ABSTRACT
Abnormal expression of long non-coding RNA cancer susceptibility candidate 9 (CASC9) has been found to play vital roles in many human tumors. However, the role and the regulatory mechanism of CASC9 have not yet been demonstrated in retinoblastoma (RB). Hence, we performed this study to explore the function and mechanism of CASC9 in RB. CASC9 expression was firstly detected in human RB tissues and cells. The influence of CASC9 on the malignant phenotypes of RB cells, including cell proliferation, invasion, epithelial–mesenchymal transition (EMT) and apoptosis, was analyzed by overexpressing or silencing CASC9. The association between CASC9, miR-145-5p and E2F transcription factor 3 (E2F3) was determined by dual-luciferase reporter assay and RNA immunoprecipitation. We found that CASC9 expression was elevated in RB tissues and cells. Overexpression of CASC9 significantly facilitated the proliferation, invasion and EMT of RB cells. On the contrary, knockdown of CASC9 inhibited the proliferation, invasion and EMT, while enhanced the apoptosis of RB cells. CASC9 acted as a competing endogenous RNA (ceRNA) for miR-145-5p to regulate E2F3. Additionally, miR-145-5p inhibitor and E2F3 overexpression both partly reversed the malignant phenotypes of RB cells affected by CASC9 knockdown. However, miR-145-5p overexpression further strengthened these features induced by CASC9 downregulation. These findings suggested that CASC9 contributed to RB development by regulating E2F3 via sponging miR-145-5p. CASC9 might be a possible therapeutic target for RB.
KEYWORDS: Long non-coding RNA CASC9, retinoblastoma, miR-145-5p, E2F3
1. Introduction
Retinoblastoma (RB) is an intraocular malignancy usually occurring in children. Approximately 8000 children are diagnosed every year in the world, and 11% of which are less than 1 year of age [1]. Many strategies have been used for the treatment of RB patients, including ophthalmectomy, chemotherapy, cryotherapy and laser therapy, which greatly improved patients’ clinical outcomes; however, the mortality is still as high as 70% in underdeveloped countries and areas largely due to invasion and metastasis [2,3]. Studies have shown that the initiation and progression of RB are associated with gene mutation and expression level change [3–5]. Hence, illustrating the molecular mechanism is responsible for developing timely therapeutic strategies for patients with RB.
Epithelial–mesenchymal transition (EMT) is a process that epithelial cells transdifferentiate into motile mesenchymal cells [6]. EMT is associated with invasive and metastatic phenotypes in multiple cancers, including RB [7,8]. A hallmark of EMT is the downregulation of E-cadherin, which leads to the reinforcement of the destabilization of adheren junctions. E-cadherin downregulation is balanced by the increased expression of mesenchymal neural cadherin (N-cadherin), resulting in a “cadherin switch” that alters cell adhesion. Through this switch process, the transitioning cells lose their association with epithelial cells and acquire an affinity for mesenchymal cells, which facilitate cell migration and invasion [6]. Vimentin filaments regulate the trafficking of organelles and membrane-associated proteins, and the activation of vimentin expression also contributes to EMT [6].
Long non-coding RNAs (lncRNAs) are a set of noncoding RNAs longer than 200 nucleotides in length, with limited ability to encode proteins [9]. Accumulating evidence has demonstrated that lncRNAs are vital cancer-associated biological molecules [10,11]. They can modulate a variety of cellular processes, such as cell proliferation, apoptosis, migration, invasion and differentiation [12,13]. Numerous references emphasize that the functionality of lncRNAs is related to their structure, and structure-mediated interaction with various effectors, including microRNAs (miRNAs) [14,15]. In recent years, studies have found that lncRNAs participate in the development of RB. Specifically, lncRNAs Hox transcript antisense intergenic RNA (HOTAIR), differentiation antagonizing non-protein coding RNA (DANCR), colon cancer-associated transcript 1 (CCAT1), and nuclear-enriched abundant transcript 1 (NEAT1) were up-regulated in RB patients, and they aggravated the development and progression of RB [16–19]. However, some lncRNAs such as MT1JP played a tumor-suppressive role in RB [20].
Cancer susceptibility candidate 9 (CASC9) is a lncRNA that located at 8q21.11. It was firstly recorded in esophageal squamous cell carcinoma, in which CASC9 was upregulated and acted as an oncogene [21]. Subsequently, studies found that CASC9 played important roles in other cancer types, such as ovarian cancer [22], gastric cancer [23], hepatocellular carcinoma [24] and papillary thyroid cancer [25]. However, the biological function and regulatory mechanism of CASC9 in RB remain unclear. Therefore, this study aimed to investigate the role of CASC9 in RB, and its molecular mechanism was further analyzed.
2. Materials and methods
2.1. Clinical specimen collection
A total of 31 RB specimens and eight normal retina tissues were recruited into the study between July 2015 to July 2018 at the First Hospital of Jilin University, the Second Hospital of Jilin University, and China–Japan Union Hospital of Jilin University. Normal retinal tissues were collected from eight patients with ophthalmorrhexis who received enucleation (average age: 7.2 years old). RB tissue samples were obtained from patients who did not receive clinical treatment before admission (average age: 6.5 years old) and these tissues were confirmed via pathological diagnosis. The parents or guardians of all patients provided written informed consent. The present study was approved by the institute research ethics committee of the First Hospital of Jilin University. Upon enucleation, all specimens were quickly frozen in liquid nitrogen and stored at −80°C for further study.
