKS1B	NM_001826	1163	−0.52	−0.67	−0.15	0.44	G2_M
A_23_P71727	CKS2	NM_001827	1164	−0.85	−1.06	−0.21	0.78	G2_M
A_23_P16673	CNN2	NM_004368	1265	0.34	0.36	0.01	−0.98	G2_M
A_24_P142743	CNN2	NM_004368	1265	0.15	0.29	0.14	0.07	G2_M
A_23_P9768	CNTROB	NM_053051	116840	−0.07	−0.01	0.06	0.00	G2_M
A_23_P9761	CNTROB	NM_001037144	116840	−0.02	0.10	0.12	−0.45	G2_M
A_23_P404606	CREBRF	NM_153607	153222	0.59	−0.30	−0.88	1.08	G2_M
A_23_P134835	CSGALNACT1	NM_018371	55790	1.04	0.75	−0.29	1.04	G2_M
A_24_P406525	CSGALNACT1	NM_018371	55790	0.10	0.31	0.21	0.25	G2_M
A_23_P58647	CTNNA1	NM_001903	1495	0.06	0.36	0.30	−0.44	G2_M
A_24_P80633	CTNNA1	NM_001903	1495	0.03	0.05	0.02	−0.27	G2_M
A_24_P881527	CTNND1	NM_001085458	1500	−0.14	0.09	0.23	−0.46	G2_M
A_23_P95080	CTNND1	NM_001085461	1500	0.13	−0.15	−0.28	0.76	G2_M
A_23_P251316	CTNND1	NM_001331	1500	−0.12	−0.21	−0.09	−0.15	G2_M
A_24_P38930	CTNND1	NM_001331	1500	0.07	−0.03	−0.10	−0.22	G2_M
A_23_P200310	DEPDC1	NM_017779	55635	−2.48	−2.08	0.40	−0.16	G2_M
A_24_P25872	DEPDC1	NM_017779	55635	−1.13	−1.41	−0.28	−0.32	G2_M
A_23_P361419	DEPDC1B	NM_018369	55789	−1.89	−1.25	0.63	−0.44	G2_M
A_23_P88331	DLGAP5	NM_014750	9787	−3.42	−2.36	1.06	−1.16	G2_M
A_24_P9671	DNAJA1	NM_001539	3301	0.95	0.69	−0.26	1.02	G2_M
A_24_P192586	DNAJA1	ENST00000330899	3301	−0.49	−0.02	0.47	0.14	G2_M
A_23_P60479	DNAJA1	NM_001539	3301	0.31	0.26	−0.05	0.90	G2_M
A_23_P63205	DR1	NM_001938	1810	0.30	−0.06	−0.36	0.37	G2_M
A_23_P391725	DR1	NM_001938	1810	0.13	0.16	0.03	0.01	G2_M
A_23_P134935	DUSP4	NM_001394	1846	−0.31	−0.20	0.12	−0.96	G2_M
A_23_P144165	DZIP3	NM_014648	9666	0.64	0.09	−0.55	0.75	G2_M
A_24_P102504	DZIP3	NM_014648	9666	−0.14	−0.30	−0.16	0.24	G2_M
A_23_P435051	DZIP3	ENST00000463306	9666	0.06	−0.22	−0.28	0.25	G2_M
A_23_P31721	E2F5	NM_001951	1875	−0.48	−0.02	0.46	−0.36	G2_M
A_23_P9574	ECT2	NM_018098	1894	−0.96	−0.37	0.59	0.16	G2_M
A_23_P44684	ECT2	NM_018098	1894	−1.09	−0.50	0.59	−0.44	G2_M
A_24_P366033	ECT2	NM_018098	1894	−0.29	−0.31	−0.02	0.38	G2_M
A_24_P282251	FGA	NM_021871	2243	0.26	−0.16	−0.42	−0.04	G2_M
A_23_P44274	FGA	NM_000508	2243	−0.08	0.01	0.09	0.24	G2_M
A_23_P375372	FGA	NM_021871	2243	0.07	0.62	0.55	−0.54	G2_M
A_23_P151150	FOXM1	NM_202002	2305	−1.27	−1.19	0.07	−1.05	G2_M
A_23_P363778	FRZB	NM_001463	2487	1.24	0.54	−0.70	1.02	G2_M
A_23_P10902	FRZB	NM_001463	2487	0.95	0.41	−0.54	0.75	G2_M
A_23_P502142	FYN	NM_002037	2534	−0.54	−0.35	0.20	−1.32	G2_M
A_23_P23221	GADD45A	NM_001924	1647	0.64	0.07	−0.58	−0.01	G2_M
A_23_P146922	GAS6	NM_000820	2621	0.18	0.16	−0.02	−0.78	G2_M
A_23_P105251	GLI1	NM_005269	2735	0.06	0.17	0.12	−0.31	G2_M
A_23_P63825	GOT1	NM_002079	2805	0.29	0.53	0.24	0.44	G2_M
A_24_P81473	GOT1	NM_002079	2805	0.20	0.18	−0.01	0.64	G2_M
A_23_P63402	GPSM2	NM_013296	29899	−1.24	−0.96	0.28	−0.28	G2_M
A_24_P273132	GPSM2	NM_013296	29899	−0.47	−0.69	−0.23	−0.02	G2_M
A_23_P257256	GRK6	NM_002082	2870	−0.18	0.03	0.21	−0.53	G2_M
A_23_P152420	GSE1	NM_014615	23199	0.19	0.03	−0.16	−0.38	G2_M
A_24_P943062	GSE1	NM_014615	23199	−0.11	0.18	0.29	−1.06	G2_M
A_23_P57588	GTSE1	NM_016426	51512	−2.01	−1.57	0.43	−0.89	G2_M
A_23_P125771	HCFC1	NM_005334	3054	−0.26	0.18	0.45	−1.13	G2_M
A_23_P168490	HERPUD2	NM_022373	64224	0.03	0.00	−0.03	−0.02	G2_M
A_23_P119543	HMG20B	NM_006339	10362	−0.82	−0.34	0.48	−0.54	G2_M
A_23_P217236	HMGB3	NM_005342	3149	−0.75	−0.79	−0.04	−0.06	G2_M
A_23_P70007	HMMR	NM_012484	3161	−3.37	−2.64	0.73	−0.46	G2_M
A_23_P109442	HPS4	NM_022081	89781	0.72	0.36	−0.36	−0.05	G2_M
A_23_P109446	HPS4	NM_022081	89781	0.58	0.44	−0.14	−0.34	G2_M
A_23_P17606	HSPA13	NM_006948	6782	1.40	0.56	−0.85	2.40	G2_M
A_24_P134392	HSPA13	NM_006948	6782	0.30	−0.05	−0.35	0.52	G2_M
A_23_P70547	HSPA1L	NM_005527	3305	1.11	0.14	−0.96	0.90	G2_M
A_32_P13728	HSPA8	NM_006597	3312	0.36	0.40	0.03	0.34	G2_M
A_24_P295745	HSPA8	NM_153201	3312	0.13	0.12	−0.01	0.78	G2_M
A_24_P287129	HSPA8	NM_006597	3312	0.05	0.06	0.02	0.10	G2_M
A_23_P24594	HSPA8	NM_006597	3312	0.03	0.12	0.09	0.17	G2_M
A_23_P410600	IDI2	NM_033261	91734	0.14	−0.01	−0.16	−0.21	G2_M
A_23_P112026	IDO1	NM_002164	3620	0.69	0.85	0.16	0.41	G2_M
A_23_P55076	INPP5K	NM_130766	51763	0.47	0.28	−0.19	−0.09	G2_M
A_24_P279328	INPP5K	NM_130766	51763	−0.09	−0.12	−0.02	−0.42	G2_M
A_23_P109184	INSM1	NM_002196	3642	1.19	0.87	−0.32	−0.25	G2_M
A_24_P31676	INSM1	NM_002196	3642	−0.05	0.13	0.17	−0.08	G2_M
A_23_P92042	ITPR1	NM_002222	3708	0.17	0.24	0.07	−0.72	G2_M
A_23_P156198	JADE2	NM_015288	23338	1.15	0.18	−0.97	0.77	G2_M
A_24_P226278	JADE2	NM_015288	23338	0.53	−0.07	−0.60	0.28	G2_M
A_23_P416434	JADE2	NM_015288	23338	−0.17	0.47	0.64	−0.91	G2_M
A_24_P927883	JADE2	A_24_P927883	NA	−0.02	0.29	0.31	−0.10	G2_M
A_24_P324011	KCTD2	NM_015353	23510	−0.20	−0.03	0.17	−0.55	G2_M
A_32_P160693	KCTD2	NM_015353	23510	−0.02	−0.13	−0.11	−0.13	G2_M
A_23_P149668	KIF14	NM_014875	9928	−0.68	−0.91	−0.23	−0.16	G2_M
A_23_P34788	KIF2C	NM_006845	11004	−3.33	−2.53	0.80	−0.82	G2_M
A_23_P415401	KLF9	NM_001206	687	0.04	−0.15	−0.20	−0.41	G2_M
A_23_P86100	KLHDC9	NM_001007255	126823	−0.01	−0.26	−0.25	0.04	G2_M
A_32_P82807	KMT5A	NM_020382	387893	0.38	0.39	0.02	0.29	G2_M
A_24_P238855	KMT5A	NM_020382	387893	−0.22	0.33	0.54	−0.29	G2_M
A_32_P191527	KMT5A	NM_020382	387893	−0.19	0.07	0.26	−0.57	G2_M
A_32_P191859	KMT5A	NM_020382	387893	−0.10	0.11	0.21	−0.39	G2_M
A_23_P217968	KMT5B	NM_016028	51111	1.11	0.43	−0.68	0.99	G2_M
A_23_P326739	KMT5B	NM_017635	51111	−0.60	−0.03	0.57	−0.90	G2_M
A_23_P96688	KMT5B	NM_016028	51111	−0.02	−0.15	−0.13	0.10	G2_M
A_23_P140705	KNSTRN	NM_001142761	90417	−1.55	−1.01	0.54	0.14	G2_M
A_24_P162718	LMNA	NM_005572	4000	−0.08	−0.12	−0.04	−0.35	G2_M
A_23_P34835	LMNA	NM_005572	4000	−0.01	−0.01	0.01	−0.44	G2_M
A_23_P251118	LPP	NM_005578	4026	0.44	0.47	0.03	0.31	G2_M
A_24_P916515	LPP	A_24_P916515	NA	0.33	0.35	0.01	−0.02	G2_M
A_32_P70519	LPP	ENST00000312675	4026	0.16	0.16	0.00	−0.46	G2_M
A_24_P114551	LPP	NM_005578	4026	−0.14	0.07	0.21	−0.89	G2_M
A_32_P39049	LPP	ENST00000312675	4026	−0.13	0.10	0.24	−0.09	G2_M
A_32_P193218	LPP	ENST00000312675	4026	−0.10	0.18	0.28	−0.83	G2_M
A_24_P778741	LPP	ENST00000312675	4026	0.10	0.37	0.27	−1.09	G2_M
A_32_P56874	LPP	ENST00000312675	4026	0.02	0.06	0.03	−0.35	G2_M
A_23_P200222	LRP8	NM_033300	7804	0.86	0.93	0.08	0.31	G2_M
A_23_P34325	LRP8	NM_033300	7804	0.14	0.53	0.38	−0.26	G2_M
A_23_P253958	LRRC17	NM_005824	10234	0.43	1.01	0.58	−0.15	G2_M
A_23_P145376	MAPK13	NM_002754	5603	0.22	−0.13	−0.35	0.82	G2_M
A_24_P406132	MAPK13	NM_002754	5603	0.08	−0.03	−0.12	0.20	G2_M
A_23_P71328	MATN2	NM_030583	4147	−0.50	−0.30	0.20	−1.34	G2_M
A_24_P179225	MATN2	NM_030583	4147	0.24	0.06	−0.17	−0.24	G2_M
A_23_P19455	MDC1	NM_014641	9656	−0.14	−0.15	−0.01	−0.40	G2_M
A_23_P105227	ME3	NM_001014811	10873	−0.40	0.15	0.55	−0.26	G2_M
A_23_P116614	ME3	NM_001014811	10873	0.04	0.39	0.35	0.08	G2_M
A_24_P346855	MKI67	NM_002417	4288	−1.66	−1.70	−0.04	−0.93	G2_M
A_32_P9382	MZT1	NM_001071775	440145	−0.33	−0.50	−0.18	0.57	G2_M
A_24_P532589	MZT1	NM_001071775	440145	−0.12	−0.28	−0.16	0.18	G2_M
A_24_P210675	NDE1	NM_017668	54820	−0.60	0.01	0.61	−1.05	G2_M
A_23_P206901	NDE1	NM_017668	54820	0.07	0.63	0.56	−0.46	G2_M
A_23_P35219	NEK2	NM_002497	4751	−1.67	−1.54	0.13	−0.25	G2_M
A_24_P319613	NEK2	NM_002497	4751	−0.86	−0.50	0.36	−0.09	G2_M
A_23_P74349	NUF2	NM_145697	83540	−3.08	−2.39	0.69	−1.08	G2_M
