Skip to main content
mBio logoLink to mBio
. 2020 Sep 22;11(5):e01911-20. doi: 10.1128/mBio.01911-20

Genotoxic Effect of Salmonella Paratyphi A Infection on Human Primary Gallbladder Cells

Ludovico P Sepe a,*,#, Kimberly Hartl a,b,c,#, Amina Iftekhar a, Hilmar Berger a, Naveen Kumar a, Christian Goosmann a, Sascha Chopra d, Sven Christian Schmidt d,e, Rajendra Kumar Gurumurthy a, Thomas F Meyer a,✉, Francesco Boccellato a,f,✉
Editor: Bruce A McClaneg
PMCID: PMC7512552  PMID: 32963006

Bacterial infections are increasingly being recognized as risk factors for the development of adenocarcinomas. The strong epidemiological evidence linking Helicobacter pylori infection to stomach cancer has paved the way to the demonstration that bacterial infections cause DNA damage in the host cells, initiating transformation. In this regard, the role of bacterial genotoxins has become more relevant. Salmonella enterica serovars Typhi and Paratyphi A have been clinically associated with gallbladder cancer. By harnessing the stem cell potential of cells from healthy human gallbladder explant, we regenerated and propagated the epithelium of this organ in vitro and used these cultures to model S. Paratyphi A infection. This study demonstrates the importance of the typhoid toxin, encoded only by these specific serovars, in causing genomic instability in healthy gallbladder cells, posing intoxicated cells at risk of malignant transformation.

KEYWORDS: DNA damage, gallbladder, mucosoid cultures, organoid cultures, Salmonella, typhoid toxin, gallbladder cancer

ABSTRACT

Carcinoma of the gallbladder (GBC) is the most frequent tumor of the biliary tract. Despite epidemiological studies showing a correlation between chronic infection with Salmonella enterica Typhi/Paratyphi A and GBC, the underlying molecular mechanisms of this fatal connection are still uncertain. The murine serovar Salmonella Typhimurium has been shown to promote transformation of genetically predisposed cells by driving mitogenic signaling. However, insights from this strain remain limited as it lacks the typhoid toxin produced by the human serovars Typhi and Paratyphi A. In particular, the CdtB subunit of the typhoid toxin directly induces DNA breaks in host cells, likely promoting transformation. To assess the underlying principles of transformation, we used gallbladder organoids as an infection model for Salmonella Paratyphi A. In this model, bacteria can invade epithelial cells, and we observed host cell DNA damage. The induction of DNA double-strand breaks after infection depended on the typhoid toxin CdtB subunit and extended to neighboring, non-infected cells. By cultivating the organoid derived cells into polarized monolayers in air-liquid interphase, we could extend the duration of the infection, and we observed an initial arrest of the cell cycle that does not depend on the typhoid toxin. Non-infected intoxicated cells instead continued to proliferate despite the DNA damage. Our study highlights the importance of the typhoid toxin in causing genomic instability and corroborates the epidemiological link between Salmonella infection and GBC.

INTRODUCTION

Gallbladder cancer (GBC) is an adenocarcinoma with very poor prognosis because early stages are often asymptomatic and few patients can be cured with surgery at initial presentation (1). Although uncommon in Western countries, it has relatively high incidence in the western parts of South America and in the northern part of the Indian subcontinent (2). An intriguing aspect is its putative link to chronic carriage of Salmonella enterica serovar Typhi/Paratyphi A. In these patients, Salmonella resides in the gallbladder (GB) both intracellularly and extracellularly by forming biofilms on gallstones (3–5), which serve as a reservoir from where bacteria are intermittently shed into the duodenum (6). A higher incidence of GBC in chronic carriers was first observed after an outbreak of Salmonella enterica in Aberdeen, Scotland (7), an observation confirmed by subsequent epidemiological studies (8, 9).

Epidemiological associations with cancer have also been shown for several other bacterial pathogens. However, studies that illuminate the underlying mechanisms are only just emerging and suggest that infection can lead to genomic instability, which may contribute to the development of cancer (10). Helicobacter pylori, Escherichia coli, and Chlamydia trachomatis have been shown to induce DNA double-strand breaks (DSBs) in host cells (11–15). Evidence suggests that infection with some species not only causes the production of reactive oxygen species (ROS) that induce DNA damage in the host, but can also modify the DNA damage response and thereby induce error-prone mechanisms of repair (10).

Salmonella enterica provokes direct genotoxicity through the action of a crucial effector, the typhoid toxin (16), which is only expressed by the human-specific serovars Typhi (17) and Paratyphi A (18). It has been hypothesized that Salmonella enterica delivers the typhoid toxin through secreted outer membrane vesicles after internalization into the host cell (19, 20). More recently, it has been found that a specific interaction of a subunit of the typhoid toxin (PtlB) with luminal receptors allows the loading of the toxin from the Salmonella-containing vacuoles into vesicle carriers (21).

Typhoid toxin is able to induce direct DNA DSBs via its CdtB subunit, a DNase that is translocated into the nucleus of the intoxicated cell (19, 20, 22). CdtB also exists as part of another bacterial toxin: the cytolethal distending toxin (CDT), which is produced by multiple Gram-negative bacterial species, including Helicobacter hepaticus (23). Here, as well, it has been directly linked to tumor development in vivo and in vitro (24, 25).

Commonly used cell lines in infection biology are mostly derived from cancerous tissues, limiting their utility for studies of early carcinogenic events, since they are already transformed and have alterations in key cellular signaling pathways. Since the epithelium is the prime target of infections and toxins, the development of organoid-based human primary cell models is an invaluable means for illuminating the molecular mechanisms by which bacteria could promote cancer. While organoid or derivative models of human gastrointestinal epithelia from the small intestine (26), colon (27), stomach (28, 29), and intrahepatic duct (30) are available, such a system was developed for murine (31) and human (32) gallbladders only very recently and has not yet been utilized for infection studies (33, 34). A robust in vitro model that recapitulates the infection dynamics in healthy human gallbladder epithelium would be of immense value in this regard.

Developing from the foregut, the outer lining of the gallbladder consists of a simple columnar epithelium without any gland or crypt structures. The cells tend to moderately produce mucins (35) and transport bile and organic ions (36–38). They share many similarities with the cholangiocytes of the intrahepatic bile duct (39), and therefore the stem cells of the adult gallbladder might express similar markers, such as CD44, CD13, and LGR5 (40, 41) and also depend on activation of the Wnt/β-catenin pathway for their maintenance (30).

Here, we describe the establishment of human gallbladder organoids and their adaptation into more physiological polarized monolayers. We use these systems to study the human-restricted, GBC-associated Salmonella enterica serovar Paratyphi A and, specifically, the effect of the typhoid toxin on healthy cells. These new models will serve as a useful resource to investigate the interaction of Salmonella and its toxin with authentic human tissue.

RESULTS

Maintenance of adult gallbladder epithelial stem cells depends on activation of the Wnt/β-catenin pathway.

Primary epithelial cells from human and murine gallbladder (GB) were isolated and grown in Matrigel supplemented with defined medium (Table 1). After 3 to 5 days, the cells started to form hollow spheres, reaching up to 1 mm in diameter (Fig. 1A for humans; see Fig. S1A in the supplemental material for mice). Organoids were passaged every 7 to 10 days by enzymatic and mechanical shearing, and the resulting cells were seeded in fresh Matrigel for further expansion. Cultures expanded indefinitely for murine cells and for human cells. Fluorescence immunohistochemistry for the proliferation markers Ki67 and PCNA showed randomly distributed positive cells at early and late passages (Fig. 1B for humans; see Fig. S1B in the supplemental material for mice). Since only a small fraction of the cells has the ability to form organoids, we assumed that growing organoids accumulate mainly differentiated cells. We therefore analyzed the transcriptome profile of early (4-day-old) versus late (14-day-old) organoids, which confirmed that only the former were enriched in stem cell markers (42) (Fig. 1C and Table 2), indicating their undifferentiated state.

TABLE 1.

Cultivation medium composition

Reagenta Supplier Catalog no. Working concentration
Human medium
    Advanced/DMEM/F-12 Invitrogen 12634-010
    R-spondin 1 conditioned medium In house 25%
    B27 Invitrogen 17504-044 1×
    N2 Invitrogen 17502-048 1×
    Human epidermal growth factor (EGF) Invitrogen PHG0311 20 ng/ml
    Human noggin Peprotech 120-10C 150 ng/ml
    Human fibroblast growth factor (FGF)-10 Peprotech 100-26 150 ng/ml
    Nicotinamide (NIC) Sigma N0636 10 mM
    A 83-01 (TGF-β type I receptor ALK-5 inhibitor) Calbiochem 2939 1 μM
    Forskolin (FSK) Tocris 1099 10 μM
    Human hepatocyte growth factor (HGF) Peprotech 100-39 25 ng/ml
    Y-27632 (ROCK inhibitor)* Sigma Y0503 7.5 μM
    Penicillin-streptomycin** Invitrogen 15140122 1 U/ml
    IWP-2*** Merck Millipore 681671 10 μM
    Wnt3a conditioned medium*** In house 25%
Murine medium
    Advanced/DMEM/F-12 Invitrogen 12634-010
    R-spondin 1 conditioned medium In house 25%
    B27 Invitrogen 17504-044 1×
    N2 Invitrogen 17502-048 1×
    Murine epidermal growth factor (mEGF) Invitrogen PMG8044 50 ng/ml
    Murine noggin Peprotech 250-38 100 ng/ml
    Nicotinamide (NIC) Sigma N0636 10 mM
    A 83-01 (TGF-β type I receptor ALK-5 inhibitor) Calbiochem 2939 1 μM
    Y-27632 (ROCK inhibitor)* Sigma Y0503 7.5 μM
    Penicillin-streptomycin** Invitrogen 15140122 1 U/ml
a

*, Added only for the first 4 days after seeding; **, not added in infection experiments; ***, only if mentioned.

FIG 1.

FIG 1

Cultivation of human gallbladder organoids and dependence on the Wnt/β-catenin pathway activation. (A) Gallbladder epithelial cells were isolated and grown as described in Materials and Methods. Pictures were taken 0, 4, and 8 days after seeding and at passages 1, 3, 5, 8, and 10. Scale bar, 1 mm. (B) Gallbladder organoids were fixed 7 days after seeding. Organoids were paraffinized, sectioned, and immunostained for the proliferation marker Ki67 (green), β-catenin (red). DRAQ5 was used to stain the nuclei (blue). (C) Gene set enrichment analysis of human pluripotent stem cell genes published by Mallon et al. (42) among genes regulated in early versus late organoids, as identified by microarray. Adjusted P value = 0.00039, enrichment score = 0.6, normalized enrichment score = 1.9. (D) Organoids at passage 1 were split to single cells and seeded, and the number of resulting organoids was counted 5 to 7 days later (i.e., at passage 2), in media + or − Wnt3A and + or − Rspo1. The organoids were kept in culture and the procedure was repeated after 8 passages (i.e., at passage 10). *, P < 0.05 (t test). (E) Organoids were split to single cells which were seeded in Matrigel and provided with media + or − the Wnt inhibitor IWP-2 and + or − 25% of Wnt3a conditioned medium. The number of resulting organoids was counted 5 to 7 days later. *, P < 0.05; ****, P < 0.00005. (F) Change in expression levels of Wnt family members observed in a microarray comparing early versus late organoids. Only transcripts with an average log2 expression of >6 are shown. *, P < 0.05 (t test). (G) Gene set enrichment analysis of β-catenin targets published by Herbst et al. (44) among genes regulated in early versus late organoids as identified by microarray. Adjusted P value = 0.0015, enrichment score = 0.61, normalized enrichment score = 1.8. (H) Lineage tracing of murine organoids derived from the Lgr5 reporter mouse, Lgr5-EGFP-IRES-CreERT2, ROSA-mTmGfloxed after HT induction. The number of organoids derived from Lgr5+ cells (green) and Lgr5– cells (red) was counted at each passage 5 to 7 days after seeding. The plot shows the percentage of each population compared to the total number of organoids. Bars indicate the standard deviations (SD).

TABLE 2.

List of differentially regulated stem cell related genes in early organoids versus late organoids

Probe Gene symbol RefSeq Entrez ID logFC Avg expression t score P
A_23_P374844 GAL NM_015973 51083 5.55 9.38 23.45 0.00
A_24_P225616 RRM2 NM_001034 6241 4.23 9.90 26.43 0.00
A_24_P397107 CDC25A NM_001789 993 3.39 10.26 23.07 0.00
A_32_P194264 CHAC2 NM_001008708 494143 2.75 10.21 9.17 0.01
A_33_P3286208 LRR1 NM_203467 122769 2.61 8.83 20.53 0.00
A_33_P3332126 SCLY ENST00000409736 51540 2.45 9.74 17.13 0.00
A_33_P3387856 CENPN NM_001100625 55839 2.42 6.42 6.88 0.01
A_23_P88740 CENPN NM_018455 55839 2.22 12.96 12.74 0.00
A_24_P83678 MMS22L NM_198468 253714 2.14 8.86 8.09 0.01
A_23_P325040 TMPO NM_003276 7112 2.14 8.95 13.02 0.00
A_23_P56553 METTL8 NM_024770 79828 2.07 10.98 12.13 0.00
A_33_P3253707 LRR1 NM_152329 122769 2.06 12.60 14.00 0.00
A_33_P3379886 FGF2 NM_002006 2247 1.99 6.35 3.18 0.07
A_23_P217637 TIMM8A NM_004085 1678 1.94 11.61 11.10 0.00
A_33_P3419696 FGF2 NM_002006 2247 1.92 7.69 4.99 0.03
A_24_P49747 HMGB3P24 ENST00000433260 NAa 1.89 6.61 15.70 0.00
A_33_P3489737 NLN NM_020726 57486 1.86 10.59 5.83 0.02
A_24_P244699 NUDT15 NM_018283 55270 1.81 9.55 6.06 0.02
A_24_P178093 TOMM40 NM_006114 10452 1.77 8.62 10.80 0.00
A_32_P95914 MMS22L NM_198468 253714 1.75 9.70 6.71 0.01
A_23_P143958 RPL22L1 NM_001099645 200916 1.66 16.39 8.91 0.01
A_24_P336853 PNO1 NM_020143 56902 1.61 10.31 12.46 0.00
A_33_P3357082 METTL8 NM_024770 79828 1.59 9.10 13.84 0.00
A_23_P82823 PINX1 NM_017884 54984 1.57 10.41 10.49 0.00
A_23_P209337 METTL21A NM_145280 151194 1.56 10.87 6.70 0.01
A_33_P3250861 ZIC3 ENST00000370606 7547 1.29 4.62 1.57 0.24
A_23_P144337 CCRN4L NM_012118 25819 1.29 3.26 6.09 0.02
A_32_P25273 HSPD1 NM_002156 3329 1.24 17.11 11.51 0.00
A_23_P150092 SEPHS1 NM_012247 22929 1.21 12.66 7.32 0.01
A_21_P0000006 TOMM40 NM_001128917 10452 1.21 13.86 9.57 0.01
A_33_P3412613 TMPO NM_001032283 7112 1.18 5.82 6.27 0.02
A_23_P202143 NOLC1 NM_004741 9221 1.13 12.02 4.96 0.03
A_33_P3619171 PMAIP1 NM_021127 5366 1.09 10.98 4.95 0.03
A_24_P253215 EMG1 NM_006331 10436 1.07 12.98 6.16 0.02
A_32_P71788 FKBP4 NM_002014 2288 1.06 8.96 9.26 0.01
A_24_P357266 GRPR NM_005314 2925 1.01 4.42 1.66 0.22
A_23_P136504 SLC25A21 NM_030631 89874 1.01 5.54 3.14 0.07
A_24_P297888 MTAP NM_002451 4507 1.00 9.97 7.12 0.01
A_33_P3256425 BICD1 NM_001714 636 0.94 6.25 2.98 0.08
A_23_P345065 SCLY NM_016510 51540 0.93 10.96 3.47 0.06
A_23_P160881 SMPDL3B NM_001009568 27293 0.93 9.95 2.62 0.10
A_23_P27167 RNASEH1 NM_002936 246243 0.93 11.31 5.67 0.02
A_23_P365060 MDN1 NM_014611 23195 0.92 6.39 7.63 0.01
A_33_P3388135 MKKS NM_170784 8195 0.92 13.58 3.97 0.04
A_23_P164141 PSME3 NM_176863 10197 0.89 10.79 7.38 0.01
A_23_P156842 EEF1E1 NM_004280 9521 0.89 13.42 7.96 0.01
A_33_P3287815 DDX21 NM_004728 9188 0.87 13.48 8.11 0.01
A_23_P43726 NUP160 NM_015231 23279 0.86 11.39 6.96 0.01
A_21_P0011842 EEF1E1 NM_001135650 9521 0.86 13.35 5.47 0.02
A_23_P131954 SNX5 NM_014426 27131 0.86 15.01 4.18 0.04
A_23_P148484 RLIM NM_016120 51132 0.86 10.97 3.37 0.06
A_23_P252362 MRPS30 NM_016640 10884 0.86 10.49 6.46 0.01
A_24_P134727 TFAM NM_003201 7019 0.83 9.21 7.42 0.01
A_23_P214907 MTHFD1L NM_015440 25902 0.82 9.75 2.11 0.15
A_23_P256148 AKIRIN1 NM_024595 79647 0.81 11.04 3.58 0.05
A_33_P3287502 MSH2 NM_000251 4436 0.77 11.49 5.50 0.02
A_23_P128991 SLIRP NM_031210 81892 0.77 14.35 2.63 0.10
A_33_P3285444 TERF1 NM_017489 7013 0.76 4.75 1.48 0.26
A_24_P50458 TERF1 NM_017489 7013 0.76 12.20 3.75 0.05
A_33_P3242659 KIF13A NM_022113 63971 0.70 5.56 3.56 0.05
A_33_P3329108 MTAP NM_002451 4507 0.69 11.71 3.99 0.04
A_23_P333951 DNAH14 NM_144989 127602 0.67 9.74 2.67 0.10
A_23_P137484 L1TD1 NM_019079 54596 0.67 5.12 5.21 0.02
A_23_P128372 FKBP4 NM_002014 2288 0.65 12.78 4.38 0.04
A_33_P3294404 AKIRIN1 NM_024595 79647 0.64 10.32 3.56 0.05
A_23_P216149 TERF1 NM_017489 7013 0.64 11.57 1.77 0.20
A_23_P102471 MSH2 NM_000251 4436 0.59 12.22 5.40 0.02
A_24_P854913 METTL21A NM_001127395 151194 0.56 11.08 1.39 0.28
A_23_P54540 EIF2AK4 NM_001013703 440275 0.55 11.76 3.94 0.04
A_23_P94636 RC3H2 NM_018835 54542 0.49 9.40 4.46 0.03
A_23_P146997 TXLNG NM_018360 55787 0.48 9.65 1.61 0.23
A_33_P3389188 TFAM NM_003201 7019 0.47 12.74 1.88 0.18
A_33_P3354267 AKIRIN1 NM_024595 79647 0.47 11.81 3.21 0.07
A_33_P3283906 NIP7 NM_016101 51388 0.46 12.12 3.33 0.06
A_33_P3345504 RC3H2 NM_018835 54542 0.45 7.47 4.19 0.04
A_33_P3299776 NODAL NM_018055 4838 0.45 3.81 1.54 0.25
A_32_P220696 TERF1 NM_017489 7013 0.45 10.55 1.81 0.19
A_23_P213908 PHAX NM_032177 51808 0.44 13.19 3.43 0.06
A_24_P192434 TERF1 NM_017489 7013 0.44 10.44 1.56 0.24
A_33_P3241786 ADD2 NM_017482 119 0.40 3.31 1.34 0.29
A_32_P87531 DNAH14 NM_001145154 127602 0.35 8.81 1.17 0.35
A_33_P3269453 BPTF ENST00000342579 2186 0.34 10.51 1.74 0.20
A_21_P0000013 TIMM8A NM_001145951 1678 0.34 10.14 2.88 0.08
A_33_P3278118 CASP3 NM_004346 836 0.32 8.43 0.86 0.47
A_23_P134008 USP45 ENST00000472914 85015 0.31 9.59 1.34 0.29
A_33_P3297978 MYO1E NM_004998 4643 0.30 14.27 2.24 0.13
A_24_P127691 DNAH14 ENST00000495456 127602 0.29 4.94 1.91 0.18
A_33_P3289996 USP45 NM_001080481 85015 0.27 7.74 2.52 0.11
A_24_P281975 GNPTAB NM_024312 79158 0.25 11.60 1.16 0.35
A_24_P215407 DDX6 NM_004397 1656 0.25 8.91 2.20 0.14
A_33_P3289995 USP45 ENST00000369232 85015 0.24 4.91 2.23 0.14
A_33_P3409506 C9orf85 NM_182505 138241 0.20 8.88 1.66 0.22
A_32_P104478 FGD6 NM_018351 55785 0.17 11.00 0.86 0.47
A_33_P3418294 DNAH14 NM_001373 127602 0.15 3.15 1.24 0.32
A_24_P51118 MTAP NM_002451 4507 0.14 10.15 0.28 0.80
A_23_P214354 EXOC2 NM_018303 55770 0.11 8.27 0.33 0.77
A_33_P3235340 DDX18 NM_006773 8886 0.11 13.07 0.98 0.42
A_33_P3269976 GAL ENST00000538401 51083 0.10 2.93 0.84 0.48
A_23_P86504 C10orf76 NM_024541 79591 0.10 11.60 0.74 0.53
A_33_P3291976 TERF1 ENST00000518695 7013 0.07 5.35 0.46 0.69
A_23_P92410 CASP3 NM_004346 836 0.06 14.49 0.52 0.65
A_32_P44775 C9orf85 NM_182505 138241 0.05 9.97 0.38 0.73
A_33_P3414669 RLIM NM_183353 51132 0.04 6.26 0.40 0.72
A_23_P351215 SKIL NM_005414 6498 0.04 7.47 0.34 0.76
A_24_P152404 C10orf76 ENST00000311122 79591 0.03 10.23 0.16 0.89
A_32_P135243 MTHFD1L NM_015440 25902 0.03 10.60 0.11 0.92
A_32_P80255 DDX6 NM_004397 1656 0.03 10.53 0.15 0.89
A_32_P528967 RTP1 NM_153708 132112 0.02 3.05 0.18 0.87
A_21_P0013574 MTHFD1L NM_001242767 25902 0.02 11.20 0.10 0.93
A_33_P3378972 UNC5D NM_080872 137970 0.01 3.02 0.12 0.92
A_32_P741851 GLB1L3 NM_001080407 112937 0.01 2.96 0.11 0.92
A_23_P140362 VRTN NM_018228 55237 0.01 2.86 0.11 0.92
A_33_P3241782 ADD2 NM_001617 119 0.01 2.76 0.08 0.94
A_23_P72817 GDF3 NM_020634 9573 0.01 2.91 0.05 0.96
A_23_P329798 CER1 NM_005454 9350 0.00 2.67 0.04 0.97
A_23_P5370 RPRM NM_019845 56475 0.00 2.84 0.03 0.98
A_23_P327910 ZIC3 NM_003413 7547 0.00 2.83 0.03 0.98
A_33_P3419632 GLB1L3 ENST00000389887 112937 0.00 3.57 0.01 1.00
A_23_P216118 UNC5D NM_080872 137970 0.00 2.95 0.02 0.99
A_21_P0014207 LOC100506507 XR_108853 NA 0.00 2.66 0.01 0.99
A_23_P380526 DPPA4 NM_018189 55211 0.00 2.81 −0.04 0.97
A_23_P421436 ADD2 NM_017488 119 −0.01 2.84 −0.05 0.96
A_19_P00318232 SHISA9 NM_001145205 729993 −0.01 2.81 −0.06 0.96
A_33_P3280729 SHISA9 NM_001145204 729993 −0.01 2.88 −0.06 0.96
A_23_P137573 LEFTY2 NM_003240 7044 −0.01 2.87 −0.06 0.96
A_24_P235049 MTHFD1L NM_015440 25902 −0.02 11.42 −0.10 0.93
A_32_P213091 SHISA9 NM_001145205 729993 −0.03 4.56 −0.26 0.82
A_23_P375147 RC3H2 ENST00000373670 54542 −0.05 11.16 −0.18 0.87
A_24_P380132 G3BP2 NM_203505 9908 −0.06 14.44 −0.28 0.80
A_23_P70168 TARS NM_152295 6897 −0.11 14.69 −0.58 0.61
A_23_P79962 MKKS NM_170784 8195 −0.11 12.65 −0.85 0.47
A_23_P84070 LARP7 NM_016648 51574 −0.11 12.56 −0.98 0.42
A_33_P3297245 RRAS2 NM_012250 22800 −0.12 14.04 −1.06 0.38
A_24_P332230 LARP7 NM_016648 51574 −0.12 13.09 −0.72 0.54
A_24_P943922 CACHD1 NM_020925 57685 −0.14 4.65 −0.18 0.87
A_33_P3307775 DENR NM_003677 8562 −0.14 7.10 −0.44 0.69
A_33_P3862375 USP45 NM_001080481 85015 −0.14 9.20 −0.32 0.78
A_33_P3234317 RRAS2 NM_012250 22800 −0.15 13.91 −1.31 0.30
A_33_P3378644 PHC1 NM_004426 1911 −0.19 7.01 −1.11 0.37
A_23_P47058 CUZD1 NM_022034 50624 −0.22 8.19 −1.04 0.39
A_23_P215484 CCL26 NM_006072 10344 −0.26 4.06 −1.35 0.29
A_23_P427217 JMJD1C NM_032776 221037 −0.46 9.97 −3.89 0.05
A_23_P346265 GNPTAB NM_024312 79158 −0.47 9.02 −1.41 0.28
A_24_P940125 CNOT6 NM_015455 57472 −0.50 11.75 −4.61 0.03
A_33_P3295523 RAC3 NM_005052 5881 −0.50 12.37 −3.43 0.06
A_23_P25587 LECT1 NM_007015 11061 −0.51 4.69 −1.91 0.18
A_24_P347624 SNURF NM_022804 8926 −0.52 13.32 −1.90 0.18
A_23_P204246 PHC1 NM_004426 1911 −0.55 4.48 −0.98 0.42
A_23_P259127 ESRP1 NM_017697 54845 −0.60 11.38 −1.91 0.18
A_23_P366376 TDGF1 NM_003212 6997 −0.65 7.90 −2.86 0.08
A_24_P144601 POU5F1 NM_002701 5460 −0.66 7.98 −2.07 0.15
A_23_P156809 METTL21A NM_001127395 151194 −0.66 11.71 −5.71 0.02
A_24_P104538 BPTF ENST00000342579 2186 −0.67 9.15 −2.77 0.09
A_21_P0000084 SLC25A21 NM_030631 89874 −0.68 3.26 −1.42 0.27
A_23_P72770 USP44 NM_032147 84101 −0.79 7.71 −7.30 0.01
A_33_P3309206 GABRB3 ENST00000556166 2562 −0.87 4.56 −7.79 0.01
A_23_P59138 POU5F1 NM_002701 5460 −0.99 12.96 −6.27 0.02
A_33_P3227506 BPTF NM_182641 2186 −1.01 9.64 −6.30 0.02
A_33_P3277075 GABRB3 NM_000814 2562 −1.04 8.28 −9.63 0.01
A_24_P52921 BCAT1 NM_005504 586 −1.06 3.48 −4.10 0.04
A_24_P314477 TUBB2B NM_178012 347733 −1.14 7.23 −10.24 0.01
A_23_P323094 PHC1 NM_004426 1911 −1.24 6.06 −4.36 0.04
A_33_P3242014 PHC1 NM_004426 1911 −1.26 10.65 −9.28 0.01
A_23_P204640 NANOG NM_024865 79923 −1.66 7.94 −7.10 0.01
A_24_P935986 BCAT1 NM_005504 586 −1.77 9.14 −9.18 0.01
A_23_P160336 LEFTY1 NM_020997 10637 −2.93 4.40 −21.49 0.00
a

NA, not applicable.