2.2. Cell culture
Two human RB cell lines (Y79 and Weri-Rb1) and human retinal epithelial cells ARPE-19 were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). RB cells were cultured with RPMI 1640 supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and 1% penicillin-streptomycin (Gibco). ARPE-19 cells were maintained in Dulbecco’s Modified Eagle’s medium (DMEM). These cells were grown at 37°C in a humidified atmosphere containing 5% CO2.
2.3. Cell transfection
miR-145-5p mimic, miR-145-5p inhibitor (anti-miR-145-5p) and their negative control were purchased from Invitrogen (Nanjing, China). pcDNA3.1-CASC9 were constructed by cloning full-length CASC9 into the pcDNA3.1 plasmid. Short hairpin RNA (shRNA) against CASC9 was used to downregulate CASC9 expression. Additionally, E2F transcription factor 3 (E2F3) cDNA was amplified from human RB tissues and then inserted into pcDNA3.1 plasmid to construct E2F3 overexpressing vector. These vectors were transfected into RB cells with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA), respectively.
2.4. Cell proliferation assay
The proliferative capability of RB cells was measured by Cell Counting Kit-8 (CCK8) colorimetric assays. Transfected Y79 and Weri-Rb1 cells were digested and reseeded in 96-well plates at 1000 cells/well with 100 μl culture medium. After culturing for 48 h, 10 μl of CCK8 solution (Dojidon, Kumamoto, Japan) was added to each well. Then, the samples were incubated at 37°C for 2 h and their optical density (OD) values were tested at 450 nm with a microplate reader (ELX800, BioTec, Winooski, VT, United States).
2.5. Flow cytometry for apoptosis analysis
The apoptosis of Y79 and Weri-Rb1 cells was measured by Annexin V-FITC/PI Apoptosis Detection Kit (Beyotime, Shanghai, China). Briefly, after transfection with indicated plasmids, the cells were digested with trypsin (without EDTA), washed with cold PBS, re-suspended in 100 μl 1× Binding buffer, and then incubated with 5 μl Annexin V-FITC and 10 μl propidium iodide (PI) for 15 min in the dark at room temperature. Finally, cell apoptosis was analyzed by flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA). The percentage of apoptotic cells in Annexin V+/PI− and Annexin V+/PI+ quadrants was recorded.
2.6. Measurement of cell invasion
The invasive capability of RB cells was detected by Transwell assays. Briefly, the upper chambers of 24-well Transwell Boyden chambers (8.0 μm pore size; Corning, USA) were pre-coated with Matrigel. Then, Y79 and Weri-Rb1 cells with indicated treatments were seeded into the upper chambers with serum-free medium. The lower chamber was filled with 600 μl RPMI 1640 containing 20% FBS. After 24 h incubation at 37°C, cells on the upper surface of the membrane were removed by a cotton swab, and cells on its bottom surface were fixed with 4% polyformaldehyde and then stained with 0.1% crystal violet. Invasive cells were observed and photographed under a light microscope (Nikon, Japan).
2.7. Dual-luciferase reporter assay
The potential interacting site between CASC9 and miR-145-5p was predicted by Starbase software. The amplified sequence of CASC9 containing miR-145-5p binding sequence was cloned into pGL3 luciferase reporter vector to produce CASC9-WT vector. Also, the mutant sequence of CASC9 cloned as the same method was acted as a control (CASC9-MUT). These recombinant plasmids were cotransfected with miR-145-5p mimic or control (NC mimic) into Y79 cells using Lipofectamine 2000, respectively. 48 h later, the activities of luciferase were analyzed using Dual-luciferase assay kit (Promega).
2.8. Real-time quantitative PCR (qRT-PCR)
Total RNA from human tissues and cells were isolated with Trizol reagent (Invitrogen). The reverse transcription was performed using PrimeScriptTM RT-PCR Kit (TaKaRa, Dalian, China) or PrimeScriptTM miRNA RT-PCR Kit (TaKaRa). qRT-PCR was carried out by SYBR® Premix Ex Taq (Takara). The sequences of primers were presented below: CASC9 F: 5ʹ- CAGCCACATTCATGGTGTTGAG-3ʹ, R: 5ʹ-TGCCAGGTGTTGTTCTGCTA-3ʹ; N-cadherin F: 5ʹ- ATGCCCGGTTTCATTTAGGG‐3ʹ, R: 5ʹ-GGCATTGGGATCGTCAGCAT-3ʹ; Vimentin F: 5ʹ- AAACTTAGGGGCGCTCTTGT-3ʹ, R: 5ʹ-GAGGGCTCCTAGCGGTTTAG-3ʹ; E-cadherin F: 5ʹ-TGAAAACAGCAAAGGGCTTGGA-3ʹ, R: 5ʹ-GCAGTGTCTCTCCAAATCCGA-3ʹ; E2F3 F: 5ʹ- CAGCTTCCTGGAGCCATTTTTC-3ʹ, R: 5ʹ-GGCCAAAAATAATCGGGGCT-3ʹ; GAPDH F: 5ʹ-CGGATTTGGTCGTATTGGGC-3ʹ, R: 5ʹ-CCCGTTCTCAGCCATGTAGTT-3ʹ; miR-145-5p F: 5ʹ-ACACTCCAGCTGGGGTCCAGTTTTCCCAGGA-3ʹ, R: 5ʹ-TGGTGTCGTGGAGTCG-3ʹ; U6 F: 5ʹ-CTCGCTTCGGCAGCACA‐3ʹ, R 5ʹ-AACG CTTCACGAATTTGCGT-3ʹ. Using the 2−ΔΔCT method, the expression of gene was presented as fold changes. GAPDH was used as the endogenous gene for CASC9, E2F3, N-cadherin, Vimentin and E-cadherin, and U6 was for miR-145-5p.