A_23_P102320	NUP35	NM_138285	129401	−0.43	−0.18	0.25	0.55	G2_M
A_23_P203586	NUP98	NM_016320	4928	0.32	0.34	0.02	−0.05	G2_M
A_24_P141522	NUP98	NM_016320	4928	0.29	0.24	−0.06	0.12	G2_M
A_23_P308032	NUP98	NM_005387	4928	−0.12	−0.28	−0.16	0.14	G2_M
A_23_P60488	ODF2	NM_002540	4957	−0.72	−0.22	0.50	−0.90	G2_M
A_23_P71889	ODF2	NM_153437	4957	−0.21	0.30	0.51	−0.15	G2_M
A_23_P63777	OIT3	NM_152635	170392	−0.28	0.06	0.34	0.06	G2_M
A_24_P124624	OLR1	NM_002543	4973	0.54	−0.05	−0.59	0.51	G2_M
A_24_P274072	PATJ	NM_176877	10207	0.45	0.06	−0.39	0.74	G2_M
A_23_P126100	PATJ	NM_176877	10207	0.39	0.15	−0.24	0.60	G2_M
A_32_P88958	PATJ	NM_176877	10207	0.20	−0.13	−0.33	0.41	G2_M
A_23_P321034	PATJ	NM_176877	10207	0.17	0.33	0.17	−0.25	G2_M
A_24_P942454	PATJ	NM_176877	10207	−0.05	0.06	0.11	0.50	G2_M
A_32_P62997	PBK	NM_018492	55872	−4.16	−3.00	1.15	−1.67	G2_M
A_23_P116578	PCF11	NM_015885	51585	−0.41	−0.40	0.01	0.36	G2_M
A_24_P835763	PCF11	A_24_P835763	NA	0.38	−0.66	−1.05	1.16	G2_M
A_23_P33303	PIK3CD	NM_005026	5293	0.56	0.53	−0.03	−0.27	G2_M
A_24_P71244	PIK3CD	NM_005026	5293	0.15	−0.05	−0.20	−0.21	G2_M
A_23_P259833	PIK3CD	NM_005026	5293	0.02	−0.13	−0.15	0.13	G2_M
A_23_P49878	PIMREG	NM_019013	54478	−2.67	−2.40	0.27	−0.54	G2_M
A_23_P411723	PLAG1	NM_002655	5324	0.44	−0.18	−0.62	1.02	G2_M
A_24_P313504	PLK1	NM_005030	5347	−1.32	−1.37	−0.05	−0.17	G2_M
A_23_P118174	PLK1	NM_005030	5347	−0.82	−0.68	0.14	−0.43	G2_M
A_24_P354300	POC1A	NM_015426	25886	−1.21	−0.81	0.40	−0.63	G2_M
A_23_P212284	POC1A	NM_015426	25886	−1.26	−0.82	0.44	−0.77	G2_M
A_24_P349002	POM121	NM_172020	9883	0.32	0.50	0.19	−0.52	G2_M
A_32_P131940	POM121	NM_172020	9883	0.27	0.40	0.13	−0.95	G2_M
A_24_P417784	POM121	NM_172020	9883	0.35	0.57	0.22	−0.86	G2_M
A_24_P266273	POM121	NM_172020	9883	0.03	−0.19	−0.22	0.06	G2_M
A_23_P156667	PPP1R10	NM_002714	5514	−0.93	0.07	1.00	−1.19	G2_M
A_23_P15305	PRPSAP1	NM_002766	5635	−0.51	−0.31	0.20	−0.68	G2_M
A_23_P80382	PRR5	NM_015366	55615	−0.21	0.00	0.21	−0.48	G2_M
A_24_P10890	PRR5	NM_015366	55615	0.20	0.06	−0.14	−0.15	G2_M
A_24_P21044	PSMG3	NM_032302	84262	−0.03	0.12	0.15	−0.11	G2_M
A_23_P103328	PTGER3	NM_198714	5733	1.30	1.41	0.11	0.82	G2_M
A_24_P945365	PTGER3	NM_198715	5733	0.53	0.61	0.08	−0.09	G2_M
A_23_P81770	PTP4A1	NM_003463	7803	0.67	0.28	−0.39	0.32	G2_M
A_24_P294832	PTP4A1	NM_003463	7803	−0.37	−0.01	0.36	−0.57	G2_M
A_24_P252043	PTP4A1	NM_003463	7803	0.50	−0.24	−0.74	0.60	G2_M
A_23_P124486	PTPN9	NM_002833	5780	−0.51	−0.22	0.29	−1.07	G2_M
A_23_P13632	PYM1	NM_032345	84305	−0.42	−0.12	0.30	−0.64	G2_M
A_23_P45106	QRICH1	NM_017730	54870	0.22	0.14	−0.08	−0.53	G2_M
A_23_P45108	QRICH1	NM_017730	54870	0.17	−0.10	−0.27	0.53	G2_M
A_23_P207014	RAD51C	NM_002876	5889	−0.96	−0.75	0.21	0.02	G2_M
A_23_P391344	RASGEF1A	BC022548	221002	0.73	0.39	−0.34	0.62	G2_M
A_32_P223140	RASGEF1A	NM_145313	221002	0.75	0.14	−0.62	1.04	G2_M
A_24_P79955	RBM8A	NM_005105	9939	−0.54	−0.12	0.41	−0.54	G2_M
A_23_P305335	RBM8A	BC017770	9939	1.29	0.20	−1.09	1.74	G2_M
A_32_P62571	RBM8A	NM_005105	9939	−0.41	0.02	0.44	−0.81	G2_M
A_23_P104116	RBM8A	NM_005105	9939	0.09	0.16	0.07	0.49	G2_M
A_23_P166248	RCAN1	NM_004414	1827	−0.18	−0.13	0.05	−0.24	G2_M
A_23_P14105	RCBTB2	NM_001268	1102	−1.53	−0.06	1.47	−1.74	G2_M
A_24_P342591	RERE	NM_012102	473	0.16	0.39	0.23	−1.12	G2_M
A_23_P85414	RERE	NM_012102	473	0.04	0.07	0.04	−0.65	G2_M
A_24_P725630	RNPS1	NM_006711	10921	0.85	0.54	−0.31	0.39	G2_M
A_24_P766577	RNPS1	NM_006711	10921	0.12	0.02	−0.10	−0.21	G2_M
A_23_P152272	RNPS1	NM_006711	10921	0.02	0.08	0.06	−0.38	G2_M
A_23_P80129	RRP1	NM_003683	8568	0.63	0.52	−0.11	0.04	G2_M
A_23_P80136	RRP1	NM_003683	8568	−0.09	0.26	0.34	−0.03	G2_M
A_24_P100517	SAPCD2	NM_178448	89958	−0.91	−0.60	0.31	−0.42	G2_M
A_23_P370625	SELENON	NM_020451	57190	−0.80	−0.26	0.54	−1.75	G2_M
A_24_P231250	SELENON	NM_020451	57190	−0.37	−0.07	0.30	−1.06	G2_M
A_24_P105283	SFPQ	NM_005066	6421	−0.18	−0.09	0.09	−0.28	G2_M
A_23_P411335	SGO2	NM_152524	151246	−1.95	−1.54	0.41	−0.59	G2_M
A_32_P96719	SHCBP1	NM_024745	79801	−1.68	−1.83	−0.14	−0.60	G2_M
A_23_P59051	SLC17A2	NM_005835	10246	0.13	0.43	0.29	−0.36	G2_M
A_24_P10657	SLC44A2	NM_020428	57153	0.24	0.31	0.07	−0.65	G2_M
A_23_P208340	SLC44A2	NM_020428	57153	−0.08	0.15	0.23	−0.96	G2_M
A_23_P68824	SMARCB1	NM_003073	6598	−0.33	0.02	0.35	−0.82	G2_M
A_24_P232696	SMARCD1	NM_139071	6602	−0.23	−0.01	0.22	−0.68	G2_M
A_23_P204745	SMARCD1	NM_139071	6602	0.16	0.65	0.49	−0.24	G2_M
A_23_P211428	SMTN	NM_134269	6525	−0.47	−0.31	0.17	−1.05	G2_M
A_23_P5934	SOGA1	AB020696	140710	−0.43	−0.12	0.31	−0.40	G2_M
A_23_P5936	SOGA1	AB020696	140710	−0.26	−0.44	−0.18	−0.42	G2_M
A_23_P5938	SOGA1	AB020696	140710	0.18	0.27	0.08	−0.36	G2_M
A_23_P89509	SPAG5	NM_006461	10615	−2.17	−1.39	0.78	−0.41	G2_M
A_23_P41948	SPDL1	NM_017785	54908	−1.58	−0.78	0.80	−0.55	G2_M
A_23_P102523	SPTBN1	NM_003128	6711	−0.45	−0.37	0.08	−0.81	G2_M
A_23_P339095	SPTBN1	NM_178313	6711	−0.19	−0.25	−0.07	−0.15	G2_M
A_23_P30223	SRD5A1	NM_001047	6715	−0.15	−0.47	−0.32	−0.08	G2_M
A_23_P413761	SRSF3	NM_003017	6428	−0.31	0.03	0.33	−0.18	G2_M
A_23_P19702	TAB2	NM_015093	23118	0.32	0.20	−0.12	0.03	G2_M
A_24_P245778	TFF3	ENST00000291525	7033	−0.63	−0.48	0.15	−0.45	G2_M
A_23_P393099	TFF3	NM_003226	7033	−0.11	−0.09	0.02	−0.05	G2_M
A_24_P289208	TFF3	NM_003226	7033	0.14	−0.41	−0.54	0.60	G2_M
A_23_P257296	TFF3	NM_003226	7033	0.03	0.03	0.00	0.06	G2_M
A_23_P153197	TGIF1	NM_170695	7050	−0.28	−0.22	0.06	−1.29	G2_M
A_24_P926367	THRAP3	NM_005119	9967	−0.61	−0.46	0.15	−0.71	G2_M
A_24_P256863	THRAP3	NM_005119	9967	−0.19	−0.38	−0.18	0.33	G2_M
A_23_P160367	THRAP3	NM_005119	9967	−0.18	−0.42	−0.24	−0.01	G2_M
A_23_P158277	TMCO4	NM_181719	255104	−0.15	0.32	0.46	−0.61	G2_M
A_23_P24723	TMEM138	NM_016464	51524	−0.43	−0.25	0.17	0.17	G2_M
A_23_P428875	TNFAIP8L1	NM_152362	126282	−0.70	−0.84	−0.14	−0.55	G2_M
A_23_P156101	TNPO1	NM_002270	3842	−0.17	−0.20	−0.04	0.49	G2_M
A_32_P99097	TNPO1	NM_002270	3842	−0.03	0.19	0.22	0.29	G2_M
A_24_P260440	TNPO1	NM_002270	3842	0.00	0.10	0.10	0.32	G2_M
A_24_P199097	TOMM34	NM_006809	10953	0.31	0.09	−0.22	1.37	G2_M
A_23_P57033	TOMM34	NM_006809	10953	0.08	−0.19	−0.27	0.78	G2_M
A_23_P68610	TPX2	NM_012112	22974	−2.37	−1.66	0.71	−1.18	G2_M
A_24_P277576	TRIP13	NM_004237	9319	−0.28	−0.08	0.21	−0.37	G2_M
A_23_P75839	TSG101	NM_006292	7251	0.10	0.06	−0.04	1.78	G2_M
A_23_P162142	TSKU	NM_015516	25987	0.51	0.27	−0.24	−0.24	G2_M
A_23_P28105	TSN	NM_004622	7247	−0.28	−0.10	0.18	−0.10	G2_M
A_24_P242820	TSN	NM_004622	7247	−0.19	−0.19	0.00	−0.29	G2_M
A_23_P259586	TTK	NM_003318	7272	−2.35	−2.45	−0.10	−0.31	G2_M
A_24_P263524	TXNDC9	NM_005783	10190	−0.65	−0.41	0.24	0.04	G2_M
A_23_P154330	TXNDC9	NM_005783	10190	−0.51	−0.20	0.32	0.23	G2_M
A_24_P362646	TXNDC9	NM_005783	10190	−0.32	−0.08	0.24	0.18	G2_M
A_23_P204581	TXNRD1	NM_003330	7296	0.59	0.55	−0.04	0.70	G2_M
A_23_P40989	USP13	NM_003940	8975	−0.40	−0.38	0.03	−0.37	G2_M
A_23_P257911	USP16	NM_001032410	10600	−0.34	−0.07	0.27	0.58	G2_M
A_24_P199655	VANGL1	NM_138959	81839	−0.63	0.04	0.66	−0.93	G2_M
A_23_P103795	VANGL1	NM_138959	81839	−0.30	0.26	0.57	−0.97	G2_M
A_23_P369316	VANGL1	NM_138959	81839	−0.17	0.00	0.18	−0.46	G2_M
A_23_P103070	YWHAH	NM_003405	7533	−0.19	−0.35	−0.16	−0.35	G2_M
A_23_P215088	ZC3HC1	NM_016478	51530	0.02	0.09	0.07	0.32	G2_M