We next tested whether the activation of the Wnt/β-catenin pathway is essential for maintenance of GB epithelial stem cells since they are phenotypically similar to adult cholangiocytes of the intrahepatic duct, which require activation of the LGR5 receptor by the Wnt agonist R-spondin for long-term culture (30). The fraction of cells able to give rise to new organoids remained at 3 to 4% for at least 10 passages for human cells only if R-spondin was added, irrespective of the presence of Wnt3A in the culture medium (Fig. 1D), and at 7 to 9% for 19 passages for murine organoids (see Fig. S1C) (30). Since R-spondins usually act synergistically with Wnt ligands, we next tested whether the epithelial cells themselves produce such ligands. Blocking Wnt ligand secretion through addition of the porcupine inhibitor IWP2 inhibited organoid formation from single cells (Fig. 1E). Organoid formation was partially rescued by the addition of exogenous Wnt3a, suggesting that GB epithelial cells or a subset of them might secrete Wnt agonists. Such a mechanism has been shown in mouse small intestinal organoids, where Paneth cells produce Wnt ligands, supporting organoid growth in the absence of exogenous Wnt agonists (43). Whether a similar subpopulation of cells is responsible for Wnt ligand production in the gallbladder is currently not known.

FIG S1

Cultivation of murine gallbladder organoids. (A) Murine gallbladder epithelial cells grown as organoids at 1, 2, and 4 days after seeding, and at passages 1, 5, 10, 16, and 19. Scale bar, 1mm. (B) Organoids on day 7 after seeding, fluorescently labeled with antibodies against the proliferation marker PCNA (green) and β-catenin (red); nuclei were stained with DRAQ5 (blue). Scale bar, 50 μm. (C) Organoids at passage 0 were split to single cells, seeded, and the number of resulting organoids was counted 5 to 7 days later (i.e., at passage 1). The organoids were kept in culture, and the procedure was repeated after 18 passages (i.e., at passage 19). Bars represent means ± the SD. (D) Lineage tracing of organoids derived from Lgr5-EGFP-IRES-CreERT2, ROSA-mTmGfloxed reporter mice after HT induction. Organoids derived from Lgr5+ cells express mGFP, while those derived from Lgr5− cells express mTomato. Scale bar, 200 μm. Download FIG S1, TIF file, 2.1 MB (2.1MB, tif) .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

We next found that WNT3, -4, -7A, -7B, and -11 were expressed in GB organoids, but only WNT7A and WNT7B were significantly overexpressed in the stem cell-enriched early organoids, whereas late organoids were enriched in WNT4 (Fig. 1F). This indicates that different types of cells are secreting specific Wnt proteins and that WNT7A and B might play a specific role in stem cell maintenance, since they are abundantly expressed in early organoids (Fig. 1F).

Since the activation of the Wnt/β-catenin pathway is essential for stem cell maintenance we expected to find higher levels of target gene transcription in stem cells. We compared a published list of β-catenin target genes (44) with the results of our microarray (Table 3) and observed a dramatic enrichment of such genes in early organoids compared to older, more differentiated organoids (Fig. 1G). The most relevant differentially regulated genes were the secreted Wnt inhibitors Dickkopf-1 (DKK1) and DKK4, the transcription factor binding to nuclear β-catenin LEF1, and LGR5. In differentiated organoids, we observed upregulated expression of the intracellular Wnt inhibitor AXIN2, which may play a role in inhibiting the pathway in more differentiated cells (Table 3).

TABLE 3.

List of differentially regulated β-catenin target genes in early organoids versus late organoids

Probe Gene symbol RefSeq Entrez ID logFC Avg expression t score P
A_23_P118815 BIRC5 NM_001012271 332 4.68 13.18 42.25 0.00
A_23_P94275 DKK4 NM_014420 27121 3.40 6.21 16.98 0.00
A_23_P24129 DKK1 NM_012242 22943 3.17 14.38 19.03 0.00
A_24_P20630 LEF1 NM_016269 51176 2.02 5.96 14.91 0.00
A_33_P3329187 DNMT1 NM_001130823 1786 1.69 12.38 10.55 0.00
A_23_P159191 GAST NM_000805 2520 1.58 7.69 5.45 0.02
A_23_P98974 LGR5 NM_003667 8549 1.54 5.41 8.18 0.01
A_33_P3258392 EDN1 NM_001955 1906 1.49 12.07 3.21 0.07
A_23_P214821 EDN1 NM_001955 1906 1.48 14.90 7.19 0.01
A_23_P202837 CCND1 NM_053056 595 1.44 11.40 3.97 0.04
A_33_P3232828 SRSF3 NM_003017 6428 1.44 13.02 6.81 0.01
A_23_P215956 MYC NM_002467 4609 1.37 14.06 6.25 0.02
A_23_P24104 PLAU NM_002658 5328 1.16 14.30 6.33 0.02
A_33_P3306146 PLAU NM_001145031 5328 1.10 9.48 2.68 0.10
A_23_P160968 LAMC2 NM_018891 3918 1.08 10.17 3.70 0.05
A_23_P413761 SRSF3 NM_003017 6428 1.03 15.83 8.66 0.01
A_33_P3411075 FSCN1 NM_003088 6624 0.99 15.10 7.56 0.01
A_23_P19673 SGK1 NM_005627 6446 0.94 12.66 4.51 0.03
A_23_P135381 SP5 NM_001003845 389058 0.87 13.23 7.77 0.01
A_33_P3381751 TIAM1 NM_003253 7074 0.86 11.85 6.00 0.02
A_33_P3301514 NRCAM NM_001193582 4897 0.85 6.87 3.77 0.05
A_23_P201636 LAMC2 NM_005562 3918 0.83 15.34 6.35 0.02
A_23_P94800 S100A4 NM_002961 6275 0.81 12.16 7.43 0.01
A_32_P69368 ID2 NM_002166 3398 0.72 12.89 2.62 0.10
A_23_P54144 BMP4 NM_001202 652 0.71 11.68 2.37 0.12
A_23_P201711 S100A6 NM_014624 6277 0.71 17.59 4.76 0.03
A_23_P143143 ID2 NM_002166 3398 0.64 12.84 5.39 0.02
A_23_P16469 PLAUR NM_001005377 5329 0.64 11.83 2.75 0.09
A_33_P3294509 CD44 NM_000610 960 0.61 15.41 5.07 0.03
A_23_P359245 MET NM_000245 4233 0.60 15.75 4.42 0.03
A_23_P58788 CDX1 NM_001804 1044 0.58 3.62 4.50 0.03
A_33_P3332414 ABCB1 NM_000927 5243 0.53 9.18 4.36 0.04
A_23_P57784 CLDN1 NM_021101 9076 0.52 13.42 4.78 0.03
A_24_P252364 NRCAM NM_001037132 4897 0.49 10.83 1.64 0.22
A_24_P303989 BMI1 NM_005180 648 0.41 8.43 3.63 0.05
A_23_P201655 MYCBP NM_012333 26292 0.39 13.57 2.96 0.08
A_23_P412389 FGF18 NM_003862 8817 0.35 10.37 2.58 0.10
A_23_P210763 JAG1 NM_000214 182 0.35 11.81 3.07 0.07
A_23_P344555 NEDD9 NM_006403 4739 0.34 8.83 1.21 0.33
A_23_P314115 BMI1 NM_005180 648 0.31 10.15 1.20 0.34
A_23_P214681 PPARD NM_006238 5467 0.31 5.70 1.13 0.36
A_33_P3374443 L1CAM NM_024003 3897 0.31 4.29 1.05 0.39
A_23_P100883 SUZ12 NM_015355 23512 0.30 13.86 1.12 0.36
A_33_P3323298 JUN NM_002228 3725 0.28 12.78 2.51 0.11
A_23_P138631 SMC3 NM_005445 9126 0.27 12.56 1.97 0.17
A_23_P82523 ABCB1 NM_000927 5243 0.27 12.31 2.01 0.16
A_24_P207995 L1CAM NM_000425 3897 0.26 3.50 0.58 0.61
A_32_P171061 ASCL2 NM_005170 430 0.23 9.18 1.38 0.28
A_21_P0000152 CD44 NM_001202557 960 0.21 6.02 0.65 0.57
A_33_P3243857 ADAM10 NM_001110 102 0.19 11.61 1.42 0.27
A_23_P31073 MYB NM_005375 4602 0.19 12.36 1.03 0.40
A_23_P26847 SOX9 NM_000346 6662 0.16 10.69 1.17 0.35
A_24_P69095 ENC1 NM_003633 8507 0.13 13.73 0.20 0.86
A_33_P3289848 CDX1 NM_001804 1044 0.11 8.23 0.72 0.54
A_23_P402751 COX2 ENST00000361739 4513 0.08 15.40 0.28 0.80
A_33_P3880302 EPHB2 NM_004442 2048 0.06 7.27 0.28 0.80
A_24_P252130 PPARD NM_006238 5467 0.06 11.98 0.50 0.66
A_33_P3245163 MYC M13930 4609 0.05 3.06 0.42 0.71
A_33_P3311795 MYB ENST00000531845 4602 0.02 2.96 0.19 0.86
A_24_P365807 EFNB1 NM_004429 1947 −0.03 15.21 −0.29 0.80
A_24_P82106 MMP14 NM_004995 4323 −0.05 10.03 −0.36 0.75
A_23_P48886 ADAM10 NM_001110 102 −0.06 10.76 −0.55 0.63
A_33_P3370787 EPHB2 NM_004442 2048 −0.18 8.02 −1.69 0.21
A_23_P6596 HES1 NM_005524 3280 −0.19 7.93 −1.74 0.20
A_23_P95060 EPHB3 NM_004443 2049 −0.19 11.52 −0.99 0.41
A_33_P3331376 EPHB2 NM_004442 2048 −0.22 5.58 −1.61 0.23
A_33_P3411628 CDKN2A NM_000077 1029 −0.33 10.69 −3.01 0.08
A_23_P52207 BAMBI NM_012342 25805 −0.40 14.60 −3.50 0.06
A_21_P0014167 NEDD9 ENST00000379433 4739 −0.41 4.24 −2.81 0.09
A_23_P27332 TCF4 NM_003199 6925 −0.50 7.67 −3.83 0.05
A_33_P3258824 NOTCH2 NM_001200001 4853 −0.54 12.30 −2.72 0.09
A_24_P298027 AXIN2 NM_004655 8313 −0.56 7.02 −2.16 0.14
A_23_P43490 CDKN2A NM_058197 1029 −0.60 12.54 −4.48 0.03
A_33_P3368358 NEDD9 NM_182966 4739 −0.64 8.82 −4.65 0.03
A_23_P418373 BCL2L2 NM_004050 599 −0.68 12.42 −6.26 0.02
A_23_P148015 AXIN2 NM_004655 8313 −0.71 10.85 −4.42 0.03
A_23_P200792 NOTCH2 NM_024408 4853 −1.06 13.84 −8.94 0.01
A_23_P52761 MMP7 NM_002423 4316 −1.10 16.35 −5.16 0.02
A_23_P502464 NOS2 NM_000625 4843 −2.40 4.30 −9.83 0.01

Finally, to verify that expansion of GB organoids is driven by Lgr5+ cells, we took advantage of a Lgr5–EGFP-IRES-creERT2:ROSA-mTmG-floxed reporter mouse. In the gallbladder cells of this mouse, Cre-ERT2 is under the control of the Lgr5 promoter. After induction with 4-hydroxytamoxifen (4HT), Lgr5+ cells switch from red-Tomato to green-GFP expression. Induction with 4HT during culture of organoids derived from GBs of the reporter mice resulted in the generation of two distinct organoid populations. The majority derived from Lgr5− cells expressing mTomato, while 8.6% originated from Lgr5+ cells expressing mGFP (Fig. 1H; see also Fig. S1D in the supplemental material). The proportion of organoids derived from Lgr5+ cells steadily increased after the first passage, making up >90% by passage 4, confirming the crucial role of Wnt/β-catenin signaling through the Lgr5 receptor in the long-term maintenance of GB cells in vitro.

Gallbladder organoids are stable and resemble the cell structure and function of the organ in situ.

To confirm that GB organoids maintain their epithelial identity, we examined expression of the epithelial marker E-cadherin by Western blot (Fig. 2A). The levels of the GB markers claudin-2 and cytokeratin-19 did not change between early (passage 1) and late (passage 10 for human, 19 for mouse) passages (see Fig. 2A for humans and see Fig. S2A for mice). Previous attempts to cultivate epithelial primary cells were frustrated by fibroblast outgrowth (45, 46). In our system, we observed that fibroblasts do not grow in Matrigel, and at the end of passage 1 we could not detect the mesenchymal marker Vimentin (Fig. 2B and Fig. S2B). In order to assess the GB identity of organoids, we used fluorescence immunohistochemistry to examine a GB-specific combination of markers and compared their expression to that of GB tissue. The luminal mucosa of the GB consists of a simple columnar epithelium expressing cytokeratin-19 (47). Similarly, the GB organoids consist of an E-cadherin-positive cell monolayer, with apical cytokeratin-19 expression (Fig. 2C for humans and Fig. S2C for mice, left panel) and eccentric nuclei (Fig. 2C for humans and Fig. S2C for mice). These organoids also show luminal junctional expression of claudin-2 (Fig. 2C for humans and Fig. S2C for mice), a tight-junction protein expressed at higher levels in the gallbladder compared to other organs including the cholangiocytes of the bile duct (48). GB epithelial cells also produce mucins, with MUC5B being one of the most abundant (49, 50). As expected, we detected MUC5B expression in both the tissue sample and the organoids (Fig. 2C for humans and Fig. S2C for mice).

FIG 2.

FIG 2

Characterization of human organoids. (A) Western blot analysis of epithelial and gallbladder markers at early (P1) and late (P10) passages. Relative densitometry values, normalized to P1 (=1), are shown above the bands. (B) Western blot analysis as in panel A of the fibroblast marker Vimentin compared to HeLa cells. (C) Immunofluorescence analysis of human gallbladder tissue and organoids 7 days after seeding for the gallbladder markers cytokeratin-19, claudin-2, or mucin5B (red); the epithelial marker E-cadherin (green); and DRAQ5 (blue). Scale bar, 25 μm. (D) Transport assay of rhodamine-123 (green) in gallbladder organoids treated with the multidrug transporter inhibitor verapamil (middle row), and gastric organoids. Scale bar, 100 μm.

FIG S2

Characterization of murine gallbladder organoids. (A) Western blot analysis of murine epithelial and gallbladder markers at early (P1) and late (P19) passages. (B) Western blot analysis as in panel A of the fibroblast marker vimentin compared to HeLa cells. (C) Immunofluorescence analysis of murine gallbladder tissue and organoids at 7 days after seeding for the gallbladder markers cytokeratin-19, claudin-2, or mucin5B (red); the epithelial marker E-cadherin (green); and DRAQ5 (blue). Scale bar, 10 μm. Download FIG S2, TIF file, 1.3 MB (1.3MB, tif) .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

One of the functions of the GB is to concentrate bile in the lumen (37, 38). The gallbladder expresses the ATP-dependent multidrug transporter MDR1, which transports organic cations back into the lumen (51–53), protecting the organ from high concentrations of potentially toxic organic ions. To test whether gallbladder organoids functionally recapitulate this physiological feature, we added rhodamine-123, a chemical dye substrate of MDR1 often used to monitor organoid function, to the medium (54). Gallbladder organoids actively transported the dye into the lumen, resulting in increased concentration of luminal fluorescence relative to the medium on the outside (Fig. 2D, top panel). Pretreating organoids with the MDR1 inhibitor verapamil prevented luminal dye accumulation (Fig. 2D, middle panel), confirming dependence on MDR1. In contrast, gastric organoids did not accumulate the dye (Fig. 2D, bottom panel).

Salmonella enterica serovar Paratyphi A induces paracrine CdtB-dependent DNA damage in GB organoids.

Since the gallbladder organoids accurately recapitulate the main molecular features of the epithelium of origin, we used them to model infection with S. enterica using the human restricted pathogenic serovar Paratyphi A, which has been epidemiologically linked to gallbladder cancer (7, 55). Previous observations of the genotoxic effects of S. Typhi/Paratyphi A were based on experiments in cell lines, using mostly ectopic expression of recombinant typhoid toxin (19, 20).

Since the genotoxicity of the bacterium resides in the CdtB subunit of the typhoid toxin, we generated a cdtB knockout. Organoids were mechanically sheared to expose the luminal side and cocultured with Salmonella enterica serovar Paratyphi A or with its isogenic cdtB knockout strain, before reseeding in Matrigel, with gentamicin-supplemented medium to eliminate extracellular bacteria. At 3 days post infection, organoids showed foci of infection with intracellular Salmonella (Fig. 3A). After verifying that the ΔcdtB mutant is capable of invading epithelial cells at a rate similar to the wild-type (w.t.) bacteria (Fig. 3B), we examined the induction of DNA damage.

FIG 3.

FIG 3

Infection and paracrine genotoxic effect of CdtB. (A) Reconstruction of whole-mount immunofluorescence labeling of organoids infected with Salmonella Paratyphi A carrying the mCherry-expressing plasmid pLS002 (red) at 3 days post infection, with phalloidin to detect F-actin (white) and Hoechst for DNA (blue). Scale bar, 10 μm. (B) Proportion of cells invaded after infection of organoids with wild-type Salmonella or a cdtB deletion mutant. (C) Whole-mount immunofluorescence labeling of organoids 3 days after infection with Salmonella Paratyphi A w.t. or ΔcdtB carrying the mCherry-expressing plasmid pLS002 using antibodies against γH2AX (green), phalloidin (white), and Hoechst (blue). Scale bar, 20 μm. (D) Model for categorization of uninfected cells according to the distance from the infected cell at position 0 (red). Orange represents the first three rings of non-infected cells (positions 1 to 3), and green represents the next three rings (positions 4 to 6). (E) Percentage of cells positive for the DNA damage marker γH2AX depending on their distance from the infected cell. The dashed blue line represents the average percentage of γH2AX-positive cells in uninfected organoids (SD = 0.97). *, P < 0.05; **, P < 0.01 (compared to uninfected cells). Infected cells are defined as cells with >5 bacteria, and γH2AX-positive cells are cells with >3 foci.

To this end, we tested organoids for phosphorylation of H2AX at serine 139 (γH2AX), a histone variant involved in detection of DSBs and recruitment of repair factors (56), and we quantified and mapped the number of γH2AX-positive cells after infection with the wild type and the ΔcdtB strain. The number of cells experiencing DNA damage was generally higher in the organoids infected with the wild-type strain compared to the ΔcdtB mutant (Fig. 3C). Quantification of the number of γH2AX-positive cells that are infected (defined in the map of Fig. 3D as position 0) revealed that both cells infected with the w.t. or ΔcdtB strain experience DNA damage (Fig. 3E, position 0). However, there is a significantly reduced number of γH2AX-positive cells among the ones infected with the mutant strain (Fig. 3E, position 0, ΔcdtB).

In addition, we noticed that in organoids infected with the wild-type strain, a number of uninfected neighboring cells also contained γH2AX foci (Fig. 3C to E). To quantify this paracrine genotoxic effect, uninfected cells were divided into two groups depending on the distance from the infected cell (Fig. 3D): Positions 1 to 3 include the first three rings of uninfected cells surrounding the infected focus, whereas positions 4 to 6 represent the rings 4 to 6 of the uninfected cells. The proportion of γH2AX-positive cells was higher in positions 1 to 3 than in positions 4 to 6 (Fig. 3E), but only for the organoids infected with wild-type bacteria. This confirms that the typhoid toxin is secreted from infected cells also in the primary polarized cells of the organoids (17) and that its genotoxic effects extend to the neighboring cells in a paracrine manner. In our system, this paracrine effect was limited to the first three rings of cells surrounding the infected one. Since γH2AX is also highly expressed during mitosis, cells that displayed chromosome condensation were excluded from the analysis. Our experiments suggest that infection with Salmonella Paratyphi A causes DNA damage and that a functional typhoid toxin increases the extent of damage in the infected cells and extends it to the neighboring uninfected cells.

Infection with Salmonella Paratyphi A activates transcription programs associated with cell cycle arrest.

The risk of developing gallbladder cancer is higher in patients who are chronic carriers of typhoid Salmonella serovars. Therefore, to understand the fate of the infected cells, we sought to extend the duration of the infection using a more physiological model that mimics chronic infection in vitro. For the infection of the organoids, the cells must be disaggregated, and after 3 days we usually observed an overgrowth of bacteria or of cells, which impaired longer-term analysis. To understand the effect of the infection on a homeostatic gallbladder epithelial barrier and to allow longer term infection, we adapted the gallbladder organoids into mucosoid cultures, as previously done for the human stomach (34). Single cells derived from organoids were seeded on a collagen-coated polycarbonate filter in a standing cell culture insert (Fig. 4A). The cultivation cocktail was identical to that used for organoids and applied both below and above the filter. After 3 days, the apical medium was removed to start air-liquid interface cultivation (Fig. 4A). Primary gallbladder cells can be expanded on a monthly basis by deriving single cells from mucosoid cultures and restarting from the seeding procedure. Gallbladder mucosoids can be infected by applying a suspension of bacteria on top of the filter after removing excess mucus (Fig. 4A). The progress of the infection can be monitored using fluorescent transgenic Salmonella. Presence of intracellular Salmonella was detectable equally for both wild-type and ΔcdtB strains (Fig. 4B), and electron microscopy analysis of non-infected and infected mucosoid cultures revealed that the monolayer and the cell gross morphology remain intact during infection (Fig. 4C).

FIG 4.

FIG 4

Generation of gallbladder mucosoids and long-term infection experiments. (A) Schematic of gallbladder mucosoid cultivation and infection procedure. (From left to right) After seeding, a polarized cell layer of gallbladder cells begins to form on the collagen-coated polycarbonate filter in the transwell insert. Primary cell medium is provided around the cell culture insert and on top of the cells. At day 3, the upper medium is withdrawn, and cells start to produce mucus. From day 10 onward, the culture is stable, and infection experiments can be performed by administering Salmonella on the cell layer. (B) Detailed view of long-term infection of human gallbladder mucosoids with S. enterica Paratyphi A and transmission electron microscopy. Stable long-term infection can be reached with both the wild type and the cdtB deletion mutant by applying gentamicin for 24 h and then withdrawing it again from the medium. Internalization and perinuclear localization of the bacteria within lysosomal structures is visible. Two zoomed-in images of intracellular bacteria are shown. b, bacterium; n, nucleus. Scale bar, 1 μm. (C) Establishment of mucosoids. The development of a polarized monolayer of gallbladder cells in an air-liquid cultivation (“mucosoids”) and transmission electron microscopy images of non-infected control (NI) and infected with S. Paratyphi A w.t. and isogenic ΔcdtB KO strains for 2 days are shown. Scale bar, 10 μm. (D) Top view of infected and non-infected gallbladder mucosoids. Staining was performed for γH2AX (green), Salmonella (red), phalloidin (white), and nuclei (blue). Cultures infected for 6 days show DNA damage, whereas there is no damage visible in the non-infected control. Scale bar, 20 μm. (E) Heat map of manually selected NF-κB target genes. A comparison of w.t. and ΔcdtB infections at 2 and 7 days post infection is shown. The heatmap was plotted using the normalized expression values (log-normalized intensity) relative to the non-infected control at each time point (logFC). (F) Heatmap of normalized enrichment scores from GSEA for genes preferentially expressed in distinct cell cycle phases (58) for comparisons of mucosoid cultures with w.t. or ΔcdtB strain infections at 2 and 7 days post infection relative to non-infected controls.

Similar to what we observed with organoids, in the infected mucosoid cultures, we found that established colonies of w.t. Salmonella induce more DNA damage than the isogenic ΔcdtB strain, as measured using gH2AX staining (Fig. 4D). We performed a microarray analysis to compare the short versus the long-term effect of the infection on the gallbladder epithelial cells. We used gene set enrichment analysis (GSEA) to investigate any statistically significant consistent differences between gene set expression in the culture after infection with the w.t. strain versus infection with the ΔcdtB isogenic mutant. Infection with both strains induced similar expression of NF-κB target genes at 2 days post infection, indicating the expected initiation of an inflammatory response (Fig. 4E). Interestingly, in the cultures infected with the w.t. strain, NF-κB-controlled cytokines and chemokine genes continued to be highly expressed at 7 days, suggesting a role of the typhoid toxin in maintaining inflammation. It has previously been observed that the typhoid toxin reduces inflammation in mice infected with a transgenic Salmonella Typhimurium strain expressing the typhoid toxin (57). Inflammation is the result of a complex interaction between immune cells and the epithelium in the mucosa, and we observed here that typhoid toxin directly or indirectly maintains high transcription of NF-κB target genes in epithelial cells.

Analysis of the cell-cycle related gene sets (58) during infection (Table 4) revealed a strong underrepresentation of transcriptional programs related to each cell cycle phase (G1/S, S, G2, and G2/M) (Fig. 4F). As those genes are usually accumulated only in a specific phase of the cell cycle, the downregulation of all the G1/S, S, G2, and G2/M transcription programs implies that a proportion of cells in the infected mucosoids are not replicating (58, 59). This effect of the infection in stopping cell replication is particularly strong at 2 days after infection, but is attenuated after 1 week, indicating that an increasing number of cells are cycling again (Fig. 4F). The effect of the infection on the cell cycle was either independent from a functional typhoid toxin or any effect of the typhoid toxin on the infected culture was masked by other bacterial effectors.

TABLE 4.