2.9. RNA immunoprecipitation (RIP)
The RIP assay using Thermo Fisher RIP kit (Thermo, MA, USA) was carried out to verify the interaction between CASC9, miR-145-5p and E2F3. Briefly, after transfection with CASC9 shRNA for 48 h, Y79 cells were lysed in RIP lysis buffer. Then, cells lysates were incubated with RIP buffer including magnetic beads, which were conjugated with human anti-Ago2 antibody (Millipore, Billerica, MA, USA) or negative control normal mouse IgG. Lastly, immunoprecipitated RNAs were assayed by qRT-PCR.
2.10. Western blot
RB cells were lysed with RIPA lysate buffer containing protease inhibitors and centrifuged at 12,000 g for 10 min at 4°C. Total protein (the supernatant) was collected and quantified with a BCA assay kit (Thermo). Equal amount of protein was performed on 12% SDS-PAGE and then transferred to PVDF membranes. The membranes were blocked with 5% nonfat milk and incubated with E2F3 primary antibody (Abcam, Cambridge, MA, USA), with anti-β-actin as a control. Then, the membranes were probed with HRP-conjugated secondary antibodies. Enhanced chemiluminescence was added to visualize the protein bands.
2.11. Statistical analysis
Each experiment was independently repeated at least three times. Data were presented as the mean ± SD. All statistical analyses were carried out using GraphPad Prism 6.0 and SPSS 19.0 software. The Mann–Whitney U test was used to assay differences of CASC9, miR-145-5p and E2F3 in human RB tissues and normal retinal tissues. The correlation among CASC9, miR-145-5p and E2F3 in RB tissues was analyzed by Spearman’s correlation analysis. Unpaired two-tailed Student’s t-test and one-way ANOVA were performed to detect the significance of data from in vitro. P < 0.05 was considered statistically significant.
3. Results
3.1. CASC9 expression is elevated in retinoblastoma tumors and cells
To investigate the role of CASC9 in RB, we firstly examined the expression of CASC9 in human RB tissues. The results revealed that CASC9 expression was enhanced in RB tissues in comparison with normal retinal tissues (P = 0.000; Figure 1(a)). According to the median value of CASC9, RB patients were divided into CASC9-high group and CASC9-low group. The high expression of CASC9 was positively associated with advanced clinical stages, poor differentiation and optic nerve invasion (P = 0.015, P = 0.029 and P = 0.006, respectively; Table 1), but not related to age, gender, laterality (P = 0.473, P = 0.722 and P = 0.654, respectively; Table 1). Furthermore, we found that CASC9 level was higher in RB cell lines, including Y79 and Weri-Rb1 cells, than in human retinal epithelial ARPE-19 cells (P = 0.000 and P = 0.001, respectively; Figure 1(b)).
Figure 1.

CASC9 levels in human RB tissues and cells. A: CASC9 expression in 31 RB tissues and 8 normal retina tissues was analyzed by qRT-PCR and its expression was elevated in RB tissues (*, P < 0.05). B: The expression of CASC9 was higher in Y79 and Weri-Rb1 RB cells than that in human retinal epithelial ARPE-19 cells (*, P < 0.05).
Table 1.
Correlation between expression of CASC9 and clinicopathological factor in RB patients.
