Prospects for potato genome editing to engineer resistance against viruses and cold-induced sweetening

ABSTRACT

Crop improvement through transgenic technologies is commonly tagged with GMO (genetically-modified-organisms) where the presence of transgene becomes a big question for the society and the legislation authorities. However, new plant breeding techniques like CRISPR/Cas9 system [clustered regularly interspaced palindromic repeats (CRISPR)-associated 9] can overcome these limitations through transgene-free products. Potato (Solanum tuberosum L.) being a major food crop has the potential to feed the rising world population. Unfortunately, the cultivated potato suffers considerable production losses due to several pre- and post-harvest stresses such as plant viruses (majorly RNA viruses) and cold-induced sweetening (CIS; the conversion of sucrose to glucose and fructose inside cell vacuole). A number of strategies, ranging from crop breeding to genetic engineering, have been employed so far in potato for trait improvement. Recently, new breeding techniques have been utilized to knock-out potato genes/factors like eukaryotic translation initiation factors [elF4E and isoform elF(iso)4E)], that interact with viruses to assist viral infection, and vacuolar invertase, a core enzyme in CIS. In this context, CRISPR technology is predicted to reduce the cost of potato production and is likely to pass through the regulatory process being marker and transgene-free. The current review summarizes the potential application of the CRISPR/Cas9 system for traits improvement in potato. Moreover, the prospects for engineering resistance against potato fungal pathogens and current limitations/challenges are discussed.

1. INTRODUCTION

Potato (Solanum tuberosum L.), being an important tuberous crop, has the potential to mitigate the world’s food security challenges. It is widely cultivated as a staple food crop providing balanced nutrition to large communities especially in developing countries. Several scientific efforts have been made to introduce desirable traits in potato such as protein-enhancement¹, bacterial and fungal resistance², viral resistance³, insect/pest resistance⁴, and improved processing traits.^5,6 These studies clearly reflect the significance of ongoing research in potato improvement. However, the public concerns with end products (especially food crops) having genetically modified (GM) label still prevail and seemed to be dominant.⁷

Modern genome editing techniques like CRISPR/Cas9 [(clustered regularly interspaced short palindromic repeats/CRISPR associated 9 (Cas9)], TALENs (transcription activator-like effector nucleases) and ZFNs (zinc-finger nucleases) offer platforms for precise transgene-free genome editing. Comparable to the other two techniques (TALENs, and ZFNs)⁸, CRISPR/Cas system is multiplexed and have been more efficiently employed for crops improvement.^9–11 CRISPR/Cas9 is a type-ΙΙ adaptive immune system, identified earlier in the Streptococcus pyogenes, which provides defense against invading viruses in prokaryotes.¹² In principle, it introduces the site-specific double-stranded breaks (DSBs) in the DNA genome which subsequently induces a cellular DNA repair mechanism through non-homologous end joining breaks (NHEJ) and/or homology-directed repair (HDR). This repairment of genome ends up in the chances of nucleotide insertion or deletion at a specified gene locus. In simplified form, a CRISPR locus transcribes a short CRISPR RNA (crRNA) which hybridizes to a complementary sequence on the targeted genome (protospacer) adjunct to the protospacer-associated motif site (PAM; in case of S. pyrogenes, a trinucleotide sequence essential for Cas9 to selectively recognize and bind to targeted viral DNA).¹³ Next, a trans-activating RNA (tracrRNA) binds with crRNA to process mature guide RNA (gRNA) and pairs up with endonuclease Cas9 and RNaseIII to form a Cas9 complex. Once the gRNA binds with the complementary target site, it guides the Cas9 nuclease to generate a DSB at three nucleotides upstream of PAM site on target nucleic acid.^14,15 CRISPR/Cas9 has potential to induce precise, site-specific genome editing through delivering synthetically designed single guiding (sg) RNAs to guide Cas9 mediated cleavage at targeted sites.¹⁶

Only some of the edited plants do not have any exogenous genetic element. Genome editing to knock-out host genes may remove the transgenic tags by the GMO legislation, as they do not contain exogenous genetic elements and probably could pass the regulatory concerns more steadily.¹⁷ The “transgene-free approaches” have offered a new prospect to publicly acceptable GM food crops. The potential applications of some techniques such as protoplast delivery of preassembled CRISPR/Cas9 ribonucleoproteins (RNPs), transient expression of programmable nucleases, and the site-specific integration of segregable CRISPR array on some other chromosomal location have developed a roadmap for transgene-free plants.¹⁸ The new frontiers of CRISPR studies have focused the crops improvement through metabolic engineering, gene expression/regulation and/or transcriptional regulation of host genes. Scientists are still in search of a more efficient, robust and flexible system to reach the targets with available resources. In this context, several new CRISPR systems such as Cpf1¹⁹, dCas9²⁰, Cas13a²¹, Cas13b²², fCas9²³, etc. have been engineered for the genome editing. The current review highlights the potential application of CRISPR/Cas9 for traits improvement in transgene-fee in order to increase its production capability.

2. MAJOR CONSTRAINTS IN POTATO PRODUCTION

The sustainable potato production faces several challenges due to pre-harvest biotic (viruses, bacteria, fungal, insects/pests) and abiotic stresses (drought, salinity, temperature, frost) and post-harvest problems (accumulation of reducing sugars during cold storage, moisture-loss, and tuber deterioration due to various diseases) (Fig. 1). However, in the current review, we have focused on the viral pathogens and cold-induced sweetening in potato.

FIGURE 1.