List of differentially regulated genesa

Probe Gene symbol RefSeq Entrez ID logFC at:
Cell cycle phaseb
2 days
7 days
w.t. vs NI dCdtB vs NI w.t. vs NI dCdtB vs NI
A_23_P39481 ABCA7 NM_019112 10347 −0.22 −0.02 0.20 −0.66 G1_S
A_23_P26375 ACD NM_022914 65057 −0.11 −0.01 0.10 −0.48 G1_S
A_23_P163143 ACYP1 NM_203488 97 0.05 −0.13 −0.18 0.71 G1_S
A_23_P211039 ADAMTS1 NM_006988 9510 0.46 0.38 −0.08 0.45 G1_S
A_23_P342275 ADAMTS1 NM_006988 9510 0.37 0.16 −0.22 0.48 G1_S
A_24_P283395 ADCK2 NM_052853 90956 −0.25 −0.29 −0.03 −0.55 G1_S
A_24_P291978 ADCK2 NM_052853 90956 0.23 −0.02 −0.26 −0.10 G1_S
A_23_P501547 ADCY6 NM_015270 112 −0.21 0.10 0.31 −0.73 G1_S
A_24_P298077 ANKRD10 NM_017664 55608 0.75 −0.03 −0.78 0.94 G1_S
A_23_P205046 ANKRD10 NM_017664 55608 0.03 0.56 0.53 −0.36 G1_S
A_23_P170331 AP3M2 NM_006803 10947 0.34 0.04 −0.30 0.60 G1_S
A_24_P64039 AP3M2 NM_006803 10947 −0.02 −0.32 −0.30 0.47 G1_S
A_23_P160729 AP4B1 NM_006594 10717 0.31 0.28 −0.03 0.46 G1_S
A_23_P256682 APEX2 NM_014481 27301 −0.22 0.20 0.42 −0.34 G1_S
A_23_P162782 ARGLU1 NM_018011 55082 0.17 −0.09 −0.25 0.74 G1_S
A_24_P159648 BAIAP2 NM_006340 10458 −0.33 −0.03 0.30 −0.93 G1_S
A_23_P315836 BAIAP2 NM_017451 10458 0.16 0.11 −0.06 −0.12 G1_S
A_23_P61810 BAIAP2 NM_017450 10458 −0.07 0.34 0.41 −1.21 G1_S
A_23_P67771 BARD1 NM_000465 580 −1.44 −1.07 0.37 −0.47 G1_S
A_32_P18824 BRD7 NM_013263 29117 0.04 −0.13 −0.17 0.07 G1_S
A_23_P381378 CAPN7 NM_014296 23473 0.00 −0.06 −0.06 0.20 G1_S
A_23_P58898 CASP8AP2 NM_012115 9994 −0.42 −0.45 −0.03 0.12 G1_S
A_32_P180315 CCDC180 NM_020893 1E+08 −0.65 −0.98 −0.33 −0.36 G1_S
A_24_P280706 CCDC180 NM_020893 1E+08 0.27 0.28 0.01 0.50 G1_S
A_23_P209200 CCNE1 NM_001238 898 −0.40 −0.33 0.08 0.17 G1_S
A_23_P215976 CCNE2 NM_057749 9134 −1.03 −0.94 0.10 −0.63 G1_S
A_24_P397107 CDC25A NM_001789 993 −1.34 −1.13 0.21 −0.75 G1_S
A_23_P121423 CDC25A NM_001789 993 −0.57 −0.96 −0.38 0.06 G1_S
A_23_P49972 CDC6 NM_001254 990 −1.14 −1.40 −0.26 0.39 G1_S
A_23_P251421 CDCA7 NM_031942 83879 −1.06 −0.35 0.72 −0.88 G1_S
A_24_P171549 CDCA7 NM_031942 83879 −1.00 −0.16 0.84 −1.13 G1_S
A_24_P274795 CDCA7L NM_018719 55536 −1.39 −0.68 0.71 −0.92 G1_S
A_23_P20752 CDK20 NM_001039803 23552 0.20 0.17 −0.02 −0.03 G1_S
A_24_P53519 CHAF1A NM_005483 10036 −0.37 −0.42 −0.05 −0.71 G1_S
A_23_P57306 CHAF1B NM_005441 8208 −0.81 −0.45 0.37 −0.54 G1_S
A_23_P126212 CLSPN NM_022111 63967 −0.82 −1.06 −0.24 −0.08 G1_S
A_23_P52556 CTSD NM_001909 1509 −0.32 −0.47 −0.15 −0.61 G1_S
A_23_P139312 DHFR2 NM_176815 200895 −0.54 −0.71 −0.17 0.09 G1_S
A_24_P186065 DHFR2 NM_176815 200895 −0.05 0.11 0.16 −0.33 G1_S
A_24_P219024 DIS3 NM_014953 22894 0.08 0.00 −0.08 0.31 G1_S
A_23_P48416 DIS3 NM_014953 22894 0.05 0.17 0.12 −0.27 G1_S
A_24_P395317 DIS3 NM_014953 22894 0.01 −0.06 −0.07 −0.29 G1_S
A_23_P36962 DNAJC3 NM_006260 5611 0.10 0.13 0.03 0.34 G1_S
A_23_P10385 DTL NM_016448 51514 −2.06 −1.93 0.13 −1.18 G1_S
A_23_P80032 E2F1 NM_005225 1869 −1.89 −1.24 0.65 −1.39 G1_S
A_23_P408955 E2F2 NM_004091 1870 −2.73 −1.92 0.80 −2.19 G1_S
A_23_P125990 E2F2 NM_004091 1870 −0.11 −0.52 −0.40 0.71 G1_S
A_23_P44932 EIF2A NM_032025 83939 0.33 0.14 −0.19 0.46 G1_S
A_32_P197524 EIF2A NM_032025 83939 0.17 −0.18 −0.35 0.32 G1_S
A_23_P87964 ESD NM_001984 2098 −0.33 −0.23 0.11 0.29 G1_S
A_24_P841662 ESD AK093643 2098 −0.38 −0.21 0.17 −0.17 G1_S
A_24_P332314 FAM111B NM_198947 374393 −2.21 −2.52 −0.31 −0.18 G1_S
A_23_P409516 FAM122A NM_138333 116224 0.03 −0.28 −0.31 0.34 G1_S
A_23_P71644 FANCG NM_004629 2189 −0.62 −0.62 −0.01 −0.03 G1_S
A_23_P141146 FBXL20 NM_032875 84961 0.56 0.06 −0.49 0.23 G1_S
A_32_P318086 FLAD1 NM_025207 80308 −0.63 −0.30 0.33 −0.11 G1_S
A_32_P6917 FLAD1 NM_025207 80308 −0.68 −0.18 0.50 0.02 G1_S
A_23_P34527 FLAD1 NM_025207 80308 −0.67 −0.05 0.62 −0.18 G1_S
A_23_P118246 GINS2 NM_016095 51659 −3.12 −2.76 0.36 −1.06 G1_S
A_23_P152136 GINS3 NM_022770 64785 −0.67 −0.65 0.02 0.09 G1_S
A_24_P159323 GINS3 NM_022770 64785 0.12 0.26 0.14 −0.05 G1_S
A_23_P19712 GMNN NM_015895 51053 −0.77 −0.85 −0.08 0.45 G1_S
A_23_P99579 GON7 NM_032490 84520 −0.62 −0.44 0.18 0.05 G1_S
A_24_P567952 HCG18 NR_024052 414777 −0.54 −0.06 0.48 −0.46 G1_S
A_24_P934162 HCG18 A_24_P934162 NA 0.28 −0.15 −0.43 0.48 G1_S
A_32_P181722 HCG18 NR_024052 414777 −0.15 0.07 0.22 −0.19 G1_S
A_24_P567944 HCG18 NR_024052 414777 −0.07 0.23 0.30 −0.14 G1_S
A_32_P199884 HORMAD1 NM_032132 84072 0.28 0.03 −0.25 0.24 G1_S
A_24_P416370 HOXB4 NM_024015 3214 −0.84 −0.78 0.06 −0.48 G1_S
A_24_P305067 HOXB4 NM_024015 3214 −0.09 0.18 0.27 −0.62 G1_S
A_23_P98183 HRAS NM_005343 3265 0.32 0.49 0.17 −0.12 G1_S
A_32_P9963 HSF2 NM_004506 3298 0.28 −0.09 −0.37 0.80 G1_S
A_23_P111360 HSF2 NM_004506 3298 0.21 −0.23 −0.44 0.62 G1_S
A_23_P43079 INTS8 NM_017864 55656 0.04 0.25 0.21 0.64 G1_S
A_23_P391506 IVNS1ABP NM_006469 10625 −0.60 −0.45 0.15 −0.49 G1_S
A_23_P137514 IVNS1ABP NM_006469 10625 −0.36 −0.18 0.18 0.63 G1_S
A_24_P324787 KANK2 NM_015493 25959 −0.33 0.05 0.38 −0.90 G1_S
A_23_P50426 KANK2 NM_015493 25959 −0.35 0.16 0.51 −1.00 G1_S
A_23_P55897 KANK2 NM_015493 25959 −0.05 0.24 0.29 −0.50 G1_S
A_23_P12079 KCNC4 NM_153763 3749 −0.37 −0.04 0.33 −0.43 G1_S
A_23_P404821 KIAA1147 NM_001080392 57189 −0.25 0.09 0.34 −0.52 G1_S
A_24_P101047 KIAA1586 NM_020931 57691 −0.24 0.03 0.27 −0.25 G1_S
A_24_P230965 KIAA1586 NM_020931 57691 −0.20 −0.22 −0.02 0.24 G1_S
A_24_P237559 LNPEP AK096804 4012 0.41 0.10 −0.31 0.64 G1_S
A_23_P144677 LNPEP ENST00000231368 4012 −0.29 −0.02 0.27 −0.56 G1_S
A_24_P132019 LNPEP ENST00000231368 4012 0.21 0.36 0.15 −0.16 G1_S
A_23_P156061 LNPEP NM_005575 4012 −0.09 −0.07 0.02 0.24 G1_S
A_32_P69475 LNPEP ENST00000231368 4012 0.03 0.05 0.02 −0.30 G1_S
A_23_P207445 MAP2K6 NM_002758 5608 −2.10 −0.61 1.49 −1.44 G1_S
A_23_P408996 MBOAT1 NM_001080480 154141 −0.45 −0.03 0.42 −0.57 G1_S
A_32_P103633 MCM2 NM_004526 4171 −1.61 −1.56 0.06 −1.32 G1_S
A_23_P132277 MCM5 NM_006739 4174 −1.85 −1.65 0.20 −1.36 G1_S
A_23_P90612 MCM6 NM_005915 4175 −1.27 −1.79 −0.52 0.06 G1_S
A_23_P204782 MDM1 NM_020128 56890 −0.85 −0.55 0.29 −0.15 G1_S
A_23_P413180 MDM1 NM_017440 56890 −0.66 −0.11 0.55 −0.69 G1_S
A_23_P105730 MDM1 NM_020128 56890 −0.14 −0.02 0.12 0.24 G1_S
A_24_P313678 MED31 NM_016060 51003 0.18 0.08 −0.11 0.78 G1_S
A_23_P341443 MNT NM_020310 4335 0.68 0.66 −0.02 −0.28 G1_S
A_24_P350969 MNT AF318360 4335 0.08 −0.20 −0.28 0.56 G1_S
A_32_P6015 MNX1 NM_005515 3110 −0.33 −0.42 −0.10 −0.36 G1_S
A_23_P253331 MNX1 NM_005515 3110 −0.07 −0.33 −0.26 0.05 G1_S
A_24_P279797 MRI1 NM_001031727 84245 0.01 0.11 0.10 0.38 G1_S
A_23_P102471 MSH2 NM_000251 4436 −0.38 −0.39 −0.02 −0.28 G1_S
A_23_P34800 NASP NM_172164 4678 −0.92 −0.57 0.34 −0.26 G1_S
A_32_P28365 NASP NM_172164 4678 −0.70 −0.46 0.24 −0.15 G1_S
A_24_P926760 NKTR NM_005385 4820 0.53 0.36 −0.17 0.78 G1_S
A_23_P212002 NKTR NM_005385 4820 0.38 0.32 −0.06 0.47 G1_S
A_24_P171601 NKTR NM_005385 4820 0.37 0.20 −0.16 0.83 G1_S
A_23_P203013 NPAT NM_002519 4863 −0.59 −0.36 0.23 −0.18 G1_S
A_24_P273823 NPAT NM_002519 4863 −0.22 −0.31 −0.09 0.27 G1_S
A_24_P29641 NSUN5P2 NM_148936 260294 0.05 0.12 0.07 0.46 G1_S
A_23_P161324 NUDT13 NM_015901 25961 −0.39 −0.32 0.07 −0.01 G1_S
A_32_P41471 NUDT13 NM_015901 25961 −0.19 −0.31 −0.11 0.29 G1_S
A_24_P200761 NUP43 NM_198887 348995 −0.37 −0.10 0.27 −0.24 G1_S
A_23_P31055 NUP43 NM_198887 348995 −0.21 0.02 0.22 0.16 G1_S
A_23_P45799 ORC1 NM_004153 4998 −0.91 −0.95 −0.04 −0.48 G1_S
A_24_P371053 ORMDL1 NM_016467 94101 −0.59 −0.20 0.39 −0.10 G1_S
A_23_P120194 ORMDL1 NM_016467 94101 −0.01 0.07 0.08 0.25 G1_S
A_32_P220762 OSBPL6 ENST00000190611 114880 0.10 −0.19 −0.29 0.11 G1_S
A_23_P108823 OSBPL6 NM_032523 114880 0.00 −0.27 −0.28 0.17 G1_S
A_24_P414446 OTULIN NM_138348 90268 −0.16 −0.55 −0.39 0.09 G1_S
A_23_P353106 OTULIN NM_138348 90268 0.13 −0.25 −0.38 0.12 G1_S
A_24_P142885 PANK2 ENST00000497424 80025 −0.56 −0.16 0.41 −0.45 G1_S
A_23_P79942 PANK2 NM_153638 80025 −0.12 0.06 0.17 −0.25 G1_S
A_24_P299911 PASK NM_015148 23178 −0.45 −0.28 0.18 −0.39 G1_S
A_23_P28886 PCNA NM_002592 5111 −1.10 −0.88 0.22 −0.11 G1_S
A_24_P280029 PDXP NM_020315 57026 0.09 −0.20 −0.28 0.81 G1_S
A_23_P61180 PLCXD1 NM_018390 55344 0.64 0.69 0.06 0.14 G1_S
A_23_P99582 PNN NM_002687 5411 0.46 0.30 −0.16 1.13 G1_S
A_32_P182439 POLD3 NM_006591 10714 −0.43 −0.01 0.42 −0.26 G1_S
A_24_P75056 POLD3 NM_006591 10714 −0.26 0.19 0.45 −0.45 G1_S
A_23_P70794 RAB23 NM_016277 51715 −0.48 −0.19 0.29 −0.27 G1_S
A_23_P71558 RECQL4 NM_004260 9401 −1.56 −0.91 0.65 −0.90 G1_S
A_23_P353717 RMI2 NM_152308 116028 −1.49 −1.51 −0.02 −1.39 G1_S
A_23_P258071 RNF113A NM_006978 7737 0.21 −0.05 −0.26 0.49 G1_S
A_23_P254970 RNPC3 AK057799 55599 −0.24 −0.35 −0.11 0.31 G1_S
A_24_P341504 RNPC3 NM_017619 55599 0.23 0.13 −0.10 0.71 G1_S
A_23_P34396 RSRP1 NM_020317 57035 0.66 0.09 −0.57 0.97 G1_S
A_24_P34155 RUNX1 NM_001122607 861 1.03 0.33 −0.71 0.67 G1_S
A_24_P96403 RUNX1 NM_001001890 861 −0.68 0.18 0.87 −1.35 G1_S
A_23_P16944 SDC1 NM_001006946 6382 −0.69 −0.50 0.19 −1.07 G1_S
A_24_P97129 SDC1 NM_001006946 6382 −0.35 −0.44 −0.08 0.50 G1_S
A_23_P357856 SEC62 NM_003262 7095 −0.56 −0.28 0.28 −0.71 G1_S
A_23_P144224 SEC62 NM_003262 7095 0.54 0.07 −0.47 0.48 G1_S
A_24_P285880 SEC62 NM_003262 7095 −0.35 −0.26 0.10 0.05 G1_S
A_23_P357860 SEC62 NM_003262 7095 −0.52 0.04 0.56 −1.67 G1_S
A_24_P251704 SEC62 NM_003262 7095 −0.05 0.04 0.09 −0.96 G1_S
A_23_P55632 SERPINB3 NM_006919 6317 1.00 1.78 0.78 1.52 G1_S
A_23_P156310 SKP2 NM_032637 6502 −0.38 −0.75 −0.37 0.37 G1_S
A_23_P7101 SLBP NM_006527 7884 0.21 0.00 −0.21 0.23 G1_S
A_23_P40896 SLC25A36 NM_018155 55186 0.27 −0.15 −0.42 0.91 G1_S
A_23_P408455 SLC25A36 NM_001104647 55186 0.24 −0.37 −0.61 0.85 G1_S
A_24_P136725 SPIN3 NR_027139 169981 −0.07 0.34 0.40 0.01 G1_S
A_24_P494454 SPIN3 NM_001010862 169981 0.01 0.06 0.05 1.15 G1_S
A_32_P222961 SPIN4 NM_001012968 139886 0.33 0.38 0.06 0.30 G1_S
A_24_P467371 SPIN4 NM_001012968 139886 0.29 0.10 −0.19 −0.42 G1_S
A_24_P222911 SRSF7 NM_001031684 6432 −0.81 −0.73 0.08 −0.35 G1_S
A_23_P39704 SRSF7 NM_001031684 6432 −0.58 −0.60 −0.02 −0.01 G1_S
A_23_P155229 SSR3 NM_007107 6747 0.53 −0.06 −0.58 0.94 G1_S
A_24_P319942 SSR3 NM_007107 6747 −0.06 −0.23 −0.18 −0.01 G1_S
A_24_P928068 TAF15 DB509819 NA 0.46 0.45 0.00 0.02 G1_S
A_23_P159305 TAF15 NM_139215 8148 0.11 0.26 0.15 −0.66 G1_S
A_32_P56525 TCAF1 NM_014719 9747 0.28 0.46 0.18 −1.13 G1_S
A_24_P380628 TCAF1 NM_014719 9747 −0.08 0.10 0.18 −0.69 G1_S
A_24_P368023 TCAF1 ENST00000479870 9747 −0.03 0.26 0.29 −1.42 G1_S
A_23_P99930 TIPIN NM_017858 54962 0.17 −0.46 −0.63 0.86 G1_S
A_23_P157283 TMEM243 NM_024315 79161 0.17 0.30 0.14 −0.37 G1_S
A_23_P159390 TOPBP1 NM_007027 11073 −0.46 −0.26 0.21 −0.01 G1_S
A_23_P31389 TRA2A NM_013293 29896 −0.67 −0.32 0.34 −0.04 G1_S
A_23_P218879 TREX1 NM_016381 11277 −0.44 −0.10 0.34 −0.38 G1_S
A_24_P339858 TSPEAR-AS2 NR_026547 114043 0.36 0.72 0.36 −0.13 G1_S
A_24_P910854 TTC14 NM_001042601 151613 0.51 0.21 −0.30 −0.10 G1_S
A_23_P212511 TTC14 NM_001042601 151613 −0.10 −0.25 −0.14 0.52 G1_S
A_24_P159094 UBR7 NM_175748 55148 −0.97 −0.65 0.33 −0.45 G1_S
A_23_P205393 UBR7 NM_175748 55148 −0.43 −0.63 −0.21 0.41 G1_S
A_23_P208880 UHRF1 NM_013282 29128 −2.52 −1.75 0.77 −1.77 G1_S
A_32_P101235 UHRF1 NM_013282 29128 −0.47 −0.43 0.04 −0.15 G1_S
A_24_P398585 UNG NM_003362 7374 −0.28 0.01 0.29 −0.27 G1_S
A_24_P137522 USP53 NM_019050 54532 0.46 0.26 −0.20 0.60 G1_S
A_32_P128701 USP53 NM_019050 54532 0.40 0.15 −0.25 0.38 G1_S
A_23_P115215 VPS72 NM_005997 6944 −0.35 −0.10 0.25 0.01 G1_S
A_23_P129075 WDR76 NM_024908 79968 −0.19 −0.48 −0.29 −0.09 G1_S
A_24_P158385 ZMYND19 NM_138462 116225 −0.29 −0.28 0.01 −0.38 G1_S
A_32_P183218 ZNF367 NM_153695 195828 −1.12 −0.76 0.35 −0.53 G1_S
A_23_P410625 ZNF367 NM_153695 195828 −0.41 −0.50 −0.09 −0.08 G1_S
A_23_P340922 ZNF414 NM_032370 84330 −0.35 0.32 0.68 −0.93 G1_S
A_32_P85978 ZNF414 NM_001146175 84330 0.21 0.26 0.05 −0.48 G1_S
A_23_P85521 ZRANB2 NM_203350 9406 0.36 0.09 −0.27 0.81 G1_S
A_24_P242299 ZRANB2 NM_005455 9406 0.30 0.10 −0.20 0.57 G1_S
A_23_P120784 TRMT2A NM_022727 27037 −0.61 −0.27 0.34 −0.58 G1_S,G2
A_24_P305662 TRMT2A NM_022727 27037 −0.33 −0.12 0.21 −0.20 G1_S,G2
A_23_P370989 MCM4 NM_005914 4173 −1.44 −1.07 0.36 −0.90 G1_S,G2_M
A_24_P59596 ATAD2 NM_014109 29028 −1.00 −1.55 −0.55 0.22 G1_S,S
A_23_P216068 ATAD2 NM_014109 29028 −0.82 −0.97 −0.15 −0.21 G1_S,S
A_23_P387943 CASP2 NM_032982 835 −0.26 0.15 0.41 −0.75 G1_S,S
A_24_P269398 CASP2 NM_032982 835 −0.17 0.04 0.21 −0.43 G1_S,S
A_23_P215701 CASP2 NM_032982 835 −0.13 0.18 0.31 −0.40 G1_S,S
A_23_P203645 CREBZF NM_001039618 58487 0.69 0.06 −0.63 0.90 G1_S,S
A_23_P252740 DSCC1 NM_024094 79075 −1.22 −1.25 −0.04 −0.64 G1_S,S
A_23_P162579 HSPB8 NM_014365 26353 1.38 0.02 −1.35 1.06 G1_S,S
A_23_P170110 NEAT1 AW806882 NA 0.73 0.39 −0.34 1.00 G1_S,S
A_24_P290999 NEAT1 NR_028272 283131 0.77 −0.15 −0.92 1.04 G1_S,S
A_24_P566916 NEAT1 NR_028272 283131 0.38 0.03 −0.34 0.03 G1_S,S
A_23_P160518 TRIM45 NM_025188 80263 −0.40 −0.18 0.22 −0.16 G1_S,S
A_23_P160523 TRIM45 NM_025188 80263 −0.22 −0.20 0.02 −0.47 G1_S,S
A_23_P14543 ALKBH1 NM_006020 8846 0.21 0.05 −0.16 0.40 G2
A_23_P108135 AP3D1 NM_003938 8943 0.58 0.63 0.05 −0.50 G2
A_23_P119526 AP3D1 NM_003938 8943 0.46 0.51 0.05 −0.18 G2
A_24_P30034 ARHGEF39 NM_032818 84904 −0.48 −0.49 −0.01 0.19 G2
A_23_P216517 ARHGEF39 NM_032818 84904 −0.48 −0.91 −0.43 0.45 G2
A_32_P234827 ARMC1 NM_018120 55156 0.00 −0.04 −0.05 0.23 G2
A_23_P415015 ATL2 NM_022374 64225 0.40 0.35 −0.05 0.17 G2
A_23_P209619 ATL2 NM_022374 64225 0.07 0.40 0.33 −0.17 G2
A_23_P130182 AURKB NM_004217 9212 −1.55 −1.32 0.24 −0.60 G2
A_24_P89512 BCLAF1 NM_014739 9774 −0.94 −0.52 0.43 −0.39 G2
A_24_P80915 BCLAF1 NM_014739 9774 −0.85 −0.89 −0.04 −0.03 G2
A_23_P111343 BCLAF1 NM_014739 9774 −0.56 −0.34 0.22 0.35 G2
A_23_P25626 BORA NM_024808 79866 −1.02 −0.89 0.12 0.28 G2
A_23_P145016 BRD8 NM_006696 10902 −0.13 0.02 0.15 −0.28 G2
A_23_P81280 BTNL9 NM_152547 153579 0.42 0.29 −0.14 0.18 G2
A_32_P187951 BTNL9 NM_152547 153579 −0.29 −0.38 −0.09 −0.48 G2
A_23_P46924 BUB3 NM_001007793 9184 −0.66 −0.53 0.13 −0.08 G2
A_23_P202316 BUB3 NM_001007793 9184 −0.63 −0.34 0.29 −0.25 G2
A_23_P320658 BUB3 NM_004725 9184 0.20 −0.10 −0.29 0.52 G2
A_24_P413941 C2orf69 NM_153689 205327 −0.24 −0.07 0.17 −0.37 G2
A_23_P142918 C2orf69 NM_153689 205327 0.10 0.06 −0.04 −0.04 G2
A_23_P92410 CASP3 NM_004346 836 −0.51 −0.13 0.38 −0.08 G2
A_24_P664995 CBX5 NM_001127322 23468 −0.34 0.24 0.57 −1.23 G2
A_24_P620621 CBX5 NM_001127322 23468 −0.15 −0.02 0.13 −0.14 G2
A_23_P2355 CBX5 NM_012117 23468 −0.17 −0.29 −0.12 0.49 G2
A_24_P193592 CCNF NM_001761 899 −0.89 −0.41 0.48 −0.46 G2
A_23_P37954 CCNF NM_001761 899 −0.74 −0.22 0.52 −0.94 G2
A_23_P88083 CDC16 NM_003903 8881 −0.36 −0.13 0.23 0.02 G2
A_23_P70249 CDC25C NM_001790 995 −2.28 −1.87 0.41 −0.78 G2
A_23_P385861 CDCA2 NM_152562 157313 −1.95 −1.77 0.18 −0.24 G2
A_24_P323434 CDCA2 NM_152562 157313 −1.36 −1.32 0.04 −0.07 G2
A_23_P375 CDCA8 NM_018101 55143 −2.04 −1.76 0.29 −0.84 G2
A_23_P138507 CDK1 NM_001786 983 −2.95 −2.22 0.73 −0.84 G2
A_24_P282343 CDKL5 NM_003159 6792 0.14 −0.06 −0.20 −0.28 G2
A_24_P81841 CDKN1B NM_004064 1027 −0.70 −0.55 0.15 −0.73 G2
A_23_P204696 CDKN1B NM_004064 1027 −0.41 −0.54 −0.13 0.24 G2
A_23_P85460 CDKN2C NM_078626 1031 −0.61 −1.44 −0.82 −0.04 G2
A_23_P126120 CENPL NM_033319 91687 −0.75 −0.56 0.19 −0.24 G2
A_24_P930100 CENPL AK056348 91687 0.01 −0.68 −0.69 0.61 G2
A_23_P201816 CEP350 NM_014810 9857 −0.25 −0.13 0.12 −0.12 G2
A_23_P119562 CFD NM_001928 1675 −0.36 −0.22 0.13 −0.26 G2
A_23_P109452 CHEK2 NM_001005735 11200 −0.96 −0.67 0.28 0.01 G2