| CASC9 |
||||
|---|---|---|---|---|
| Factors | Number | Low (15) | High (16) | P value |
| Age | 0.473 | |||
| <3 | 18 | 10 | 8 | |
| ≥3 | 13 | 5 | 8 | |
| Gender | 0.722 | |||
| Male | 17 | 9 | 8 | |
| Female | 14 | 6 | 8 | |
| Laterality | 0.654 | |||
| Unilateral | 25 | 13 | 12 | |
| Bilateral | 6 | 2 | 4 | |
| Clinical Stage | 0.015* | |||
| Early stages (A, B) | 8 | 7 | 1 | |
| Advanced stages (C, D, E) | 23 | 8 | 15 | |
| Differentiation | 0.029* | |||
| Well/moderately | 12 | 9 | 3 | |
| Poorly/undifferentiated | 19 | 6 | 13 | |
| Optic nerve invasion | 0.006* | |||
| Negative | 21 | 14 | 7 | |
| Positive | 10 | 1 | 9 | |
*P < 0.05
3.2. CASC9 promotes the proliferation, invasion and EMT, but inhibits the apoptosis of RB cells
The role of CASC9 in RB was investigated in RB cells by overexpressing or silencing CASC9. Compared with the pcDNA3.1 empty plasmid, abundant expression of CASC9 was found in Y79 and Weri-Rb1 cells transfected with pcDNA3.1-CASC9 plasmid (P = 0.013, P = 0.014); whereas CASC9 shRNA notably decreased CASC9 level compared to its control (P = 0.006, P = 0.005; Figure 2(a)). Overexpression of CASC9 promoted the viability and invasion of Y79 and Weri-Rb1 cells (P = 0.000, P = 0.003 for viability; P = 0.001, P = 0.000 for invasion). Contrarily, downregulation of CASC9 suppressed the viability and invasion of these cells (P = 0.012, P = 0.006 for viability; P = 0.005, P = 0.010 for invasion; Figure 2(b,c)). Furthermore, upregulation of CASC9 increased the expression of N-cadherin and Vimentin (P = 0.018, P = 0.009 for N-cadherin; P = 0.03, P = 0.008 for Vimentin), but reduced E-cadherin expression in RB cells (P = 0.007, P = 0.001); whereas CASC9 downregulation exerted adverse effects on levels of N-cadherin, Vimentin and E-cadherin (P = 0.005, P = 0.001 for N-cadherin; P = 0.002, P = 0.003 for Vimentin; P = 0.032, P = 0.043 for E-cadherin; Figure 2(d,e)). Additionally, downregulation of CASC9 promoted the apoptosis of Y79 and Weri-Rb1 cells (P = 0.001, P = 0.002; Figure 2(f)). These data suggested that CASC9 promoted the proliferation, invasion and EMT, whereas suppressed the apoptosis of RB cells.
Figure 2.

CASC9 promotes the proliferation, invasion and EMT, but inhibits the apoptosis of RB cells. A: CASC9 expression was detected in Y79 and Weri-Rb1 cells after transfection with different plasmid. B: The viability of Y79 and Weri-Rb1 cells was enhanced by CASC9 overexpression, but suppressed by knockdown of CASC9. C: Overexpression of CASC9 facilitated the invasion of Y79 and Weri-Rb1 cells, whereas CASC9 downregulation restricted cell invasion. The expression levels of N-cadherin, Vimentin and E-cadherin in Y79 (d) and Weri-Rb1 (e) cells were assayed by qRT-PCR. F: Cell apoptosis was measured by flow cytometry. *P < 0.05 compared to the pcDNA3.1 group, #P < 0.05 compared to the sh-NC group.
3.3. miR-145-5p is negatively regulated by CASC9 in RB
Starbase bioinformatics software analyzed the potential binding miRNAs of CASC9 and results showed that there was a binding sequence between CASC9 and miR-145-5p (Figure 3(a)). Overexpression of miR-145-5p decreased the luciferase activity of CASC9-WT plasmid but not CASC9-MUT plasmid in Y79 cells, which verified a direct binding between CASC9 and miR-145-5p (P = 0.000; P = 0.755; Figure 3(b)). Downregulation of CASC9 notably upregulated miR-145-5p level in Y79 and Weri-Rb1 cells (P = 0.000, P = 0.000; Figure 3(c)). Additionally, miR-145-5p expression in human RB tissues was decreased compared with normal retinal tissues (P = 0.000; Figure 3(d)). And its level was negatively related to CASC9 expression in human RB tissues (P = 0.003; Figure 3(e)).
Figure 3.

The association between CASC9 and miR-145-5p in RB. A: The binding relationship of CASC9 and miR-145-5p as predicted by Starbase software. B: Luciferase reporter assay in Y79 cells, which were co-transfected with CASC9-WT/CASC9-MUT plasmid and miR-145-5p mimic or scrambled control. C: miR-145-5p expression in Y79 and Weri-Rb1 cells was decreased after CASC9 downregulation. D: miR-145-5p expression in 31 RB tissues and 8 normal retina tissues. E: The association between miR-145-5p and CASC9 in 31 human RB tissues. *P < 0.05 compared to the NC mimic group, #P < 0.05 compared to the sh-NC group, &P < 0.05 compared to the Normal group.
3.4. CASC9 functions via modulating miR-145-5p expression in RB cells
In the following, we investigated whether CASC9 functioned via miR-145-5p. Our results revealed that anti-miR-145-5p significantly abrogated the reduction of cell viability (P = 0.011, P = 0.006) and invasion (P = 0.027, P = 0.004), reversed the expression of N-cadherin (P = 0.003, P = 0.001), Vimentin (P = 0.001, P = 0.000) and E-cadherin (P = 0.001, P = 0.016), and decreased apoptosis (P = 0.016, P = 0.027) of Y79 and Weri-Rb1 cells affected by CASC9 shRNA (Figure 4). And overexpression of miR-145-5p further enhanced these influences induced by CASC9 shRNA (P = 0.010, P = 0.022 for viability; P = 0.015, P = 037 for invasion; P = 0.045, P = 0.048 for N-cadherin; P = 0.011, P = 0.012 for Vimentin; P = 0.000, P = 0.002 for E-cadherin; P = 0.004, P = 0.005 for apoptosis; Figure 4). These results indicated that CASC9 functions through negatively modulating miR-145-5p in RB cells.