A diagrammatic representation of various biotic and abiotic factors affecting potato production. Several biotic factors such as viruses, bacteria, fungi, nematodes etc. influence potato growth by causing various leaf/tuber diseases. Several abiotic factors such as temperature, humidity, frost, soil texture, and moisture, etc. also affect potato crop. Cold-induced sweetening is another major problem affecting tuber processing quality and is associated with cold-storage of potato tubers.

Cultivated potato is susceptible to around 40 different viral and 2 viroid species.²⁴ The estimated yield losses in potato due to viruses range from 10–80% for Potato virus Y (PVY)²⁵; 15–30% for Potato virus X (PVX), 10–20% for Potato virus S (PVS)³; and a global loss of 8% due to different viruses²⁶ have been reported. The viral diseases cause more problems in vegetatively propagated crops, including potato, because of the chances of viral transmission increase through vertical transfer in tubers from generation to generation. Several field screening surveys have investigated the prevalence of multiple viruses affecting potatoes worldwide.^27–29 Among dominating viruses, Potato virus Y (PVY, genus; potyvirus) is probably the most diverse virus infecting potato worldwide and is considered to be the most damaging virus in terms of economic losses.^30,31 In addition, several strains of PVY are characterized so far especially from Europe and North America.³¹ This broad epidemiology of PVY increases the risk of PVY infections on the globally cultivated potato.

Potato tubers are usually subjected to cold storage (4–8ºC) after harvest to reduce sprouting, decaying, water deficit and for extending the shelf life. However, this cold storage causes accumulation of reducing sugars (primarily, glucose and fructose) in potato tubers, a biological pathway termed as cold-induced sweetening (CIS).⁵ During cold storage, tuber carbohydrates (starch) breakdown to sucrose through various hydrolytic enzymes and results in a systemic increase of sucrose concentrations.³² This increased sucrose is transported inside vacuole, where it is further hydrolyzed into reducing sugars (glucose and fructose). Scientists have investigated various pathways involved in CIS mechanism and conclude that the hydrolytic conversion of sucrose to fructose and glucose inside vacuole is predominantly controlled by the vacuolar acid invertase gene (VInv).^5,32,33 High-temperature processing of CIS affected tubers results in acrylamide (potential neurotoxin/carcinogenic) formation due to a reaction with tuber reducing sugars and free α-radicals present in cooking oils.³⁴ The CIS of potato is a big problem for the processing industry due to the higher acrylamide contents in the Chips/French fries from CIS affected tubers and results in failure of food quality and safety to the consumers.^35,36

3. STRATEGIES EMPLOYED SO FAR FOR POTATO TRAIT IMPROVEMENT

Virus resistance in potato has been engineered through several routes ranging from simple plant breeding to advanced genetic engineering (Table 1). Among different antiviral approaches utilized so far, pathogen-derived resistance (PDR) has resulted in successful viral resistance in potato crop.^38,40 The concept of PDR involves exogenous delivery of viral sequences in transgenic potatoes to modulate a pre-programmed nucleotide complementarity based resistance even before virus acquisition.⁵⁰ In this context, the coat protein (CP) gene of viruses is regarded as a highly efficient target for inducing virus resistance.⁵⁰ RNAi-mediated resistance targeting the viral CP region has been demonstrated in potato, where single or multiple RNA viruses have been targeted with different success levels; such as Potato virus X (PVX), PVY and Potato virus S (PVS) resistance in potato cultivar (cv.) Desiree³; PVY resistance in potato³⁸; PVY and Potato leafroll virus (PLRV) resistance in potato cv. Vales Sovereign⁴⁰; and potato cv. Cardinal.³⁹ The current scenario of GM potatoes being commercialized in some countries includes viral resistant potatoes generated through genetic engineering.^51,52

TABLE 1.

Use of resistant strategies to develop virus resistant transgenic potatoes.

Virus	Genus	Genome	Region targeted	Mechanism used	Results	Reference
Pathogen-Derived Resistance (PDR)
Potato virus Y	Potyvirus	+ssRNA	CP	Chimeric CP	Resistance	37
			CP	RNA silencing	Resistance	38
			HCpro	Hp-RNAi	Reduced virus titer	39
			CP	Hp-RNAi	High resistance	40
			CP	Hp-RNAi	High resistance	3
Potato virus X	Potexvirus	+ssRNA	CP	Chimeric CP	Resistance	41
			CP	Chimeric CP	Reduced virus accumulation	37
			CP	S-PTGS	High resistance	42
			ORF2	Hp-RNAi	High resistance	39
			CP	Hp-RNAi	High resistance	3
Potato virus A	Potyvirus	+ssRNA	cylindrical inclusion body	Hp-RNAi	High Resistance	40
Potato leafroll virus	Polerovirus	+ssRNA	CP	S-PTGS	Recovery	43
			CP	Hp-RNAi	Less disease incidence	39
			Rep	Hp-RNAi	High resistance	40
Potato virus S	Carlavirus	+ssRNA	CP	Chimeric CP	Resistance	44
			CP	Hp-RNAi	High resistance	45
			CP	Hp-RNAi	High resistance	3
Tobacco rattle virus	Tobravirus	+ssRNA	57kda-Rep	S-PTGS	Fewer infection symptoms	46
Host-gene mediated
Potato virus Y	Potyvirus	+ssRNA	Y-1 Gene	Gene expression	Systemic cell death	47
			eIF4E-1 allele	Gene expression	Resistance	48
			Nz Gene	Breeding crosses	Resistance	49

+ ss: Positive single-stranded; CP: Coat protein; Hp-RNAi: Hairpin RNA interference; Rep: Replicase gene; S-PTGS: sense post-transcriptional gene silencing

Resistance against CIS in potato is another prime focus of researchers in recent years. Several studies have tried to find the solutions to limit acrylamide contents by indirectly interfering with the CIS phenomenon at molecular levels.^5,6,53–55 The methodologies used so far for controlling the CIS problems in potato are summarized in Table 2. Decreasing the expression of endogenous potato VInv has effectively reduced the glucose and fructose accumulations in various potato cultivars during cold storage and demonstrated a promising approach to control the CIS.^5,58,60 Recently, a multinational company, JR Simplot has introduced “innate potato” using RNAi technology⁵¹, which have resistance against acrylamide formation and got approved by the U.S. Food and Drug Administration (FDA). The efforts to reduce the potential risks of dietary toxins such as acrylamide in the processed potato have resulted in improved food quality and safety concerns.^34,36

TABLE 2.