A_23_P250313 CIP2A NM_020890 57650 −0.85 −0.77 0.08 0.01 G2
A_24_P351466 CIP2A NM_020890 57650 0.02 −0.40 −0.42 0.14 G2
A_23_P388812 CKAP2L NM_152515 150468 −2.34 −2.03 0.31 −0.35 G2
A_23_P213745 CXCL14 NM_004887 9547 −2.26 −1.16 1.10 −2.35 G2
A_23_P2181 CYB5R2 NM_016229 51700 0.31 −0.19 −0.49 1.01 G2
A_23_P119377 CYTH2 NM_004228 9266 −0.42 −0.11 0.31 −0.64 G2
A_23_P422268 DCAF7 NM_005828 10238 0.32 0.42 0.10 −0.21 G2
A_24_P916141 DCAF7 NM_005828 10238 −0.20 0.23 0.44 −1.47 G2
A_24_P91222 DCAF7 NM_005828 10238 0.13 0.10 −0.02 −0.15 G2
A_23_P26836 DCAF7 NM_005828 10238 0.10 0.41 0.31 −1.19 G2
A_32_P430743 DET1 AK125793 NA 1.07 0.74 −0.33 0.27 G2
A_23_P26184 DET1 NM_017996 55070 0.04 0.07 0.03 0.09 G2
A_23_P124224 DHX8 NM_004941 1659 0.03 0.04 0.02 0.16 G2
A_23_P119478 EBI3 NM_005755 10148 4.87 4.24 −0.63 4.69 G2
A_24_P370201 EBI3 NM_005755 10148 1.35 0.70 −0.65 1.40 G2
A_23_P117580 ENTPD5 NM_001249 957 0.12 0.09 −0.03 0.16 G2
A_23_P32707 ESPL1 NM_012291 9700 −0.40 −1.11 −0.70 0.46 G2
A_32_P119007 ESPL1 NM_012291 9700 0.48 1.80 1.33 −0.18 G2
A_24_P278637 FADD NM_003824 8772 −0.41 −0.08 0.33 −0.18 G2
A_23_P86917 FADD NM_003824 8772 −0.33 0.05 0.37 −0.32 G2
A_23_P386241 FAM110A NM_001042353 83541 0.01 0.38 0.37 −0.66 G2
A_23_P323751 FAM83D NM_030919 81610 −1.23 −1.77 −0.54 0.09 G2
A_23_P377888 FAN1 NM_014967 22909 0.24 0.15 −0.09 0.33 G2
A_23_P345678 FANCD2 NM_033084 2177 −0.61 −1.11 −0.50 −0.17 G2
A_32_P24165 FANCD2 NM_001018115 2177 −0.59 −0.68 −0.09 −0.10 G2
A_23_P143994 FANCD2 NM_001018115 2177 −0.59 −0.56 0.03 −0.90 G2
A_23_P142333 FZR1 NM_016263 51343 0.40 0.18 −0.22 0.12 G2
A_23_P142325 FZR1 NM_001136198 51343 0.41 0.05 −0.35 0.11 G2
A_24_P944291 FZR1 ENST00000395095 51343 0.04 0.25 0.21 −0.49 G2
A_24_P318836 FZR1 NM_016263 51343 −0.04 0.02 0.06 −0.53 G2
A_23_P106280 GABPB1 NR_026891 55056 −0.85 −0.42 0.43 −0.95 G2
A_23_P205789 GABPB1 NM_002041 2553 1.27 0.43 −0.84 1.47 G2
A_24_P176255 GABPB1 NM_005254 2553 −0.14 −0.02 0.12 0.16 G2
A_23_P83134 GAS1 NM_002048 2619 0.50 −0.71 −1.21 0.26 G2
A_24_P38895 H2AFX NM_002105 3014 −1.09 −0.78 0.31 −0.88 G2
A_23_P141965 HAUS8 NM_033417 93323 −0.41 −0.45 −0.04 0.18 G2
A_32_P85500 HCP5 NM_006674 10866 0.72 0.39 −0.32 0.76 G2
A_23_P111126 HCP5 L06175 10866 0.55 0.24 −0.31 0.80 G2
A_24_P17870 HCP5 NM_006674 10866 0.52 0.14 −0.37 0.70 G2
A_24_P238609 HCP5 NM_006674 10866 0.28 0.09 −0.19 0.40 G2
A_23_P145574 HINT3 NM_138571 135114 0.38 0.18 −0.20 0.80 G2
A_24_P681011 HIPK2 NM_022740 28996 0.20 0.72 0.52 −2.31 G2
A_23_P169756 HIPK2 NM_022740 28996 0.20 0.39 0.19 −1.41 G2
A_24_P500621 HIPK2 NM_022740 28996 0.10 0.39 0.29 −1.71 G2
A_23_P169766 HIPK2 NM_022740 28996 −0.02 0.20 0.22 −1.50 G2
A_23_P149301 HIST3H2A NM_033445 92815 0.15 0.07 −0.08 0.79 G2
A_24_P257099 HJURP NM_018410 55355 −2.18 −1.32 0.86 −1.01 G2
A_23_P155765 HMGB2 NM_002129 3148 −0.77 −2.05 −1.29 0.90 G2
A_23_P88303 HSPA2 NM_021979 3306 1.00 0.29 −0.71 0.23 G2
A_23_P17633 IFNAR1 NM_000629 3454 0.54 0.11 −0.43 0.40 G2
A_23_P113803 KATNA1 NM_007044 11104 0.17 −0.33 −0.50 0.62 G2
A_23_P77286 KATNBL1 NM_024713 79768 −0.55 −0.37 0.18 −0.19 G2
A_32_P58163 KATNBL1 NM_024713 79768 −0.34 −0.15 0.20 −0.11 G2
A_24_P12539 KBTBD2 NM_015483 25948 0.20 −0.15 −0.35 0.37 G2
A_23_P70951 KBTBD2 NM_015483 25948 0.06 0.00 −0.07 0.06 G2
A_23_P74446 KDM4A NM_014663 9682 −0.20 0.07 0.27 −0.48 G2
A_24_P227091 KIF11 NM_004523 3832 −2.63 −1.71 0.93 −1.86 G2
A_23_P52278 KIF11 NM_004523 3832 −1.24 −0.93 0.31 −0.76 G2
A_23_P54622 KIF22 NM_007317 3835 −1.46 −1.13 0.33 −0.79 G2
A_23_P133956 KIFC1 NM_002263 3833 −2.20 −1.79 0.41 −1.11 G2
A_24_P252739 KLF6 NM_001300 1316 −1.45 −1.02 0.43 −0.96 G2
A_24_P932981 KLF6 NM_001300 1316 0.59 −0.18 −0.77 −0.30 G2
A_24_P69654 KLF6 NM_001300 1316 0.81 −0.29 −1.10 0.00 G2
A_23_P63798 KLF6 NM_001300 1316 0.57 −0.29 −0.86 −0.26 G2
A_23_P125265 KPNA2 NM_002266 3838 −1.25 −0.63 0.62 −0.25 G2
A_23_P342744 LIX1L NM_153713 128077 0.56 0.04 −0.52 0.40 G2
A_24_P687594 LIX1L ENST00000369308 128077 0.30 −0.02 −0.31 −0.45 G2
A_23_P258493 LMNB1 NM_005573 4001 −1.90 −1.59 0.31 −1.26 G2
A_24_P264790 LTBP3 NM_021070 4054 −0.85 −0.57 0.28 −0.36 G2
A_24_P298360 LTBP3 NM_021070 4054 0.36 −0.16 −0.51 −0.64 G2
A_23_P92441 MAD2L1 NM_002358 4085 −1.86 −1.58 0.28 −0.36 G2
A_24_P873659 MALAT1 NR_002819 378938 0.29 −0.40 −0.69 1.76 G2
A_23_P21143 MALAT1 NR_002819 378938 −0.19 −0.44 −0.25 0.80 G2
A_24_P829261 MALAT1 NR_002819 378938 0.11 0.03 −0.08 0.27 G2
A_24_P497244 MALAT1 NR_002819 378938 0.07 −0.32 −0.40 1.05 G2
A_23_P94422 MELK NM_014791 9833 −3.11 −2.07 1.04 −1.29 G2
A_23_P42626 MEPCE NM_019606 56257 −0.18 0.15 0.32 −0.74 G2
A_24_P312189 MEPCE NM_019606 56257 −0.16 0.24 0.40 −0.71 G2
A_23_P145844 MET NM_000245 4233 0.51 0.41 −0.10 0.86 G2
A_23_P145846 MET NM_000245 4233 0.27 0.27 0.00 0.71 G2
A_23_P359245 MET NM_000245 4233 0.22 0.30 0.08 0.11 G2
A_23_P65558 MGAT2 NM_002408 4247 −0.19 −0.39 −0.20 1.27 G2
A_32_P128656 MID1 NM_000381 4281 −0.31 0.14 0.46 −0.59 G2
A_23_P170037 MID1 NM_033290 4281 −0.01 0.50 0.50 −0.87 G2
A_23_P133123 MND1 NM_032117 84057 −2.67 −2.06 0.61 −1.08 G2
A_23_P360605 MTCL1 NM_015210 23255 −1.12 −0.38 0.74 −1.41 G2
A_23_P137856 MUC1 NM_002456 4582 −0.29 0.17 0.46 −1.61 G2
A_32_P71447 NCAPD3 NM_015261 23310 −0.92 −0.59 0.32 −0.53 G2
A_23_P415443 NCAPH NM_015341 23397 −2.82 −2.15 0.67 −1.02 G2
A_23_P50108 NDC80 NM_006101 10403 −3.12 −2.49 0.64 −0.69 G2
A_24_P14156 NDC80 NM_006101 10403 −1.90 −1.59 0.31 −0.41 G2
A_23_P155711 NEIL3 NM_018248 55247 −0.52 −0.51 0.02 0.19 G2
A_24_P356830 NFIC AK129956 4782 0.20 0.15 −0.06 −0.83 G2
A_23_P131115 NFIC NM_005597 4782 −0.18 0.31 0.49 −0.92 G2
A_24_P180383 NIPBL NM_015384 25836 −0.12 0.22 0.33 −0.46 G2
A_23_P213883 NIPBL NM_133433 25836 0.09 −0.04 −0.13 −0.15 G2
A_24_P357688 NIPBL NM_015384 25836 0.10 −0.05 −0.16 0.70 G2
A_24_P213161 NLRP2 NM_017852 55655 −0.78 −0.17 0.61 −1.33 G2
A_23_P88522 NMB NM_021077 4828 1.35 0.91 −0.44 2.12 G2
A_23_P127584 NNMT NM_006169 4837 −0.01 0.25 0.27 −0.30 G2
A_24_P787914 NR3C1 U25029 2908 1.13 0.58 −0.55 1.02 G2
A_23_P214059 NR3C1 NM_001018077 2908 0.83 0.19 −0.64 0.56 G2
A_24_P214754 NR3C1 NM_001018077 2908 0.80 0.04 −0.76 1.23 G2
A_24_P216968 NUCKS1 NM_022731 64710 −0.40 −0.39 0.01 −0.04 G2
A_24_P145122 NUCKS1 NM_022731 64710 −0.35 −0.36 −0.01 −0.07 G2
A_24_P216964 NUCKS1 NM_022731 64710 −0.23 −0.48 −0.25 −0.15 G2
A_24_P374652 NUCKS1 NM_022731 64710 0.09 −0.04 −0.14 0.21 G2
A_23_P149724 NUCKS1 NM_022731 64710 −0.02 −0.24 −0.22 0.07 G2
A_23_P162120 NUMA1 NM_006185 4926 0.11 0.39 0.28 −0.38 G2
A_23_P17471 PCED1A NM_022760 64773 −0.13 −0.27 −0.14 0.08 G2
A_23_P416468 PIF1 NM_025049 80119 −2.16 −1.63 0.53 −0.08 G2
A_23_P323749 PIF1 NM_025049 80119 −0.37 0.19 0.56 −0.14 G2
A_23_P323743 PIF1 NM_025049 80119 −0.19 −0.27 −0.08 0.04 G2
A_24_P196534 PKNOX1 NM_004571 5316 0.32 0.19 −0.14 0.10 G2
A_23_P211299 PKNOX1 NM_004571 5316 0.20 0.25 0.05 0.49 G2
A_24_P378907 PKNOX1 NM_004571 5316 −0.23 0.25 0.48 −0.15 G2
A_23_P333998 POLQ AF090919 10721 −1.90 −1.42 0.48 −1.15 G2
A_23_P218827 POLQ NM_199420 10721 −2.19 −1.69 0.49 −1.00 G2
A_24_P63109 PPP1R2 NM_006241 5504 0.30 −0.18 −0.48 0.89 G2
A_32_P17133 PPP1R2 NM_006241 5504 0.11 −0.21 −0.31 0.63 G2
A_24_P174367 PPP1R2 NM_006241 5504 −0.06 −0.17 −0.11 0.34 G2
A_23_P46539 PSRC1 NM_032636 84722 −0.92 −0.66 0.26 −0.48 G2
A_23_P106439 RCCD1 NM_033544 91433 −0.52 −0.10 0.41 −0.66 G2
A_23_P106433 RCCD1 NM_033544 91433 −0.23 −0.05 0.17 −0.62 G2
A_23_P25684 RDH11 NM_016026 51109 −0.39 −0.19 0.20 −0.56 G2
A_24_P377775 RGS3 NM_017790 5998 0.85 0.37 −0.48 0.24 G2
A_23_P219197 RGS3 NM_134427 5998 −0.03 −0.04 −0.01 −0.43 G2
A_23_P134714 RIDA NM_005836 10247 −0.54 −0.12 0.42 −0.41 G2
A_23_P121602 SAP30 NM_003864 8819 −0.39 −0.22 0.16 0.11 G2
A_23_P147647 SGCD NM_000337 6444 0.23 −0.19 −0.41 0.51 G2
A_23_P136254 SGCD NM_172244 6444 0.17 0.37 0.20 −0.63 G2
A_32_P4595 SGCD NM_000337 6444 0.05 −0.38 −0.43 0.33 G2
A_23_P340909 SKA3 BC013418 221150 −3.76 −2.71 1.05 −1.64 G2
A_23_P327643 SMC4 A_23_P327643 NA 0.61 0.07 −0.53 0.40 G2
A_23_P91900 SMC4 NM_005496 10051 −0.46 −0.37 0.09 −0.62 G2
A_23_P87049 SORL1 NM_003105 6653 0.07 0.31 0.24 −0.86 G2
A_23_P56630 STAT1 NM_007315 6772 0.35 0.58 0.23 −0.36 G2
A_24_P274270 STAT1 NM_139266 6772 0.16 0.43 0.28 −0.09 G2
A_24_P214231 STIL NM_001048166 6491 −0.73 0.04 0.78 −0.96 G2
A_23_P154367 STK17B NM_004226 9262 −0.33 −0.57 −0.24 0.27 G2
A_24_P636882 STK17B NM_004226 9262 −0.30 0.07 0.37 −0.78 G2
A_23_P100022 SV2B NM_014848 9899 −0.25 0.02 0.27 0.33 G2
A_23_P431381 TEDC1 NM_001134875 283643 −0.52 −0.16 0.37 −0.24 G2
A_32_P14187 TFAP2A NM_001032280 7020 0.71 0.16 −0.56 0.26 G2
A_23_P62115 TIMP1 NM_003254 7076 0.09 0.06 −0.03 0.27 G2
A_23_P24716 TMEM132A NM_017870 54972 0.30 0.29 0.00 −0.74 G2
A_24_P210244 TMPO NM_001032283 7112 −0.85 −0.65 0.20 0.42 G2
A_23_P325040 TMPO NM_003276 7112 −0.33 −0.59 −0.26 −0.17 G2
A_24_P44891 TNPO2 NM_013433 30000 0.63 0.13 −0.50 1.02 G2
A_23_P354953 TNPO2 NM_013433 30000 −0.43 0.05 0.48 −0.11 G2
A_23_P170491 TRAIP NM_005879 10293 −0.48 −0.61 −0.12 0.31 G2
A_23_P407718 TRIM59 NM_173084 286827 −0.89 −0.76 0.13 −0.13 G2
A_32_P72341 TRIM59 NM_173084 286827 −0.44 −0.58 −0.14 0.05 G2
A_23_P48826 TRIM69 NM_182985 140691 0.42 0.05 −0.38 0.44 G2
A_24_P50543 TRIM69 A_24_P50543 NA −0.04 −0.01 0.03 0.21 G2
A_23_P254193 TTC38 NM_017931 55020 −0.45 0.19 0.64 −0.76 G2
A_24_P156388 TTC38 NM_017931 55020 −0.35 0.01 0.36 −0.53 G2
A_32_P168388 TTF2 AK123765 8458 −0.21 −0.18 0.03 −0.40 G2
A_23_P97161 TTF2 NM_003594 8458 0.23 −0.05 −0.28 0.25 G2
A_23_P139547 TUBA1A NM_006009 7846 −0.34 −0.17 0.17 0.19 G2
A_23_P128598 TUBA3C NM_006001 7278 0.22 0.66 0.44 −0.22 G2
A_23_P154065 TUBA4A NM_006000 7277 0.66 0.48 −0.18 0.76 G2
A_23_P102109 TUBA4A NM_006000 7277 0.56 0.48 −0.09 0.81 G2
A_23_P154070 TUBA4A NM_006000 7277 −0.45 −0.15 0.30 0.06 G2
A_23_P84448 TUBA4A NM_006000 7277 0.22 0.14 −0.08 0.52 G2
A_23_P387057 TUBB NM_178014 203068 −0.46 −0.41 0.05 0.07 G2
A_23_P81912 TUBB NM_178014 203068 −0.37 −0.37 0.00 0.25 G2
A_32_P78528 TUBB NM_178014 203068 −0.28 −0.16 0.12 0.07 G2
A_23_P19291 TUBB2A NM_001069 7280 1.18 −0.07 −1.25 0.79 G2
A_23_P501276 TUBB2A NM_001069 7280 0.42 −0.32 −0.74 0.72 G2
A_23_P26895 TUBD1 NM_016261 51174 −0.02 0.13 0.15 0.14 G2
A_23_P423480 TYSND1 NM_173555 219743 −0.21 −0.16 0.05 0.11 G2
A_24_P290585 UACA NM_001008224 55075 0.28 0.01 −0.27 1.38 G2
A_23_P360340 UACA NM_001008224 55075 0.10 −0.23 −0.33 0.55 G2
A_24_P90774 UACA NM_001008224 55075 0.03 0.11 0.07 −0.41 G2
A_24_P297539 UBE2C NM_181803 11065 −2.93 −2.50 0.43 −0.57 G2
A_23_P11936 UBXN11 NM_183008 91544 −0.32 −0.37 −0.06 −0.35 G2
A_24_P239811 UBXN11 NM_183008 91544 −0.03 0.00 0.03 0.00 G2
A_23_P428298 UNC5CL NM_173561 222643 0.48 0.40 −0.08 −0.09 G2
A_23_P66599 VPS25 NM_032353 84313 −0.33 −0.20 0.13 0.02 G2
A_24_P294982 VTA1 NM_016485 51534 −0.42 −0.42 0.00 0.18 G2
A_23_P42368 VTA1 NM_016485 51534 −0.36 −0.20 0.16 −0.24 G2
A_23_P393766 WDR62 NM_173636 284403 0.15 −0.21 −0.36 0.47 G2
A_23_P339705 WDR62 NM_173636 284403 −0.02 −0.17 −0.15 −0.03 G2
A_23_P101281 ZNF587 NM_032828 84914 −0.17 −0.06 0.11 0.19 G2
A_24_P313804 ZNF587 NM_032828 84914 −0.19 −0.14 0.05 0.74 G2
A_24_P373726 ZNF587 NM_032828 84914 −0.01 −0.30 −0.28 0.42 G2
A_23_P329286 ZNHIT2 NM_014205 741 −0.25 −0.03 0.22 −0.41 G2
A_23_P356684 ANLN NM_018685 54443 −2.41 −2.24 0.17 −0.42 G2,G2_M
A_23_P334845 ARHGAP19 NM_032900 84986 0.51 0.47 −0.04 0.34 G2,G2_M
A_23_P1387 ARHGAP19 NM_032900 84986 0.00 −0.49 −0.49 0.70 G2,G2_M
A_24_P19337 ASXL1 NM_015338 171023 0.61 0.34 −0.26 0.39 G2,G2_M
A_32_P41021 ASXL1 NM_015338 171023 −0.32 0.00 0.32 −0.65 G2,G2_M
A_23_P58321 CCNA2 NM_001237 890 −2.44 −1.76 0.69 −0.71 G2,G2_M
A_24_P218979 CDCA3 NM_031299 83461 −2.19 −2.02 0.17 −0.56 G2,G2_M
A_23_P162476 CDCA3 NM_031299 83461 −1.69 −1.43 0.27 −0.36 G2,G2_M
A_23_P209394 CFLAR NM_001127184 8837 1.55 0.95 −0.60 2.06 G2,G2_M
A_24_P120115 CFLAR NM_003879 8837 0.65 0.80 0.15 0.12 G2,G2_M
A_23_P151405 CKAP2 NM_018204 26586 −1.71 −0.85 0.87 −0.82 G2,G2_M
A_24_P99090 CKAP2 NM_018204 26586 −0.17 −0.05 0.12 0.04 G2,G2_M
A_23_P90062 DNAJB1 NM_006145 3337 1.18 0.26 −0.92 0.32 G2,G2_M
A_24_P941759 G2E3 NM_017769 55632 −0.44 −0.47 −0.04 −0.04 G2,G2_M
A_23_P99604 G2E3 NM_017769 55632 0.22 −0.14 −0.36 0.64 G2,G2_M
A_32_P189204 GAS2L3 NM_174942 283431 −0.76 −0.63 0.13 0.22 G2,G2_M
A_32_P37143 GAS2L3 BX649059 283431 −0.46 −0.60 −0.14 0.25 G2,G2_M
A_24_P944616 HP1BP3 NM_016287 50809 −0.33 −0.08 0.25 −0.95 G2,G2_M
A_23_P137630 HP1BP3 NM_016287 50809 −0.28 −0.26 0.02 0.52 G2,G2_M
A_24_P247660 JPT1 NM_001002033 51155 −0.50 −0.45 0.05 −0.64 G2,G2_M
A_23_P100632 JPT1 NM_001002033 51155 −0.11 0.22 0.33 −0.42 G2,G2_M
A_23_P75071 KIF20B NM_016195 9585 −1.72 −1.70 0.02 −0.31 G2,G2_M
A_23_P86403 KIF5B NM_004521 3799 0.08 −0.01 −0.09 −0.13 G2,G2_M
A_23_P200493 LBR NM_002296 3930 −0.26 −0.23 0.03 0.20 G2,G2_M
A_23_P106162 MIS18BP1 NM_018353 55320 −0.89 −0.34 0.55 −0.14 G2,G2_M
A_23_P364107 MIS18BP1 NM_018353 55320 −1.10 −0.59 0.52 −0.69 G2,G2_M
A_23_P315843 NCOA5 NM_020967 57727 −0.63 0.19 0.82 −1.05 G2,G2_M
A_23_P210515 NCOA5 NM_020967 57727 −0.66 0.45 1.12 −1.46 G2,G2_M
A_24_P416079 NUSAP1 NM_016359 51203 −2.70 −2.01 0.69 −0.98 G2,G2_M
A_23_P333420 RANGAP1 NM_002883 5905 0.07 −0.20 −0.27 0.29 G2,G2_M
A_23_P139066 RNF141 NM_016422 50862 0.39 −0.13 −0.53 0.95 G2,G2_M
A_24_P372625 RNF141 NM_016422 50862 0.06 −0.02 −0.08 0.14 G2,G2_M
A_23_P100788 STAT5B NM_012448 6777 0.68 0.33 −0.34 0.33 G2,G2_M
A_24_P342178 STAT5B BC020868 6777 0.33 0.08 −0.25 0.46 G2,G2_M
A_32_P187327 TUBB4B NM_006088 10383 −0.26 0.35 0.60 −0.76 G2,G2_M
A_23_P312863 TUBB4B NM_006088 10383 −0.21 0.32 0.53 −0.67 G2,G2_M
A_23_P4353 WSB1 NM_015626 26118 1.02 −0.01 −1.03 1.36 G2,G2_M
A_23_P214756 ADGRG6 NM_198569 57211 0.15 0.08 −0.07 0.85 G2,S
A_24_P942945 ADGRG6 NM_020455 57211 −0.14 −0.28 −0.14 −0.14 G2,S
A_24_P411749 ADGRG6 NM_020455 57211 −0.01 −0.21 −0.21 0.28 G2,S
A_23_P118834 TOP2A NM_001067 7153 −3.63 −2.61 1.02 −1.33 G2,S
A_23_P502314 ADGRE5 NM_078481 976 −0.13 0.18 0.32 −0.67 G2_M
A_23_P502312 ADGRE5 NM_078481 976 0.02 0.39 0.37 −0.76 G2_M
A_23_P30098 ADH4 NM_000670 127 −0.24 0.51 0.75 0.10 G2_M
A_23_P27688 ADM5 NM_001101340 199800 −0.26 −0.26 0.00 0.09 G2_M
A_23_P436353 AFDN NM_001040001 4301 0.39 0.35 −0.04 −0.39 G2_M
A_23_P256603 AFDN NM_005936 4301 0.11 −0.83 −0.93 0.75 G2_M
A_24_P943484 AHI1 NM_017651 54806 0.27 0.29 0.01 0.72 G2_M
A_24_P213710 AHI1 NM_017651 54806 −0.24 0.10 0.34 0.06 G2_M
A_24_P38143 AHI1 NM_017651 54806 −0.19 0.11 0.30 0.14 G2_M
A_23_P70746 AHI1 NM_017651 54806 0.07 0.27 0.19 0.16 G2_M
A_23_P428819 AKIRIN2 NM_018064 55122 0.39 0.20 −0.19 −0.07 G2_M
A_23_P428827 AKIRIN2 NM_018064 55122 0.11 −0.07 −0.18 −0.37 G2_M
A_23_P20615 ANP32B NM_006401 10541 0.43 0.07 −0.36 0.24 G2_M
A_24_P225468 ANP32E NM_030920 81611 −0.32 −0.68 −0.37 0.30 G2_M
A_23_P160934 ANP32E NM_030920 81611 0.01 −0.39 −0.41 0.90 G2_M
A_23_P151075 ARHGDIB NM_001175 397 −0.28 0.41 0.69 0.07 G2_M
A_24_P356218 ARL6IP1 NM_015161 23204 −0.14 −0.27 −0.13 0.08 G2_M
A_23_P118150 ARL6IP1 NM_015161 23204 −0.29 −0.32 −0.03 1.16 G2_M
A_23_P91640 ASPHD2 NM_020437 57168 −0.55 0.19 0.74 −1.23 G2_M
A_24_P245815 ASPHD2 NM_020437 57168 −0.29 0.33 0.62 −1.00 G2_M
A_23_P112950 ATF7IP NM_018179 55729 0.17 0.54 0.37 −0.51 G2_M
A_24_P923757 ATF7IP NM_018179 55729 0.26 0.26 0.00 0.25 G2_M
A_23_P48278 ATF7IP AK001001 55729 −0.01 0.81 0.82 −0.13 G2_M
A_23_P163814 ATXN1L NM_001137675 342371 0.09 −0.31 −0.40 0.20 G2_M
A_23_P131866 AURKA NM_198433 6790 −1.56 −1.01 0.56 0.03 G2_M