Figure 4.

CASC9 modulates the malignant phenotypes of RB cells via negatively controlling miR-145-5p. A: The proliferation ability of Y79 and Weri-Rb1 cells was determined by CCK-8 assay after transfection with sh-NC/sh-CASC9 or co-transfection with sh-CASC9 and anti-miR-145-5p/miR-145-5p mimic. B: The invasion of Y79 and Weri-Rb1 cells were examined by Transwell assays. qRT-PCR assay for the expression of N-cadherin, Vimentin and E-cadherin in Y79 (c) and Weri-Rb1 (d) cells. E: Cell apoptosis was tested by flow cytometry. *P < 0.05 compared to the sh-NC group, #P < 0.05 compared to the sh-CASC9 group.
3.5. CASC9 acts as a ceRNA for miR-145-5p to regulate E2F3 expression
Starbase software was used to predict the potential targets for miR-145-5p and the result showed that E2F3 was one of the targets of miR-145-5p. And their direct interaction has been demonstrated in gastric cancer cells [26]. Previous studies have demonstrated that E2F3 was an important transcription factor that promoted the development of various cancers [27,28] and that highly expressed in RB [29]. Our results also confirmed E2F3 expression was upregulated in collected RB tissues in comparation with normal retinal tissues (P = 0.000; Figure 5(a)). Importantly, E2F3 expression was negatively related to miR-145-5p in RB tissues (P = 0.002; Figure 5(b)). Therefore, we analyzed whether E2F3 was a target of miR-145-5p in RB and whether CASC9 could regulate E2F3 expression in RB. Overexpression of miR-145-5p significantly decreased E2F3 level in Y79 cells (P = 0.000; Figure 5(c)). In RB tissues, we also found E2F3 expression was positively associated with CASC9 (P = 0.000; Figure 5(d)). Interestingly, E2F3 expression in RB cells was notably reduced after CASC9 knockdown (P = 0.000, P = 0.000 for mRNA; P = 0.000, P = 0.000 for protein), but was elevated after co-transfected with anti-miR-145-5p (P = 0.001, P = 0.005 for mRNA; P = 0.002, P = 0.001 for protein; Figure 5(e–g)). However, E2F3 expression reduced by CASC9 shRNA was further decreased by miR-145-5p mimic (P = 0.011, P = 0.001 for mRNA; P = 0.001, P = 0.039 for protein; Figure 5(e–g)). Moreover, E2F3 expression levels were increased by CASC9-WT plasmid but not its mutant plasmid (P = 0.007, P = 0.008 for CASC9-WT; P = 0.980, P = 0.991 for CASC9-MUT; Figure 5(h)). In addition, the RIP assay results verified that CASC9 content was decreased in the complex bound to AGO2, whereas the amount of E2F3 bound to AGO2 was elevated, in Y79 cells after CASC9 knockdown (P = 0.000, P = 0.000; Figure 5(i)). Taken together, these results indicated that CASC9 regulated E2F3 expression via sponging miR-145-5p.
Figure 5.

CASC9 regulates E2F3 expression by sponging miR-145-5p. A: E2F3 was overexpressed in human RB tissues. B: The expression correlation between E2F3 and miR-145-5p in RB tissues. C: Y79 cells were transfected with miR-145-5p mimic or its control for 72 h, and E2F3 protein levels were notably decreased by miR-145-5p. D: There was a positive correlation between E2F3 and CASC9 in RB tissues. E: The mRNA levels of E2F3 in Y79 and Weri-Rb1 cells were analyzed by qRT-PCR. F and G: Western blot assay for the protein levels of E2F3. H: Y79 and Weri-Rb1 cells were transfected with CASC9-WT or CASC9-MUT plasmid for 72 h, and E2F3 mRNA levels were measured by qRT-PCR. I: RIP assay was carried out to verify the association between CASC9, miR-145-5p and E2F3 in Y79 cells transfected with CASC9 shRNA. *P < 0.05 compared to the Normal or NC mimic group, #P < 0.05 compared to the sh-NC or NC group, &P < 0.05 compared to the sh-CASC9 group.
3.6. E2F3 upregulation reverses the effect of CASC9 knockdown on the proliferation, invasion and apoptosis of RB cells
To explore whether CASC9 regulated the biological function of RB cells via mediating E2F3, Weri-Rb1 cells were co-transfected with CASC9 shRNA and E2F3 overexpressing plasmids. As shown in Figure 6(a,b), the viability of Weri-Rb1 cells decreased by CASC9 knockdown was partly abrogated by E2F3 overexpression (P = 0.023), which was modulated by transfection with pcDNA3.1-E2F3 plasmid (P = 0.000). Also, the suppressed invasion by CASC9 shRNA was partially ablated by E2F3 upregulation (P = 0.037; Figure 6(c)). Additionally, CASC9 shRNA enhanced cell apoptosis was reversed by upregulation of E2F3 (P = 0.022; Figure 6(d)). These results showed that CASC9 promoted RB tumor cell growth and invasion via positively regulating E2F3.