Use of molecular techniques to reduce cold-induced sweetening in transgenic potatoes.

Potato cultivar	Gene-targeted	Methodology used	Results	Reference
*	Tobacco invertase inhibitor homolog	Gene expression	Prevented CIS	56
Kathadin	VInv	Hp-RNAi	Reduced CIS	5
Ranger Russet	VInv	Sense and antisense Gene expression	Reduced CIS	53
Dakota Pearl, Atlantic, MegaChip, Snowden	VInv	Hp-RNAi	Reduced CIS	57
E-potato 3 (E3)	VInv	Hp-RNAi	Decreased CIS	54
Karaka	Vacuolar invertase inhibitor	Hp-RNAi	Reduced CIS	58
Katahdin	VInv	Hp-RNAi	Reduced CIS	59
Russet Burbank	VInv and the asparagine synthetase genes	Hp-RNAi	Reduced CIS	60
Ranger Russet	VInv	TALENs	CIS resistant	55
Désirée	VInv	Hp-RNAi	CIS resistant	6

*: unknown; VInv: Potato vacuolar invertase gene

4. CRISPR/CAS9 TO ENGINEER POTATO HOST GENES: A BIOLOGICAL TOOL FOR TRAIT IMPROVEMENT

After infecting plant cells, viruses interact and take over the functions of the host translation initiation like factors, eIF4E and its paralogue eIF(iso)4E (elF complex), to facilitate the translation of viral RNAs and develops the successful viral infection.⁶¹ These host translation factors have been reported as a facilitator of viral replication and systemic movements to the adjacent plant cells. The viral RNAs or proteins interact with these eukaryotic translation factors to operate a non-canonical viral translation, a detriment to host endogenous cellular machinery.⁶² PVY is filamentous, rod-shaped virion, containing ~9.7Kb single-stranded (ss) positive sense RNA (+ssRNA) genome, coated by viral capsid protein (CP).³¹ After entering plant cells, PVY translates its genomic RNA into a single large polyprotein, which is subsequently cleaved into 10 more functional subunits (proteins) through autocatalysis performed by potyviral endonucleases.⁶³ The potyviral ‘VPg’ (viral protein genome-linked) protein develops a direct interaction between viral 5′ untranslated region (UTR) and the host translation factors (elF complex) to assist the viral translation. This exclusive binding of the potyviral VPg was first demonstrated through yeast two-hybrid screening system between Turnip mosaic virus (TMV)-VPg and Arabidopsis eIF(iso)4E, an interaction that leads to viral infection.⁶⁴ A number of studies elucidated the idea of host translation repression to trigger an antiviral response through disruptions in viral-host interactions.^61,65,66

Genome editing using CRISPR/Cas9 system has extended the possibilities to engineer virus resistance in plants by targeting the host genes that are directly involved in host-viral interactions.^62,67 The CRISPR/Cas9 system was employed to generate resistance against a potyvirus; Turnip mosaic virus (TuMV) in Arabidopsis thaliana through genomic deletion of eIF(iso)4E.⁶² A similar approach was used to engineer virus resistance in transgene-free GM cucumber (Cucumis sativus L.) by disrupting the host eIF4E to abort the virus-host interactions. These transgene-free plants developed a simultaneous resistance against an ipomovirus (Cucumber vein yellowing virus) and two potyviruses (Zucchini yellow mosaic virus and Papaya ringspot mosaic virus-W).⁶⁸ TALEN technology has been used to silence the VInv in potato to minimize the accumulation of reducing sugars during cold-storage.⁵⁵ These studies clearly indicate the efficacy of genome editing for improving traits like virus resistance and cold-storage in potato.

5. A GENERALIZED CRISPR/CAS9 MODEL TO ENGINEER TRANSGENE-FREE POTATO RESISTANT TO VIRUSES AND COLD-INDUCED SWEETENING

The cultivated potato has an autotetraploid genome (2n = 4x = 48), making it difficult for traits-improvement using conventional breeding techniques, due to a high level of heterozygosity.⁶⁹ In vegetatively propagated crops where the chances of removing transgenes in subsequent generations through segregations are limited, protoplast delivery of functional components of CRISPR array as preassembled Cas9-gRNA RNPs could be a substitute to generate transgene-free plants.¹⁷ Following up a simple and efficient CRISPR/Cas9 method, simultaneous editing in the host translation initiation factors and the VInv gene in potato is described in the sections below and is schematically represented in Fig. 2.

FIGURE 2.

A schematic layout of CRISPR/Cas9 system for potato genome engineering. At the first step, a computational approach is utilized to sought out the potential sgRNA targeting sites in potato genome. Then, a multiplex joint cassette harboring multiple sgRNAs and Cas9 could be designed and would be cloned into a suitable plants transformation binary vector, LB and RB represent the left and right borders of the binary vector. The binary vector would be stably transformed into potato plants using different plant transformation methods. The control plants would be transformed with an empty binary vector to ensure no CRISPR/Cas9 mediated resistance and also a subset of non-transformed plants. The putative transformants could be generated on a suitable selection media in tissue culture experiments. The regenerated plants could be screened for targeted mutations by using various methods such as next-generation sequencing, restriction digest analysis for site loss, reporter genes, qPCR for targeted gene expression/down regulation etc. The confirmed mutant lines could be further utilized for downstream analysis and conclusions.