A_24_P290527	ZFX	NM_003410	7543	−0.28	−0.08	0.21	0.18	G2_M
A_23_P125639	ZFX	NM_003410	7543	0.36	0.08	−0.28	0.75	G2_M
A_24_P940524	ZFX	NM_003410	7543	−0.16	0.13	0.29	−0.31	G2_M
A_23_P161091	ZMYM1	NM_024772	79830	−0.12	−0.30	−0.18	0.27	G2_M
A_24_P53985	ZMYM1	NM_024772	79830	−0.10	−0.25	−0.15	0.38	G2_M
A_23_P159027	ZNF521	NM_015461	25925	−0.33	0.08	0.41	−0.63	G2_M
A_23_P78018	ABCA5	NM_018672	23461	−0.15	−0.02	0.13	−0.05	S
A_24_P67096	ABCA5	NM_018672	23461	−0.15	−0.01	0.14	−0.10	S
A_23_P158976	ABCC2	NM_000392	1244	0.45	0.07	−0.38	0.36	S
A_23_P44569	ABCC2	NM_000392	1244	0.12	0.14	0.02	0.26	S
A_23_P212665	ABCC5	NM_005688	10057	0.29	−0.21	−0.50	−0.14	S
A_23_P258221	ABCC5	NM_005688	10057	−0.08	0.07	0.15	−0.03	S
A_24_P268662	ABHD10	NM_018394	55347	−0.37	0.38	0.75	−0.08	S
A_23_P92213	ABHD10	NM_018394	55347	−0.18	−0.37	−0.19	0.56	S
A_24_P308590	ABHD10	NM_018394	55347	0.11	−0.07	−0.19	0.04	S
A_23_P23630	ACAP3	NM_030649	116983	−0.69	−0.34	0.35	−0.14	S
A_23_P23625	ACAP3	NM_030649	116983	−0.61	−0.11	0.50	−0.52	S
A_23_P12231	ACAP3	NM_030649	116983	0.26	−0.45	−0.71	−0.20	S
A_24_P281497	ACAP3	NM_030649	116983	−0.15	0.41	0.55	−0.17	S
A_24_P355006	ADAM22	ENST00000398204	53616	−0.54	−0.45	0.09	−0.53	S
A_23_P215625	ADAM22	NM_021723	53616	−0.37	−0.61	−0.24	−0.10	S
A_24_P243741	ADAM22	NM_021721	53616	0.22	0.27	0.06	−0.17	S
A_24_P203630	ANKRD36	NM_001164315	375248	0.93	0.78	−0.15	0.57	S
A_24_P6725	ANKRD36	NM_001164315	375248	0.78	0.66	−0.12	0.32	S
A_24_P686992	ANKRD36	NM_001164315	375248	0.67	0.50	−0.17	0.58	S
A_24_P336931	ANKRD36	NM_001164315	375248	−0.02	−0.39	−0.36	0.53	S
A_23_P119254	ASF1B	NM_018154	55723	−2.77	−2.37	0.40	−1.54	S
A_23_P120629	ASIP	NM_001672	434	0.04	−0.21	−0.25	0.38	S
A_23_P106835	BBS2	NM_031885	583	−0.11	−0.25	−0.14	0.10	S
A_23_P105833	BIVM	NM_017693	54841	−0.28	0.14	0.43	−0.75	S
A_23_P88630	BLM	NM_000057	641	−2.28	−1.89	0.39	−0.83	S
A_24_P303989	BMI1	NM_005180	648	−0.26	−0.03	0.23	0.05	S
A_23_P314115	BMI1	NM_005180	648	−0.12	−0.01	0.10	0.02	S
A_23_P207400	BRCA1	NM_007300	672	−1.00	−0.91	0.08	−0.65	S
A_23_P15844	BRIP1	NM_032043	83990	−1.30	−1.16	0.14	0.07	S
A_24_P255524	CALD1	AF247820	800	0.54	0.69	0.15	0.28	S
A_24_P921366	CALD1	NM_033138	800	−0.51	−0.17	0.34	−0.79	S
A_23_P42575	CALD1	NM_033138	800	−0.33	0.02	0.35	−0.35	S
A_24_P313993	CAPS	NM_004058	828	−0.42	0.14	0.56	−0.19	S
A_23_P78958	CAPS	NM_004058	828	−0.22	0.44	0.66	−0.43	S
A_23_P384056	CCDC14	NM_022757	64770	−0.59	−0.46	0.13	0.41	S
A_23_P39574	CCDC150	NM_001080539	284992	−1.38	−1.34	0.04	0.15	S
A_24_P157156	CCDC150	NM_001080539	284992	−0.47	−0.52	−0.05	−0.24	S
A_23_P320190	CCDC150	A_23_P320190	NA	−0.34	−0.24	0.10	−0.53	S
A_24_P636332	CCDC84	NM_198489	338657	0.17	0.21	0.04	0.76	S
A_24_P693946	CCDC84	A_24_P693946	NA	0.05	−0.01	−0.06	0.62	S
A_23_P57379	CDC45	NM_003504	8318	−3.57	−2.37	1.20	−1.90	S
A_23_P148807	CDC7	NM_003503	8317	−0.70	−0.50	0.20	−0.07	S
A_23_P104651	CDCA5	NM_080668	113130	−2.58	−2.15	0.42	−1.16	S
A_23_P405267	CDH24	AK057922	64403	1.03	−0.05	−1.08	1.04	S
A_23_P25790	CDH24	NM_022478	64403	0.26	−0.37	−0.62	0.19	S
A_23_P258002	CDKN2AIP	NM_017632	55602	0.18	−0.17	−0.35	0.51	S
A_24_P399888	CENPM	NM_001002876	79019	−2.65	−2.27	0.38	−0.97	S
A_23_P70328	CENPQ	NM_018132	55166	−0.18	−0.36	−0.18	0.41	S
A_23_P254733	CENPU	NM_024629	79682	−1.79	−1.85	−0.06	−0.23	S
A_24_P289366	CERS6	NM_203463	253782	0.10	0.18	0.08	−0.46	S
A_32_P5480	CERS6	NM_203463	253782	−0.08	0.35	0.43	−0.45	S
A_23_P144071	COL7A1	NM_000094	1294	−0.17	0.28	0.46	−0.03	S
A_24_P932308	COQ9	AK075438	57017	0.90	0.78	−0.12	1.05	S
A_23_P14928	COQ9	NM_020312	57017	−0.08	0.22	0.31	−0.15	S
A_23_P87556	CPNE8	NM_153634	144402	−0.23	0.33	0.56	−0.20	S
A_24_P56240	CPNE8	NM_153634	144402	0.05	0.58	0.53	0.06	S
A_23_P144438	DCAF16	NM_017741	54876	0.31	0.11	−0.20	0.31	S
A_32_P104000	DCUN1D3	NM_173475	123879	−0.18	0.11	0.30	0.02	S
A_23_P429491	DDIAS	NM_145018	220042	−1.24	−1.00	0.24	−0.25	S
A_24_P926543	DDIAS	AK058145	220042	0.41	0.29	−0.12	−0.14	S
A_23_P385126	DEPDC7	NM_139160	91614	0.99	0.06	−0.93	1.16	S
A_24_P320284	DHFR	NM_000791	1719	−1.51	−1.20	0.32	−0.38	S
A_24_P942328	DHFR	NM_000791	1719	−1.91	−1.52	0.39	−1.10	S
A_32_P211045	DHFR	NM_000791	1719	−2.16	−1.40	0.76	−1.27	S
A_23_P167553	DHFR	NM_000791	1719	−1.58	−1.13	0.45	−0.59	S
A_24_P343095	DHFR	NM_000791	1719	−1.26	−0.87	0.39	−0.36	S
A_23_P327361	DMXL2	NM_015263	23312	0.07	−0.14	−0.21	−0.02	S
A_24_P366107	DNA2	NM_001080449	1763	−0.86	−0.69	0.17	−0.56	S
A_23_P51339	DNAJB4	NM_007034	11080	1.16	−0.02	−1.18	0.98	S
A_24_P393958	DNAJB4	NM_007034	11080	1.11	−0.10	−1.21	1.23	S
A_23_P95359	DNAJC6	NM_014787	9829	−0.44	−0.40	0.03	−0.41	S
A_23_P147479	DNAJC6	NM_014787	9829	0.35	−0.02	−0.38	0.58	S
A_23_P500390	DONSON	NM_017613	29980	0.52	−0.11	−0.64	1.07	S
A_23_P425502	DONSON	NM_017613	29980	0.30	−0.34	−0.64	0.96	S
A_23_P35871	E2F8	NM_024680	79733	−0.76	−0.35	0.41	−0.23	S
A_23_P214291	EFHC1	NM_018100	114327	−0.37	−0.45	−0.08	0.72	S
A_32_P86245	EFHC1	NM_018100	114327	−0.31	−0.07	0.24	−0.10	S
A_24_P913374	EIF4EBP2	NM_004096	1979	−0.66	−0.29	0.36	−1.22	S
A_24_P4387	EIF4EBP2	NM_004096	1979	−0.42	−0.08	0.34	−0.58	S
A_24_P115621	EIF4EBP2	NM_004096	1979	−0.25	−0.04	0.21	−0.90	S
A_23_P115922	EIF4EBP2	NM_004096	1979	−0.22	0.01	0.24	−0.47	S
A_24_P323598	ESCO2	NM_001017420	157570	−2.00	−1.95	0.05	−0.79	S
A_23_P23303	EXO1	NM_003686	9156	−2.11	−1.68	0.42	−1.23	S
A_23_P259641	EZH2	NM_004456	2146	−0.74	−0.91	−0.16	0.13	S
A_23_P99853	FAM214A	NM_019600	56204	0.25	0.05	−0.20	−0.03	S
A_24_P357576	FAM214A	NM_019600	56204	0.17	0.09	−0.08	−0.27	S
A_23_P206441	FANCA	NM_000135	2175	−0.49	−0.42	0.07	−0.58	S
A_24_P73158	FEN1	NM_004111	2237	−1.16	−1.11	0.04	−0.36	S
A_24_P84898	FEN1	NM_004111	2237	−1.27	−1.29	−0.02	−0.33	S
A_23_P103996	GCLM	NM_002061	2730	0.55	1.42	0.87	−0.32	S
A_32_P177953	GCLM	ENST00000370238	2730	0.05	1.10	1.05	−0.67	S
A_32_P2392	GOLGA8A	NM_181077	23015	0.91	0.31	−0.60	0.66	S
A_23_P37623	GOLGA8A	NM_181077	23015	0.54	0.52	−0.02	−0.12	S
A_24_P910580	GOLGA8A	NR_027409	23015	0.50	0.47	−0.03	0.73	S
A_23_P29257	H1F0	NM_005318	3005	0.40	0.02	−0.39	−0.58	S
A_23_P349771	HAUS5	NM_015302	23354	0.41	0.89	0.48	−0.01	S
A_23_P12816	HELLS	NM_018063	3070	−0.95	−1.12	−0.17	−0.02	S
A_23_P372860	HIST1H2AC	NM_003512	8334	−0.38	−0.57	−0.19	0.76	S
A_23_P167983	HIST1H2AC	ENST00000314088	8334	−0.22	−0.24	−0.02	−0.03	S
A_32_P221799	HIST1H2AM	NM_003514	8336	−1.05	−1.41	−0.36	0.21	S
A_24_P86389	HIST1H2AM	NM_003514	8336	0.10	−0.07	−0.17	0.83	S
A_23_P93180	HIST1H2BC	NM_003526	8347	−0.04	−0.26	−0.22	0.90	S
A_24_P166407	HIST1H4B	NM_003544	8366	−0.91	−0.89	0.02	−0.16	S
A_23_P214487	HIST1H4C	NM_003542	8364	−1.27	−1.00	0.27	−0.66	S
A_23_P323685	HIST1H4H	NM_003543	8365	−0.31	−0.82	−0.51	0.73	S
A_23_P52266	IFIT1	NM_001548	3434	1.72	0.64	−1.08	1.80	S
A_23_P102454	INSIG2	NM_016133	51141	0.53	0.07	−0.46	1.13	S
A_24_P944458	INSIG2	NM_016133	51141	−0.30	−0.67	−0.37	0.31	S
A_23_P52082	INTS7	NM_015434	25896	−0.49	0.16	0.64	−0.44	S
A_32_P159651	KAT2B	NM_003884	8850	−0.66	−0.62	0.04	−0.51	S
A_23_P41128	KAT2B	NM_003884	8850	−0.38	−0.33	0.05	−0.36	S
A_23_P358542	KIFC2	NM_145754	90990	−0.21	−0.01	0.20	0.33	S
A_23_P165414	KLHL23	NM_144711	151230	−0.63	−0.12	0.51	−1.29	S
A_24_P923102	KLHL23	ENST00000392647	151230	−0.62	−0.02	0.60	−0.81	S