Figure 6.

CASC9 functions via positively modulating E2F3 in RB. A: Weri-Rb1 cells transfected with pcDNA3.1-E2F3 showed significant elevation of E2F3. B: The viability of Weri-Rb1 cells was detected by performing rescue experiment using pcDNA3.1-E2F3. C: The invasion of Weri-Rb1 cells transfected with different vectors was measured by Transwell assays. D: The elevated apoptosis of Weri-Rb1 cells by CASC9 knockdown was restored by E2F3 overexpressing. E: Schematic diagram of the regulatory mechanism of CASC9 during RB development. *P < 0.05 compared to the pcDNA3.1 group, #P < 0.05 compared to the sh-NC group, &P < 0.05 compared to the sh-CASC9 group.
4. Discussion
Increasing evidence indicated that lncRNAs are associated with the pathogenesis of various types of tumors, including RB [19,30]. In this study, the influences of CASC9 on the proliferation, invasion, EMT and apoptosis were investigated in RB. The data showed that CASC9 could promote the proliferation, invasion and EMT, but suppressed the apoptosis of RB cells. Mechanically, we proved that CASC9 might play a role in RB carcinogenesis by upregulating E2F3 via inhibition of miR-145-5p.
Recently, CASC9 has been found as a master regulator of many cancers. The study has shown that CASC9 was frequently elevated in colorectal cancer. And its higher expression was related to advanced Tumor Node Metastasis (TNM) stage and poor outcomes of patients [31]. CASC9 exhibited an oncogenic activity by activating TGF-β signaling through interacting with CPSF3 [31]. In oral squamous cell carcinoma (OSCC) tissues and cell lines, increased CASC9 expression was found [32,33]. It could suppress the autophagy and apoptosis of OSCC cells via Akt/mTOR pathway [32], and promote cell migration and invasion through modulating miR-423-5p/SOX12 signaling [33]. Similarly, CASC9 level was increased in ovarian cancer cell lines and tumor samples. CASC9 facilitated the malignancy of ovarian cancer via acting as a ceRNA for miR-758-3p to target LIN7A [22]. Our data showed that CASC9 was highly expressed in patients with RB as well as RB cell lines compared to the control. And elevated CASC9 expression was positively related to advanced clinical stages, poor differentiation and optic nerve invasion of RB patients. Further study demonstrated that overexpression of CASC9 increased the proliferation, invasion and EMT of RB cells. Whereas silencing of CASC9 reduced RB cell proliferation, invasion and EMT, but promoted the apoptosis of cells. This indicated that CASC9 was an oncogene in the development of RB.
LncRNAs have been demonstrated to have the capacity to mediate the abundance and/or activity of miRNAs via base-pairing interactions, which are termed as ceRNA [22,34]. miRNAs, small non-coding RNAs with 18–25 nucleotides in length, possess critical regulatory functions in multiple biological processes [35,36]. miR-145-5p has been described to function as a tumor suppressor in multiple cancer types [37]. Sun et al. [38] have shown that miR-145-5p expression was decreased in RB tissues and cells, and its overexpressing inhibited RB cell proliferation, migration and invasion. Consistent with the results by Sun et al. [38], our study confirmed that miR-145-5p was lower in human RB tissues compared to normal retinal tissues. Bioinformatics software predicted that CASC9 has the potential binding sequence with miR-145-5p. And there was a reverse correlation between CASC9 and miR-145-5p in human RB tissues. Hence, we speculated that CASC9 may act as a ceRNA for miR-145-5p. Luciferase activity assay affirmed the direct binding between CASC9 and miR-145-5p. Moreover, in the present study, we proved that CASC9 could negatively regulate miR-145-5p expression in RB cells. More importantly, the results showed that the effects of CASC9 silencing on the proliferation, invasion, EMT and apoptosis were abrogated by miR-145-5p inhibitor, but further strengthened by miR-145-5p overexpression. These results indicated that CASC9 functioned through negatively modulating miR-145-5p in RB cells.
E2F3 is a member of the E2F transcription factor family. It participated in the carcinogenic process of many human cancers, including cell proliferation, apoptosis and metastasis [39,40]. Studies have found that E2F3 was overexpressed in RB tissues and cell lines [29,41], and downregulation of E2F3 significantly inhibited the proliferation and promoted apoptosis of RB cells [41]. Here, we also found that E2F3 expression was upregulated in RB tissues. E2F3 has been demonstrated to be regulated by miRNAs, including miR-145-5p [26,27]. In this study, there was a negative correlation between E2F3 and miR-145-5p in human RB tissues. Meanwhile, overexpression of miR-145-5p notably suppressed E2F3 expression. Therefore, we further verified whether CASC9 functioned by regulating E2F3 through sponging miR-145-5p. There was a positive correlation between the expression of CASC9 and E2F3 in RB tissues. Knockdown of CASC9 remarkably suppressed E2F3 expression, the effect of which was restored by anti-miR-145-5p. While overexpression of miR-145-5p further enhanced the effects of CASC9 shRNA on E2F3 expression. Importantly, an RIP assay confirmed there was a competition between CASC9 and E2F3. Additionally, our data showed that overexpressing E2F3 notably abrogated the impacts of CASC9 silencing on the proliferation, invasion and apoptosis of RB cells. These results confirmed that CASC9 facilitated the malignant phenotypes of RB cells by upregulating E2F3 through sponging miR-145-5p.