A_24_P103803 B4GALT1 NM_001497 2683 0.90 0.68 −0.22 −0.45 G2_M
A_23_P135271 B4GALT1 NM_001497 2683 0.49 0.22 −0.27 −0.06 G2_M
A_24_P115774 BIRC2 NM_001166 329 −0.12 −0.28 −0.16 0.32 G2_M
A_23_P118815 BIRC5 NM_001012271 332 −3.41 −2.33 1.08 −1.52 G2_M
A_23_P143331 BMP2 NM_001200 650 1.44 0.57 −0.87 0.93 G2_M
A_23_P124417 BUB1 NM_004336 699 −3.26 −2.47 0.79 −0.75 G2_M
A_23_P163481 BUB1B NM_001211 701 −3.08 −2.32 0.76 −1.02 G2_M
A_23_P92928 C6 NM_000065 729 −0.19 −0.33 −0.14 −0.46 G2_M
A_23_P28664 CCDC88A NM_018084 55704 0.71 0.22 −0.49 0.70 G2_M
A_24_P20120 CCDC88A NM_018084 55704 0.52 0.40 −0.12 0.49 G2_M
A_23_P17269 CCDC88A NM_018084 55704 0.36 −0.01 −0.37 0.82 G2_M
A_24_P28739 CCDC88A NM_018084 55704 0.32 −0.17 −0.49 0.41 G2_M
A_23_P122197 CCNB1 NM_031966 891 −2.14 −1.49 0.65 −0.27 G2_M
A_23_P65757 CCNB2 NM_004701 9133 −3.05 −2.42 0.64 −0.70 G2_M
A_32_P72822 CCNB2 AK023404 9133 0.52 0.74 0.22 0.59 G2_M
A_23_P202837 CCND1 NM_053056 595 −0.15 −0.20 −0.05 −0.10 G2_M
A_24_P124550 CCND1 NM_053056 595 −0.03 −0.15 −0.12 −0.75 G2_M
A_24_P193011 CCND1 NM_053056 595 −0.02 0.09 0.11 −1.15 G2_M
A_23_P366908 CCSAP NM_145257 126731 0.38 −0.19 −0.57 0.18 G2_M
A_24_P930764 CCSAP BC039241 126731 0.40 −0.35 −0.75 0.71 G2_M
A_32_P83776 CCSAP NM_145257 126731 0.42 0.13 −0.29 −1.01 G2_M
A_23_P149200 CDC20 NM_001255 991 −1.36 −1.65 −0.28 0.10 G2_M
A_23_P210726 CDC25B NM_021873 994 −0.75 −0.03 0.72 −0.74 G2_M
A_23_P66777 CDC27 NM_001256 996 0.05 0.25 0.20 0.28 G2_M
A_23_P166453 CDC42EP1 NM_152243 11135 −0.06 0.25 0.31 −0.98 G2_M
A_24_P143032 CDC42EP1 NM_152243 11135 0.06 0.25 0.19 −0.63 G2_M
A_23_P89941 CDKN2D NM_001800 1032 0.50 −0.51 −1.01 0.79 G2_M
A_24_P413884 CENPA NM_001809 1058 −2.99 −2.34 0.65 −1.30 G2_M
A_23_P253524 CENPE NM_001813 1062 −2.90 −1.84 1.06 −1.03 G2_M
A_23_P401 CENPF NM_016343 1063 −3.83 −2.46 1.37 −1.17 G2_M
A_24_P96780 CENPF NM_016343 1063 −1.58 −0.86 0.72 −0.66 G2_M
A_23_P115872 CEP55 NM_018131 55165 −2.96 −2.26 0.71 −0.74 G2_M
A_23_P420551 CIT NM_007174 11113 −2.31 −1.43 0.88 −1.92 G2_M
A_23_P135977 CKAP5 NM_001008938 9793 −0.65 −0.56 0.09 −0.09 G2_M
A_24_P300841 CKAP5 NM_001008938 9793 −0.27 −0.13 0.14 −0.11 G2_M
A_23_P45917 CKS1B NM_001826 1163 −0.90 −1.00 −0.10 0.48 G2_M
A_32_P206698 CKS1B NM_001826 1163 −0.79 −0.88 −0.08 0.51 G2_M
A_32_P192430 CKS1B NM_001826 1163 −0.52 −0.67 −0.15 0.44 G2_M
A_23_P71727 CKS2 NM_001827 1164 −0.85 −1.06 −0.21 0.78 G2_M
A_23_P16673 CNN2 NM_004368 1265 0.34 0.36 0.01 −0.98 G2_M
A_24_P142743 CNN2 NM_004368 1265 0.15 0.29 0.14 0.07 G2_M
A_23_P9768 CNTROB NM_053051 116840 −0.07 −0.01 0.06 0.00 G2_M
A_23_P9761 CNTROB NM_001037144 116840 −0.02 0.10 0.12 −0.45 G2_M
A_23_P404606 CREBRF NM_153607 153222 0.59 −0.30 −0.88 1.08 G2_M
A_23_P134835 CSGALNACT1 NM_018371 55790 1.04 0.75 −0.29 1.04 G2_M
A_24_P406525 CSGALNACT1 NM_018371 55790 0.10 0.31 0.21 0.25 G2_M
A_23_P58647 CTNNA1 NM_001903 1495 0.06 0.36 0.30 −0.44 G2_M
A_24_P80633 CTNNA1 NM_001903 1495 0.03 0.05 0.02 −0.27 G2_M
A_24_P881527 CTNND1 NM_001085458 1500 −0.14 0.09 0.23 −0.46 G2_M
A_23_P95080 CTNND1 NM_001085461 1500 0.13 −0.15 −0.28 0.76 G2_M
A_23_P251316 CTNND1 NM_001331 1500 −0.12 −0.21 −0.09 −0.15 G2_M
A_24_P38930 CTNND1 NM_001331 1500 0.07 −0.03 −0.10 −0.22 G2_M
A_23_P200310 DEPDC1 NM_017779 55635 −2.48 −2.08 0.40 −0.16 G2_M
A_24_P25872 DEPDC1 NM_017779 55635 −1.13 −1.41 −0.28 −0.32 G2_M
A_23_P361419 DEPDC1B NM_018369 55789 −1.89 −1.25 0.63 −0.44 G2_M
A_23_P88331 DLGAP5 NM_014750 9787 −3.42 −2.36 1.06 −1.16 G2_M
A_24_P9671 DNAJA1 NM_001539 3301 0.95 0.69 −0.26 1.02 G2_M
A_24_P192586 DNAJA1 ENST00000330899 3301 −0.49 −0.02 0.47 0.14 G2_M
A_23_P60479 DNAJA1 NM_001539 3301 0.31 0.26 −0.05 0.90 G2_M
A_23_P63205 DR1 NM_001938 1810 0.30 −0.06 −0.36 0.37 G2_M
A_23_P391725 DR1 NM_001938 1810 0.13 0.16 0.03 0.01 G2_M
A_23_P134935 DUSP4 NM_001394 1846 −0.31 −0.20 0.12 −0.96 G2_M
A_23_P144165 DZIP3 NM_014648 9666 0.64 0.09 −0.55 0.75 G2_M
A_24_P102504 DZIP3 NM_014648 9666 −0.14 −0.30 −0.16 0.24 G2_M
A_23_P435051 DZIP3 ENST00000463306 9666 0.06 −0.22 −0.28 0.25 G2_M
A_23_P31721 E2F5 NM_001951 1875 −0.48 −0.02 0.46 −0.36 G2_M
A_23_P9574 ECT2 NM_018098 1894 −0.96 −0.37 0.59 0.16 G2_M
A_23_P44684 ECT2 NM_018098 1894 −1.09 −0.50 0.59 −0.44 G2_M
A_24_P366033 ECT2 NM_018098 1894 −0.29 −0.31 −0.02 0.38 G2_M
A_24_P282251 FGA NM_021871 2243 0.26 −0.16 −0.42 −0.04 G2_M
A_23_P44274 FGA NM_000508 2243 −0.08 0.01 0.09 0.24 G2_M
A_23_P375372 FGA NM_021871 2243 0.07 0.62 0.55 −0.54 G2_M
A_23_P151150 FOXM1 NM_202002 2305 −1.27 −1.19 0.07 −1.05 G2_M
A_23_P363778 FRZB NM_001463 2487 1.24 0.54 −0.70 1.02 G2_M
A_23_P10902 FRZB NM_001463 2487 0.95 0.41 −0.54 0.75 G2_M
A_23_P502142 FYN NM_002037 2534 −0.54 −0.35 0.20 −1.32 G2_M
A_23_P23221 GADD45A NM_001924 1647 0.64 0.07 −0.58 −0.01 G2_M
A_23_P146922 GAS6 NM_000820 2621 0.18 0.16 −0.02 −0.78 G2_M
A_23_P105251 GLI1 NM_005269 2735 0.06 0.17 0.12 −0.31 G2_M
A_23_P63825 GOT1 NM_002079 2805 0.29 0.53 0.24 0.44 G2_M
A_24_P81473 GOT1 NM_002079 2805 0.20 0.18 −0.01 0.64 G2_M
A_23_P63402 GPSM2 NM_013296 29899 −1.24 −0.96 0.28 −0.28 G2_M
A_24_P273132 GPSM2 NM_013296 29899 −0.47 −0.69 −0.23 −0.02 G2_M
A_23_P257256 GRK6 NM_002082 2870 −0.18 0.03 0.21 −0.53 G2_M
A_23_P152420 GSE1 NM_014615 23199 0.19 0.03 −0.16 −0.38 G2_M
A_24_P943062 GSE1 NM_014615 23199 −0.11 0.18 0.29 −1.06 G2_M
A_23_P57588 GTSE1 NM_016426 51512 −2.01 −1.57 0.43 −0.89 G2_M
A_23_P125771 HCFC1 NM_005334 3054 −0.26 0.18 0.45 −1.13 G2_M
A_23_P168490 HERPUD2 NM_022373 64224 0.03 0.00 −0.03 −0.02 G2_M
A_23_P119543 HMG20B NM_006339 10362 −0.82 −0.34 0.48 −0.54 G2_M
A_23_P217236 HMGB3 NM_005342 3149 −0.75 −0.79 −0.04 −0.06 G2_M
A_23_P70007 HMMR NM_012484 3161 −3.37 −2.64 0.73 −0.46 G2_M
A_23_P109442 HPS4 NM_022081 89781 0.72 0.36 −0.36 −0.05 G2_M
A_23_P109446 HPS4 NM_022081 89781 0.58 0.44 −0.14 −0.34 G2_M
A_23_P17606 HSPA13 NM_006948 6782 1.40 0.56 −0.85 2.40 G2_M
A_24_P134392 HSPA13 NM_006948 6782 0.30 −0.05 −0.35 0.52 G2_M
A_23_P70547 HSPA1L NM_005527 3305 1.11 0.14 −0.96 0.90 G2_M
A_32_P13728 HSPA8 NM_006597 3312 0.36 0.40 0.03 0.34 G2_M
A_24_P295745 HSPA8 NM_153201 3312 0.13 0.12 −0.01 0.78 G2_M
A_24_P287129 HSPA8 NM_006597 3312 0.05 0.06 0.02 0.10 G2_M
A_23_P24594 HSPA8 NM_006597 3312 0.03 0.12 0.09 0.17 G2_M
A_23_P410600 IDI2 NM_033261 91734 0.14 −0.01 −0.16 −0.21 G2_M
A_23_P112026 IDO1 NM_002164 3620 0.69 0.85 0.16 0.41 G2_M
A_23_P55076 INPP5K NM_130766 51763 0.47 0.28 −0.19 −0.09 G2_M
A_24_P279328 INPP5K NM_130766 51763 −0.09 −0.12 −0.02 −0.42 G2_M
A_23_P109184 INSM1 NM_002196 3642 1.19 0.87 −0.32 −0.25 G2_M
A_24_P31676 INSM1 NM_002196 3642 −0.05 0.13 0.17 −0.08 G2_M
A_23_P92042 ITPR1 NM_002222 3708 0.17 0.24 0.07 −0.72 G2_M
A_23_P156198 JADE2 NM_015288 23338 1.15 0.18 −0.97 0.77 G2_M
A_24_P226278 JADE2 NM_015288 23338 0.53 −0.07 −0.60 0.28 G2_M
A_23_P416434 JADE2 NM_015288 23338 −0.17 0.47 0.64 −0.91 G2_M
A_24_P927883 JADE2 A_24_P927883 NA −0.02 0.29 0.31 −0.10 G2_M
A_24_P324011 KCTD2 NM_015353 23510 −0.20 −0.03 0.17 −0.55 G2_M
A_32_P160693 KCTD2 NM_015353 23510 −0.02 −0.13 −0.11 −0.13 G2_M
A_23_P149668 KIF14 NM_014875 9928 −0.68 −0.91 −0.23 −0.16 G2_M
A_23_P34788 KIF2C NM_006845 11004 −3.33 −2.53 0.80 −0.82 G2_M
A_23_P415401 KLF9 NM_001206 687 0.04 −0.15 −0.20 −0.41 G2_M
A_23_P86100 KLHDC9 NM_001007255 126823 −0.01 −0.26 −0.25 0.04 G2_M
A_32_P82807 KMT5A NM_020382 387893 0.38 0.39 0.02 0.29 G2_M
A_24_P238855 KMT5A NM_020382 387893 −0.22 0.33 0.54 −0.29 G2_M
A_32_P191527 KMT5A NM_020382 387893 −0.19 0.07 0.26 −0.57 G2_M
A_32_P191859 KMT5A NM_020382 387893 −0.10 0.11 0.21 −0.39 G2_M
A_23_P217968 KMT5B NM_016028 51111 1.11 0.43 −0.68 0.99 G2_M
A_23_P326739 KMT5B NM_017635 51111 −0.60 −0.03 0.57 −0.90 G2_M
A_23_P96688 KMT5B NM_016028 51111 −0.02 −0.15 −0.13 0.10 G2_M
A_23_P140705 KNSTRN NM_001142761 90417 −1.55 −1.01 0.54 0.14 G2_M
A_24_P162718 LMNA NM_005572 4000 −0.08 −0.12 −0.04 −0.35 G2_M
A_23_P34835 LMNA NM_005572 4000 −0.01 −0.01 0.01 −0.44 G2_M
A_23_P251118 LPP NM_005578 4026 0.44 0.47 0.03 0.31 G2_M
A_24_P916515 LPP A_24_P916515 NA 0.33 0.35 0.01 −0.02 G2_M
A_32_P70519 LPP ENST00000312675 4026 0.16 0.16 0.00 −0.46 G2_M
A_24_P114551 LPP NM_005578 4026 −0.14 0.07 0.21 −0.89 G2_M
A_32_P39049 LPP ENST00000312675 4026 −0.13 0.10 0.24 −0.09 G2_M
A_32_P193218 LPP ENST00000312675 4026 −0.10 0.18 0.28 −0.83 G2_M
A_24_P778741 LPP ENST00000312675 4026 0.10 0.37 0.27 −1.09 G2_M
A_32_P56874 LPP ENST00000312675 4026 0.02 0.06 0.03 −0.35 G2_M
A_23_P200222 LRP8 NM_033300 7804 0.86 0.93 0.08 0.31 G2_M
A_23_P34325 LRP8 NM_033300 7804 0.14 0.53 0.38 −0.26 G2_M
A_23_P253958 LRRC17 NM_005824 10234 0.43 1.01 0.58 −0.15 G2_M
A_23_P145376 MAPK13 NM_002754 5603 0.22 −0.13 −0.35 0.82 G2_M
A_24_P406132 MAPK13 NM_002754 5603 0.08 −0.03 −0.12 0.20 G2_M
A_23_P71328 MATN2 NM_030583 4147 −0.50 −0.30 0.20 −1.34 G2_M
A_24_P179225 MATN2 NM_030583 4147 0.24 0.06 −0.17 −0.24 G2_M
A_23_P19455 MDC1 NM_014641 9656 −0.14 −0.15 −0.01 −0.40 G2_M
A_23_P105227 ME3 NM_001014811 10873 −0.40 0.15 0.55 −0.26 G2_M
A_23_P116614 ME3 NM_001014811 10873 0.04 0.39 0.35 0.08 G2_M
A_24_P346855 MKI67 NM_002417 4288 −1.66 −1.70 −0.04 −0.93 G2_M
A_32_P9382 MZT1 NM_001071775 440145 −0.33 −0.50 −0.18 0.57 G2_M
A_24_P532589 MZT1 NM_001071775 440145 −0.12 −0.28 −0.16 0.18 G2_M
A_24_P210675 NDE1 NM_017668 54820 −0.60 0.01 0.61 −1.05 G2_M
A_23_P206901 NDE1 NM_017668 54820 0.07 0.63 0.56 −0.46 G2_M
A_23_P35219 NEK2 NM_002497 4751 −1.67 −1.54 0.13 −0.25 G2_M
A_24_P319613 NEK2 NM_002497 4751 −0.86 −0.50 0.36 −0.09 G2_M
A_23_P74349 NUF2 NM_145697 83540 −3.08 −2.39 0.69 −1.08 G2_M
A_23_P102320 NUP35 NM_138285 129401 −0.43 −0.18 0.25 0.55 G2_M
A_23_P203586 NUP98 NM_016320 4928 0.32 0.34 0.02 −0.05 G2_M
A_24_P141522 NUP98 NM_016320 4928 0.29 0.24 −0.06 0.12 G2_M
A_23_P308032 NUP98 NM_005387 4928 −0.12 −0.28 −0.16 0.14 G2_M
A_23_P60488 ODF2 NM_002540 4957 −0.72 −0.22 0.50 −0.90 G2_M
A_23_P71889 ODF2 NM_153437 4957 −0.21 0.30 0.51 −0.15 G2_M
A_23_P63777 OIT3 NM_152635 170392 −0.28 0.06 0.34 0.06 G2_M
A_24_P124624 OLR1 NM_002543 4973 0.54 −0.05 −0.59 0.51 G2_M
A_24_P274072 PATJ NM_176877 10207 0.45 0.06 −0.39 0.74 G2_M
A_23_P126100 PATJ NM_176877 10207 0.39 0.15 −0.24 0.60 G2_M
A_32_P88958 PATJ NM_176877 10207 0.20 −0.13 −0.33 0.41 G2_M
A_23_P321034 PATJ NM_176877 10207 0.17 0.33 0.17 −0.25 G2_M
A_24_P942454 PATJ NM_176877 10207 −0.05 0.06 0.11 0.50 G2_M
A_32_P62997 PBK NM_018492 55872 −4.16 −3.00 1.15 −1.67 G2_M
A_23_P116578 PCF11 NM_015885 51585 −0.41 −0.40 0.01 0.36 G2_M
A_24_P835763 PCF11 A_24_P835763 NA 0.38 −0.66 −1.05 1.16 G2_M
A_23_P33303 PIK3CD NM_005026 5293 0.56 0.53 −0.03 −0.27 G2_M
A_24_P71244 PIK3CD NM_005026 5293 0.15 −0.05 −0.20 −0.21 G2_M
A_23_P259833 PIK3CD NM_005026 5293 0.02 −0.13 −0.15 0.13 G2_M
A_23_P49878 PIMREG NM_019013 54478 −2.67 −2.40 0.27 −0.54 G2_M
A_23_P411723 PLAG1 NM_002655 5324 0.44 −0.18 −0.62 1.02 G2_M
A_24_P313504 PLK1 NM_005030 5347 −1.32 −1.37 −0.05 −0.17 G2_M
A_23_P118174 PLK1 NM_005030 5347 −0.82 −0.68 0.14 −0.43 G2_M
A_24_P354300 POC1A NM_015426 25886 −1.21 −0.81 0.40 −0.63 G2_M
A_23_P212284 POC1A NM_015426 25886 −1.26 −0.82 0.44 −0.77 G2_M
A_24_P349002 POM121 NM_172020 9883 0.32 0.50 0.19 −0.52 G2_M
A_32_P131940 POM121 NM_172020 9883 0.27 0.40 0.13 −0.95 G2_M
A_24_P417784 POM121 NM_172020 9883 0.35 0.57 0.22 −0.86 G2_M
A_24_P266273 POM121 NM_172020 9883 0.03 −0.19 −0.22 0.06 G2_M
A_23_P156667 PPP1R10 NM_002714 5514 −0.93 0.07 1.00 −1.19 G2_M
A_23_P15305 PRPSAP1 NM_002766 5635 −0.51 −0.31 0.20 −0.68 G2_M
A_23_P80382 PRR5 NM_015366 55615 −0.21 0.00 0.21 −0.48 G2_M
A_24_P10890 PRR5 NM_015366 55615 0.20 0.06 −0.14 −0.15 G2_M
A_24_P21044 PSMG3 NM_032302 84262 −0.03 0.12 0.15 −0.11 G2_M
A_23_P103328 PTGER3 NM_198714 5733 1.30 1.41 0.11 0.82 G2_M
A_24_P945365 PTGER3 NM_198715 5733 0.53 0.61 0.08 −0.09 G2_M
A_23_P81770 PTP4A1 NM_003463 7803 0.67 0.28 −0.39 0.32 G2_M
A_24_P294832 PTP4A1 NM_003463 7803 −0.37 −0.01 0.36 −0.57 G2_M
A_24_P252043 PTP4A1 NM_003463 7803 0.50 −0.24 −0.74 0.60 G2_M
A_23_P124486 PTPN9 NM_002833 5780 −0.51 −0.22 0.29 −1.07 G2_M
A_23_P13632 PYM1 NM_032345 84305 −0.42 −0.12 0.30 −0.64 G2_M
A_23_P45106 QRICH1 NM_017730 54870 0.22 0.14 −0.08 −0.53 G2_M
A_23_P45108 QRICH1 NM_017730 54870 0.17 −0.10 −0.27 0.53 G2_M
A_23_P207014 RAD51C NM_002876 5889 −0.96 −0.75 0.21 0.02 G2_M
A_23_P391344 RASGEF1A BC022548 221002 0.73 0.39 −0.34 0.62 G2_M
A_32_P223140 RASGEF1A NM_145313 221002 0.75 0.14 −0.62 1.04 G2_M
A_24_P79955 RBM8A NM_005105 9939 −0.54 −0.12 0.41 −0.54 G2_M
A_23_P305335 RBM8A BC017770 9939 1.29 0.20 −1.09 1.74 G2_M
A_32_P62571 RBM8A NM_005105 9939 −0.41 0.02 0.44 −0.81 G2_M
A_23_P104116 RBM8A NM_005105 9939 0.09 0.16 0.07 0.49 G2_M
A_23_P166248 RCAN1 NM_004414 1827 −0.18 −0.13 0.05 −0.24 G2_M
A_23_P14105 RCBTB2 NM_001268 1102 −1.53 −0.06 1.47 −1.74 G2_M
A_24_P342591 RERE NM_012102 473 0.16 0.39 0.23 −1.12 G2_M
A_23_P85414 RERE NM_012102 473 0.04 0.07 0.04 −0.65 G2_M
A_24_P725630 RNPS1 NM_006711 10921 0.85 0.54 −0.31 0.39 G2_M
A_24_P766577 RNPS1 NM_006711 10921 0.12 0.02 −0.10 −0.21 G2_M
A_23_P152272 RNPS1 NM_006711 10921 0.02 0.08 0.06 −0.38 G2_M
A_23_P80129 RRP1 NM_003683 8568 0.63 0.52 −0.11 0.04 G2_M
A_23_P80136 RRP1 NM_003683 8568 −0.09 0.26 0.34 −0.03 G2_M
A_24_P100517 SAPCD2 NM_178448 89958 −0.91 −0.60 0.31 −0.42 G2_M
A_23_P370625 SELENON NM_020451 57190 −0.80 −0.26 0.54 −1.75 G2_M
A_24_P231250 SELENON NM_020451 57190 −0.37 −0.07 0.30 −1.06 G2_M
A_24_P105283 SFPQ NM_005066 6421 −0.18 −0.09 0.09 −0.28 G2_M
A_23_P411335 SGO2 NM_152524 151246 −1.95 −1.54 0.41 −0.59 G2_M
A_32_P96719 SHCBP1 NM_024745 79801 −1.68 −1.83 −0.14 −0.60 G2_M
A_23_P59051 SLC17A2 NM_005835 10246 0.13 0.43 0.29 −0.36 G2_M
A_24_P10657 SLC44A2 NM_020428 57153 0.24 0.31 0.07 −0.65 G2_M
A_23_P208340 SLC44A2 NM_020428 57153 −0.08 0.15 0.23 −0.96 G2_M
A_23_P68824 SMARCB1 NM_003073 6598 −0.33 0.02 0.35 −0.82 G2_M
A_24_P232696 SMARCD1 NM_139071 6602 −0.23 −0.01 0.22 −0.68 G2_M
A_23_P204745 SMARCD1 NM_139071 6602 0.16 0.65 0.49 −0.24 G2_M
A_23_P211428 SMTN NM_134269 6525 −0.47 −0.31 0.17 −1.05 G2_M
A_23_P5934 SOGA1 AB020696 140710 −0.43 −0.12 0.31 −0.40 G2_M
A_23_P5936 SOGA1 AB020696 140710 −0.26 −0.44 −0.18 −0.42 G2_M
A_23_P5938 SOGA1 AB020696 140710 0.18 0.27 0.08 −0.36 G2_M
A_23_P89509 SPAG5 NM_006461 10615 −2.17 −1.39 0.78 −0.41 G2_M
A_23_P41948 SPDL1 NM_017785 54908 −1.58 −0.78 0.80 −0.55 G2_M
A_23_P102523 SPTBN1 NM_003128 6711 −0.45 −0.37 0.08 −0.81 G2_M
A_23_P339095 SPTBN1 NM_178313 6711 −0.19 −0.25 −0.07 −0.15 G2_M
A_23_P30223 SRD5A1 NM_001047 6715 −0.15 −0.47 −0.32 −0.08 G2_M
A_23_P413761 SRSF3 NM_003017 6428 −0.31 0.03 0.33 −0.18 G2_M
A_23_P19702 TAB2 NM_015093 23118 0.32 0.20 −0.12 0.03 G2_M
A_24_P245778 TFF3 ENST00000291525 7033 −0.63 −0.48 0.15 −0.45 G2_M
A_23_P393099 TFF3 NM_003226 7033 −0.11 −0.09 0.02 −0.05 G2_M
A_24_P289208 TFF3 NM_003226 7033 0.14 −0.41 −0.54 0.60 G2_M
A_23_P257296 TFF3 NM_003226 7033 0.03 0.03 0.00 0.06 G2_M
A_23_P153197 TGIF1 NM_170695 7050 −0.28 −0.22 0.06 −1.29 G2_M
A_24_P926367 THRAP3 NM_005119 9967 −0.61 −0.46 0.15 −0.71 G2_M
A_24_P256863 THRAP3 NM_005119 9967 −0.19 −0.38 −0.18 0.33 G2_M
A_23_P160367 THRAP3 NM_005119 9967 −0.18 −0.42 −0.24 −0.01 G2_M
A_23_P158277 TMCO4 NM_181719 255104 −0.15 0.32 0.46 −0.61 G2_M
A_23_P24723 TMEM138 NM_016464 51524 −0.43 −0.25 0.17 0.17 G2_M
A_23_P428875 TNFAIP8L1 NM_152362 126282 −0.70 −0.84 −0.14 −0.55 G2_M
A_23_P156101 TNPO1 NM_002270 3842 −0.17 −0.20 −0.04 0.49 G2_M
A_32_P99097 TNPO1 NM_002270 3842 −0.03 0.19 0.22 0.29 G2_M
A_24_P260440 TNPO1 NM_002270 3842 0.00 0.10 0.10 0.32 G2_M
A_24_P199097 TOMM34 NM_006809 10953 0.31 0.09 −0.22 1.37 G2_M