A_23_P165408	KLHL23	NM_144711	151230	−0.70	−0.36	0.34	−1.03	S
A_23_P74252	LINC00339	NR_023918	29092	−0.41	−0.62	−0.20	0.04	S
A_23_P84219	LIPH	NM_139248	200879	−0.15	−0.11	0.04	0.38	S
A_24_P799858	LIPH	ENST00000296252	200879	−0.03	0.14	0.17	−0.11	S
A_23_P380181	LMO4	NM_006769	8543	−0.36	−0.07	0.30	−0.34	S
A_32_P18159	LYRM7	NM_181705	90624	0.41	0.17	−0.23	−0.18	S
A_32_P211141	LYRM7	NM_181705	90624	0.26	0.44	0.18	0.07	S
A_24_P256603	LYRM7	NM_181705	90624	0.20	0.32	0.13	0.16	S
A_23_P337464	LYRM7	NM_181705	90624	−0.23	0.02	0.25	−0.66	S
A_24_P926195	MAN1A2	NM_006699	10905	−0.52	−0.01	0.51	−0.55	S
A_23_P103571	MAN1A2	NM_006699	10905	−0.48	0.14	0.62	−0.21	S
A_32_P88603	MAN1A2	ENST00000356554	10905	−0.49	0.09	0.59	−0.78	S
A_32_P88598	MAN1A2	ENST00000356554	10905	−0.42	0.25	0.66	−0.72	S
A_24_P213548	MAN1A2	NM_006699	10905	−0.11	0.41	0.52	0.02	S
A_23_P313640	MAP3K2	NM_006609	10746	0.60	0.45	−0.15	0.16	S
A_32_P98887	MAP3K2	ENST00000409947	10746	0.42	−0.11	−0.53	0.32	S
A_23_P313645	MAP3K2	NM_006609	10746	0.23	0.24	0.01	0.40	S
A_23_P201988	MASTL	NM_032844	84930	−0.45	−0.86	−0.41	0.36	S
A_24_P258051	MASTL	NM_032844	84930	−0.16	−0.38	−0.22	0.06	S
A_23_P92154	MBD4	NM_003925	8930	−0.37	−0.14	0.24	0.14	S
A_23_P68547	MCM8	NM_182802	84515	−0.81	−0.49	0.32	−0.43	S
A_24_P305556	MCM8	NM_182802	84515	−0.50	−0.48	0.03	−0.09	S
A_32_P129894	MEGF9	NM_001080497	1955	−0.12	0.13	0.25	−1.13	S
A_23_P426663	MITF	NM_198159	4286	−0.17	−0.15	0.02	−0.04	S
A_23_P73345	MITF	NM_198159	4286	0.26	0.19	−0.07	1.01	S
A_24_P910310	MITF	NM_198177	4286	0.14	−0.39	−0.53	0.72	S
A_23_P61945	MITF	NM_198159	4286	−0.03	0.11	0.13	−0.07	S
A_24_P323815	MYCBP2	NM_015057	23077	−0.48	−0.28	0.20	−0.08	S
A_23_P151459	MYCBP2	NM_015057	23077	0.04	0.56	0.52	−0.46	S
A_23_P209805	NAB1	NM_005966	4664	0.67	0.61	−0.06	1.30	S
A_24_P191417	NAB1	NM_005966	4664	0.01	0.29	0.28	0.47	S
A_23_P5761	NFE2L2	NM_006164	4780	0.04	0.26	0.22	−0.14	S
A_23_P23006	NRDC	NM_002525	4898	−0.42	−0.16	0.27	−0.07	S
A_32_P213822	NSUN3	ENST00000314622	63899	−0.66	−0.31	0.36	−0.19	S
A_23_P21785	NSUN3	NM_022072	63899	−0.08	−0.10	−0.01	0.55	S
A_23_P382043	NT5DC1	NM_152729	221294	−0.40	−0.15	0.25	−0.31	S
A_23_P219004	NT5DC1	NM_152729	221294	0.14	0.15	0.01	0.37	S
A_24_P922606	NUP160	NM_015231	23279	0.83	0.11	−0.72	0.83	S
A_23_P43726	NUP160	NM_015231	23279	−0.06	0.06	0.12	0.15	S
A_23_P381979	OGT	NM_181672	8473	−0.25	−0.44	−0.19	0.06	S
A_23_P381976	OGT	NM_181672	8473	−0.17	−0.08	0.09	0.12	S
A_23_P42045	ORC3	NM_181837	23595	−0.10	−0.60	−0.50	0.66	S
A_23_P79818	OSER1	NM_016470	51526	0.27	−0.36	−0.63	0.95	S
A_24_P261083	OSGIN2	NM_004337	734	0.89	0.41	−0.47	0.84	S
A_23_P82859	OSGIN2	NM_004337	734	−0.01	−0.06	−0.05	0.18	S
A_23_P117852	PCLAF	NM_014736	9768	−3.04	−2.31	0.73	−0.87	S
A_32_P61339	PHIP	BC036479	55023	−0.57	−1.00	−0.43	−0.08	S
A_24_P196400	PHIP	NM_017934	55023	−0.36	−0.34	0.01	0.15	S
A_23_P145437	PHIP	NM_017934	55023	−0.18	−0.09	0.09	0.20	S
A_24_P630039	PHIP	NM_017934	55023	−0.22	−0.03	0.20	−0.13	S
A_24_P931503	PHIP	NM_017934	55023	−0.21	−0.12	0.09	−0.61	S
A_24_P175176	PHTF2	NM_020432	57157	−0.76	−0.05	0.70	−0.58	S
A_32_P409919	PHTF2	NM_020432	57157	0.57	0.05	−0.52	0.50	S
A_24_P323944	PHTF2	NM_020432	57157	0.08	−0.05	−0.13	0.21	S
A_24_P403244	PILRB	NM_013440	29990	−0.31	0.08	0.38	0.15	S
A_23_P19829	PILRB	NM_013440	29990	−0.32	0.06	0.38	0.08	S
A_24_P105102	PKMYT1	NM_182687	9088	−1.77	−1.36	0.41	−1.22	S
A_23_P398515	PKMYT1	NM_004203	9088	0.12	0.19	0.07	−0.19	S
A_23_P25019	PRIM1	NM_000946	5557	−1.04	−1.21	−0.17	−0.32	S
A_23_P44139	PRIM2	NM_000947	5558	−0.53	−0.21	0.32	−0.16	S
A_24_P282237	PRIM2	NM_000947	5558	−0.33	−0.25	0.08	−0.17	S
A_24_P75158	PTAR1	NM_001099666	375743	−0.36	−0.37	0.00	0.26	S
A_23_P121222	RAD18	NM_020165	56852	−0.58	−0.47	0.11	−0.13	S
A_23_P88731	RAD51	NM_002875	5888	−1.73	−1.58	0.15	−1.02	S
A_23_P99292	RAD51AP1	NM_006479	10635	−2.35	−2.26	0.08	−1.01	S
A_23_P74115	RAD54L	NM_003579	8438	−2.14	−1.79	0.34	−0.94	S
A_23_P252371	RBBP8	NM_002894	5932	−0.40	−0.41	−0.01	0.30	S
A_23_P96285	REEP1	NM_022912	65055	−2.14	−1.68	0.45	−1.95	S
A_23_P93823	RFC2	NM_181471	5982	−0.45	−0.33	0.12	−0.47	S
A_23_P18196	RFC4	NM_002916	5984	−0.84	−0.88	−0.04	−0.04	S
A_23_P92710	RHOBTB3	NM_014899	22836	0.42	0.87	0.46	−0.96	S
A_23_P315386	RHPN1	NM_052924	114822	−0.19	−0.28	−0.09	0.50	S
A_23_P87432	RHPN1	NM_052924	114822	0.22	−0.57	−0.79	0.73	S
A_23_P87435	RHPN1	NM_052924	114822	−0.14	−0.25	−0.11	−0.38	S
A_23_P86133	RPA2	NM_002946	6118	−0.52	−0.77	−0.25	0.22	S
A_23_P87351	RRM1	NM_001033	6240	−0.73	−0.81	−0.08	0.31	S
A_24_P234196	RRM2	NM_001034	6241	−3.49	−2.56	0.93	−1.85	S
A_24_P225616	RRM2	NM_001034	6241	−1.98	−1.54	0.44	−1.50	S
A_24_P350160	RSRC2	NM_198261	65117	0.43	0.09	−0.34	1.05	S
A_23_P53267	RSRC2	NM_198261	65117	−0.16	−0.52	−0.36	0.70	S
A_24_P304987	SAP30BP	NM_013260	29115	−0.32	−0.05	0.27	−0.13	S
A_23_P54953	SAP30BP	NM_013260	29115	−0.23	−0.44	−0.21	0.26	S
A_23_P169351	SH3GL2	NM_003026	6456	0.07	−0.50	−0.57	−0.13	S
A_23_P200443	SHC1	NM_003029	6464	0.29	0.36	0.07	−0.42	S
A_24_P68585	SHC1	NM_183001	6464	0.06	0.14	0.08	−0.06	S
A_23_P202587	SHTN1	NM_018330	57698	−0.27	0.15	0.42	−0.46	S
A_32_P309404	SLC22A3	NM_021977	6581	−0.45	0.30	0.75	−0.81	S
A_23_P19733	SLC22A3	NM_021977	6581	0.20	0.72	0.52	0.12	S
A_24_P246841	SLC25A27	NM_004277	9481	0.40	0.38	−0.03	0.84	S
A_23_P81721	SLC25A27	NM_004277	9481	0.26	0.25	−0.01	0.57	S
A_23_P218079	SLC38A2	NM_018976	54407	0.24	0.33	0.09	1.24	S
A_24_P295963	SLC38A2	NM_018976	54407	−0.09	0.13	0.22	0.23	S
A_23_P104282	SLF2	NM_018121	55719	−0.37	−0.42	−0.05	−0.26	S
A_32_P143516	SLF2	NM_018121	55719	−0.14	−0.16	−0.02	0.17	S
A_23_P356139	SLF2	NM_018121	55719	−0.12	0.13	0.25	−0.62	S
A_23_P366312	SP1	NM_138473	6667	0.39	0.48	0.09	−0.14	S
A_23_P53397	SP1	NM_138473	6667	0.23	0.09	−0.15	−0.01	S
A_32_P45493	SRSF10	NM_006625	10772	−0.79	−0.49	0.30	0.03	S
A_23_P45737	SRSF10	NM_006625	10772	−0.43	−0.30	0.13	0.21	S
A_23_P352291	SRSF10	NM_054016	10772	−0.20	−0.18	0.01	−0.41	S
A_24_P4795	SRSF10	NM_054016	10772	−0.19	−0.09	0.10	0.57	S
A_23_P377819	SRSF5	NM_001039465	6430	−0.29	−0.21	0.08	−0.40	S
A_32_P45894	STAG3L1	NM_018991	54441	0.17	0.06	−0.12	0.53	S
A_24_P374962	STAG3L1	NM_018991	54441	0.05	0.20	0.15	0.21	S
A_24_P111242	SVIP	NM_148893	258010	−0.53	−0.55	−0.03	0.11	S
A_32_P41070	TMCC1	NM_015008	23023	−0.10	0.09	0.20	−0.29	S
A_32_P41065	TMCC1	NM_001017395	23023	−0.08	−0.15	−0.08	−0.17	S
A_24_P922288	TMCC1	NM_001017395	23023	0.08	−0.29	−0.37	0.60	S
A_23_P170986	TMCC1	NM_001017395	23023	−0.01	−0.12	−0.11	0.40	S
A_23_P39813	TTC31	NM_022492	64427	−0.34	0.04	0.38	−0.46	S
A_32_P204169	TTLL7	ENST00000260505	79739	0.29	0.86	0.57	−0.42	S
A_23_P97481	TTLL7	NM_024686	79739	−0.18	−0.38	−0.21	0.08	S
A_24_P165450	TTLL7	NM_024686	79739	0.02	−0.02	−0.03	0.15	S
A_23_P50096	TYMS	NM_001071	7298	−1.55	−1.70	−0.15	−0.34	S
A_23_P115482	UBE2T	NM_014176	29089	−1.18	−0.89	0.29	0.14	S
A_24_P330234	UBL3	NM_007106	5412	−0.30	−0.27	0.03	0.04	S
A_23_P140029	UBL3	NM_007106	5412	0.23	0.04	−0.19	0.04	S
A_23_P11652	USP1	NM_003368	7398	−0.44	−0.67	−0.23	0.22	S
A_23_P98483	ZBED5	NM_021211	58486	−0.41	−0.22	0.19	0.20	S
A_23_P210608	ZNF217	NM_006526	7764	0.02	−0.28	−0.30	0.05	S
A_23_P63789	ZWINT	NM_032997	11130	−2.88	−2.07	0.82	−1.15	S