In summary, for the first time, our findings demonstrated that CASC9 was upregulated and functioned as an oncogene in RB. CASC9 promoted the proliferation, invasion and EMT, and inhibited apoptosis of RB cells, which possibly by acting as a ceRNA for miR-145-5p to target E2F3 (Figure 6(e)). This study indicated that CASC9 is a novel target of RB treatment.
Disclosure statement
No potential conflict of interest was reported by the authors.
References
- [1].Pascual-Pasto G, Bazan-Peregrino M, Olaciregui NG, et al. Therapeutic targeting of the RB1 pathway in retinoblastoma with the oncolytic adenovirus VCN-01. Sci Transl Med. 2019;11:eaat9321. [DOI] [PubMed] [Google Scholar]
- [2].Balmer A, Zografos L, Munier F.. Diagnosis and current management of retinoblastoma. Oncogene. 2006;25:5341–5349. [DOI] [PubMed] [Google Scholar]
- [3].Dimaras H, Corson TW, Cobrinik D, et al. Retinoblastoma. Nat Rev Dis Primers. 2015;1:15021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [4].Gudiseva HV, Berry JL, Polski A, et al. Next-generation technologies and strategies for the management of retinoblastoma. Genes (Basel). 2019;10:1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [5].Plousiou M, Vannini I.. Non-coding RNAs in retinoblastoma. Front Genet. 2019;10:1155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014;15:178–196. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [7].Cordani M, Strippoli R, Somoza A. Nanomaterials as inhibitors of epithelial mesenchymal transition in cancer treatment. Cancers (Basel). 2019;12:25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Cheng Y, Chang Q, Zheng B, et al. LncRNA XIST promotes the epithelial to mesenchymal transition of retinoblastoma via sponging miR-101. Eur J Pharmacol. 2019;843:210–216. [DOI] [PubMed] [Google Scholar]
- [9].Kopp F, Mendell JT. Functional classification and experimental dissection of long noncoding RNAs. Cell. 2018;172:393–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [10].Wu P, Mo Y, Peng M, et al. Emerging role of tumor-related functional peptides encoded by lncRNA and circRNA. Mol Cancer. 2020;19:22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [11].Wang Y, Fang Z, Hong M, et al. Long-noncoding RNAs (lncRNAs) in drug metabolism and disposition, implications in cancer chemo-resistance. Acta Pharm Sin B. 2020;10:105–112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [12].Wang JY, Yang Y, Ma Y, et al. Potential regulatory role of lncRNA-miRNA-mRNA axis in osteosarcoma. Biomed Pharmacothe. 2020;121:109627. [DOI] [PubMed] [Google Scholar]
- [13].Denaro N, Merlano MC, Lo Nigro C. Long noncoding RNAs as regulators of cancer immunity. Mol Oncol. 2019;13:61–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [14].Somarowthu S, Legiewicz M, Chillon I, et al. HOTAIR forms an intricate and modular secondary structure. Mol Cell. 2015;58:353–361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [15].McCown PJ, Wang MC, Jaeger L, et al. Secondary structural model of human MALAT1 reveals multiple structure-function relationships. Int J Mol Sci. 2019;20:5610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Yang G, Fu Y, Lu X, et al. LncRNA HOTAIR/miR-613/c-met axis modulated epithelial-mesenchymal transition of retinoblastoma cells. J Cell Mol Med. 2018;22:5083–5096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [17].Wang JX, Yang Y, Li K. Long noncoding RNA DANCR aggravates retinoblastoma through miR-34c and miR-613 by targeting MMP-9. J Cell Physiol. 2018;233:6986–6995. [DOI] [PubMed] [Google Scholar]
- [18].Zhang H, Zhong J, Bian Z, et al. Long non-coding RNA CCAT1 promotes human retinoblastoma SO-RB50 and Y79 cells through negative regulation of miR-218-5p. Biomed Pharmacothe. 2017;87:683–691. [DOI] [PubMed] [Google Scholar]
- [19].Zhong W, Yang J, Li M, et al. Long noncoding RNA NEAT1 promotes the growth of human retinoblastoma cells via regulation of miR-204/CXCR4 axis. J Cell Physiol. 2019;234:11567–11576. [DOI] [PubMed] [Google Scholar]
- [20].Bi LL, Han F, Zhang XM, et al. LncRNA MT1JP acts as a tumor inhibitor via reciprocally regulating Wnt/beta-Catenin pathway in retinoblastoma. Eur Rev Med Pharmacol Sci. 2018;22:4204–4214. [DOI] [PubMed] [Google Scholar]