A_23_P57033 TOMM34 NM_006809 10953 0.08 −0.19 −0.27 0.78 G2_M
A_23_P68610 TPX2 NM_012112 22974 −2.37 −1.66 0.71 −1.18 G2_M
A_24_P277576 TRIP13 NM_004237 9319 −0.28 −0.08 0.21 −0.37 G2_M
A_23_P75839 TSG101 NM_006292 7251 0.10 0.06 −0.04 1.78 G2_M
A_23_P162142 TSKU NM_015516 25987 0.51 0.27 −0.24 −0.24 G2_M
A_23_P28105 TSN NM_004622 7247 −0.28 −0.10 0.18 −0.10 G2_M
A_24_P242820 TSN NM_004622 7247 −0.19 −0.19 0.00 −0.29 G2_M
A_23_P259586 TTK NM_003318 7272 −2.35 −2.45 −0.10 −0.31 G2_M
A_24_P263524 TXNDC9 NM_005783 10190 −0.65 −0.41 0.24 0.04 G2_M
A_23_P154330 TXNDC9 NM_005783 10190 −0.51 −0.20 0.32 0.23 G2_M
A_24_P362646 TXNDC9 NM_005783 10190 −0.32 −0.08 0.24 0.18 G2_M
A_23_P204581 TXNRD1 NM_003330 7296 0.59 0.55 −0.04 0.70 G2_M
A_23_P40989 USP13 NM_003940 8975 −0.40 −0.38 0.03 −0.37 G2_M
A_23_P257911 USP16 NM_001032410 10600 −0.34 −0.07 0.27 0.58 G2_M
A_24_P199655 VANGL1 NM_138959 81839 −0.63 0.04 0.66 −0.93 G2_M
A_23_P103795 VANGL1 NM_138959 81839 −0.30 0.26 0.57 −0.97 G2_M
A_23_P369316 VANGL1 NM_138959 81839 −0.17 0.00 0.18 −0.46 G2_M
A_23_P103070 YWHAH NM_003405 7533 −0.19 −0.35 −0.16 −0.35 G2_M
A_23_P215088 ZC3HC1 NM_016478 51530 0.02 0.09 0.07 0.32 G2_M
A_24_P290527 ZFX NM_003410 7543 −0.28 −0.08 0.21 0.18 G2_M
A_23_P125639 ZFX NM_003410 7543 0.36 0.08 −0.28 0.75 G2_M
A_24_P940524 ZFX NM_003410 7543 −0.16 0.13 0.29 −0.31 G2_M
A_23_P161091 ZMYM1 NM_024772 79830 −0.12 −0.30 −0.18 0.27 G2_M
A_24_P53985 ZMYM1 NM_024772 79830 −0.10 −0.25 −0.15 0.38 G2_M
A_23_P159027 ZNF521 NM_015461 25925 −0.33 0.08 0.41 −0.63 G2_M
A_23_P78018 ABCA5 NM_018672 23461 −0.15 −0.02 0.13 −0.05 S
A_24_P67096 ABCA5 NM_018672 23461 −0.15 −0.01 0.14 −0.10 S
A_23_P158976 ABCC2 NM_000392 1244 0.45 0.07 −0.38 0.36 S
A_23_P44569 ABCC2 NM_000392 1244 0.12 0.14 0.02 0.26 S
A_23_P212665 ABCC5 NM_005688 10057 0.29 −0.21 −0.50 −0.14 S
A_23_P258221 ABCC5 NM_005688 10057 −0.08 0.07 0.15 −0.03 S
A_24_P268662 ABHD10 NM_018394 55347 −0.37 0.38 0.75 −0.08 S
A_23_P92213 ABHD10 NM_018394 55347 −0.18 −0.37 −0.19 0.56 S
A_24_P308590 ABHD10 NM_018394 55347 0.11 −0.07 −0.19 0.04 S
A_23_P23630 ACAP3 NM_030649 116983 −0.69 −0.34 0.35 −0.14 S
A_23_P23625 ACAP3 NM_030649 116983 −0.61 −0.11 0.50 −0.52 S
A_23_P12231 ACAP3 NM_030649 116983 0.26 −0.45 −0.71 −0.20 S
A_24_P281497 ACAP3 NM_030649 116983 −0.15 0.41 0.55 −0.17 S
A_24_P355006 ADAM22 ENST00000398204 53616 −0.54 −0.45 0.09 −0.53 S
A_23_P215625 ADAM22 NM_021723 53616 −0.37 −0.61 −0.24 −0.10 S
A_24_P243741 ADAM22 NM_021721 53616 0.22 0.27 0.06 −0.17 S
A_24_P203630 ANKRD36 NM_001164315 375248 0.93 0.78 −0.15 0.57 S
A_24_P6725 ANKRD36 NM_001164315 375248 0.78 0.66 −0.12 0.32 S
A_24_P686992 ANKRD36 NM_001164315 375248 0.67 0.50 −0.17 0.58 S
A_24_P336931 ANKRD36 NM_001164315 375248 −0.02 −0.39 −0.36 0.53 S
A_23_P119254 ASF1B NM_018154 55723 −2.77 −2.37 0.40 −1.54 S
A_23_P120629 ASIP NM_001672 434 0.04 −0.21 −0.25 0.38 S
A_23_P106835 BBS2 NM_031885 583 −0.11 −0.25 −0.14 0.10 S
A_23_P105833 BIVM NM_017693 54841 −0.28 0.14 0.43 −0.75 S
A_23_P88630 BLM NM_000057 641 −2.28 −1.89 0.39 −0.83 S
A_24_P303989 BMI1 NM_005180 648 −0.26 −0.03 0.23 0.05 S
A_23_P314115 BMI1 NM_005180 648 −0.12 −0.01 0.10 0.02 S
A_23_P207400 BRCA1 NM_007300 672 −1.00 −0.91 0.08 −0.65 S
A_23_P15844 BRIP1 NM_032043 83990 −1.30 −1.16 0.14 0.07 S
A_24_P255524 CALD1 AF247820 800 0.54 0.69 0.15 0.28 S
A_24_P921366 CALD1 NM_033138 800 −0.51 −0.17 0.34 −0.79 S
A_23_P42575 CALD1 NM_033138 800 −0.33 0.02 0.35 −0.35 S
A_24_P313993 CAPS NM_004058 828 −0.42 0.14 0.56 −0.19 S
A_23_P78958 CAPS NM_004058 828 −0.22 0.44 0.66 −0.43 S
A_23_P384056 CCDC14 NM_022757 64770 −0.59 −0.46 0.13 0.41 S
A_23_P39574 CCDC150 NM_001080539 284992 −1.38 −1.34 0.04 0.15 S
A_24_P157156 CCDC150 NM_001080539 284992 −0.47 −0.52 −0.05 −0.24 S
A_23_P320190 CCDC150 A_23_P320190 NA −0.34 −0.24 0.10 −0.53 S
A_24_P636332 CCDC84 NM_198489 338657 0.17 0.21 0.04 0.76 S
A_24_P693946 CCDC84 A_24_P693946 NA 0.05 −0.01 −0.06 0.62 S
A_23_P57379 CDC45 NM_003504 8318 −3.57 −2.37 1.20 −1.90 S
A_23_P148807 CDC7 NM_003503 8317 −0.70 −0.50 0.20 −0.07 S
A_23_P104651 CDCA5 NM_080668 113130 −2.58 −2.15 0.42 −1.16 S
A_23_P405267 CDH24 AK057922 64403 1.03 −0.05 −1.08 1.04 S
A_23_P25790 CDH24 NM_022478 64403 0.26 −0.37 −0.62 0.19 S
A_23_P258002 CDKN2AIP NM_017632 55602 0.18 −0.17 −0.35 0.51 S
A_24_P399888 CENPM NM_001002876 79019 −2.65 −2.27 0.38 −0.97 S
A_23_P70328 CENPQ NM_018132 55166 −0.18 −0.36 −0.18 0.41 S
A_23_P254733 CENPU NM_024629 79682 −1.79 −1.85 −0.06 −0.23 S
A_24_P289366 CERS6 NM_203463 253782 0.10 0.18 0.08 −0.46 S
A_32_P5480 CERS6 NM_203463 253782 −0.08 0.35 0.43 −0.45 S
A_23_P144071 COL7A1 NM_000094 1294 −0.17 0.28 0.46 −0.03 S
A_24_P932308 COQ9 AK075438 57017 0.90 0.78 −0.12 1.05 S
A_23_P14928 COQ9 NM_020312 57017 −0.08 0.22 0.31 −0.15 S
A_23_P87556 CPNE8 NM_153634 144402 −0.23 0.33 0.56 −0.20 S
A_24_P56240 CPNE8 NM_153634 144402 0.05 0.58 0.53 0.06 S
A_23_P144438 DCAF16 NM_017741 54876 0.31 0.11 −0.20 0.31 S
A_32_P104000 DCUN1D3 NM_173475 123879 −0.18 0.11 0.30 0.02 S
A_23_P429491 DDIAS NM_145018 220042 −1.24 −1.00 0.24 −0.25 S
A_24_P926543 DDIAS AK058145 220042 0.41 0.29 −0.12 −0.14 S
A_23_P385126 DEPDC7 NM_139160 91614 0.99 0.06 −0.93 1.16 S
A_24_P320284 DHFR NM_000791 1719 −1.51 −1.20 0.32 −0.38 S
A_24_P942328 DHFR NM_000791 1719 −1.91 −1.52 0.39 −1.10 S
A_32_P211045 DHFR NM_000791 1719 −2.16 −1.40 0.76 −1.27 S
A_23_P167553 DHFR NM_000791 1719 −1.58 −1.13 0.45 −0.59 S
A_24_P343095 DHFR NM_000791 1719 −1.26 −0.87 0.39 −0.36 S
A_23_P327361 DMXL2 NM_015263 23312 0.07 −0.14 −0.21 −0.02 S
A_24_P366107 DNA2 NM_001080449 1763 −0.86 −0.69 0.17 −0.56 S
A_23_P51339 DNAJB4 NM_007034 11080 1.16 −0.02 −1.18 0.98 S
A_24_P393958 DNAJB4 NM_007034 11080 1.11 −0.10 −1.21 1.23 S
A_23_P95359 DNAJC6 NM_014787 9829 −0.44 −0.40 0.03 −0.41 S
A_23_P147479 DNAJC6 NM_014787 9829 0.35 −0.02 −0.38 0.58 S
A_23_P500390 DONSON NM_017613 29980 0.52 −0.11 −0.64 1.07 S
A_23_P425502 DONSON NM_017613 29980 0.30 −0.34 −0.64 0.96 S
A_23_P35871 E2F8 NM_024680 79733 −0.76 −0.35 0.41 −0.23 S
A_23_P214291 EFHC1 NM_018100 114327 −0.37 −0.45 −0.08 0.72 S
A_32_P86245 EFHC1 NM_018100 114327 −0.31 −0.07 0.24 −0.10 S
A_24_P913374 EIF4EBP2 NM_004096 1979 −0.66 −0.29 0.36 −1.22 S
A_24_P4387 EIF4EBP2 NM_004096 1979 −0.42 −0.08 0.34 −0.58 S
A_24_P115621 EIF4EBP2 NM_004096 1979 −0.25 −0.04 0.21 −0.90 S
A_23_P115922 EIF4EBP2 NM_004096 1979 −0.22 0.01 0.24 −0.47 S
A_24_P323598 ESCO2 NM_001017420 157570 −2.00 −1.95 0.05 −0.79 S
A_23_P23303 EXO1 NM_003686 9156 −2.11 −1.68 0.42 −1.23 S
A_23_P259641 EZH2 NM_004456 2146 −0.74 −0.91 −0.16 0.13 S
A_23_P99853 FAM214A NM_019600 56204 0.25 0.05 −0.20 −0.03 S
A_24_P357576 FAM214A NM_019600 56204 0.17 0.09 −0.08 −0.27 S
A_23_P206441 FANCA NM_000135 2175 −0.49 −0.42 0.07 −0.58 S
A_24_P73158 FEN1 NM_004111 2237 −1.16 −1.11 0.04 −0.36 S
A_24_P84898 FEN1 NM_004111 2237 −1.27 −1.29 −0.02 −0.33 S
A_23_P103996 GCLM NM_002061 2730 0.55 1.42 0.87 −0.32 S
A_32_P177953 GCLM ENST00000370238 2730 0.05 1.10 1.05 −0.67 S
A_32_P2392 GOLGA8A NM_181077 23015 0.91 0.31 −0.60 0.66 S
A_23_P37623 GOLGA8A NM_181077 23015 0.54 0.52 −0.02 −0.12 S
A_24_P910580 GOLGA8A NR_027409 23015 0.50 0.47 −0.03 0.73 S
A_23_P29257 H1F0 NM_005318 3005 0.40 0.02 −0.39 −0.58 S
A_23_P349771 HAUS5 NM_015302 23354 0.41 0.89 0.48 −0.01 S
A_23_P12816 HELLS NM_018063 3070 −0.95 −1.12 −0.17 −0.02 S
A_23_P372860 HIST1H2AC NM_003512 8334 −0.38 −0.57 −0.19 0.76 S
A_23_P167983 HIST1H2AC ENST00000314088 8334 −0.22 −0.24 −0.02 −0.03 S
A_32_P221799 HIST1H2AM NM_003514 8336 −1.05 −1.41 −0.36 0.21 S
A_24_P86389 HIST1H2AM NM_003514 8336 0.10 −0.07 −0.17 0.83 S
A_23_P93180 HIST1H2BC NM_003526 8347 −0.04 −0.26 −0.22 0.90 S
A_24_P166407 HIST1H4B NM_003544 8366 −0.91 −0.89 0.02 −0.16 S
A_23_P214487 HIST1H4C NM_003542 8364 −1.27 −1.00 0.27 −0.66 S
A_23_P323685 HIST1H4H NM_003543 8365 −0.31 −0.82 −0.51 0.73 S
A_23_P52266 IFIT1 NM_001548 3434 1.72 0.64 −1.08 1.80 S
A_23_P102454 INSIG2 NM_016133 51141 0.53 0.07 −0.46 1.13 S
A_24_P944458 INSIG2 NM_016133 51141 −0.30 −0.67 −0.37 0.31 S
A_23_P52082 INTS7 NM_015434 25896 −0.49 0.16 0.64 −0.44 S
A_32_P159651 KAT2B NM_003884 8850 −0.66 −0.62 0.04 −0.51 S
A_23_P41128 KAT2B NM_003884 8850 −0.38 −0.33 0.05 −0.36 S
A_23_P358542 KIFC2 NM_145754 90990 −0.21 −0.01 0.20 0.33 S
A_23_P165414 KLHL23 NM_144711 151230 −0.63 −0.12 0.51 −1.29 S
A_24_P923102 KLHL23 ENST00000392647 151230 −0.62 −0.02 0.60 −0.81 S
A_23_P165408 KLHL23 NM_144711 151230 −0.70 −0.36 0.34 −1.03 S
A_23_P74252 LINC00339 NR_023918 29092 −0.41 −0.62 −0.20 0.04 S
A_23_P84219 LIPH NM_139248 200879 −0.15 −0.11 0.04 0.38 S
A_24_P799858 LIPH ENST00000296252 200879 −0.03 0.14 0.17 −0.11 S
A_23_P380181 LMO4 NM_006769 8543 −0.36 −0.07 0.30 −0.34 S
A_32_P18159 LYRM7 NM_181705 90624 0.41 0.17 −0.23 −0.18 S
A_32_P211141 LYRM7 NM_181705 90624 0.26 0.44 0.18 0.07 S
A_24_P256603 LYRM7 NM_181705 90624 0.20 0.32 0.13 0.16 S
A_23_P337464 LYRM7 NM_181705 90624 −0.23 0.02 0.25 −0.66 S
A_24_P926195 MAN1A2 NM_006699 10905 −0.52 −0.01 0.51 −0.55 S
A_23_P103571 MAN1A2 NM_006699 10905 −0.48 0.14 0.62 −0.21 S
A_32_P88603 MAN1A2 ENST00000356554 10905 −0.49 0.09 0.59 −0.78 S
A_32_P88598 MAN1A2 ENST00000356554 10905 −0.42 0.25 0.66 −0.72 S
A_24_P213548 MAN1A2 NM_006699 10905 −0.11 0.41 0.52 0.02 S
A_23_P313640 MAP3K2 NM_006609 10746 0.60 0.45 −0.15 0.16 S
A_32_P98887 MAP3K2 ENST00000409947 10746 0.42 −0.11 −0.53 0.32 S
A_23_P313645 MAP3K2 NM_006609 10746 0.23 0.24 0.01 0.40 S
A_23_P201988 MASTL NM_032844 84930 −0.45 −0.86 −0.41 0.36 S
A_24_P258051 MASTL NM_032844 84930 −0.16 −0.38 −0.22 0.06 S
A_23_P92154 MBD4 NM_003925 8930 −0.37 −0.14 0.24 0.14 S
A_23_P68547 MCM8 NM_182802 84515 −0.81 −0.49 0.32 −0.43 S
A_24_P305556 MCM8 NM_182802 84515 −0.50 −0.48 0.03 −0.09 S
A_32_P129894 MEGF9 NM_001080497 1955 −0.12 0.13 0.25 −1.13 S
A_23_P426663 MITF NM_198159 4286 −0.17 −0.15 0.02 −0.04 S
A_23_P73345 MITF NM_198159 4286 0.26 0.19 −0.07 1.01 S
A_24_P910310 MITF NM_198177 4286 0.14 −0.39 −0.53 0.72 S
A_23_P61945 MITF NM_198159 4286 −0.03 0.11 0.13 −0.07 S
A_24_P323815 MYCBP2 NM_015057 23077 −0.48 −0.28 0.20 −0.08 S
A_23_P151459 MYCBP2 NM_015057 23077 0.04 0.56 0.52 −0.46 S
A_23_P209805 NAB1 NM_005966 4664 0.67 0.61 −0.06 1.30 S
A_24_P191417 NAB1 NM_005966 4664 0.01 0.29 0.28 0.47 S
A_23_P5761 NFE2L2 NM_006164 4780 0.04 0.26 0.22 −0.14 S
A_23_P23006 NRDC NM_002525 4898 −0.42 −0.16 0.27 −0.07 S
A_32_P213822 NSUN3 ENST00000314622 63899 −0.66 −0.31 0.36 −0.19 S
A_23_P21785 NSUN3 NM_022072 63899 −0.08 −0.10 −0.01 0.55 S
A_23_P382043 NT5DC1 NM_152729 221294 −0.40 −0.15 0.25 −0.31 S
A_23_P219004 NT5DC1 NM_152729 221294 0.14 0.15 0.01 0.37 S
A_24_P922606 NUP160 NM_015231 23279 0.83 0.11 −0.72 0.83 S
A_23_P43726 NUP160 NM_015231 23279 −0.06 0.06 0.12 0.15 S
A_23_P381979 OGT NM_181672 8473 −0.25 −0.44 −0.19 0.06 S
A_23_P381976 OGT NM_181672 8473 −0.17 −0.08 0.09 0.12 S
A_23_P42045 ORC3 NM_181837 23595 −0.10 −0.60 −0.50 0.66 S
A_23_P79818 OSER1 NM_016470 51526 0.27 −0.36 −0.63 0.95 S
A_24_P261083 OSGIN2 NM_004337 734 0.89 0.41 −0.47 0.84 S
A_23_P82859 OSGIN2 NM_004337 734 −0.01 −0.06 −0.05 0.18 S
A_23_P117852 PCLAF NM_014736 9768 −3.04 −2.31 0.73 −0.87 S
A_32_P61339 PHIP BC036479 55023 −0.57 −1.00 −0.43 −0.08 S
A_24_P196400 PHIP NM_017934 55023 −0.36 −0.34 0.01 0.15 S
A_23_P145437 PHIP NM_017934 55023 −0.18 −0.09 0.09 0.20 S
A_24_P630039 PHIP NM_017934 55023 −0.22 −0.03 0.20 −0.13 S
A_24_P931503 PHIP NM_017934 55023 −0.21 −0.12 0.09 −0.61 S
A_24_P175176 PHTF2 NM_020432 57157 −0.76 −0.05 0.70 −0.58 S
A_32_P409919 PHTF2 NM_020432 57157 0.57 0.05 −0.52 0.50 S
A_24_P323944 PHTF2 NM_020432 57157 0.08 −0.05 −0.13 0.21 S
A_24_P403244 PILRB NM_013440 29990 −0.31 0.08 0.38 0.15 S
A_23_P19829 PILRB NM_013440 29990 −0.32 0.06 0.38 0.08 S
A_24_P105102 PKMYT1 NM_182687 9088 −1.77 −1.36 0.41 −1.22 S
A_23_P398515 PKMYT1 NM_004203 9088 0.12 0.19 0.07 −0.19 S
A_23_P25019 PRIM1 NM_000946 5557 −1.04 −1.21 −0.17 −0.32 S
A_23_P44139 PRIM2 NM_000947 5558 −0.53 −0.21 0.32 −0.16 S
A_24_P282237 PRIM2 NM_000947 5558 −0.33 −0.25 0.08 −0.17 S
A_24_P75158 PTAR1 NM_001099666 375743 −0.36 −0.37 0.00 0.26 S
A_23_P121222 RAD18 NM_020165 56852 −0.58 −0.47 0.11 −0.13 S
A_23_P88731 RAD51 NM_002875 5888 −1.73 −1.58 0.15 −1.02 S
A_23_P99292 RAD51AP1 NM_006479 10635 −2.35 −2.26 0.08 −1.01 S
A_23_P74115 RAD54L NM_003579 8438 −2.14 −1.79 0.34 −0.94 S
A_23_P252371 RBBP8 NM_002894 5932 −0.40 −0.41 −0.01 0.30 S
A_23_P96285 REEP1 NM_022912 65055 −2.14 −1.68 0.45 −1.95 S
A_23_P93823 RFC2 NM_181471 5982 −0.45 −0.33 0.12 −0.47 S
A_23_P18196 RFC4 NM_002916 5984 −0.84 −0.88 −0.04 −0.04 S
A_23_P92710 RHOBTB3 NM_014899 22836 0.42 0.87 0.46 −0.96 S
A_23_P315386 RHPN1 NM_052924 114822 −0.19 −0.28 −0.09 0.50 S
A_23_P87432 RHPN1 NM_052924 114822 0.22 −0.57 −0.79 0.73 S
A_23_P87435 RHPN1 NM_052924 114822 −0.14 −0.25 −0.11 −0.38 S
A_23_P86133 RPA2 NM_002946 6118 −0.52 −0.77 −0.25 0.22 S
A_23_P87351 RRM1 NM_001033 6240 −0.73 −0.81 −0.08 0.31 S
A_24_P234196 RRM2 NM_001034 6241 −3.49 −2.56 0.93 −1.85 S
A_24_P225616 RRM2 NM_001034 6241 −1.98 −1.54 0.44 −1.50 S
A_24_P350160 RSRC2 NM_198261 65117 0.43 0.09 −0.34 1.05 S
A_23_P53267 RSRC2 NM_198261 65117 −0.16 −0.52 −0.36 0.70 S
A_24_P304987 SAP30BP NM_013260 29115 −0.32 −0.05 0.27 −0.13 S
A_23_P54953 SAP30BP NM_013260 29115 −0.23 −0.44 −0.21 0.26 S
A_23_P169351 SH3GL2 NM_003026 6456 0.07 −0.50 −0.57 −0.13 S
A_23_P200443 SHC1 NM_003029 6464 0.29 0.36 0.07 −0.42 S
A_24_P68585 SHC1 NM_183001 6464 0.06 0.14 0.08 −0.06 S
A_23_P202587 SHTN1 NM_018330 57698 −0.27 0.15 0.42 −0.46 S
A_32_P309404 SLC22A3 NM_021977 6581 −0.45 0.30 0.75 −0.81 S
A_23_P19733 SLC22A3 NM_021977 6581 0.20 0.72 0.52 0.12 S
A_24_P246841 SLC25A27 NM_004277 9481 0.40 0.38 −0.03 0.84 S
A_23_P81721 SLC25A27 NM_004277 9481 0.26 0.25 −0.01 0.57 S
A_23_P218079 SLC38A2 NM_018976 54407 0.24 0.33 0.09 1.24 S
A_24_P295963 SLC38A2 NM_018976 54407 −0.09 0.13 0.22 0.23 S
A_23_P104282 SLF2 NM_018121 55719 −0.37 −0.42 −0.05 −0.26 S
A_32_P143516 SLF2 NM_018121 55719 −0.14 −0.16 −0.02 0.17 S
A_23_P356139 SLF2 NM_018121 55719 −0.12 0.13 0.25 −0.62 S
A_23_P366312 SP1 NM_138473 6667 0.39 0.48 0.09 −0.14 S
A_23_P53397 SP1 NM_138473 6667 0.23 0.09 −0.15 −0.01 S
A_32_P45493 SRSF10 NM_006625 10772 −0.79 −0.49 0.30 0.03 S
A_23_P45737 SRSF10 NM_006625 10772 −0.43 −0.30 0.13 0.21 S
A_23_P352291 SRSF10 NM_054016 10772 −0.20 −0.18 0.01 −0.41 S
A_24_P4795 SRSF10 NM_054016 10772 −0.19 −0.09 0.10 0.57 S
A_23_P377819 SRSF5 NM_001039465 6430 −0.29 −0.21 0.08 −0.40 S
A_32_P45894 STAG3L1 NM_018991 54441 0.17 0.06 −0.12 0.53 S
A_24_P374962 STAG3L1 NM_018991 54441 0.05 0.20 0.15 0.21 S
A_24_P111242 SVIP NM_148893 258010 −0.53 −0.55 −0.03 0.11 S
A_32_P41070 TMCC1 NM_015008 23023 −0.10 0.09 0.20 −0.29 S
A_32_P41065 TMCC1 NM_001017395 23023 −0.08 −0.15 −0.08 −0.17 S
A_24_P922288 TMCC1 NM_001017395 23023 0.08 −0.29 −0.37 0.60 S
A_23_P170986 TMCC1 NM_001017395 23023 −0.01 −0.12 −0.11 0.40 S
A_23_P39813 TTC31 NM_022492 64427 −0.34 0.04 0.38 −0.46 S
A_32_P204169 TTLL7 ENST00000260505 79739 0.29 0.86 0.57 −0.42 S
A_23_P97481 TTLL7 NM_024686 79739 −0.18 −0.38 −0.21 0.08 S
A_24_P165450 TTLL7 NM_024686 79739 0.02 −0.02 −0.03 0.15 S
A_23_P50096 TYMS NM_001071 7298 −1.55 −1.70 −0.15 −0.34 S
A_23_P115482 UBE2T NM_014176 29089 −1.18 −0.89 0.29 0.14 S
A_24_P330234 UBL3 NM_007106 5412 −0.30 −0.27 0.03 0.04 S
A_23_P140029 UBL3 NM_007106 5412 0.23 0.04 −0.19 0.04 S
A_23_P11652 USP1 NM_003368 7398 −0.44 −0.67 −0.23 0.22 S
A_23_P98483 ZBED5 NM_021211 58486 −0.41 −0.22 0.19 0.20 S
A_23_P210608 ZNF217 NM_006526 7764 0.02 −0.28 −0.30 0.05 S
A_23_P63789 ZWINT NM_032997 11130 −2.88 −2.07 0.82 −1.15 S
a