^aFrom Whitfield et al. (58).

^bPhases: G1, G₁; G2, G₂; G2_M, G₂/M; G2,G2_M, G₂ or G₂/M, etc.

Intoxication with Salmonella supernatant containing CdtB induces DNA damage not coupled with cell cycle arrest.

The majority of chronically infected carriers of typhoid Salmonella are usually diagnosed with gallstones and it has been found that Salmonella is able to grow on them forming biofilms. Salmonella covered gallstones might represent a reservoir for the bacteria but also a potential source of typhoid toxin (60). To understand the effect of the typhoid toxin on primary gallbladder cells, we sought to achieve a homogeneous typhoid toxin intoxication. To this aim, we seeded organoid-derived cells as 2D monolayers on collagen-coated plastic wells and supplemented them for 24 h with supernatant from Salmonella grown in MM5.8 medium, which is known to stimulate the production of typhoid toxin (19). Western blot analysis confirmed that only treatment with wild-type supernatant and etoposide, a chemical inducer of DSBs (61), resulted in an increased phosphorylation of H2AX, which is indicative of the presence of DSBs (Fig. 5A). The amount of DSBs was quantified using a neutral comet assay, which showed a significant increase in DNA in the tail of the comet analyzed from cells treated with supernatant from wild-type bacteria compared to supernatant from the ΔcdtB Salmonella or sterile medium (Fig. 5B, quantified in Fig. 5C). Cells treated with a genotoxic agent normally respond by arresting the cell cycle, and this was also reported for cells treated with recombinant CDT, a bacterial toxin that shares the CdtB subunit with the typhoid toxin (62). To examine whether cell cycle arrest was also induced in our intoxication model, we fluorescently labeled cells with antibodies against γH2AX and Ki67, a marker of proliferating cells. There was no difference in the percentage of Ki67⁺ cells in cultures treated with sterile, deletion mutant or wild-type supernatants (Fig. 5D, quantified in Fig. 5E). In stark contrast, cultures treated with etoposide contained little to no Ki67⁺ cells, although etoposide caused an amount of damage similar to that caused by the supernatant conditioned with wild-type typhoid toxin (Fig. 5A to C). Analysis of the γH2AX signal intensity in Ki67⁺ versus Ki67^– cells showed that supernatant conditioned with typhoid toxin induced more DNA damage, especially in proliferating cells (Fig. 5D and F). Cells intoxicated with ΔcdtB supernatant showed non-significant differences in the distribution of γH2AX intensities compared to sterile medium, both in proliferating and non-proliferating cells. The presence of cells positive for both γH2AX and Ki67 was detected only after intoxication with the wild-type typhoid toxin, and this observation occurred up to 48 h after intoxication started (see Fig. S3A and B). Finally, not only intoxicated cells but also rare infected cells were positive for γH2AX but still in an active state of proliferation, as indicated by double labeling with a Ki67 antibody (Fig. 5G). Our data show that human primary gallbladder cells are subjected to a low but persistent level of DNA damage caused by the CdtB subunit of the S. Paratyphi A-encoded typhoid toxin. The DNA damage caused by the genotoxin does not induce cell cycle arrest but particularly affects proliferating cells.

FIG 5.

Intoxication of primary cell 2D monolayers with typhoid toxin-containing Salmonella supernatant. (A) Western blot analysis of γH2AX levels in primary cells after exposure to Salmonella supernatant or etoposide for 24 h. Relative densitometry values, normalized to the sterile medium condition (=1), are shown above the bands. (B) Comet assay showing that DNA damage, seen as a tail of DNA after electrophoresis, is higher after exposure to supernatant from w.t. Salmonella than from the cdtB deletion mutant. Etoposide served as a positive control. Pictures of two representative nuclei per condition are shown. (C) Quantification of the comet assay, shown as means ± the SEM. ****, P < 0.0001. (D) Immunofluorescence analysis of cells intoxicated or treated with etoposide for 24 h with antibodies against γH2AX (green) and Ki67 (red); nuclei were stained with Hoechst (blue). Scale bar, 25 μm. (E) Quantification of Ki67⁺ cells in intoxicated cells. Unlike cells treated with etoposide, cells intoxicated with w.t. Salmonella supernatant do not stop proliferation despite the presence of DNA DSBs. (F) Quantification of DNA damage in proliferating and non-proliferating cells. The intensity of the γH2AX signal was quantified for each Ki67 positive and negative nucleus, using ImageJ. Data shown as means ± the SEM. ***, P < 0.001; ****, P < 0.0001. (G) Primary cell monolayers infected for 3 days with Salmonella Paratyphi A transformed with the mCherry expressing vector pLS002 (red) and fluorescently labeled with antibodies against γH2AX (green) and Ki67 (white); nuclei were labeled with Hoechst (blue). Scale bar, 10 μm.

FIG S3

Long-term intoxication, 24 and 48 h. Human GB organoids were seeded in 2D and intoxicated for 24 or 48 h. For intoxication for 48 h, the bacterial supernatant was produced twice, and fresh supernatant was diluted in medium was added after 24 h. The cells seeded were less confluent than in normal 24-h intoxication experiments to avoid premature confluence of the culture. The figure shows double-positive cells for Ki67 and γH2AX at 24 h (A) and 48 h (B). N, the minimum number of counted cells per individual experiment. Download FIG S3, TIF file, 1.2 MB ^{(1.2MB, tif)} .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

DISCUSSION

Here, we present a long-lived organoid model for human and murine GB. We found that long-term maintenance of GB organoid cultures depends on the presence of R-spondin, which mediates the activation of the Wnt/β-catenin signaling pathway and the regeneration of the gallbladder epithelium from Lgr5⁺ cells. These results confirm a recent report from a murine organoid model, which showed that the addition of R-spondin and Noggin, but not of Wnt ligands, was necessary for the expansion of GB stem cells in vitro (31). Since Wnt ligands are crucial for the activation of the Wnt/β-catenin pathway, we have found that the epithelium is itself the source of secreted WNT7A/7B. Our data suggest, in addition, that the organoids are able to transport organic ions, emulating the concentration of bile typical of this organ, and that GB epithelial features are stable over time in culture.

Resembling the architecture of the organ in situ, this organoid model provides an advanced platform for investigating GB pathology in primary, non-transformed cells. We therefore used GB organoids to develop a novel infection model for the human-specific, cancer-associated bacterium S. Paratyphi A, focusing on the genotoxic effect of the typhoid toxin. Previous data have suggested that bacterial internalization is essential for the secretion of the typhoid toxin by the host cell (17, 19–21). Here, we confirm that by infecting healthy human GB cells with a wild-type strain that produces the typhoid toxin, the non-infected bystander cells experienced genomic instability. This paracrine DNA damage effect depended on the presence of the CdtB subunit, moving attention to non-infected but intoxicated cells as potential targets of cellular transformation.

It has been shown that Salmonella is able to promote cell division through activation of the AKT and mitogen-activated protein kinase (MAPK) pathways. S. Typhimurium, which lacks the typhoid toxin, is able to induce tumor growth in a genetically predisposed primary mouse fibroblast model (63). We previously suggested that chronic carriers, subjected to low levels of genotoxicity and DSBs for years, might develop a similar genetic predisposition (64). Together with the anti-apoptotic effects of Salmonella on host cells (65, 66) and persistent inflammation, the enhanced damage is likely to contribute to an increased risk of developing malignant mutations observed in chronic carriers.

By using the organoids a source of cells to develop mucosoid cultures (as previously done for the human stomach) (34), we could generate an advanced model for S. Paratyphi A chronic infection in vitro. The gene expression profile of long-term S. Paratyphi A-infected mucosoid revealed that infection induced an initial cell cycle arrest that did not depend on the DNA damage caused by the typhoid toxin. It has been reported that bacteria use particular cell cycle phases for their invasion or replication. For these reasons they are equipped with factors known as cyclomodulins. Salmonella is known to preferentially invade mitotic cells (67) and is equipped with diverse cyclomodulins, including SpvB and PheA, that induce cell cycle arrest at different phases of the cell cycle depending on the type of infected cell (68). The typhoid toxin and other CdtB containing toxins, such as the cytolethal distending toxins (CDT), are also cyclomodulins since the DNA damage that they induce is known to induce cell cycle arrest, typically at the G₂/M checkpoint (69–72). In the physiological settings of the mucosoids and using S. Paratyphi A, a wild-type typhoid toxin-producing strain, we could again detect DNA damage. However, we could not observe any stronger or longer effect due to the typhoid toxin over other effectors in blocking the cell cycle.

To distinguish the effect of the typhoid toxin over other bacterial effectors, we intoxicated primary epithelial cells derived from the organoids with a functional typhoid toxin obtained from bacterial supernatants. Our data confirm that the DNA damage is due to the action of the CdtB subunit of the typhoid toxin, but we showed in addition that damaged cells failed to arrest their cell cycle, and cells with higher levels of damage actually maintained proliferation. Chronic exposure to sublethal levels of recombinant CDT was previously found to induce genomic instability and anchorage-independent growth in Big Blue rat fibroblasts (25), suggesting that the duration of the exposure rather than the dose of the toxin is the key element that increases the risk of cellular transformation. In chronic carriers, healthy GB cells might get intoxicated with the typhoid toxin from neighboring infected Salmonella Paratyphi A cells or from gallstones coated with the same bacterium. The secretion of the toxin is at such a level that does not impair the cell cycle but still provokes DNA damage.

Future investigations should seek to understand whether the typhoid toxin leaves a genetic mutational signature in the gallbladder, as has been observed for other cancer types that have a signature reflecting the original mutagenic insult (15, 73, 74). Such a signature would provide an important molecular link between Salmonella and associated GBC.

MATERIALS AND METHODS

Human organoid culture.

Human gallbladder epithelial cells were derived from patients that underwent cholecystectomy (for details, see Table 5). The samples were stored in ice-cold phosphate-buffered saline (PBS) for up to 2 h, and then epithelial cell isolation was performed as described previously (75). Briefly, the tissue was washed with PBS from the residual bile and mucus, and it was then incubated at 37°C with the mucosal side facing a solution of 0.2% collagenase type IV. The mucosa was abraded thoroughly with the end of a glass microscope slide held at an angle of 45° every 5 min four times. The isolated cells were passed through a cell strainer with 70-μm pores and spun down, and 1 to 3 million cells were resuspended in a drop of 50 μl of Matrigel. The polymerized Matrigel drop was then supplemented with a medium based on Advanced/DMEM/F-12 (Invitrogen; described in Table 1). The medium was replaced twice a week. Every 7 to 10 days, the organoids were split at a ratio 1 to 3 or 4 by treatment with trypsin and then passed 10 times through a heat-narrowed Pasteur pipette. In the experiments in which single cells were seeded, trypsin-treated organoids were also passed through a 40-μm-pore cell strainer before seeding them in Matrigel.

TABLE 5.

Patient information

ID	Age (yr)	Gender	Comments
GB6	66	F	Cholecystectomy due to presence of gallstones and inflammation.
GB10	61	F	Cholecystectomy due to presence of gallstones and inflammation.
GB11	56	M	Cholecystectomy due to presence of gallstones and inflammation.
GB12	37	M	Cholecystectomy due to polyps in the gallbladder; we got a healthy piece
GB13	66	M	Adenocarcinoma of the gastroesophageal junction, type III, otherwise healthy GB; patient received neoadjuvant chemotherapy before surgery and preventive cholecystectomy.
GB16	65	F	Gastric carcinoma, otherwise healthy GB; patient underwent gastrectomy and preventive cholecystectomy.

Murine organoid culture.

Murine gallbladders were derived from mice with C57BL/6J genetic background. After sacrificing the mouse, the gallbladder was resected, cut in four pieces, and incubated in a thermal mixer at 37°C in 2 ml of TrypLE (Thermo Scientific) for 45 min. The tissue pieces were pipetted up and down five times to release the cells, big pieces were removed, and isolated cells were centrifuged, washed with Dulbecco modified Eagle medium (DMEM), and then seeded in 50-μl Matrigel drops. The polymerized Matrigel drop was then supplemented with the medium described in Table 1. The medium was replaced twice a week. The splitting procedure was the same as that described for the human organoids.

Human gallbladder mucosoid culture.

The generation of the human gallbladder mucosoids follows a protocol that was previously published for the healthy human stomach (34). Briefly, single cells derived from organoid cultures were seeded on collagen-coated filters of Millicell standing cell culture inserts (Millipore, PIHP01250) at 150,000 cells/insert in primary cell medium (refer to Table 1 for more detail). Cells were incubated at 37°C, and the medium in the surrounding well was changed daily for the first 5 days, followed by twice a week. After 3 days, the medium on the filter was removed, and cells started to produce mucus that was withdrawn during medium change. Once a month, the mucosoids were split at a ratio of 1:3 by incubating the apical and basal sides of the mucosoids with trypsin-EDTA (0.5%). Single cells were reseeded again on new coated cell culture inserts.

Lineage tracing.

For lineage tracing experiments, we used murine gallbladder organoids derived from C57BL/6J, Lgr5-EGFP-IRES-CreERT2, ROSA-mTmG^floxed mice. At 5 days after seeding, 10 μM 4-hydroxytamoxifen (4HT; Sigma) was added to the medium, and the mixture was kept for 2 days. The induction was performed only once.

Microarray.

Organoids were harvested 4 or 14 days (small and big organoids, respectively) after seeding. The Matrigel drops containing the organoids were dissolved in 1 ml of TRIzol (Life Technologies), and RNA was isolated as described in the manufacturer’s protocol using glycogen as a coprecipitant. For mucosoids, filters were cut from the insert and dissolved thoroughly in 1 ml of TRIzol. Quality control and quantification of total RNA was assessed using a 2100 bioanalyzer (Agilent Technologies) and a NanoDrop 1000 UV-Vis spectrophotometer (Kisker).

(i) Organoids. Microarray experiments were performed as independent dual-color dye-reversal color-swap hybridizations using two biological replicates each. Total RNA was amplified and labeled with a dual-color Quick-Amp labeling kit (Agilent Technologies). In brief, mRNA was reverse transcribed and amplified using an oligo-dT-T7 promoter primer and labeled with cyanine 3-CTP or cyanine 5-CTP. After precipitation, purification, and quantification, 0.75 μg of each labeled cRNA was fragmented and hybridized to custom whole-genome human multipack microarrays (8 × 60k; Agilent, 048908) according to the supplier’s protocol (Agilent Technologies). Scanning of microarrays was performed at 3-μm resolution using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with Image Analysis/Feature Extraction software G2567AA vA.11.5.1.1 (Agilent Technologies) using default settings and the GE2_1105_Oct12 extraction protocol. The extracted dual-color raw data .txt files were further analyzed using R and the associated BioConductor package limma (76). Microarray data have been deposited in the Gene Expression Omnibus (GEO; www.ncbi.nlm.nih.gov/geo/) of the National Center for Biotechnology Information and can be assessed with the GEO accession number GSE100656.

For GSEA, a gene set of β-catenin target genes published previously (44) and human pluripotent stem cell genes published by Mallon et al. (42) (Tables 2 and 3) were used, and GSEA was performed on genes preranked by gene expression-based t score between early and differentiated organoids, using the fgsea R package (77) with 5,000 permutations. Wnt family member’s average intensities were calculated by global average in all the conditions. They were then filtered for an average intensity of >6. The differentially expressed ones were then identified as having a P value of <0.05.

(ii) Mucosoids. Single-color hybridizations using two technical replicates each were conducted. Microarrays used had design Agilent-014850 whole human genome microarray 4x44K G4112F (Agilent Technologies) and were read using the machines and software of the same manufacturer. The extracted raw data .txt files were further analyzed using R and the associated BioConductor package limma (76). Since MSigDB gene sets use human gene symbols to map genes to pathways, mouse symbols were translated to homologous human symbols using HomologeneDB from NCBI. GSEA was also performed on gene sets for cell cycle associated genes (58) from MSigDB v7.0 (PMID 21546393) (Table 4) between wild-type (w.t.) and ΔcdtB strain-infected mucosoid versus non-infected at 2 and 7 days post infection.

For human gene sets (i.e., MSigDB and those derived from human experiments), the full set of genes in the DGE results after collapsing t scores by gene and ranking was used. To analyze the mouse gene sets, the DGE data were restricted to probe sets that have a homologous gene in mice and humans. For these probe sets, the one with the highest t score and rank in the resulting list was selected and subsequently used for fGSEA analysis.

Expression data were analyzed as follows. For each of the selected comparisons, the replicates of the target condition were compared to the corresponding control using limma, producing differential expression statistics for all genes and comparisons. Analyses were performed as individual two-group unpaired comparisons: 2-day infection, w.t. versus NI; 2-day infection, ΔcdtB versus NI; 2-day infection, ΔcdtB versus w.t.; 7-day infection, w.t. versus NI; 7-day infection, ΔcdtB versus NI; and 7-day infection, ΔcdtB versus w.t.

The interpreting plotting of the results was done using Microsoft Excel, and the software R/R Studio was used to create the plots for the heatmaps. The heatmaps were plotted by using the normalized expression values (log-normalized intensity) again normalized on the non-infected control of each time point (logFC) when expression data from single genes were plotted and the calculated NES scores, respectively, for pathway analysis.

Immunofluorescence.

Organoids were removed from Matrigel at the indicated time point by washing with ice-cold PBS and then fixed with 3.7% paraformaldehyde. Tissue pieces were washed with PBS and fixed. After fixation, organoids and tissue pieces were embedded in paraffin and cut with a microtome to get 5-μm slices. Cells seeded in 2D (two dimensions) were washed with PBS and fixed. For whole-mount staining, the organoids were fixed directly in the Matrigel drop and then stained. The staining was performed with the antibodies and dyes listed in Table 6. Images were acquired with a Leica TCS SP-8 confocal microscope. For immunofluorescence of the mucosoids, the filters were cut form the insert, and pieces of the filters were blocked in a bovine serum albumin-containing blocking buffer for 3 h for whole-mount staining. Alternatively, the filters were fixed overnight in 4% paraformaldehyde (PFA) at 4°C, washed, embedded orthogonally in Histogel (HG-4000-144) inside a casting mold, and paraffinized overnight in a Leica TP1020 tissue processor. The paraffin blocks were generated inside a casting mold on a Paraffin console (Microm). Next, 5-μm sections were cut with a paraffin rotation microtome (Microm). For dewaxing and antigen retrieval, sample slides were washed twice with xylene (10 min), followed by a descending series of alcohols (20 s each), followed by two washes with water and 30 min in target retrieval solution (Dako) at 95°C and 20 min at room temperature and 5 min under running water. Primary antibodies were diluted in the blocking solution: in-house-made anti-γH2AX conjugated to ATTO488 (a green fluorescent dye; 1:500), phalloidin-Alexa 647 (lot 1731699; 1:100), and Hoechst (1:1,000; Sigma, B2261, lot 019K4029). Antibodies were incubated overnight at room temperature in the dark. Next, filter pieces were washed three times with blocking solution for 3 h at room temperature in the dark. The stained filters were mounted in Vectashield (Vector Laboratories, H-1500) on a glass slide, and the images were acquired using an SP-8 confocal microscope. The pictures are a result of a projection of multiple z-stacks analyzed with the software ImageJ.

TABLE 6.

Antibodies and dyes

Antibody	Supplier	Catalog no.	Source	Application(s) (dilution)a
Anti-β-Actin (AC-15)	Sigma	A5441	Mouse monoclonal	WB (1:10,000)
E-cadherin (clone CD324)	BD	562869	Mouse monoclonal	IF (1:300), WB (1:500)
Ki67 (D2H10)	Cell Signaling	9027	Rabbit monoclonal	IF (1:200)
PCNA (csPC10)	Cell Signaling	2586	Mouse monoclonal	IF (1:100)
Phospho-histone H2A.X (Ser139) (clone JBW301)	Millipore	05-636-I	Mouse monoclonal	WB (1:200)
Phospho-histone H2A.X (Ser139)-conjugated FITCS	In house		Mouse monoclonal	IF (1:500)
β-Catenin	Sigma	C2206	Rabbit polyclonal	IF (1:300), WB (1:500)
Claudin-2	Abcam	ab53032	Rabbit polyclonal	IF (1:200), WB (1:500)
Cytokeratin 19 (EP1580Y)	Abcam	ab52625	Rabbit monoclonal	IF: 1:500), WB (1:5,000)
Muc5B	Abcam	ab87376	Rabbit polyclonal	IF (1:300)
Vimentin (D21H3)	Cell Signaling	5741	Rabbit monoclonal	WB (1:1,000)
Hoechst (bisbenzimide H 33258)	Sigma	H6024		IF (1:1,000)
Draq5	Abcam	ab108410		IF (1:1,000)
Phalloidin 647	Invitrogen	A22287		IF (1:500)

^aWB, Western blotting; IF, immunofluorescence.

Transmission electron microscopy.

Infected and non-infected gallbladder mucosoids were washed in-well with PBS, fixed with 4% PFA for 30 min, and washed twice with PBS. Filters were cut from the insert and cropped into pieces with bacterial patches under visual control. Cropped filter pieces were stored in PBS at 4°C until use. For fine structural analysis, cell layers on filters were fixed with 2.5% glutaraldehyde, postfixed with 0.5% osmium tetroxide, contrasted with uranyl acetate and tannic acid, dehydrated in a graded ethanol series, and infiltrated in Polybed (Polysciences). Cut-out pieces of the filters were stacked in flat embedding molds with Polybed. After polymerization, specimens were cut at 60 nm and contrasted with lead citrate. Specimens were analyzed in a Leo 906E transmission electron microscope (Zeiss, Oberkochen, Germany) equipped with a side-mounted digital camera (Morada, SIS-Olympus, Münster, Germany). Figures were assembled with the help of a FigureJ-Plugin (78).

Western blotting.

For the Western blots, organoids and cells seeded in 2D were harvested in Laemmli buffer, and 12% SDS-PAGE gels were run and transferred to a nitrocellulose membrane, which was then blotted with the antibodies listed in Table 6. Densitometry was calculated using ImageJ software.

Functional assay.

The functional assay is a modified version of a previously described assay (54). Briefly, 1 week after seeding, the organoids were incubated with DMEM/F-12 (Invitrogen) containing 100 μM rhodamine-123 (Sigma) for 5 min, washed with three times with PBS, and supplemented with the regular medium. Images were taken every minute with a Leica SP-E confocal microscope for 30 min. Temperature and CO₂ concentration were kept at 37°C and 5%, respectively. To show that transport of rhodamine-123 depends on activity of multidrug-resistant (MDR) gene products, the organoids were incubated with 10 μM verapamil (Sigma), an MDR inhibitor, for 30 min before rhodamine-123 was added. As a negative control, gastric organoids were used, cultivated as previously described (28).

Bacterial strains.

Salmonella enterica serovar Paratyphi A (ATCC 9150) was used for the infection experiments. An isogenic mutant knockout of cdtB was generated by interrupting the gene with a kanamycin resistance cassette. Briefly, two sequences were amplified upstream and downstream cdtB using the primers TCTATAGTTGTCTCTTTGGTATTAAC and CGCGGATCCACCATAAGAATATCC for the region upstream and the primers CGCGGATCCATATAAGATATATCT and ACAGCTTCGTGCCAAAAAGG for the region downstream. After insertion in a pGEM-T Easy vector (Promega), a kanamycin resistance cassette was inserted in between by making use of the BamHI sites included in the primers. The resulting region was PCR amplified and electroporated in Salmonella, and the clones where homologous recombination occurred were selected, as described previously (79). If mentioned, to visualize the bacteria, the w.t. and ΔcdtB strains were additionally transformed with pLS002, a plasmid carrying the constitutively expressed mCherry gene and an ampicillin resistance cassette.

Infection experiments.

Organoids were removed from Matrigel by washing with ice-cold PBS, mechanically sheared by pipetting them three times through a heat-narrowed Pasteur pipette, and incubated at 37°C with 300 μl of primary medium containing log-phase Salmonella to a multiplicity of infection of 100 for 2 h. The cells were pelleted and washed twice with PBS before reseeding them in Matrigel. The gentamicin protection assay was performed by incubation for 1 h in primary medium supplemented with 100 μg/ml gentamicin. At this point, the invasion assay was performed. The organoids were removed from Matrigel and washed twice with PBS, the membrane was permeabilized by 2 min of incubation with 1% Triton X-100, and then sequential dilutions were plated on LB agar plates. The following day, colonies were counted as follows: invasion percentage = (CFU recovered from the infected organoids/bacteria used for infection) × 100. In the well with the remaining infected organoids, the concentration of gentamicin was decreased to 10 μg/ml for the duration of the experiment (80). Infection of mucosoids with Salmonella was done accordingly: log-phase mCherry-transformed Salmonella was administered on the filter to a multiplicity of infection of 100 for 24 h by using a penicillin-streptomycin-free 3D gallbladder medium (see Table 1). The infection medium was then removed, the filters and wells were washed with 37°C PBS, and the gentamicin protection assay was performed by incubation for 1 h in primary medium supplemented with 100 μg/ml gentamicin. The gentamicin concentration was then reduced to 10 μg/ml and withdrawn completely at 48 h post infection. The cells were washed, and the medium was refreshed every 2 days.

Intoxication experiments.

Organoids were split to single cells, seeded onto a type I collagen (Thermo Fisher, A10644-0)-coated plastic (10 μg/cm²) or glass (15 μg/cm²) surface, supplemented with the conventional 3D medium, and intoxicated when 50% confluence was reached. The typhoid toxin-containing Salmonella supernatant was prepared by using a modified version of a previously described protocol (19). Briefly, the bacteria were grown in Luria-Bertani overnight, diluted 1:50 in MM5.8 (19, 81), and then grown overnight until the optical density at 600 nm reached 0.4 to 0.5. The bacteria were then removed by centrifugation and subsequent filtration through 0.4-μm-pore filters. The supernatant was then concentrated 20-fold using an Amicon Ultra-15 column. It was then diluted 1 to 20 in primary medium and incubated for 24 h with the cells. As a positive control, the cells received 50 μM etoposide (Sigma) for 24 h.

Neutral comet assay.

The neutral comet assay was performed after intoxication using the kit from Trevigen according to the manufacturer´s protocol. Images were acquired using fluorescence microscope (Leica DMR). The percentage of DNA in the tail (which is a measure of DNA damage) was quantified using Comet Score software (TriTek).

Data availability.

Microarray data have been deposited in the Gene Expression Omnibus (GEO; www.ncbi.nlm.nih.gov/geo/) of the National Center for Biotechnology Information and can be accessed under GEO accession number GSE100656.