- [21].Pan Z, Mao W, Bao Y, et al. The long noncoding RNA CASC9 regulates migration and invasion in esophageal cancer. Cancer Med. 2016;5:2442–2447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [22].Hu X, Li Y, Kong D, et al. Long noncoding RNA CASC9 promotes LIN7A expression via miR-758-3p to facilitate the malignancy of ovarian cancer. J Cell Physiol. 2019;234:10800–10808. [DOI] [PubMed] [Google Scholar]
- [23].Fang J, Chen W, Meng XL. LncRNA CASC9 suppressed the apoptosis of gastric cancer cells through regulating BMI1. Pathol Oncol Res. 2019;26:475–482. [DOI] [PubMed] [Google Scholar]
- [24].Noh JH, Gorospe M. AKTions by cytoplasmic lncRNA CASC9 promote hepatocellular carcinoma survival. Hepatology. 2018;68:1675–1677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [25].Chen Y, Li Y, Gao H. Long noncoding RNA CASC9 promotes the proliferation and metastasis of papillary thyroid cancer via sponging miR-488-3p. Cancer Med. 2020;9:1830–1841. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- [26].Hu CE, Du PZ, Zhang HD, et al. Long noncoding RNA CRNDE promotes proliferation of gastric cancer cells by targeting miR-145. Cell Physiol Biochem. 2017;42:13–21. [DOI] [PubMed] [Google Scholar]
- [27].Zehavi L, Schayek H, Jacob-Hirsch J, et al. MiR-377 targets E2F3 and alters the NF-kB signaling pathway through MAP3K7 in malignant melanoma. Mol Cancer. 2015;14:68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [28].Bilke S, Schwentner R, Yang F, et al. Oncogenic ETS fusions deregulate E2F3 target genes in Ewing sarcoma and prostate cancer. Genome Res. 2013;23:1797–1809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [29].Madhavan J, Mitra M, Mallikarjuna K, et al. KIF14 and E2F3 mRNA expression in human retinoblastoma and its phenotype association. Mol Vis. 2009;15:235–240. [PMC free article] [PubMed] [Google Scholar]
- [30].Chi Y, Wang D, Wang J, et al. Long non-coding RNA in the pathogenesis of cancers. Cells. 2019;8:1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [31].Luo K, Geng J, Zhang Q, et al. LncRNA CASC9 interacts with CPSF3 to regulate TGF-beta signaling in colorectal cancer. J Exp Clin Cancer Res. 2019;38:249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32].Yang Y, Chen D, Liu H, et al. Increased expression of lncRNA CASC9 promotes tumor progression by suppressing autophagy-mediated cell apoptosis via the AKT/mTOR pathway in oral squamous cell carcinoma. Cell Death Dis. 2019;10:41. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [33].Chen X, Xu H, Sun G, et al. LncRNA CASC9 affects cell proliferation, migration, and invasion of tongue squamous cell carcinoma via regulating miR-423-5p/SOX12 axes. Cancer Manag Res. 2020;12:277–287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34].Klec C, Prinz F, Pichler M. Involvement of the long noncoding RNA NEAT1 in carcinogenesis. Mol Oncol. 2019;13:46–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [35].van den Berg MMJ, Krauskopf J, Ramaekers JG, et al. Circulating microRNAs as potential biomarkers for psychiatric and neurodegenerative disorders. Prog Neurobiol. 2020;185:101732. [DOI] [PubMed] [Google Scholar]
- [36].Lai X, Eberhardt M, Schmitz U, et al. Systems biology-based investigation of cooperating microRNAs as monotherapy or adjuvant therapy in cancer. Nucleic Acids Res. 2019;47:7753–7766. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [37].Hsu WC, Li WM, Lee YC, et al. MicroRNA-145 suppresses cell migration and invasion in upper tract urothelial carcinoma by targeting ARF6. Faseb J. 2020;34:5975–5992. [DOI] [PubMed] [Google Scholar]
- [38].Sun Z, Zhang A, Jiang T, et al. MiR-145 suppressed human retinoblastoma cell proliferation and invasion by targeting ADAM19. Int J Clin Exp Pathol. 2015;8:14521–14527. [PMC free article] [PubMed] [Google Scholar]
- [39].Wang L, Wang L, Zhang X. Knockdown of lncRNA HOXA-AS2 inhibits viability, migration and invasion of osteosarcoma cells by miR-124-3p/E2F3. Onco Targets Ther. 2019;12:10851–10861. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [40].Ye J, Zhang W, Liu S, et al. miR-363 inhibits the growth, migration and invasion of hepatocellular carcinoma cells by regulating E2F3. Oncol Rep. 2017;38:3677–3684. [DOI] [PubMed] [Google Scholar]
- [41].Zhao W, Wang S, Qin T, et al. Circular RNA (circ-0075804) promotes the proliferation of retinoblastoma via combining heterogeneous nuclear ribonucleoprotein K (HNRNPK) to improve the stability of E2F transcription factor 3 E2F3. J Cell Biochem. 2020;121:3516–3525. [DOI] [PubMed] [Google Scholar]