From Whitfield et al. (58).

b

Phases: G1, G1; G2, G2; G2_M, G2/M; G2,G2_M, G2 or G2/M, etc.

Intoxication with Salmonella supernatant containing CdtB induces DNA damage not coupled with cell cycle arrest.

The majority of chronically infected carriers of typhoid Salmonella are usually diagnosed with gallstones and it has been found that Salmonella is able to grow on them forming biofilms. Salmonella covered gallstones might represent a reservoir for the bacteria but also a potential source of typhoid toxin (60). To understand the effect of the typhoid toxin on primary gallbladder cells, we sought to achieve a homogeneous typhoid toxin intoxication. To this aim, we seeded organoid-derived cells as 2D monolayers on collagen-coated plastic wells and supplemented them for 24 h with supernatant from Salmonella grown in MM5.8 medium, which is known to stimulate the production of typhoid toxin (19). Western blot analysis confirmed that only treatment with wild-type supernatant and etoposide, a chemical inducer of DSBs (61), resulted in an increased phosphorylation of H2AX, which is indicative of the presence of DSBs (Fig. 5A). The amount of DSBs was quantified using a neutral comet assay, which showed a significant increase in DNA in the tail of the comet analyzed from cells treated with supernatant from wild-type bacteria compared to supernatant from the ΔcdtB Salmonella or sterile medium (Fig. 5B, quantified in Fig. 5C). Cells treated with a genotoxic agent normally respond by arresting the cell cycle, and this was also reported for cells treated with recombinant CDT, a bacterial toxin that shares the CdtB subunit with the typhoid toxin (62). To examine whether cell cycle arrest was also induced in our intoxication model, we fluorescently labeled cells with antibodies against γH2AX and Ki67, a marker of proliferating cells. There was no difference in the percentage of Ki67+ cells in cultures treated with sterile, deletion mutant or wild-type supernatants (Fig. 5D, quantified in Fig. 5E). In stark contrast, cultures treated with etoposide contained little to no Ki67+ cells, although etoposide caused an amount of damage similar to that caused by the supernatant conditioned with wild-type typhoid toxin (Fig. 5A to C). Analysis of the γH2AX signal intensity in Ki67+ versus Ki67– cells showed that supernatant conditioned with typhoid toxin induced more DNA damage, especially in proliferating cells (Fig. 5D and F). Cells intoxicated with ΔcdtB supernatant showed non-significant differences in the distribution of γH2AX intensities compared to sterile medium, both in proliferating and non-proliferating cells. The presence of cells positive for both γH2AX and Ki67 was detected only after intoxication with the wild-type typhoid toxin, and this observation occurred up to 48 h after intoxication started (see Fig. S3A and B). Finally, not only intoxicated cells but also rare infected cells were positive for γH2AX but still in an active state of proliferation, as indicated by double labeling with a Ki67 antibody (Fig. 5G). Our data show that human primary gallbladder cells are subjected to a low but persistent level of DNA damage caused by the CdtB subunit of the S. Paratyphi A-encoded typhoid toxin. The DNA damage caused by the genotoxin does not induce cell cycle arrest but particularly affects proliferating cells.

FIG 5.

FIG 5

Intoxication of primary cell 2D monolayers with typhoid toxin-containing Salmonella supernatant. (A) Western blot analysis of γH2AX levels in primary cells after exposure to Salmonella supernatant or etoposide for 24 h. Relative densitometry values, normalized to the sterile medium condition (=1), are shown above the bands. (B) Comet assay showing that DNA damage, seen as a tail of DNA after electrophoresis, is higher after exposure to supernatant from w.t. Salmonella than from the cdtB deletion mutant. Etoposide served as a positive control. Pictures of two representative nuclei per condition are shown. (C) Quantification of the comet assay, shown as means ± the SEM. ****, P < 0.0001. (D) Immunofluorescence analysis of cells intoxicated or treated with etoposide for 24 h with antibodies against γH2AX (green) and Ki67 (red); nuclei were stained with Hoechst (blue). Scale bar, 25 μm. (E) Quantification of Ki67+ cells in intoxicated cells. Unlike cells treated with etoposide, cells intoxicated with w.t. Salmonella supernatant do not stop proliferation despite the presence of DNA DSBs. (F) Quantification of DNA damage in proliferating and non-proliferating cells. The intensity of the γH2AX signal was quantified for each Ki67 positive and negative nucleus, using ImageJ. Data shown as means ± the SEM. ***, P < 0.001; ****, P < 0.0001. (G) Primary cell monolayers infected for 3 days with Salmonella Paratyphi A transformed with the mCherry expressing vector pLS002 (red) and fluorescently labeled with antibodies against γH2AX (green) and Ki67 (white); nuclei were labeled with Hoechst (blue). Scale bar, 10 μm.

FIG S3

Long-term intoxication, 24 and 48 h. Human GB organoids were seeded in 2D and intoxicated for 24 or 48 h. For intoxication for 48 h, the bacterial supernatant was produced twice, and fresh supernatant was diluted in medium was added after 24 h. The cells seeded were less confluent than in normal 24-h intoxication experiments to avoid premature confluence of the culture. The figure shows double-positive cells for Ki67 and γH2AX at 24 h (A) and 48 h (B). N, the minimum number of counted cells per individual experiment. Download FIG S3, TIF file, 1.2 MB (1.2MB, tif) .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

DISCUSSION

Here, we present a long-lived organoid model for human and murine GB. We found that long-term maintenance of GB organoid cultures depends on the presence of R-spondin, which mediates the activation of the Wnt/β-catenin signaling pathway and the regeneration of the gallbladder epithelium from Lgr5+ cells. These results confirm a recent report from a murine organoid model, which showed that the addition of R-spondin and Noggin, but not of Wnt ligands, was necessary for the expansion of GB stem cells in vitro (31). Since Wnt ligands are crucial for the activation of the Wnt/β-catenin pathway, we have found that the epithelium is itself the source of secreted WNT7A/7B. Our data suggest, in addition, that the organoids are able to transport organic ions, emulating the concentration of bile typical of this organ, and that GB epithelial features are stable over time in culture.

Resembling the architecture of the organ in situ, this organoid model provides an advanced platform for investigating GB pathology in primary, non-transformed cells. We therefore used GB organoids to develop a novel infection model for the human-specific, cancer-associated bacterium S. Paratyphi A, focusing on the genotoxic effect of the typhoid toxin. Previous data have suggested that bacterial internalization is essential for the secretion of the typhoid toxin by the host cell (17, 19–21). Here, we confirm that by infecting healthy human GB cells with a wild-type strain that produces the typhoid toxin, the non-infected bystander cells experienced genomic instability. This paracrine DNA damage effect depended on the presence of the CdtB subunit, moving attention to non-infected but intoxicated cells as potential targets of cellular transformation.

It has been shown that Salmonella is able to promote cell division through activation of the AKT and mitogen-activated protein kinase (MAPK) pathways. S. Typhimurium, which lacks the typhoid toxin, is able to induce tumor growth in a genetically predisposed primary mouse fibroblast model (63). We previously suggested that chronic carriers, subjected to low levels of genotoxicity and DSBs for years, might develop a similar genetic predisposition (64). Together with the anti-apoptotic effects of Salmonella on host cells (65, 66) and persistent inflammation, the enhanced damage is likely to contribute to an increased risk of developing malignant mutations observed in chronic carriers.

By using the organoids a source of cells to develop mucosoid cultures (as previously done for the human stomach) (34), we could generate an advanced model for S. Paratyphi A chronic infection in vitro. The gene expression profile of long-term S. Paratyphi A-infected mucosoid revealed that infection induced an initial cell cycle arrest that did not depend on the DNA damage caused by the typhoid toxin. It has been reported that bacteria use particular cell cycle phases for their invasion or replication. For these reasons they are equipped with factors known as cyclomodulins. Salmonella is known to preferentially invade mitotic cells (67) and is equipped with diverse cyclomodulins, including SpvB and PheA, that induce cell cycle arrest at different phases of the cell cycle depending on the type of infected cell (68). The typhoid toxin and other CdtB containing toxins, such as the cytolethal distending toxins (CDT), are also cyclomodulins since the DNA damage that they induce is known to induce cell cycle arrest, typically at the G2/M checkpoint (69–72). In the physiological settings of the mucosoids and using S. Paratyphi A, a wild-type typhoid toxin-producing strain, we could again detect DNA damage. However, we could not observe any stronger or longer effect due to the typhoid toxin over other effectors in blocking the cell cycle.

To distinguish the effect of the typhoid toxin over other bacterial effectors, we intoxicated primary epithelial cells derived from the organoids with a functional typhoid toxin obtained from bacterial supernatants. Our data confirm that the DNA damage is due to the action of the CdtB subunit of the typhoid toxin, but we showed in addition that damaged cells failed to arrest their cell cycle, and cells with higher levels of damage actually maintained proliferation. Chronic exposure to sublethal levels of recombinant CDT was previously found to induce genomic instability and anchorage-independent growth in Big Blue rat fibroblasts (25), suggesting that the duration of the exposure rather than the dose of the toxin is the key element that increases the risk of cellular transformation. In chronic carriers, healthy GB cells might get intoxicated with the typhoid toxin from neighboring infected Salmonella Paratyphi A cells or from gallstones coated with the same bacterium. The secretion of the toxin is at such a level that does not impair the cell cycle but still provokes DNA damage.

Future investigations should seek to understand whether the typhoid toxin leaves a genetic mutational signature in the gallbladder, as has been observed for other cancer types that have a signature reflecting the original mutagenic insult (15, 73, 74). Such a signature would provide an important molecular link between Salmonella and associated GBC.

MATERIALS AND METHODS

Human organoid culture.

Human gallbladder epithelial cells were derived from patients that underwent cholecystectomy (for details, see Table 5). The samples were stored in ice-cold phosphate-buffered saline (PBS) for up to 2 h, and then epithelial cell isolation was performed as described previously (75). Briefly, the tissue was washed with PBS from the residual bile and mucus, and it was then incubated at 37°C with the mucosal side facing a solution of 0.2% collagenase type IV. The mucosa was abraded thoroughly with the end of a glass microscope slide held at an angle of 45° every 5 min four times. The isolated cells were passed through a cell strainer with 70-μm pores and spun down, and 1 to 3 million cells were resuspended in a drop of 50 μl of Matrigel. The polymerized Matrigel drop was then supplemented with a medium based on Advanced/DMEM/F-12 (Invitrogen; described in Table 1). The medium was replaced twice a week. Every 7 to 10 days, the organoids were split at a ratio 1 to 3 or 4 by treatment with trypsin and then passed 10 times through a heat-narrowed Pasteur pipette. In the experiments in which single cells were seeded, trypsin-treated organoids were also passed through a 40-μm-pore cell strainer before seeding them in Matrigel.

TABLE 5.

Patient information

ID Age (yr) Gender Comments
GB6 66 F Cholecystectomy due to presence of gallstones and inflammation.
GB10 61 F Cholecystectomy due to presence of gallstones and inflammation.
GB11 56 M Cholecystectomy due to presence of gallstones and inflammation.
GB12 37 M Cholecystectomy due to polyps in the gallbladder; we got a healthy piece
GB13 66 M Adenocarcinoma of the gastroesophageal junction, type III, otherwise healthy GB; patient received neoadjuvant chemotherapy before surgery and preventive cholecystectomy.
GB16 65 F Gastric carcinoma, otherwise healthy GB; patient underwent gastrectomy and preventive cholecystectomy.

Murine organoid culture.

Murine gallbladders were derived from mice with C57BL/6J genetic background. After sacrificing the mouse, the gallbladder was resected, cut in four pieces, and incubated in a thermal mixer at 37°C in 2 ml of TrypLE (Thermo Scientific) for 45 min. The tissue pieces were pipetted up and down five times to release the cells, big pieces were removed, and isolated cells were centrifuged, washed with Dulbecco modified Eagle medium (DMEM), and then seeded in 50-μl Matrigel drops. The polymerized Matrigel drop was then supplemented with the medium described in Table 1. The medium was replaced twice a week. The splitting procedure was the same as that described for the human organoids.

Human gallbladder mucosoid culture.

The generation of the human gallbladder mucosoids follows a protocol that was previously published for the healthy human stomach (34). Briefly, single cells derived from organoid cultures were seeded on collagen-coated filters of Millicell standing cell culture inserts (Millipore, PIHP01250) at 150,000 cells/insert in primary cell medium (refer to Table 1 for more detail). Cells were incubated at 37°C, and the medium in the surrounding well was changed daily for the first 5 days, followed by twice a week. After 3 days, the medium on the filter was removed, and cells started to produce mucus that was withdrawn during medium change. Once a month, the mucosoids were split at a ratio of 1:3 by incubating the apical and basal sides of the mucosoids with trypsin-EDTA (0.5%). Single cells were reseeded again on new coated cell culture inserts.

Lineage tracing.

For lineage tracing experiments, we used murine gallbladder organoids derived from C57BL/6J, Lgr5-EGFP-IRES-CreERT2, ROSA-mTmGfloxed mice. At 5 days after seeding, 10 μM 4-hydroxytamoxifen (4HT; Sigma) was added to the medium, and the mixture was kept for 2 days. The induction was performed only once.

Microarray.

Organoids were harvested 4 or 14 days (small and big organoids, respectively) after seeding. The Matrigel drops containing the organoids were dissolved in 1 ml of TRIzol (Life Technologies), and RNA was isolated as described in the manufacturer’s protocol using glycogen as a coprecipitant. For mucosoids, filters were cut from the insert and dissolved thoroughly in 1 ml of TRIzol. Quality control and quantification of total RNA was assessed using a 2100 bioanalyzer (Agilent Technologies) and a NanoDrop 1000 UV-Vis spectrophotometer (Kisker).

(i) Organoids. Microarray experiments were performed as independent dual-color dye-reversal color-swap hybridizations using two biological replicates each. Total RNA was amplified and labeled with a dual-color Quick-Amp labeling kit (Agilent Technologies). In brief, mRNA was reverse transcribed and amplified using an oligo-dT-T7 promoter primer and labeled with cyanine 3-CTP or cyanine 5-CTP. After precipitation, purification, and quantification, 0.75 μg of each labeled cRNA was fragmented and hybridized to custom whole-genome human multipack microarrays (8 × 60k; Agilent, 048908) according to the supplier’s protocol (Agilent Technologies). Scanning of microarrays was performed at 3-μm resolution using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with Image Analysis/Feature Extraction software G2567AA vA.11.5.1.1 (Agilent Technologies) using default settings and the GE2_1105_Oct12 extraction protocol. The extracted dual-color raw data .txt files were further analyzed using R and the associated BioConductor package limma (76). Microarray data have been deposited in the Gene Expression Omnibus (GEO; www.ncbi.nlm.nih.gov/geo/) of the National Center for Biotechnology Information and can be assessed with the GEO accession number GSE100656.

For GSEA, a gene set of β-catenin target genes published previously (44) and human pluripotent stem cell genes published by Mallon et al. (42) (Tables 2 and 3) were used, and GSEA was performed on genes preranked by gene expression-based t score between early and differentiated organoids, using the fgsea R package (77) with 5,000 permutations. Wnt family member’s average intensities were calculated by global average in all the conditions. They were then filtered for an average intensity of >6. The differentially expressed ones were then identified as having a P value of <0.05.

(ii) Mucosoids. Single-color hybridizations using two technical replicates each were conducted. Microarrays used had design Agilent-014850 whole human genome microarray 4x44K G4112F (Agilent Technologies) and were read using the machines and software of the same manufacturer. The extracted raw data .txt files were further analyzed using R and the associated BioConductor package limma (76). Since MSigDB gene sets use human gene symbols to map genes to pathways, mouse symbols were translated to homologous human symbols using HomologeneDB from NCBI. GSEA was also performed on gene sets for cell cycle associated genes (58) from MSigDB v7.0 (PMID 21546393) (Table 4) between wild-type (w.t.) and ΔcdtB strain-infected mucosoid versus non-infected at 2 and 7 days post infection.

For human gene sets (i.e., MSigDB and those derived from human experiments), the full set of genes in the DGE results after collapsing t scores by gene and ranking was used. To analyze the mouse gene sets, the DGE data were restricted to probe sets that have a homologous gene in mice and humans. For these probe sets, the one with the highest t score and rank in the resulting list was selected and subsequently used for fGSEA analysis.

Expression data were analyzed as follows. For each of the selected comparisons, the replicates of the target condition were compared to the corresponding control using limma, producing differential expression statistics for all genes and comparisons. Analyses were performed as individual two-group unpaired comparisons: 2-day infection, w.t. versus NI; 2-day infection, ΔcdtB versus NI; 2-day infection, ΔcdtB versus w.t.; 7-day infection, w.t. versus NI; 7-day infection, ΔcdtB versus NI; and 7-day infection, ΔcdtB versus w.t.

The interpreting plotting of the results was done using Microsoft Excel, and the software R/R Studio was used to create the plots for the heatmaps. The heatmaps were plotted by using the normalized expression values (log-normalized intensity) again normalized on the non-infected control of each time point (logFC) when expression data from single genes were plotted and the calculated NES scores, respectively, for pathway analysis.

Immunofluorescence.

Organoids were removed from Matrigel at the indicated time point by washing with ice-cold PBS and then fixed with 3.7% paraformaldehyde. Tissue pieces were washed with PBS and fixed. After fixation, organoids and tissue pieces were embedded in paraffin and cut with a microtome to get 5-μm slices. Cells seeded in 2D (two dimensions) were washed with PBS and fixed. For whole-mount staining, the organoids were fixed directly in the Matrigel drop and then stained. The staining was performed with the antibodies and dyes listed in Table 6. Images were acquired with a Leica TCS SP-8 confocal microscope. For immunofluorescence of the mucosoids, the filters were cut form the insert, and pieces of the filters were blocked in a bovine serum albumin-containing blocking buffer for 3 h for whole-mount staining. Alternatively, the filters were fixed overnight in 4% paraformaldehyde (PFA) at 4°C, washed, embedded orthogonally in Histogel (HG-4000-144) inside a casting mold, and paraffinized overnight in a Leica TP1020 tissue processor. The paraffin blocks were generated inside a casting mold on a Paraffin console (Microm). Next, 5-μm sections were cut with a paraffin rotation microtome (Microm). For dewaxing and antigen retrieval, sample slides were washed twice with xylene (10 min), followed by a descending series of alcohols (20 s each), followed by two washes with water and 30 min in target retrieval solution (Dako) at 95°C and 20 min at room temperature and 5 min under running water. Primary antibodies were diluted in the blocking solution: in-house-made anti-γH2AX conjugated to ATTO488 (a green fluorescent dye; 1:500), phalloidin-Alexa 647 (lot 1731699; 1:100), and Hoechst (1:1,000; Sigma, B2261, lot 019K4029). Antibodies were incubated overnight at room temperature in the dark. Next, filter pieces were washed three times with blocking solution for 3 h at room temperature in the dark. The stained filters were mounted in Vectashield (Vector Laboratories, H-1500) on a glass slide, and the images were acquired using an SP-8 confocal microscope. The pictures are a result of a projection of multiple z-stacks analyzed with the software ImageJ.

TABLE 6.

Antibodies and dyes

Antibody Supplier Catalog no. Source Application(s) (dilution)a
Anti-β-Actin (AC-15) Sigma A5441 Mouse monoclonal WB (1:10,000)
E-cadherin (clone CD324) BD 562869 Mouse monoclonal IF (1:300), WB (1:500)
Ki67 (D2H10) Cell Signaling 9027 Rabbit monoclonal IF (1:200)
PCNA (csPC10) Cell Signaling 2586 Mouse monoclonal IF (1:100)
Phospho-histone H2A.X (Ser139) (clone JBW301) Millipore 05-636-I Mouse monoclonal WB (1:200)
Phospho-histone H2A.X (Ser139)-conjugated FITCS In house Mouse monoclonal IF (1:500)
β-Catenin Sigma C2206 Rabbit polyclonal IF (1:300), WB (1:500)
Claudin-2 Abcam ab53032 Rabbit polyclonal IF (1:200), WB (1:500)
Cytokeratin 19 (EP1580Y) Abcam ab52625 Rabbit monoclonal IF: 1:500), WB (1:5,000)
Muc5B Abcam ab87376 Rabbit polyclonal IF (1:300)
Vimentin (D21H3) Cell Signaling 5741 Rabbit monoclonal WB (1:1,000)
Hoechst (bisbenzimide H 33258) Sigma H6024 IF (1:1,000)
Draq5 Abcam ab108410 IF (1:1,000)
Phalloidin 647 Invitrogen A22287 IF (1:500)
a

WB, Western blotting; IF, immunofluorescence.

Transmission electron microscopy.

Infected and non-infected gallbladder mucosoids were washed in-well with PBS, fixed with 4% PFA for 30 min, and washed twice with PBS. Filters were cut from the insert and cropped into pieces with bacterial patches under visual control. Cropped filter pieces were stored in PBS at 4°C until use. For fine structural analysis, cell layers on filters were fixed with 2.5% glutaraldehyde, postfixed with 0.5% osmium tetroxide, contrasted with uranyl acetate and tannic acid, dehydrated in a graded ethanol series, and infiltrated in Polybed (Polysciences). Cut-out pieces of the filters were stacked in flat embedding molds with Polybed. After polymerization, specimens were cut at 60 nm and contrasted with lead citrate. Specimens were analyzed in a Leo 906E transmission electron microscope (Zeiss, Oberkochen, Germany) equipped with a side-mounted digital camera (Morada, SIS-Olympus, Münster, Germany). Figures were assembled with the help of a FigureJ-Plugin (78).

Western blotting.

For the Western blots, organoids and cells seeded in 2D were harvested in Laemmli buffer, and 12% SDS-PAGE gels were run and transferred to a nitrocellulose membrane, which was then blotted with the antibodies listed in Table 6. Densitometry was calculated using ImageJ software.

Functional assay.

The functional assay is a modified version of a previously described assay (54). Briefly, 1 week after seeding, the organoids were incubated with DMEM/F-12 (Invitrogen) containing 100 μM rhodamine-123 (Sigma) for 5 min, washed with three times with PBS, and supplemented with the regular medium. Images were taken every minute with a Leica SP-E confocal microscope for 30 min. Temperature and CO2 concentration were kept at 37°C and 5%, respectively. To show that transport of rhodamine-123 depends on activity of multidrug-resistant (MDR) gene products, the organoids were incubated with 10 μM verapamil (Sigma), an MDR inhibitor, for 30 min before rhodamine-123 was added. As a negative control, gastric organoids were used, cultivated as previously described (28).

Bacterial strains.

Salmonella enterica serovar Paratyphi A (ATCC 9150) was used for the infection experiments. An isogenic mutant knockout of cdtB was generated by interrupting the gene with a kanamycin resistance cassette. Briefly, two sequences were amplified upstream and downstream cdtB using the primers TCTATAGTTGTCTCTTTGGTATTAAC and CGCGGATCCACCATAAGAATATCC for the region upstream and the primers CGCGGATCCATATAAGATATATCT and ACAGCTTCGTGCCAAAAAGG for the region downstream. After insertion in a pGEM-T Easy vector (Promega), a kanamycin resistance cassette was inserted in between by making use of the BamHI sites included in the primers. The resulting region was PCR amplified and electroporated in Salmonella, and the clones where homologous recombination occurred were selected, as described previously (79). If mentioned, to visualize the bacteria, the w.t. and ΔcdtB strains were additionally transformed with pLS002, a plasmid carrying the constitutively expressed mCherry gene and an ampicillin resistance cassette.

Infection experiments.

Organoids were removed from Matrigel by washing with ice-cold PBS, mechanically sheared by pipetting them three times through a heat-narrowed Pasteur pipette, and incubated at 37°C with 300 μl of primary medium containing log-phase Salmonella to a multiplicity of infection of 100 for 2 h. The cells were pelleted and washed twice with PBS before reseeding them in Matrigel. The gentamicin protection assay was performed by incubation for 1 h in primary medium supplemented with 100 μg/ml gentamicin. At this point, the invasion assay was performed. The organoids were removed from Matrigel and washed twice with PBS, the membrane was permeabilized by 2 min of incubation with 1% Triton X-100, and then sequential dilutions were plated on LB agar plates. The following day, colonies were counted as follows: invasion percentage = (CFU recovered from the infected organoids/bacteria used for infection) × 100. In the well with the remaining infected organoids, the concentration of gentamicin was decreased to 10 μg/ml for the duration of the experiment (80). Infection of mucosoids with Salmonella was done accordingly: log-phase mCherry-transformed Salmonella was administered on the filter to a multiplicity of infection of 100 for 24 h by using a penicillin-streptomycin-free 3D gallbladder medium (see Table 1). The infection medium was then removed, the filters and wells were washed with 37°C PBS, and the gentamicin protection assay was performed by incubation for 1 h in primary medium supplemented with 100 μg/ml gentamicin. The gentamicin concentration was then reduced to 10 μg/ml and withdrawn completely at 48 h post infection. The cells were washed, and the medium was refreshed every 2 days.

Intoxication experiments.

Organoids were split to single cells, seeded onto a type I collagen (Thermo Fisher, A10644-0)-coated plastic (10 μg/cm2) or glass (15 μg/cm2) surface, supplemented with the conventional 3D medium, and intoxicated when 50% confluence was reached. The typhoid toxin-containing Salmonella supernatant was prepared by using a modified version of a previously described protocol (19). Briefly, the bacteria were grown in Luria-Bertani overnight, diluted 1:50 in MM5.8 (19, 81), and then grown overnight until the optical density at 600 nm reached 0.4 to 0.5. The bacteria were then removed by centrifugation and subsequent filtration through 0.4-μm-pore filters. The supernatant was then concentrated 20-fold using an Amicon Ultra-15 column. It was then diluted 1 to 20 in primary medium and incubated for 24 h with the cells. As a positive control, the cells received 50 μM etoposide (Sigma) for 24 h.

Neutral comet assay.

The neutral comet assay was performed after intoxication using the kit from Trevigen according to the manufacturer´s protocol. Images were acquired using fluorescence microscope (Leica DMR). The percentage of DNA in the tail (which is a measure of DNA damage) was quantified using Comet Score software (TriTek).

Data availability.

Microarray data have been deposited in the Gene Expression Omnibus (GEO; www.ncbi.nlm.nih.gov/geo/) of the National Center for Biotechnology Information and can be accessed under GEO accession number GSE100656.

ACKNOWLEDGMENTS

We thank Lothar Wieler and Anton Aebischer for critical revision of the project, Hans-Joachim Mollenkopf and Ina Wagner for support with the microarray experiments, and Rike Zietlow and Mary Muers for editing the manuscript.

Author contributions were as follows: L.P.S., study design, experiments design, generation, analysis and interpretation of data, drafting of the manuscript, statistical analysis, development of experimental procedures; K.H., development of experimental procedures, generation, analysis and interpretation of data, statistical analysis, drafting of the manuscript; A.I., experimental design and development of procedures, generation of data; H.B., statistical analysis of microarray data, bioinformatics support; N.K., generation and analysis of data; C.G., electron microscopy; S.C., preparation and provision of human specimens; S.C.S., preparation and provision of human specimens; R.K.G., conception, contribution to the study design and supervision; T.F.M., conception, design and supervision of the study, revision of manuscript, funding acquisition; and F.B., study conception and design, study supervision, analysis and interpretation of data, writing and revision of the manuscript.

We declare there are no conflicts of interest.

Footnotes

Citation Sepe LP, Hartl K, Iftekhar A, Berger H, Kumar N, Goosmann C, Chopra S, Schmidt SC, Gurumurthy RK, Meyer TF, Boccellato F. 2020. Genotoxic effect of Salmonella Paratyphi A infection on human primary gallbladder cells. mBio 11:e01911-20. https://doi.org/10.1128/mBio.01911-20.