5.1. Data Retrieval and Target Selection

The major limiting factors in the target selection are the possible risks of off-site targeting (discussed in detail in the section, “Off-site targeting assessments”), loss of transgene expression due to integrations in the untranslated genomic region (introns), and presence of natural polymorphism. Fortunately, various bioinformatic tools have been developed to overcome these limitations which can computationally predict efficient sgRNA targeting sites avoiding any offsite targeting. The target selection strategy follows three basic steps: i) genomic data retrieval (host genome) and selection of target region (genomic sites for sgRNA targeting); ii) sgRNA selection/designing [various sgRNA designing tools are online available (Table 3), or manually by following sgRNA selection attributes⁷⁹)]; iii) the validation of sgRNA for target specificity and off-site targeting.⁸⁰ These selection attributes have been experimentally categorized to design efficient sgRNAs that guide Cas9 for precise targeting.^71,79

TABLE 3.

List of some web-based tools to design CRISPR/Cas systems.

Tool	Features	Web address	Reference
CRISPR Design	sgRNA designing, prediction of off-site targeting against a limited number of reference genomes including Arabidopsis thaliana,	http://crispr.mit.edu	70
Cas-OFFinder	Multi-featured, prediction of potential off-site targeting against many reference genomes, sgRNA designing, PAM type option for different CRISPR/Cas variants	http://www.rgenome.net/cas-offinder/	71
CCTop	sgRNA target selection, off-target prediction	http://crispr.cos.uni-heidelberg.de/	72
CHOPCHOP	Multi-featured, Target sites for CRISPR/TALENs systems, Off-site targeting against many reference genomes	http://chopchop.cbu.uib.no	73
E-CRISP	Multi-featured, Designing of CRISPR constructs, Prediction of off-site targeting against a limited number of genomes	http://www.e-crisp.org/E-CRISP/reannotate_crispr.html	74
CROP-IT	CRISPR/Cas9 target sites in the input sequence, prediction of off-site targeting	http://www.adlilab.org/CROP-IT/homepage.html	75
CRISPR-P	sgRNA designing in plants, prediction of off-site targeting	http://cbi.hzau.edu.cn/crispr/	76
CRISPRseek	Target-specific sgRNA design tool, Prediction of off-site targeting	http://bioconductor.org/packages/release/bioc/html/CRISPRseek.html	77
CRISPR-PLANT	CRISPR/Cas9-sgRNAs designing tool limited to plants	http://genome.arizona.edu/crispr/	78
SYNTHEGO-tool	Multi-featured, Design and validate CRISPR sgRNAs, Prediction of off-site targeting	https://design.synthego.com/#/

5.1.1. Proposed sgRNA Designed

For achieving robust knockdown/-out modifications at targeted loci in potato genome, we propose a sgRNA designing methodology for efficient functional sgRNAs.⁷⁹ For this purpose, we have retrieved the full-length nucleotide sequences of elF4E (Gene ID: 102580433), eIF(iso)4E (Gene ID: 102602624) and VInv (Gene ID: 102577489) in S. tuberosum subsp. tuberosum genome from NCBI database. For designing putative sgRNAs, nucleotide sequences were selected from 1^st exon of respective genes; (VInv, elF4E, and eIF(iso)4E) (Fig. 3). More specifically, we propose to select the N-terminal coding region of the 1^st exon of each gene as it was meant to facilitate more chances of mutagenesis in protein expression by causing frame shifts, deletion or insertions leading to disruption of the gene.⁶² In addition, we queried the proposed sgRNAs for possible off-site targeting using S. tuberosum (PGSC v4.03) genome as a reference in the online Cas-OFFinder tool (http://www.rgenome.net/).⁷¹ On the basis of generated results, we selected those sgRNAs which show single target specificity in the reference genome, having no off-site targeting. In addition, we used the off-targeting filter option from 0 to 4 base mismatch and selected sgRNAs which contain no less than two base pair mismatches to their seed region (12 consecutive nucleotides upstream of the PAM) (Additional file 1).

FIGURE 3.

Schematic diagram of the potato (Solanum tuberosum L.) genome targeted for editing by CRISPR/Cas9 technology. The selected genes for sgRNA targeting include potato (A) vacuolar invertase gene (VInv), (B) eukaryotic translation initiation factors (elF4E) and (C) eukaryotic translation initiation factors isoform 4E [eIF(iso)4E]. The rectangles entitled (I, II, III, IV, etc.) represent the gene exon loci within complete nucleotide gene sequence of each respective gene. The rectangles drawn by the red broken line shows the selected sgRNA sequence within nucleotide gene sequence. Each target site (target 1, 2) shown by a red colored arrow represents the sgRNA with respective orientation (5ʹ to 3ʹ). The position of the putative sgRNAs relative to the position in gene sequence is indicated in the black colored text. The targeting gene strand (plus for sense; minus for antisense) is mentioned below of each sgRNA. The protospacer adjacent motif (PAM) sequence of each sgRNA is indicated in the blue colored arrow. Each sgRNA is represented having multiple restriction sites meant for testing possible mutations in genome edited plants using restriction site loss assay at a later stage.

ADDITIONAL FILE 1.

Thermodynamic attributes of putatively designed sgRNAs.

Sr. #	sgRNA sequence	Targeted ORF in gene sequence	Nucleotide position in gene	Targeting Strand	No. of off-target hits	S-Score
Vacuolar invertase gene (VInv) Gene ID: 102577489 targeting sgRNA
1	GGGTCTAAGATTGGTAAAACGGG	ORF12	2278–2298	Plus	2	80
2	GACTGAAAAAACAAACGGGTTGG	ORF12	2415–2435	Plus	1	100
3	GATAACCCGGAATTGGATTGTGG	ORF12	2554–2574	Plus	3	60
4	GAGAGGATCAGATAAGTTGGTGG	ORF12	1804–1824	Minus	2	80
5	GAGGATCAGATAAGTTGGTGGGG	ORF12	1806–1826	Minus	3	60
Translation initiation factor (elF4E) targeting sgRNA
1	GAGCTGGATGGAAATATCTTCGG	ORF3	2406–2429	Minus	2	80
2	GCTCCCATAACCAACTTGCTTGG		2454–2474	Minus	3	60
3	GTCCCTCCATTGGCACATACAGG		2486–2506	Minus	3	60
4	GATATTCCACATCATGGATTAGG		1852–1872	Plus	3	60
Translation initiation factor [elf(iso)4E]
	GTCAGAAGATATATGTGGAG	ORF11		Plus	1	100
	GAGTGGTTGCTAGTGTGCGT	ORF11		Plus	2	80
	GGTGGCAGTCTTGGTCCACA	ORF11		Minus	2	80
	GATGAGTCAGAAGATATATG	ORF11		Plus	2	80
	GTCAGGATAAACTTTCCTTG	ORF11		Plus	2	80

5.2. Suitable CRISPR/Cas9 Delivery System to Generate Transgene-free Plants

The selection of suitable CRISPR/Cas9 delivery system for executing efficient site-specific genome editing is another important factor. The indigenous expression of designed sgRNA and bacterial Cas9 protein inside the host cells requires a suitable promoter (s).⁸¹ Several plant promoters (U6p, U3P, Cauliflower mosaic virus (CaMV) 35S, Ubiquitin promoter, etc.) have been employed for sgRNA/Cas9 expression in plant cells.⁸¹ Next step involves the synthesis of the single binary cassette to incorporate the sgRNAs/Cas9 and, if required, a FLAG or HA tag and a nuclear localization signal (NLS) followed by NOS terminator. For cassette assembly, different gene cloning strategies have been used such as Gateway cloning⁸², array assembly⁸³, or use of chimeric constructs.⁸⁴ Gateway cloning and Golden Gate assembly are easy strategies for the development of Cas9 binary cassette as it contains sgRNA cloning sites as well.

For delivering the putatively designed CRISPR/Cas9 binary cassette, here we propose two methodologies for plant transformation based on transgene delivery, integration, and the time-span to generate the transgene-free potato plants.

5.2.1. Stable Transformation of CRISPR/Cas9 Cassette and Subsequent Segregation

Different plant transformation methodologies such as Agrobacterium-mediated stable transformation, protoplast delivery, biolistic gene-gun delivery⁸¹, or some customized transformation vectors⁸⁵ have been employed based on having different characteristics. Potato is routinely a vegetatively propagated crop and it is difficult, laborious and time-consuming to reproduce it sexually. During the stable transformation of CRISPR constructs, the subsequent segregation of CRISPR reagents (delivery/vector components) is required to generate the transgene-free plants. Due to a higher rate of heterozygosity, complex genome, and limited sexual reproduction, it is difficult to segregate the CRISPR reagents from the gnome edited potato plants. However, if it to utilize the stable transformation, the segregation of CRISPR reagents could be approached through self-pollination for consecutive generations to obtain the transgene-free potatoes following methods as comprehensively described earlier.^62,68,86

5.2.2. Protoplast Transformation of Preassembled CRISPR/Cas9 RNPs

To overcome the bottlenecks of stable transformation, protoplast delivery of preassembled CRISPR/Cas9 RNPs could be approached for generating the transgene-free plants.¹⁷ The reason for using CRISPR/Cas9 RNPs relies on the fact that upon transfection they react immediately to induce mutations at the targeted site and are degraded shortly through host endonucleases.⁸⁷ This reduces their chances of stable integrations in the host genome or passage to the next generations. In potato, the protoplast isolation has been reported earlier.⁵⁵ The proposed sgRNAs could be amplified through in vitro transcription reaction or could be commercially synthesized along with recombinant Cas9 protein.⁸⁸ The synthesized sgRNA-Cas9 could be tested in vitro for targeted cleavage assay using the method as described earlier.⁸⁷ In order to efficiently transfer these CRISPR/Cas9 RNPs into potato protoplast, transformation method could be optimized following protocols as described earlier.^17,88

5.3. Screening of Transformants for Targeted Mutations

Screening of transformants carrying the desired mutation is of prime importance as it extends to the subsequent analysis and results. The use of various reporter genes (GFP, GUS, RFP, etc.) as biological markers in genome editing has facilitated the transformant screening process. These markers could be employed to detect a simple frameshift mutation in their expression through CRISPR/Cas9 driven deletion/addition in GMO.^89,90 However, the expression of reporter genes in a transgene-free approach is impracticable due to their exogenous nature being questionable to the regulatory/public authorities. Alternatively, the sgRNA targeted region could be designed containing specific restriction sites which could be latterly confirmed through restriction site loss assay for the targeted mutation.^81,91 The putative transformants (T₀ generation) could be tested through deep sequencing of targeted sites^17,88, High Resolution Melting⁸⁵, or through T7 endonuclease assay.⁶²

5.4. Resistance Analysis of Viral Infections and CIS

The confirmed targeted mutant lines could be subjected to viral resistance assay. For potyviral infections, mechanical inoculations could be performed under control conditions using PVY (ordinary strain) inoculum as described earlier.³ Theoretically, the mutant lines would be viral symptom-free whereas control plants (non-transformed wild plants) will start typical viral infection symptoms after 3 to 4 weeks post inoculation. Likewise, the confirmed T₀ mutant lines should also be screened for CIS resistance using methods as performed earlier.^5,6 The CIS resistant tubers derived from mutant lines would be tested for acrylamide content following protocol.⁵ The high-temperature processing of tubers derived from CIS resistant lines should represent some light-colored chips (a direct indication of lower acrylamide content as a result of decreased reducing sugar profile in cold-stored tubers). In comparison, the controls will go through normal CIS process and would represent dark-colored chips (higher acrylamide).

5.5. Off-site Targeting Assessments

Off-site targeting is a critical issue for CRISPR/Cas9-mediated genome editing⁹² and is a big challenge for scientists and legislations to predict the long-term consequences of genome edited products. Despite having all the CRISPR fascination in its broader implicitly, the chances of sgRNAs (meant to hybridize with specific genome targets) to bind with some non-specific targets having nucleotide similarity with few mismatches are always there. With the advancement of CRISPR discoveries, a number of countermeasures are proposed by scientists to deal with such limitations. Most of these strategies utilize a computational prediction approach and some could be in vitro tested but still needs further explorations for any conclusive results. Based on the available data, some strategic ways have been proposed to minimize the off-site targeting effects. First includes the computational predictions of designed sgRNA for target specificity and any off-site targeting.⁹³ For this purpose, numerous web-based bioinformatic tools are available (Table 3) which can be utilized with filtering option of potato genome as reference sequence against target specificity. Some of these tools also facilitate with the option of mismatch base pairing which represents the sgRNA specificity to target any complementary sequence having number and location of mismatches that sgRNA shares within host genome.⁷⁰ Simply if a sgRNA have high nucleotide similarity with any off-site target with less than 3 mismatch base pairing, it represents higher chances of off-site targeting effects.⁷⁰ A number of studies have identified that Cas9 nuclease could perform a nuclease activity even if there are few mismatches among sgRNA/target duplexes.^70,86 However, the specificity of sgRNA/target duplex is primarily dependent on sgRNA seed region (consecutive 12 nucleotides upstream of PAM sequences) and it has been experimentally proven that mismatch base pairing at 3ʹ end of sgRNA is less tolerable whereas mismatches up to three nucleotides in 5´end of sgRNA could be tolerated by CRISPR/Cas system.⁹⁴ Based on these facts, those sgRNA could be designed which show single targets and have 0 mismatches with targets and retain >3 mismatches with other off-sites in the host genome, thus ensuring their high specificity.

Second, the other plausible way to avoid off-site targeting has been employed through strategic sgRNA designing having guanidine residues at 5´end⁸⁷, and/or by truncating the sgRNA size to 17–18 nucleotides.⁹⁵ Third, to minimize the off-site targeting, the sgRNA: Cas9 ratio has been optimized for balanced on-site targeting and avoiding any excessive DNA cleavages.^70,96 Fourth, scientists have created Cas9 mutants by deleting some cutting domains to generate customized Cas9 (D10A) which works as nickase to cut single DNA strand instead of DSB.^20,97 By fusing two sgRNAs with wild-type Cas9 (D10A), the specific target site could be cleaved at both strands with high specificity. The possible off-site targeting through this system can generate a single nick on one of the DNA strands that could be repaired by the host base excision repair mechanism. This wild-type Cas9 paired nickases significantly reduced (up to 50–1500 folds) off-site targeting in mouse cell system and could be potentially applied in other organisms.^20,98 Fifth, the other major strategies to mitigate the off-site targeting includes the usage of various Cas9 variants. Scientists have modified Cas9 activity for minimal off-site targeting through generating various Cas9 orthologs such as eSpCas9: enhanced specificity-SpCas9⁹⁹, SpCas9-HF1: SpCas9 high-fidelity variant¹⁰⁰, and FokI-dCas9, dCas9 fused with FokI catalytic domain.²³ These Cas9 variants could be employed for efficient genomic editing with modified nuclease activities.

In vitro assessment of off-site targeting has been tested through deep sequencing of confirmed mutant lines for insertion/deletion in other possible targeted sites (four to six mismatch base pairing).^17,86,88 The other important task would be to reproduce a large number of transgenic events, as it will minimize the risks of somaclonal variations originating during tissue culture regenerations.¹⁰¹ For phenotypic trait assessment, mutant lines could be grown and checked for any trait penalty during subsequent generations.^62,86 The CRISPR/Cas9 layout discussed here could mitigate the dominating challenges in potato productivity and can be an important step to increase potato production and quality.

6. CRISPR APPLICATIONS FOR OTHER TRAITS IN POTATO: EXAMPLES SO FAR

Recent years, the CRISPR technology has proved its enormous potential for an efficient and targeted genome editing in potato (Table 4). The first report of CRISPR/Cas9 application in potato appeared in 2015 when it was employed to exert an efficient site-specific mutation (up to 83%) in the host gene, Auxin/indole-3-acetic acid (StIAA2).¹⁰² By using Agrobacterium-mediated transformation, the CRISPR constructs were used to knock-out StIAA2 gene (monoallelic/biallelic with 2-18bp nucleotide deletions) which resulted in engineered potato lines having an altered Aux/IAA protein expression.¹⁰² Furthermore, the PCR/sequencing assay was used to elucidate the off-target effects (if any) of CRISPR/Cas9 constructs in StIAA2 knock-out lines and found no off-target activity. This report paved the way for the efficient CRISPR-mediated targeted mutagenesis in tetraploid cultivated potato where the existing traditional breeding approaches have met with limited success due to tetrasomic inheritance and heterozygous genome.¹⁰⁷ Similarly, CRISPR/Cas constructs were designed to target another potato host gene, Acetolactate synthase1 gene (StALS1).¹⁰³ Importantly, a dual vector strategy carrying either a conventional T-DNA or a modified geminivirus T-DNA (meant for highly site-specific targeting) was utilized to induce targeted mutations in both tetraploid (S. tuberosum cv. Desirée) and diploid (MSX914-10-X914-10) potato. Stable expression of CRISPR/Cas constructs exhibited a site-specific mutation (ranged from 3–60%) in StALS alleles of the primary events of diploid/tetraploid plants. Single targeted mutations were stably heritable (87–100% transmission) in successive diploid and tetraploid potato generations¹⁰³, thus elucidating the potential of CRISPR/Cas9 technology in potato and providing platforms for the upcoming studies. Lately, the CRISPR/Cas9 technology was employed to bring nutritional changes in potato cv. Kuras¹⁰⁴, comprehensively reviewed in our recent publication.⁵² Transient protoplast-mediated transfection with CRISPR/Cas9 constructs resulted in a site-specific mutation in all (four) alleles of the host gene, Granule-bound starch synthase (GBSS) in some regenerated potato lines. In contrary to the stable transformation of CRISPR/Cas9 constructs^102-104 used the transient expression system to induce mutation in potato and thus avoided the subsequent segregation of CRISPR reagents. However, the protoplast-mediated transformation leads to the somaclonal variations and yielded an average of 25% of stunted plants in the regenerated lines. To reduce this drawback, they collected huge data of regenerated lines (2051) and subjected them to high-resolution fragment analysis (HRFA) for the detection of mutation. Overall, the transient expression of CRISPR/Cas9 constructs resulted in full knock-out of the targeted gene but met with lower mutation frequency (2.2–11.6%)¹⁰⁴ as compared to the stable transformation of CRISPR/Cas9 constructs^102,103 but the regeneration of transgene-free lines should be more advantageous in the long run. In another study,¹⁰⁵ utilized CRISPR/Cas9 technology to knock-out the host transcription factor gene (StMYB44), predominantly involved in phosphate mobilization. Agrobacterium-mediated stable transformation of CRISPR/Cas9 constructs resulted in higher mutation (84% frequency) in StMYB44 alleles with no compromise on other agronomic traits when compared with the wild-type plants.¹⁰⁵ To enhance the targeted mutation frequency in the tetraploid genome of potato,¹⁰⁸ utilized the CRISPR/Cas9 system integrated with a translational enhancer (dMac3). The enhanced expression of Cas9 resulted in 25% of targeted mutagenesis in the four alleles of the potato granule-bound starch synthase I (GBSSI) gene that generated the potato tubers having a lower amylose starch.

TABLE 4.

Use of CRISPR/Cas9 technology for potato genome editing.

Cultivar	Target gene	Delivery method	Modification	Phenotype/trait	Mutation frequency %	Reference
Double-haploid DM	StIAA2	ATMT	Knock-out/Multiallelic Indels	Functional studies of uncharacterized genes in potato	Up to 83%	102
Désirée	StALS1	ATMT	Knock-out/Indels	Herbicide resistance	3–60%	103
Kuras	GBSS	PMT	Knock-out/Multiallelic Indels	Amylopectin rich potato; Waxy Potato	67% (multiple alleles); 2–12% (one allele)	104
Désirée	StMYB44	ATMT	Knock-out/Indels	Phosphate mobilization	84%	105
Kuras	GBSS	RNPs-PMT	Knock-out/Multiallelic Indels	Amylopectin rich potato; Waxy Potato	Up to 9%	106

ATMT: Agrobacterium tumefaciens-mediated transformation

GBSS: Granule-bound starch synthase

StIAA2: Auxin/indole-3-acetic acid

StALS1: Acetolactate synthase1

StMYB44: Transcription factor gene

PMT: Protoplast-mediated transfection, direct DNA uptake into protoplasts

RNPs-PMT: Ribonucleoproteins Protoplast-mediated transfection

Recently,¹⁰⁶ used the RNPs-mediated delivery of CRISPR/Cas9 constructs in potato and presented some exciting results. By using the protoplast-mediated transfection with CRISPR/Cas9-RNPs, an endogenous GBSS (EC 2.4.1.242) gene was targeted and resulted in full-knockout with a mutation frequency of up to 9%.¹⁰⁶ Importantly, all the regenerated knockout lines transfected with synthetically produced RNPs (preassembled gRNA: Cas9 complexes) were transgene-free, in contrary to their previous study¹⁰⁴, where plasmid DNA-mediated delivery of CRISPR/Cas9 produced a number of mutated lines having unintended plasmid DNA integration. Conclusively, the RNPs-mediated delivery of CRISPR/Cas9 was many steps ahead of previously applied tools in potato¹⁰⁶ and could be potentially adopted and further optimized for producing commercial potato lines having transgene-free status. Another study reported the use of Cytidine base editors (CBEs) coupled with CRISPR/Cas9 technology and produced the transgene-free potato plants resistant to herbicide “chlorsulfuron”.¹⁰⁹ Importantly, they targeted the host acetolactate synthase (ALS) gene in potato using Agrobacterium-mediated stable transformation of CRISPR/Cas9 components and produced 10% of transgene-free regenerated potato plants lacking any stable-integration of T-DNA, however, confirmed the base edited (C-to-T base) mutation at the targeted site.

The studies discussed in this section provide comprehensive information regarding the utility of CRISPR/Cas9 for potato genome editing. Although, the applications of CRISPR tools are countless in the context of molecular engineering yet the selection of most appropriate editing tool and the targeted site is a critical prerequisite to achieve the predicted goals. For example, editing in host genes with transient expression of CRISPR system could bring desired edits without the stable integration of any unintended DNA and could be in line with the natural variants (mutants) of that species. Furthermore, multiplexing with CRISPR system could offer promising solutions for metabolic engineering involving several molecular pathways like starch synthesis/storage, etc. that otherwise would require tedious time, labor and multistep engineering using traditional breeding programs.

7. ANTICIPATED CHALLENGES AND POSSIBLE SOLUTIONS

The CRISPR/Cas9 technology looks very promising for the transgene-free system, however, several questions such as viral evolution/evasion from the host resistance⁹¹, social/regulatory approval, off-site targeting effects, use of Cas9 variants, and host responses to the CRISPR/Cas9 system need to be addressed. Multiple viral attacks and synergistic interactions among co-infecting viruses are frequent on potato in field conditions, leading to severe disease symptoms.²⁹ To overcome this drawback, CRISPR/Cas9 could be employed to generate a broad-spectrum viral resistance through multiple sgRNA targeting various viral genomes in a single multiplexed CRISPR cassette. However, it seems impossible to achieve this with a transgene-free potato. This “single multiplexed CRISPR cassette” must be in the potato cells all the time (i.e. permanently transformed) so that when viruses attack, the potato cells would target and degrade the viral genomes using the multiplexed CRISPR system and this would not be “transgene-free” and would be just like any other GMOs. Furthermore, the applicability and long-term effects of this genetic modification also remain a question.⁶⁷ In nature, viruses exist in an arms race with their competing host and try to evolve at a considerably faster rate to overcome the host defense system. Since disease arises from a compatible interaction between the plant and pathogen, altering a host susceptible gene that critically facilitates plant-pathogen interaction, provides a broad-spectrum and durable type of resistance.¹¹⁰ Genome editing in host susceptible genes will induce resistance like the natural recessive resistance, as mostly natural potyviral resistance works in a similar way i.e. loss-of-function mutation in host translation initiation factors.^{61,62,110,111}

Several earlier studies^5,6,55 support the control of CIS through targeting VInv gene in the potato which is responsible for the accumulation of reducing sugars in the vacuole. However, some other invertase isoforms are also present in the cytoplasm and cell wall which also regulate reducing sugars concentrations inside the cell.⁵⁵ Therefore, we suggest evaluating other invertase genes in the future to further reduce the concentrations of reducing sugars. Furthermore, the field performance of VInv mutated lines will provide a functional evaluation, showing comparative tuberization along with wild-type plants.

8. CONCLUSION AND PROSPECTS

Potato is the most important non-grain food crop and is an integral part of the world’s food security. Recently, scientists have developed heat tolerance in potato through expressing a specific allele of a thermotolerance gene (HEAT-SHOCK COGNATE 70), introduced through conventional breeding approaches.¹¹² Another innovative breakthrough came recently in 2017, where the U.S. Environmental Protection Agency (EPA) and FDA has provided approval for the commercialization of GM potato (Innate^TM Second-Generation; developed by Simplot corp.) resistant to fungal infections (late blight) that caused the Irish potato famine (https://durangoherald.com/articles/140336-u-s-approves-3-types-of-genetically-engineered-potatoes?wallit_nosession=1). To circumvent the challenges of viral pathogens and to accelerate the trait improvements in potato, recent advances in genome editing have offered new frameworks for efficient and precise genomic modification.¹¹³ The precision, accuracy, and timeframe of these methodologies have potential to take over the conventional time-consuming breeding programs used previously. Several viral resistant and CIS resistant strategies have been employed so far in potato, but the transgenic potatoes have been questioned by the society and legislation authorities. The current scenario of transgene-free crops, more specifically for food crops, has gained considerable attention from regulatory authorities and seems to be more streamlined in the future. The utilization of host genes as a specific editing target will likely eliminate the dependence on the foreign DNA and will subsequently help to produce the genetically improved instead of genetically transformed crops having GMO labeling. The CRISPR/Cas9 system could be effectively utilized to induce target specific genome editing in a transgene-free manner and to mediate crop regularization approvals at a faster pace. The RNA guided cleavage of target genome gives superiority to the CRISPR/Cas9 system over TALEN and ZFN, where protein-mediated nuclease expression is considered a major limitation to their applicability. The RNA-guided system is considered more feasible in terms of broader applicability to target multiple genomic sites by designing target-specific sgRNAs.¹¹³ Furthermore, the CRISPR/Cas9 methodology could be employed to knock in the expression of transcription factor (StWRKY1) in transgene-free potato, that would generate a durable late blight resistance through mediating metabolic pathways leading to host cell wall strengthening.¹¹⁴ The CRISPR/Cas system could also be employed to enhance potato nutritional status¹, transcriptional regulation of secondary metabolites, increased starch production, and to enhance resistance spectrum against diverse phytopathogens. The current review emphasizes on the generation of transgene-free potatoes, using a multiplex CRISPR/Cas9 approach that could be harnessed to generate resistance against viruses and CIS, making it more feasible for farmers and processing industry. Notably, in the context of food crops, this study could be devised practically to enhance the potato production and quality traits and could contribute significantly to the world food security programs.

Conflict of Interest

The authors declare that there are no conflicts of interest in any perspective.

Author Contributions

AH provided the outlines of the review and contributed the key ideas. AH, MAM, MS, and SF wrote the manuscript and prepared the figures. AK and SA worked on and improved the original draft and figures. The first draft of the manuscript was approved by all co-authors.