REFERENCES

  • 1.Kanthan R, Senger J-L, Ahmed S, Kanthan SC. 2015. Gallbladder cancer in the 21st century. J Oncol 2015:967472–967472. doi: 10.1155/2015/967472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Randi G, Franceschi S, La Vecchia C. 2006. Gallbladder cancer worldwide: geographical distribution and risk factors. Int J Cancer 118:1591–1602. doi: 10.1002/ijc.21683. [DOI] [PubMed] [Google Scholar]
  • 3.Crawford RW, Gibson DL, Kay WW, Gunn JS. 2008. Identification of a bile-induced exopolysaccharide required for Salmonella biofilm formation on gallstone surfaces. Infect Immun 76:5341–5349. doi: 10.1128/IAI.00786-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Crawford RW, Rosales-Reyes R, Ramírez-Aguilar ML, Chapa-Azuela O, Alpuche-Aranda C, Gunn JS. 2010. Gallstones play a significant role in Salmonella spp. gallbladder colonization and carriage. Proc Natl Acad Sci U S A 107:4353–4358. doi: 10.1073/pnas.1000862107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Gonzalez-Escobedo G, Gunn JS. 2013. Gallbladder epithelium as a niche for chronic salmonella carriage. Infect Immun 81:2920–2930. doi: 10.1128/IAI.00258-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gonzalez-Escobedo G, Marshall JM, Gunn JS. 2011. Chronic and acute infection of the gall bladder by Salmonella Typhi: understanding the carrier state. Nat Rev Microbiol 9:9–14. doi: 10.1038/nrmicro2490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Caygill CPJ, Hill MJ, Braddick M, Sharp JCM. 1994. Cancer mortality in chronic typhoid and paratyphoid carriers. Lancet 343:83–84. doi: 10.1016/S0140-6736(94)90816-8. [DOI] [PubMed] [Google Scholar]
  • 8.Kumar S, Kumar S, Kumar S. 2006. Infection as a risk factor for gallbladder cancer. J Surg Oncol 93:633–639. doi: 10.1002/jso.20530. [DOI] [PubMed] [Google Scholar]
  • 9.Nagaraja V, Eslick GD. 2014. Systematic review with meta-analysis: the relationship between chronic Salmonella Typhi carrier status and gall-bladder cancer. Aliment Pharmacol Ther 39:745–750. doi: 10.1111/apt.12655. [DOI] [PubMed] [Google Scholar]
  • 10.Chumduri C, Gurumurthy RK, Zietlow R, Meyer TF. 2016. Subversion of host genome integrity by bacterial pathogens. Nat Rev Mol Cell Biol 17:659–673. doi: 10.1038/nrm.2016.100. [DOI] [PubMed] [Google Scholar]
  • 11.Koeppel M, Garcia-Alcalde F, Glowinski F, Schlaermann P, Meyer TF. 2015. Helicobacter pylori infection causes characteristic DNA damage patterns in human cells. Cell Rep 11:1703–1713. doi: 10.1016/j.celrep.2015.05.030. [DOI] [PubMed] [Google Scholar]
  • 12.Toller IM, Neelsen KJ, Steger M, Hartung ML, Hottiger MO, Stucki M, Kalali B, Gerhard M, Sartori AA, Lopes M, Muller A. 2011. Carcinogenic bacterial pathogen Helicobacter pylori triggers DNA double-strand breaks and a DNA damage response in its host cells. Proc Natl Acad Sci U S A 108:14944–14949. doi: 10.1073/pnas.1100959108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Chumduri C, Gurumurthy RK, Zadora PK, Mi Y, Meyer TF. 2013. Chlamydia infection promotes host DNA damage and proliferation but impairs the DNA damage response. Cell Host Microbe 13:746–758. doi: 10.1016/j.chom.2013.05.010. [DOI] [PubMed] [Google Scholar]
  • 14.Cuevas-Ramos G, Petit CR, Marcq I, Boury M, Oswald E, Nougayrède J-P. 2010. Escherichia coli induces DNA damage in vivo and triggers genomic instability in mammalian cells. Proc Natl Acad Sci U S A 107:11537–11542. doi: 10.1073/pnas.1001261107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dziubańska-Kusibab PJ, Berger H, Battistini F, Bouwman BAM, Iftekhar A, Katainen R, Cajuso T, Crosetto N, Orozco M, Aaltonen LA, Meyer TF. 2020. Colibactin DNA-damage signature indicates mutational impact in colorectal cancer. Nat Med 26:1063–1069. doi: 10.1038/s41591-020-0908-2. [DOI] [PubMed] [Google Scholar]
  • 16.Song J, Gao X, Galán JE. 2013. Structure and function of the Salmonella Typhi chimeric A(2)B(5) typhoid toxin. Nature 499:350–354. doi: 10.1038/nature12377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Spanò S, Ugalde JE, Galán JE. 2008. Delivery of a Salmonella Typhi exotoxin from a host intracellular compartment. Cell Host Microbe 3:30–38. doi: 10.1016/j.chom.2007.11.001. [DOI] [PubMed] [Google Scholar]
  • 18.Rodriguez-Rivera LD, Bowen BM, den Bakker HC, Duhamel GE, Wiedmann M. 2015. Characterization of the cytolethal distending toxin (typhoid toxin) in non-typhoidal Salmonella serovars. Gut Pathog 7:19–19. doi: 10.1186/s13099-015-0065-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Guidi R, Levi L, Rouf SF, Puiac S, Rhen M, Frisan T. 2013. Salmonella enterica delivers its genotoxin through outer membrane vesicles secreted from infected cells. Cell Microbiol 15:2034–2050. doi: 10.1111/cmi.12172. [DOI] [PubMed] [Google Scholar]
  • 20.Haghjoo E, Galan JE. 2004. Salmonella Typhi encodes a functional cytolethal distending toxin that is delivered into host cells by a bacterial-internalization pathway. Proc Natl Acad Sci U S A 101:4614–4619. doi: 10.1073/pnas.0400932101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chang SJ, Song J, Galán JE. 2016. Receptor-mediated sorting of typhoid toxin during its export from Salmonella Typhi-infected cells. Cell Host Microbe 20:682–689. doi: 10.1016/j.chom.2016.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Grasso F, Frisan T. 2015. Bacterial genotoxins: merging the DNA damage response into infection biology. Biomolecules 5:1762–1782. doi: 10.3390/biom5031762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fox JG, Ge Z, Whary MT, Erdman SE, Horwitz BH. 2011. Helicobacter hepaticus infection in mice: models for understanding lower bowel inflammation and cancer. Mucosal Immunol 4:22–30. doi: 10.1038/mi.2010.61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ge Z, Feng Y, Ge L, Parry N, Muthupalani S, Fox JG. 2017. Helicobacter hepaticus cytolethal distending toxin promotes intestinal carcinogenesis in 129Rag2-deficient mice. Cell Microbiol 19. doi: 10.1111/cmi.12728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Guidi R, Guerra L, Levi L, Stenerlöw B, Fox JG, Josenhans C, Masucci MG, Frisan T. 2013. Chronic exposure to the cytolethal distending toxins of Gram-negative bacteria promotes genomic instability and altered DNA damage response. Cell Microbiol 15:98–113. doi: 10.1111/cmi.12034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sato T, Stange DE, Ferrante M, Vries RGJ, Van Es JH, Van Den Brink S, Van Houdt WJ, Pronk A, Van Gorp J, Siersema PD, Clevers H. 2011. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett’s epithelium. Gastroenterology 141:1762–1772. doi: 10.1053/j.gastro.2011.07.050. [DOI] [PubMed] [Google Scholar]
  • 27.Jung P, Sato T, Merlos-Suárez A, Barriga FM, Iglesias M, Rossell D, Auer H, Gallardo M, Blasco M, Sancho E, Clevers H, Batlle E. 2011. Isolation and in vitro expansion of human colonic stem cells. Nat Med 17:1225–1227. doi: 10.1038/nm.2470. [DOI] [PubMed] [Google Scholar]
  • 28.Schlaermann P, Toelle B, Berger H, Schmidt SC, Glanemann M, Ordemann J, Bartfeld S, Mollenkopf HJ, Meyer TF. 2016. A novel human gastric primary cell culture system for modeling Helicobacter pylori infection in vitro. Gut 65:202–213. doi: 10.1136/gutjnl-2014-307949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bartfeld S, Bayram T, van de Wetering M, Huch M, Begthel H, Kujala P, Vries R, Peters PJ, Clevers H. 2015. In vitro expansion of human gastric epithelial stem cells and their responses to bacterial infection. Gastroenterology 148:126–136.e6. doi: 10.1053/j.gastro.2014.09.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Huch M, Gehart H, Boxtel RV, Hamer K, Blokzijl F, Verstegen MMa, Ellis E, Wenum MV, Fuchs S, Ligt JD, Wetering MVD, Sasaki N, Boers SJ, Kemperman H, Jonge JD, Ijzermans JNM, Nieuwenhuis EES, Hoekstra R, Strom S, Vries RRG, Laan L, Cuppen E, Clevers H. 2015. Article long-term culture of genome-stable bipotent stem cells from adult human liver. Cell 160:299–312. doi: 10.1016/j.cell.2014.11.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lugli N, Kamileri I, Keogh A, Malinka T, Sarris ME, Talianidis I, Schaad O, Candinas D, Stroka D, Halazonetis TD. 2016. R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders. EMBO Rep 17:769–779. doi: 10.15252/embr.201642169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sampaziotis F, Justin AW, Tysoe OC, Sawiak S, Godfrey EM, Upponi SS, Gieseck RL, 3rd, de Brito MC, Berntsen NL, Gómez-Vázquez MJ, Ortmann D, Yiangou L, Ross A, Bargehr J, Bertero A, Zonneveld MCF, Pedersen MT, Pawlowski M, Valestrand L, Madrigal P, Georgakopoulos N, Pirmadjid N, Skeldon GM, Casey J, Shu W, Materek PM, Snijders KE, Brown SE, Rimland CA, Simonic I, Davies SE, Jensen KB, Zilbauer M, Gelson WTH, Alexander GJ, Sinha S, Hannan NRF, Wynn TA, Karlsen TH, Melum E, Markaki AE, Saeb-Parsy K, Vallier L. 2017. Reconstruction of the mouse extrahepatic biliary tree using primary human extrahepatic cholangiocyte organoids. Nat Med 23:954–963. doi: 10.1038/nm.4360. [DOI] [PubMed] [Google Scholar]
  • 33.Bartfeld S. 2016. Modeling infectious diseases and host-microbe interactions in gastrointestinal organoids. Dev Biol 420:252–270. doi: 10.1016/j.ydbio.2016.09.014. [DOI] [PubMed] [Google Scholar]
  • 34.Boccellato F, Woelffling S, Imai-Matsushima A, Sanchez G, Goosmann C, Schmid M, Berger H, Morey P, Denecke C, Ordemann J, Meyer TF. 2019. Polarised epithelial monolayers of the gastric mucosa reveal insights into mucosal homeostasis and defence against infection. Gut 68:400–413. doi: 10.1136/gutjnl-2017-314540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yoo KS, Choi HS, Jun DW, Lee HL, Lee OY, Yoon BC, Lee KG, Paik SS, Kim YS, Lee J. 2016. MUC expression in gallbladder epithelial tissues in cholesterol-associated gallbladder disease. Gut Liver 10:851–858. doi: 10.5009/gnl15600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hayashi A, Lee SP. 1996. Bidirectional transport of cholesterol between gallbladder epithelial cells and model bile. Am J Physiol 271:G410–G414. doi: 10.1152/ajpgi.1996.271.3.G410. [DOI] [PubMed] [Google Scholar]
  • 37.Nakanuma Y, Katayanagi K, Kawamura Y, Yoshida K. 1997. Monolayer and three-dimensional cell culture and living tissue culture of gallbladder epithelium. Microsc Res Tech 39:71–84. doi: 10.1002/(SICI)1097-0029(19971001)39:1<71::AID-JEMT6>3.0.CO;2-2. [DOI] [PubMed] [Google Scholar]
  • 38.Frizzell RA, Heintze K. 1980. Transport functions of the gallbladder. Int Rev Physiol 21:221–247. [PubMed] [Google Scholar]
  • 39.Yoo KS, Lim WT, Choi HS. 2016. Biology of cholangiocytes: from bench to bedside. Gut Liver 10:687–698. doi: 10.5009/gnl16033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Manohar R, Li Y, Fohrer H, Guzik L, Stolz DB, Chandran UR, LaFramboise WA, Lagasse E. 2015. Identification of a candidate stem cell in human gallbladder. Stem Cell Res 14:258–269. doi: 10.1016/j.scr.2014.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Carpino G, Cardinale V, Gentile R, Onori P, Semeraro R, Franchitto A, Wang Y, Bosco D, Iossa A, Napoletano C, Cantafora A, D’Argenio G, Nuti M, Caporaso N, Berloco P, Venere R, Oikawa T, Reid L, Alvaro D, Gaudio E. 2014. Evidence for multipotent endodermal stem/progenitor cell populations in human gallbladder. J Hepatol 60:1194–1202. doi: 10.1016/j.jhep.2014.01.026. [DOI] [PubMed] [Google Scholar]
  • 42.Mallon BS, Chenoweth JG, Johnson KR, Hamilton RS, Tesar PJ, Yavatkar AS, Tyson LJ, Park K, Chen KG, Fann YC, McKay RD. 2013. StemCellDB: the human pluripotent stem cell database at the National Institutes of Health. Stem Cell Res 10:57–66. doi: 10.1016/j.scr.2012.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Sato T, van Es JH, Snippert HJ, Stange DE, Vries RG, van den Born M, Barker N, Shroyer NF, van de Wetering M, Clevers H. 2011. Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature 469:415–418. doi: 10.1038/nature09637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Herbst A, Jurinovic V, Krebs S, Thieme SE, Blum H, Goke B, Kolligs FT. 2014. Comprehensive analysis of beta-catenin target genes in colorectal carcinoma cell lines with deregulated Wnt/beta-catenin signaling. BMC Genomics 15:74. doi: 10.1186/1471-2164-15-74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Jones JC. 2008. Reduction of contamination of epithelial cultures by fibroblasts. CSH Protoc 2008:pdb.prot4478. doi: 10.1101/pdb.prot4478. [DOI] [PubMed] [Google Scholar]
  • 46.Mitra A, Mishra L, Li S. 2013. Technologies for deriving primary tumor cells for use in personalized cancer therapy. Trends Biotechnol 31:347–354. doi: 10.1016/j.tibtech.2013.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kuver R, Savard CE, Lee SK, Haigh WG, Lee SP. 2007. Murine gallbladder epithelial cells can differentiate into hepatocyte-like cells in vitro. Am J Physiol Gastrointest Liver Physiol 293:G944–G955. doi: 10.1152/ajpgi.00263.2006. [DOI] [PubMed] [Google Scholar]
  • 48.Németh Z, Szász AM, Tátrai P, Németh J, Gyorffy H, Somorácz A, Szíjártó A, Kupcsulik P, Kiss A, Schaff Z. 2009. Claudin-1, -2, -3, -4, -7, -8, and -10 protein expression in biliary tract cancers. J Histochem Cytochem 57:113–121. doi: 10.1369/jhc.2008.952291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kampf C, Mardinoglu A, Fagerberg L, Hallström BM, Danielsson A, Nielsen J, Pontén F, Uhlen M. 2014. Defining the human gallbladder proteome by transcriptomics and affinity proteomics. Proteomics 14:2498–2507. doi: 10.1002/pmic.201400201. [DOI] [PubMed] [Google Scholar]
  • 50.van Klinken BJ, Dekker J, van Gool SA, van Marle J, Buller HA, Einerhand AW. 1998. MUC5B is the prominent mucin in human gallbladder and is also expressed in a subset of colonic goblet cells. Am J Physiol 274:G871–G878. doi: 10.1152/ajpgi.1998.274.5.G871. [DOI] [PubMed] [Google Scholar]
  • 51.Gigliozzi A, Fraioli F, Sundaram P, Lee J, Mennone A, Alvaro D, Boyer JL. 2000. Molecular identification and functional characterization of Mdr1a in rat cholangiocytes. Gastroenterology 119:1113–1122. doi: 10.1053/gast.2000.18156. [DOI] [PubMed] [Google Scholar]
  • 52.Pstrpw JD. 1967. Absorption of bile pigments by the gall bladder. J Clin Invest 46:2035–2052. doi: 10.1172/JCI105692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Scoazec JY, Bringuier AF, Medina JF, Martínez-Ansó E, Veissiere D, Feldmann G, Housset C. 1997. The plasma membrane polarity of human biliary epithelial cells: in situ immunohistochemical analysis and functional implications. J Hepatol 26:543–553. doi: 10.1016/s0168-8278(97)80419-9. [DOI] [PubMed] [Google Scholar]
  • 54.Tanimizu N, Miyajima A, Mostov KE. 2007. Liver progenitor cells develop cholangiocyte-type epithelial polarity in three-dimensional culture. Mol Biol Cell 18:1472–1479. doi: 10.1091/mbc.e06-09-0848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Nath G, Gulati AK, Shukla VK. 2010. Role of bacteria in carcinogenesis, with special reference to carcinoma of the gallbladder. World J Gastroenterol 16:5395–5404. doi: 10.3748/wjg.v16.i43.5395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Paull TT, Rogakou EP, Yamazaki V, Kirchgessner CU, Gellert M, Bonner WM. 2000. A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr Biol 10:886–895. doi: 10.1016/s0960-9822(00)00610-2. [DOI] [PubMed] [Google Scholar]
  • 57.Del Bel Belluz L, Guidi R, Pateras IS, Levi L, Mihaljevic B, Rouf SF, Wrande M, Candela M, Turroni S, Nastasi C, Consolandi C, Peano C, Tebaldi T, Viero G, Gorgoulis VG, Krejsgaard T, Rhen M, Frisan T. 2016. The typhoid toxin promotes host survival and the establishment of a persistent asymptomatic infection. PLoS Pathog 12:e1005528. doi: 10.1371/journal.ppat.1005528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Whitfield ML, Sherlock G, Saldanha AJ, Murray JI, Ball CA, Alexander KE, Matese JC, Perou CM, Hurt MM, Brown PO, Botstein D. 2002. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell 13:1977–2000. doi: 10.1091/mbc.02-02-0030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Liu Y, Chen S, Wang S, Soares F, Fischer M, Meng F, Du Z, Lin C, Meyer C, DeCaprio JA, Brown M, Liu XS, He HH. 2017. Transcriptional landscape of the human cell cycle. Proc Natl Acad Sci U S A 114:3473–3478. doi: 10.1073/pnas.1617636114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Di Domenico EG, Cavallo I, Pontone M, Toma L, Ensoli F. 2017. Biofilm-producing Salmonella Typhi: chronic colonization and development of gallbladder cancer. Int J Mol Sci 18:1887. doi: 10.3390/ijms18091887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Wozniak AJ, Ross WE. 1983. DNA damage as a basis for 4′-demethylepipodophyllotoxin-9-(4,6-O-ethylidene-β-d-glucopyranoside) (etoposide) cytotoxicity. Cancer Res 43:120–124. [PubMed] [Google Scholar]
  • 62.Gagnaire A, Nadel B, Raoult D, Neefjes J, Gorvel JP. 2017. Collateral damage: insights into bacterial mechanisms that predispose host cells to cancer. Nat Rev Microbiol 15:109–128. doi: 10.1038/nrmicro.2016.171. [DOI] [PubMed] [Google Scholar]
  • 63.Scanu T, Spaapen RM, Bakker JM, Pratap CB, Wu LE, Hofland I, Broeks A, Shukla VK, Kumar M, Janssen H, Song J-Y, Neefjes-Borst EA, Te Riele H, Holden DW, Nath G, Neefjes J. 2015. Salmonella manipulation of host signaling pathways provokes cellular transformation associated with gallbladder carcinoma. Cell Host Microbe 17:763–774. doi: 10.1016/j.chom.2015.05.002. [DOI] [PubMed] [Google Scholar]
  • 64.Boccellato F, Meyer TF. 2015. Bacteria moving into focus of human cancer. Cell Host Microbe 17:728–730. doi: 10.1016/j.chom.2015.05.016. [DOI] [PubMed] [Google Scholar]
  • 65.Steele-Mortimer O, Knodler LA, Marcus SL, Scheid MP, Goh B, Pfeifer CG, Duronio V, Finlay BB. 2000. Activation of Akt/protein kinase B in epithelial cells by the Salmonella Typhimurium effector sigD. J Biol Chem 275:37718–37724. doi: 10.1074/jbc.M008187200. [DOI] [PubMed] [Google Scholar]
  • 66.Roppenser B, Kwon H, Canadien V, Xu R, Devreotes PN, Grinstein S, Brumell JH. 2013. Multiple host kinases contribute to Akt Activation during Salmonella infection. PLoS One 8:e71015. doi: 10.1371/journal.pone.0071015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Santos AJ, Meinecke M, Fessler MB, Holden DW, Boucrot E. 2013. Preferential invasion of mitotic cells by Salmonella reveals that cell surface cholesterol is maximal during metaphase. J Cell Sci 126:2990–2996. doi: 10.1242/jcs.115253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Buckner MM. 2016. Divide and conquer: Salmonella move into both daughter cells during mitosis. Virulence 7:616–619. doi: 10.1080/21505594.2016.1190063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Pérès SY, Marchès O, Daigle F, Nougayrède JP, Herault F, Tasca C, De Rycke J, Oswald E. 1997. A new cytolethal distending toxin (CDT) from Escherichia coli producing CNF2 blocks HeLa cell division in G2/M phase. Mol Microbiol 24:1095–1107. doi: 10.1046/j.1365-2958.1997.4181785.x. [DOI] [PubMed] [Google Scholar]
  • 70.Comayras C, Tasca C, Pérès SY, Ducommun B, Oswald E, De Rycke J. 1997. Escherichia coli cytolethal distending toxin blocks the HeLa cell cycle at the G2/M transition by preventing cdc2 protein kinase dephosphorylation and activation. Infect Immun 65:5088–5095. doi: 10.1128/IAI.65.12.5088-5095.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Ohguchi M, Ishisaki A, Okahashi N, Koide M, Koseki T, Yamato K, Noguchi T, Nishihara T. 1998. Actinobacillus actinomycetemcomitans toxin induces both cell cycle arrest in the G2/M phase and apoptosis. Infect Immun 66:5980–5987. doi: 10.1128/IAI.66.12.5980-5987.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Sert V, Cans C, Tasca C, Bret-Bennis L, Oswald E, Ducommun B, De Rycke J. 1999. The bacterial cytolethal distending toxin (CDT) triggers a G2 cell cycle checkpoint in mammalian cells without preliminary induction of DNA strand breaks. Oncogene 18:6296–6304. doi: 10.1038/sj.onc.1203007. [DOI] [PubMed] [Google Scholar]
  • 73.Poon SL, McPherson JR, Tan P, Teh BT, Rozen SG. 2014. Mutation signatures of carcinogen exposure: genome-wide detection and new opportunities for cancer prevention. Genome Med 6:24. doi: 10.1186/gm541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Pleguezuelos-Manzano C, Puschhof J, Rosendahl Huber A, van Hoeck A, Wood HM, Nomburg J, Gurjao C, Manders F, Dalmasso G, Stege PB, Paganelli FL, Geurts MH, Beumer J, Mizutani T, Miao Y, van der Linden R, van der Elst S, Garcia KC, Top J, Willems RJL, Giannakis M, Bonnet R, Quirke P, Meyerson M, Cuppen E, van Boxtel R, Clevers H, Genomics England Research Consortium. 2020. Mutational signature in colorectal cancer caused by genotoxic pks(+) Escherichia coli. Nature 580:269–273. doi: 10.1038/s41586-020-2080-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Auth MK, Keitzer R, Scholz M, Blaheta R, Hottenrott EC, Herrmann G, Encke A, Markus BH. 1993. Establishment and immunological characterization of cultured human gallbladder epithelial cells. Hepatology 18:546–555. doi: 10.1002/hep.1840180311. [DOI] [PubMed] [Google Scholar]
  • 76.Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. 2015. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res 43:e47. doi: 10.1093/nar/gkv007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Sergushichev AA, Loboda AA, Jha AK, Vincent EE, Driggers EM, Jones RG, Pearce EJ, Artyomov MN. 2016. GAM: a web-service for integrated transcriptional and metabolic network analysis. Nucleic Acids Res 44:W194–W200. doi: 10.1093/nar/gkw266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Mutterer J, Zinck E. 2013. Quick-and-clean article figures with FigureJ. J Microsc 252:89–91. doi: 10.1111/jmi.12069. [DOI] [PubMed] [Google Scholar]
  • 79.Datsenko K, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Elhadad D, Desai P, Grassl GA, McClelland M, Rahav G, Gal-Mor O. 2016. Differences in host cell invasion and SPI-1 expression between Salmonella enterica serovar Paratyphi A and the non-typhoidal serovar Typhimurium. Infect Immun 84:1150–1165. doi: 10.1128/IAI.01461-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Nelson DL, Kennedy EP. 1971. Magnesium transport in Escherichia coli: inhibition by cobaltous ion. J Biol Chem 246:3042–3049. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

FIG S1

Cultivation of murine gallbladder organoids. (A) Murine gallbladder epithelial cells grown as organoids at 1, 2, and 4 days after seeding, and at passages 1, 5, 10, 16, and 19. Scale bar, 1mm. (B) Organoids on day 7 after seeding, fluorescently labeled with antibodies against the proliferation marker PCNA (green) and β-catenin (red); nuclei were stained with DRAQ5 (blue). Scale bar, 50 μm. (C) Organoids at passage 0 were split to single cells, seeded, and the number of resulting organoids was counted 5 to 7 days later (i.e., at passage 1). The organoids were kept in culture, and the procedure was repeated after 18 passages (i.e., at passage 19). Bars represent means ± the SD. (D) Lineage tracing of organoids derived from Lgr5-EGFP-IRES-CreERT2, ROSA-mTmGfloxed reporter mice after HT induction. Organoids derived from Lgr5+ cells express mGFP, while those derived from Lgr5− cells express mTomato. Scale bar, 200 μm. Download FIG S1, TIF file, 2.1 MB (2.1MB, tif) .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S2

Characterization of murine gallbladder organoids. (A) Western blot analysis of murine epithelial and gallbladder markers at early (P1) and late (P19) passages. (B) Western blot analysis as in panel A of the fibroblast marker vimentin compared to HeLa cells. (C) Immunofluorescence analysis of murine gallbladder tissue and organoids at 7 days after seeding for the gallbladder markers cytokeratin-19, claudin-2, or mucin5B (red); the epithelial marker E-cadherin (green); and DRAQ5 (blue). Scale bar, 10 μm. Download FIG S2, TIF file, 1.3 MB (1.3MB, tif) .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S3

Long-term intoxication, 24 and 48 h. Human GB organoids were seeded in 2D and intoxicated for 24 or 48 h. For intoxication for 48 h, the bacterial supernatant was produced twice, and fresh supernatant was diluted in medium was added after 24 h. The cells seeded were less confluent than in normal 24-h intoxication experiments to avoid premature confluence of the culture. The figure shows double-positive cells for Ki67 and γH2AX at 24 h (A) and 48 h (B). N, the minimum number of counted cells per individual experiment. Download FIG S3, TIF file, 1.2 MB (1.2MB, tif) .

Copyright © 2020 Sepe et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

Data Availability Statement

Microarray data have been deposited in the Gene Expression Omnibus (GEO; www.ncbi.nlm.nih.gov/geo/) of the National Center for Biotechnology Information and can be accessed under GEO accession number GSE100656.


Articles from mBio are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES