Skip to main content
NCBI home page
MicrobiologyOpen logoLink to MicrobiologyOpen
. 2020 Jul 12;9(9):e1101. doi: 10.1002/mbo3.1101

Pseudomonas glycinae sp. nov. isolated from the soybean rhizosphere

Jiayuan Jia 1, Xiaoqiang Wang 1,2, Peng Deng 1, Lin Ma 1,3, Sonya M Baird 1, Xiangdong Li 4, Shi‐En Lu 1,✉
PMCID: PMC7520993  PMID: 32657018

Abstract

Strains MS586T and MS82, which are aerobic, Gram‐negative, rod‐shaped, and polar‐flagellated bacteria, were isolated from the soybean rhizosphere in Mississippi. Taxonomic positions of MS586T and MS82 were determined using a polyphasic approach. 16S rRNA gene sequence analyses of the two strains showed high pairwise sequence similarities (>98%) to some Pseudomonas species. Analysis of the concatenated 16S rRNA, rpoB, rpoD, and gyrB gene sequences indicated that the strains belonging to the Pseudomonas koreensis subgroup (SG) shared the highest similarity with Pseudomonas kribbensis strain 46‐2T. Analyses of average nucleotide identity (ANI), genome‐to‐genome distance, delineated MS586T and MS82 from other species within the genus Pseudomonas. The predominant quinone system of the strain was ubiquinone 9 (Q‐9), and the DNA G+C content was 60.48 mol%. The major fatty acids were C16:0, C17:0 cyclo, and the summed features 3 and 8 consisting of C16:1ω7c/C16:1ω6c and C18:1ω7c/C18:1ω6c, respectively. The major polar lipids were phosphatidylglycerol, phosphatidylethanolamine, and diphosphatidylglycerol. Based on these data, it is proposed that strains MS586T and MS82 represent a novel species within the genus Pseudomonas. The proposed name for the new species is Pseudomonas glycinae, and the type strain is MS586T (accession NRRL B‐65441 = accession LMG 30275).

Keywords: average nucleotide identity, Pseudomonas glycinae, rhizosphere, soybean

Bacterial strains MS586T and MS82 were isolated from soybean rhizosphere in Mississippi. Both strains exhibited striking antimicrobial activity. According to analyses of phylogenetic, phenotypic, physiological, biochemical, and chemotaxonomic characteristics, strains MS586T and MS82 represent a novel species of the genus Pseudomonas, which belongs to the Pseudomonas koreensis subgroup. The proposed name for the new species is Pseudomonas glycinae, and the type strain is MS586T.

graphic file with name MBO3-9-e1101-g006.jpg

1. INTRODUCTION

The genus Pseudomonas was first described by Migula (1894). Strains of this genus have been found in natural habitats including plants, soil, animals, and water (Palleroni, 1994). Members of the genus Pseudomonas are known to be Gram‐negative, rod‐shaped, cream‐colored, and polar‐flagellated. Pseudomonas spp. have great metabolic and nutritional versatility. Some strains of Pseudomonas spp. play potential roles as bioremediation agents to alleviate various hazardous organic substrates, such as sodium dodecyl sulfate (Furmanczyk, Kaminski, Lipinski, Dziembowski, & Sobczak, 2018). Some strains of Pseudomonas spp. promote plant growth directly by facilitating resource acquisition or indirectly by decreasing the inhibitory effects of various pathogenic agents on plant growth and development; however, some other strains of Pseudomonas can act as pathogens inciting plant diseases (Moore et al., 1996; Oueslati et al., 2019; Ye et al., 2019).

Over 200 species of Pseudomonas are included in the Bacterial Names with Standing in Nomenclature (http://www.bacterio.net). Numerous methods, including physiological, molecular, and phenotypic distinctions (Sneath, Stevens, & Sackin, 1981); 16S rDNA gene sequencing; and multilocus sequence analysis (MLSA) (Pascual, Macián, Arahal, Garay, & Pujalte, 2010), have been used to identify the taxonomic status of Pseudomonas species. With the accumulation of genomic data, the analysis of complete genomes is very useful in Pseudomonas taxonomy (Hesse et al., 2018; Peix, Ramirez‐Bahena, & Velazquez, 2018). Average nucleotide identity (ANI) values calculated from genome assemblies have been widely used for the taxonomy of bacteria (Konstantinidis & Tiedje, 2005). ANI evaluates a large number of nucleic acid sequences, including some that evolve quickly and others that evolve slowly, in its calculation and reduces the influence of horizontal gene transfer events or variable evolutionary rates. It has been suggested that species descriptions of bacteria and archaea should include a high‐quality genome sequence of at least the type strain as an obligatory requirement (Rosselló‐Móra & Amann, 2015). The current metagenome databases have shown evidence for approximately 8000 sequence‐discrete natural populations, which is roughly equivalent to species at the 95% ANI level (Rosselló‐Móra & Whitman, 2018). Genome‐to‐genome distance (GGDC 2.0) is another highly effective method for inferring whole‐genome distances. GGDC effectively mimics DNA‐DNA hybridization for genome‐based species delineation and subspecies delineation (Meier‐Kolthoff, Auch, Klenk, & Göker, 2013). Therefore, ANI and GGDC are highly effective ways to evaluate the genetic relatedness between genomes. Strains MS586T and MS82 were isolated from the rhizosphere soybean plants growing in fields where most plants were infected by the charcoal rot pathogen Macrophomina phaseolina. Plate bioassay indicated both strains MS586T and MS82 exhibited striking antimicrobial activity (Ma et al., 2017). This research is focused on the characterization of the taxonomic position of the two strains.

2. MATERIALS AND METHODS

2.1. Bacterial strains and growth conditions

MS586T and MS82 were isolated from a soybean rhizosphere sample by standard dilution plating on nutrient broth yeast extract (NBY) agar medium (Vidaver, 1967) at 28°C. Antimicrobial activity against multiple plant pathogens was detected with an antifungal plate assay as previously described (Gu, Wang, Chaney, Smith, & Lu, 2009). Following purification, the bacterium was preserved in 20% glycerol at −80°C. Pseudomonas spp. type strains and reference strains were provided by the Leibniz Institute DSMZ—German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). All strains used in this study are summarized in Table A1.

2.2. Cell morphology and physiological tests

Colony morphology of the strains MS586T and MS82 was determined after growth on NBY agar plates. Gram staining was performed as described previously (Murray, Doetsch, & Robinow, 1994); cell morphology and flagellation types were observed with a transmission electron microscope (TEM) using routine negative glutaraldehyde staining; and the production of fluorescent pigments was tested on King B medium (King, Ward, & Raney, 1954). Optical density (OD600) metrics recorded for NBY liquid cultures were used to evaluate optimal growth and pH, at temperatures from 4°C to 40°C, with an interval of 4°C for 24 hr, and at pH 4.0–10.0.

Physiological and biochemical tests were conducted as described previously (Peix, Berge, Rivas, Abril, & Velázquez, 2005). Cellular fatty acids were identified using the Sherlock 6.1 system (Microbial IDentification Inc.) and the library RTSBA6 (Sasser, 1990). Biochemical features and enzyme activities were determined using API 20 NE and API 50 CH strips with API 50 CHB/E medium (bioMerieux), as well as Biology GENIII Microplates (Biolog) as directed in the manufacturer's instructions; results were recorded after incubation for 48 hr at 28°C.

2.3. Phylogenetic analysis

Bacterial genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) protocol (Doyle, 1987) and used as a template to amplify the nearly full‐length 16S rRNA gene. PCR was performed with the 16S rRNA universal primers 27F (5′‐AGAGTTTGATCMTGGCTCAG‐3′) and 1492R (5′‐TACGGHTACCTTGTTACGACTT‐3′) (Chelius & Triplett, 2000; Lane, 1991). Amplification and partial sequencing of rpoB (Tayeb, Ageron, Grimont, & Grimont, 2005), rpoD (Mulet, Bennasar, Lalucat, & García‐Valdés, 2009), and gyrB (Yamamoto et al., 2000) housekeeping genes were performed following previously described methods (Mulet et al., 2009) using primers LAPS (5′‐TGGCCGAGAACCAGTTCCGCGT‐3′)/LAPS27 (5′‐CGGCTTCGTCCAGCTTGTTCAG‐3′) for ropB, PsEG30F (5′‐ATYGAAATCGCCAARCG‐3′)/PsEG790R (5′‐CGGTTGATKTCCTTGA‐3′) for rpoD, and APrU (5′‐TGTAAACGACGGCCAGTGCNGGRTCYTTYTCYTGRCA‐3′)/UP1E (5′‐CAGGAAACAGCTATGACCAYGSNGGNGGNAARTTYRA‐3) for gyrB. All PCR was performed with a PTC‐200 Peltier Thermal Cycler (MJ Research), and products were purified using a Wizard SV Gel and PCR Clean‐Up System (Promega). Sanger sequencing reactions were performed using the Eurofins MWG Operon.

Phylogenetic analysis of the multilocus sequence analysis (MLSA) was performed in MEGA 7 software using the maximum‐likelihood algorithm (Kumar, Stecher, & Tamura, 2016). The sequence fragments of the four genes (16s rRNA, rpoB, rpoD, and gyrB) were concatenated in the following order: 16s rRNA, rpoB, rpoD, and gyrB. Sequences of type strains used in the MLSA were downloaded from NCBI (accession numbers in Table A2). The maximum‐likelihood method was used to construct the phylogenetic tree with 1000 bootstrap replicates.

2.4. DNA fingerprinting

DNA fingerprinting has been evaluated and proposed as a reliable method for distinguishing different strains in the same taxon, which are not clonal varieties. Thus, the primer sequence corresponding to BOX elements (BoxA1R: 5′‐CTACGGCAAGGCGACGCTGACG‐3′) was used for DNA fingerprinting (Koeuth, Versalovic, & Lupski, 1995). PCR amplification was conducted as follows: initial denaturation at 94°C for 5 min, followed by 30 cycles (94°C for 1 min, 52°C or 53°C for 1 min, and 72°C for 2 min), and finally 72°C for 8 min. The DNA fragments were analyzed in a 2% agarose gel.

2.5. Genome sequencing and analysis

Genomic DNA of strain MS586T was extracted using the Wizard Genomic DNA Purification Kit (Promega Corporation). The extracted genomic DNA was used for library construction with an average insert size of 400 bp, and three mate‐pair libraries with an average insert size of 2000 bp, 5000 bp, and 8000 bp were prepared and sequenced on the Illumina MiSeq instrument according to the manufacturer's instructions (Illumina). The standard library and 2000‐bp mate‐pair library were selected for de novo assembly using a method described by Durfee et al. (2008) using DNASTAR Lasergene software (DNASTAR, Inc.). The genome was annotated using the NCBI Prokaryotic Genome Annotation Pipeline (Angiuoli et al., 2008). The complete genome sequence was deposited in GenBank under accession number CP014205, and the genome project was deposited in the Genomes OnLine Database under GP0128017.

Similarity analyses (ANI and GGDC) of the sequenced genome of strain MS586T to other 40 genomes of the closely related Pseudomonas species were determined as briefed below. ANI based on pairwise comparison was calculated using the software JSpecies with the ANIb algorithm (Richter & Rosselló‐Móra, 2009). GGDC was calculated using the web service http://ggdc.dsmz.de and using the recommended BLAST+method (Meier‐Kolthoff et al., 2013). The GGDC results shown are based on the recommended formula 2 (sum of all identities found in HSPs divided by the overall HSP length), which is independent of the genome length and is thus robust against the use of incomplete draft genomes. The Type (Strain) Genome Server (https://www.dsmz.de/services/online‐tools/tygs) with the recommended settings was used to clarify species delineation (Meier‐Kolthoff & Göker, 2019). The phylogenomic tree based on whole‐genome sequences was reconstructed by Genome Blast Distance Phylogeny (GBDP). Accession numbers of sequences used in the whole‐genome phylogenetic analysis are summarized in Table A3. The clustering of the type‐based species using a 70% dDDH radius around each type strain was conducted as previously described (Meier‐Kolthoff & Göker, 2019).

2.6. Chemotaxonomic analysis

As important chemical characteristics for bacterial identification, the cellular fatty acid profile of the strain MS586T was analyzed. Cellular fatty acids were harvested after 2 days of growth at 28°C on TSA. Fatty acids extracted from the bacteria were methylated and analyzed following the protocol of the Sherlock 6.1 Microbial Identification (MIDI) system (Microbial IDentification Inc.) using the library RTSBA6 (Sasser, 1990). Analyses of respiratory quinones and polar lipids were carried out by the Identification Service of the DSMZ (Braunschweig, Germany).

3. RESULTS AND DISCUSSION

3.1. Phenotype analysis

Both strains MS586T and MS82 were observed to be Gram‐negative, rod‐shaped (0.6–0.8 × 2.0–3.0 μm), and motile utilizing polar flagella (Figure A1). Colonies of the two strains were 3–5 mm in diameter and light yellow after 2 days of incubation on NBY at 28°C. No growth was detected at 40°C or with 7% NaCl. The optimum growth occurred at 28–30°C. The bacteria tolerated pH values ranging from 4 to 10. The two strains could produce fluorescent pigments when cultured for 24–48 hr at 28°C on King B medium, whereas Pseudomonas kribbensis 46‐2T, which is the closest species of strains MS586T and MS82, could not produce fluorescent (Table 1). Strain MS586T showed negative for assimilation of dextrin, formic acid, and d‐serine. In contrast, all these reactions were not negative for P. kribbensis 46‐2T, P. granadensis F‐278,770T, P. moraviensis 1B4T, and Pseudomonas koreensis Ps 9‐14T. Gelatin was hydrolyzed by strain MS586T, but it was negative by P. kribbensis 46‐2T. The physiological, morphological, and phenotypic characteristics in the API 20 NE, API 50 CH, and Biology GEN III tests, which allowed differentiation of strains MS586T from other closely related Pseudomonas species, are listed in Table 1.

TABLE 1.

Differentiating characteristics of strain MS586T from other related species of Pseudomonas

Characteristics 1 2a 3b 4c 5c 6d 7e 8e 9e 10e
Flagellation Polar, multiple Polar, multiple Polar, two Polar, two Polar, multiple ND ND Polar, single ND ND
Fluorescence + − − + + + + + − −
Growth at:
4°C + + + + + + ND + ND ND
Tolerance of NaCl at
5% + − + + − + − − − −
Nitrate reduction − − − − − − + + − −
Arginine dihydrolase + + + + + + − + − +
Hydrolysis of gelatin + − + − − + − − − −
Citrate utilization + + + + + + + + − +
Urease − − − − ND − − − − −
Assimilation of
l‐Arabinose + + + + + + − + + +
N‐Acetyl‐d‐glucosamine + + + + + + + + − −
Phenylacetic acid − − − − − − + + + +
d‐Mannose + + + + + + − + − −
Dextrin − + w + + − + + + −
Tween‐40 − + + + + + − + + −
d‐Cellobiose − + − + + − + + − −
d‐Trehalose − − + + − − w − − −
l‐Arabinose + + + + + + − + + +
d‐Fructose + + + + + + ND + − −
d‐Mannitol + + + + + + + + − +
d‐Arabitol − + + + + + − − + −
l‐Alanine + + + + + + + + w ND
l‐Serine + + − + + + + + w +
α‐Ketobutyric acid − − w + + − − + + −
α‐Ketoglutaric acid + + + + − + + + − +
Glucuronamide − + + + + − − − − −
l‐Histidine − + − + + − + + − +
d‐Serine − + w + + − − + − −
d‐Galactose + + + + + + − + + +
d‐Galacturonic acid − ND − − ND − − − + +
d‐Glucuronic acid − − − − − − − − − +
Glucuronamide − + + ND + − − − − ND
p‐Hydroxy phenylacetic acid − − − − − − − + − −
Quinic acid + + + + + + − + + +
d‐Saccharic acid + + + + + + − + + +
Glycyl‐l‐proline − ND + + + − + + + +
l‐Pyroglutamic acid + + + + ND + − + + +
Inosine − + + + + + + − + −
Propionic acid + + + + + + + + w −
Formic acid − + − + − − − + + −
Acetic acid + + w + − + + + + −
Methyl pyruvate − + + + + + + + + +
GC content (%) 60.5 60.5 59.9 60.3 59.1 58.7 67.2 62.2 59.1 59.4
Open in a new tab

Strains. 1, MS586T; 2, P. kribbensis 46‐2T; 3, P. granadensis F‐278,770T; 4, P. moraviensis 1B4T; 5, P. koreensis Ps9‐14T; 6, P. baetica a390T; 7, P. vancouverensis DhA‐51T; 8, P. jessenii DSM 17150T; 9, P. reinekei MT1T; 10, P. moorei RW10T. Data for strain MS586T were obtained in this study. Data for other type strains were obtained from references. a, (Chang et al., 2016); b, (Pascual, García‐López, Bills, & Genilloud, 2015); c, (Tvrzova et al., 2006); and d, (Lopez et al., 2012); e, (Camara et al., 2007).

Abbreviations: −, negative; +, positive; ND, not determined; W, weak.

3.2. Phylogenetic analysis

Sequence analysis revealed that the 16S rRNA genes of MS586T and MS82 shared significant identities (>98%) to some Pseudomonas species of the P. koreensis subgroup in the Pseudomonas fluorescens group. The closely related strains include P. kribbensis 46‐2T (99.94%), P. granadensis F‐278,770T (99.55%), P. koreensis Ps 9‐14T (99.52%), P. reinekei MT1T (99.46%), P. moraviensis 1B4T (99.41%), P. vancouverensis DhA‐51T (99.33%), P. baetica a390T (99.20%), P. jessenii DSM 17150T (98.94%), and P. fluorescens Pf0‐1 (99.87%). However, analysis of the 16S rRNA gene sequence alone is insufficient to define the relative taxonomic positions of Pseudomonas species (Rosselló‐Móra & Whitman, 2018). Therefore, MLSA was conducted based on previously described methods using four gene sequences for the studies: 16S rRNA (1326 bp), rpoB (905 bp), rpoD (802 bp), and gyrB (663 bp). According to Hesse et al. (2018), the genus Pseudomonas has been phylogenetically divided into 13 groups (G) and 10 subgroups (SG). The closely related species of P. fluorescens subgroup and representative species of each group were selected to reconstruct the phylogenetic tree. The maximum‐likelihood tree illustrates the phylogenetic position of strain MS586T and 61 related members of the genus Pseudomonas based on four concatenated gene sequences (3696 bp); Acinetobacter baumannii strain ATCC 19606T was used as an outgroup. As shown in Figure 1, strains MS586T and MS82 were clustered with P. fluorescens Pf0‐1 with 100% bootstrap values. Strains MS586T and MS82 belong to the P. koreensis subgroup in the P. fluorescens group. It has been noted that, as reported by Gomila, Peña, Mulet, Lalucat, and García‐Valdés (2015), 30% of the genus Pseudomonas sequenced genomes of non‐type strains were not correctly assigned at the species level in the accepted taxonomy of the genus and 20% of the strains were not identified at the species level. Therefore, further extensive research is needed to update the Pseudomonas taxonomy.

FIGURE 1.

FIGURE 1

Open in a new tab

Maximum‐likelihood tree illustrating the phylogenetic position of strain MS586T and related members of the genus Pseudomonas using four concatenated gene sequences (3696 bp): 16S rRNA (1326 bp), rpoB (905 bp), rpoD (802 bp), and gyrB (663 bp). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. A. baumannii strain ATCC 19606T was used as the outgroup. Only bootstrap values above 50% are indicated. The colored bar designates groups of Pseudomonas spp. Accession numbers of sequences used in this study are summarized in Table A2

3.3. DNA fingerprinting

DNA fingerprinting by BOX‐PCR revealed that strains MS586T and MS82 were different representatives of the proposed novel species. As shown in Figure A2, two strains have the two common bands (490 bp and 900 bp) in the BOX‐PCR profiles; however, each of them produced unique bands (125 bp, 300 bp, 750 bp, and 1350 bp for MS586T; 700 bp, 750 bp, 1100 bp, and 1350 bp for MS82), which suggests the two strains are not identical isolates.

3.4. General taxonomic genome features of strain MS586T

The main characteristics of the whole‐genome sequence of strain MS586T are depicted in Table 2. No plasmid was detected. The DNA G+C content of strain MS586T was 60.48 mol%. This value is in the range (48–68 mol%) of those reported within the genus Pseudomonas (Hesse et al., 2018).

TABLE 2.

Chromosome statistics for strain MS586T

Feature Total
Size 6,396,728 bp
Genes 5893
CDs 5805
Pseudogenes 131
rRNAs 17
tRNAs 67
ncRNA 4
G+C content 60.48%
Open in a new tab

All genome‐relatedness values of strain MS586T were calculated by the algorithms ANIb and GGDC. The MS586T genome was compared with the complete genome assemblies downloaded from NCBI for the strains shown in Table 3. ANI 95%–96% is equivalent to a DNA‐DNA hybridization of 70% (Kim, Oh, Park, & Chun, 2014). The species demarcations ANI ≥ 95% or GGDC ≥ 70% were used as a benchmark (Richter & Rosselló‐Móra, 2009). ANI values and GGDC values ranged from 75.28% to 98.24% and 21.00% to 84.10%, respectively, with the highest value between MS82 and MS586T. As shown in Table 3, strain MS586T shared less than 91% ANI and 35% GGDC with any of the other type strain of bacteria, but it had ANI value of 98.24% and GGDC value of 84.10% with strain MS82, which are higher than the species boundary cutoff values. Additionally, the two strains share 95.59% ANI and 65.30% GGDC with P. fluorescens Pf0‐1, which is the closest relative outside to the novel species. As reported by Lopes et al. (Lopes et al., 2018), three strains isolated from tropical soils, which share ≥95% ANI values with strain MS586T, are the potential strains for the novel species. As shown in Figure 2, the whole‐genome‐based phylogenetic tree obtained with TYGS automated pipeline shows that both MS586T and MS82 were grouped into the same species cluster and confirmed that P. kribbensis 46‐2T is the closely related type strain. P. fluorescens Pf0‐1 was clustered to independent branch, which indicates its distinct phylogenetic position and potential as a separate species. Collectively, the ANI, GGDC, and whole‐genome phylogenetic tree data support that strains MS586T and MS82 represent a unique species.

TABLE 3.

ANI (%) and GGDC (%) between strain MS586T and closely related sequenced strains of the genus Pseudomonas

Pseudomonas species Genome accession number at https://www.ebi.ac.uk/ena ANI (%) GGDC%
P. agarici LMG 2112T GCA_900109755 79.87% 24.30%
P. arsenicoxydans CECT 7543T GCA_900103875 84.36% 28.60%
P. azotoformans LMG 21611T GCA_900103345 80.75% 25.10%
P. baetica LMG 25716T GCA_002813455 86.58% 33.30%
P. entomophila L48T GCA_000026105 77.45% 22.40%
P. fluorescens ATCC 13525T GCA_900215245 80.84% 24.40%
P. frederiksbergensis LMG19851T GCA_900105495 84.64% 29.10%
P. fuscovaginae LMG 2158T GCA_900108595 80.04% 24.60%
P. gessardii DSM 17152T GCA_001983165 80.81% 25.00%
P. graminis DSM 11363T GCA_900111735 77.72% 22.70%
P. granadensis LMG 27940T GCA_900105485 85.88% 31.60%
P. jessenii DSM 17150T GCA_002236115 84.40% 29.70%
P. knackmussii B13T GCA_000689415 75.51% 21.00%
P. koreensis LMG 21318T GCA_900101415 87.32% 32.63%
P. kribbensis KCTC 32541T GCA_003352185 90.22% 42.20%
P. laurylsulfatiphila AP3_16T GCA_002934665 84.74% 29.70%
P. laurylsulfativorans AP3_22T GCA_002906155 84.61% 29.50%
P. libanensis DSM 17149T GCA_001439685 80.41% 24.50%
P. lini DSM 16768T GCA_900104735 84.44% 29.20%
P. lutea LMG 21974T GCA_900110795 70.69% 19.50%
P. mandelii LMG 2210T GCA_900106065 84.41% 28.90%
P. migulae LMG 21608T GCA_900106025 84.51% 29.40%
P. mohnii DSM 18327T GCA_900105115 84.24% 29.20%
P. monteilii DSM 14164T GCA_000621245 77.07% 21.80%
P. moorei DSM 12647T GCA_900102045 84.76% 29.30%
P. moraviensis LMG 24280T GCA_900105805 85.75% 31.70%
P. mucidolens LMG 2223T GCA_900106045 80.17% 24.50%
P. parafulva DSM 17004T GCA_000425765 76.47% 21.50%
P. plecoglossicida DSM 15088T GCA_000730665 77.84% 22.50%
P. prosekii LMG26867T GCA_900105155 84.28% 28.40%
P. punonensis LMG 26839T GCA_900142655 75.28% 21.50%
P. putida NCTC 10936T GCA_900455645 77.34% 22.30%
P. reinekei MT1T GCA_001945365 84.16% 29.00%
P. rhizosphaerae DSM 16299T GCA_000761155 77.99% 22.90%
P. synxantha NCTC 10696T GCA_901482615 80.31% 24.70%
P. umsongensis DSM 16611T GCA_002236105 83.79% 29.00%
P. vancouverensis DhA‐51T GCA_004348895 83.95% 28.80%
P. yamanorum LMG 27247T GCA_900105735 80.67% 25.10%
P. fluorescens Pf0‐1 GCA_000012445 95.59% 65.30%
MS82 GCA_003055645 98.24% 84.10%
Open in a new tab

FIGURE 2.

FIGURE 2

Open in a new tab

Whole‐genome sequence tree generated with TYGS for strain MS586T and its closely related species of the genus Pseudomonas. Tree inferred with FastME from GBDP distances was calculated from genome sequences. Branch lengths are scaled in terms of GBDP distance formula d5; numbers above branches are GBDP pseudo‐bootstrap support values from 100 replications. The colored squares designate species cluster. Accession numbers of sequences used in this study are summarized in Table A3

Furthermore, strains MS586T and MS82 were noteworthy, which were isolated from the rhizosphere of soybean plants associated with fungal pathogen infections. Strain MS586T has shown remarkable antifungal activities against a broad range of plant fungal pathogens (Jia and Lu, unpublished). Similarly, our study has demonstrated that strain MS82 possesses antifungal activities against the mushroom fungal pathogen Mycogone perniciosa, but not the mushroom fungus (Ma et al., 2019). Furthermore, it has been reported that PafR gene confers resistance to the mushroom pathogenic fungus (Ma et al., 2017). As expected, the PafR gene was also found in strains MS586T. Therefore, it is not surprising that multiple nonribosomal peptide synthetase gene clusters, which are frequently associated with the production of antimicrobial compounds (Mootz & Marahiel, 1997), have been predicted from the genomes of the bacterial strains.

3.5. Chemotaxonomic analysis

Cellular fatty acids were identified using the Sherlock 6.1 system (Microbial IDentification Inc.) and the library RTSBA6 (Sasser, 1990). The majority of fatty acids for strain MS586T were C16:0 (22.9%), summed feature 3 (C16:1ω7c/C16:1ω6c) (23.57%), summed feature 8 (C18:1ω7c/C18:1ω6c) (13.37%), and C17:0 cyclo (10.28%). The similarity of the fatty acid profiles supports the affiliation of strain MS586T with the genus Pseudomonas. The three fatty acids typical of the genus Pseudomonas (C10:0 3‐OH, C12:0, and C12:0 3‐OH) were also identified in strain MS586T (Palleroni, 2005). Besides, the lowest amounts of fatty acid C16:0 (22.9%) were observed in strain MS586T than in the strains of closely related species (29.4–36.5%). Strain MS586T also contains the highest amounts of C10:0 3‐OH (6.6%) when compared to the reference strains (2.2%–5.4%). The detailed fatty acid profiles of strain MS586T and the type strains of closely related species are provided in Table 4. Two‐dimensional TLC analysis revealed that the polar lipids of strain MS586T were phosphatidylethanolamine (PE), diphosphatidylglycerol (DPG), phosphatidylglycerol (PG), three unidentified phospholipids (PL), and one unidentified lipid (L) (Figure A3). Strain MS586T contains higher amounts of PL and L as compared with those of the closest relative of P. kribbensis 46‐2T. As expected, the major polar lipid components of strain MS586T were PE, DPG, and PG, which agrees with data published previously for the genus Pseudomonas (Moore et al., 2006). Also, the major respiratory quinone of strain MS586T was Q‐9, which is consistent with other species in the genus Pseudomonas (Moore et al., 2006).

TABLE 4.

Cellular fatty acid profiles of strain MS586T and strains of closely related species

Fatty acid 1 2a 3b 4c 5c 6d 7e 8e 9e 10e
C10:0 3‐OH 6.6 5.4 3.2 2.6 2.2 3.4 4.8 2.8 3.3 2.9
C12:0 2‐OH 5.5 6.8 4.7 4.9 5 5.5 3.8 5.5 4.3 3.5
C12:0 3‐OH 6.7 7.5 2.5 4.1 4 3.2 5.7 3.2 4.8 3.7
C10:0 0.8 ND ND ND ND 0.1 0.3 0.1 ND ND
C12:0 2.9 ND 1.5 2.1 1.6 1.7 3.8 4.7 3.6 2.8
C14:0 0.6 1.2 ND 0.4 0.7 0.5 0.6 0.3 0.7 0.7
C16:0 22.9 33.4 32 29 33 29.4 29.4 29.4 36.5 36
C17:0 cyclo 10.3 15.1 6.9 2.4 2 3.2 9.4 0.9 22.3 21
C18:0 0.3 1.6 ND 0.5 0.7 0.3 0.2 0.7 0.8 0.9
C19:0 ω8c 1.2 ND ND 0.2 ND ND ND ND 0.7 1.2
Summed feature 3 23.6 16.8 36 36 37 39.5 30.8 38.1 28 23
Summed feature 8 13.4 8.9 12 17 13 12.2 8.5 17.2 8.6 10
Open in a new tab

Strains. 1, MS586T; 2, P. kribbensis 46‐2T; 3, P. granadensis F‐278,770T; 4, P. moraviensis 1B4T; 5, P. koreensis Ps9‐14T; 6, P. baetica a390T; 7, P. vancouverensis DhA‐51T; 8, P. jessenii DSM 17150T; 9, P. reinekei MT1T; and 10, P. moorei RW10T. Data for strain MS586T were obtained in this study. Data for other type strains were obtained from references. a, (Chang et al., 2016); b, (Pascual et al., 2015); c, (Tvrzova et al., 2006); d, (Lopez et al., 2012); and e, (Camara et al., 2007). Values are percentages of total fatty acids.

Summed features represent groups of two or three fatty acids that cannot be separated by GC with the MIDI system. Summed feature 3 consists of C16:1ω7c/C16:1ω6c; summed feature 8 consists of C18:1ω7c/C18:1ω6c.

Abbreviation: ND, not detected/not reported.

4. CONCLUSIONS

Analyses of molecular, phenotypic, physiological, and biochemical characteristics are needed to discriminate between members of the genus Pseudomonas and other rRNA groups of aerobic “pseudomonads” (Palleroni, 2005). These analyses of strains MS586T and MS82 revealed its distinct characteristics of 16S rRNA and housekeeping gene sequences, ANI values, GGDC values, and phenotypic and chemotaxonomic assays as compared with those of other species and strains of the genus Pseudomonas. Collectively, these results demonstrate that strain MS586T and strain MS82 represent a novel species of the genus Pseudomonas. The name Pseudomonas glycinae sp. nov. is proposed with strain MS586T as the type strain. Strain MS586T is a motile Gram‐negative, rod‐shaped, strictly aerobic, catalase‐ and oxidase‐positive, fluorescent strain. These findings support the placement of strain MS586T in the genus Pseudomonas (Hildebrand, Palleroni, Hendson, Toth, & Johnson, 1994).

4.1. Description of Pseudomonas glycinae sp. nov.

Pseudomonas glycinae (gly.ci'nae. N.L. gen. n. glycinae of Glycine max, soybean) is an aerobic, Gram‐negative, rod‐shaped bacterium, with motility through polar flagella. When cultured on NBY agar plates, it produces fluorescence and forms fresh light‐yellow colonies. The colony is raised from the side view, the shape is circular, and it is usually 3.0–5.0 mm in diameter within 2 days of growth at 28°C. Cells are 0.6–0.8 × 2.0–3.0 μm. Growth occurs between 4°C and 36°C (optimum growth temperature is 28–30°C). Growth occurs between pH 4 and 10 (optimum pH 6–7). The organism tolerates up to 6% (w/v) NaCl. The results obtained with Biology GENIII Microplates indicate the following substrates can be utilized: α‐d‐glucose, d‐mannose, d‐fructose, d‐fucose, d‐galactose, d‐mannitol, l‐alanine, l‐arginine, l‐aspartic acid, l‐glutamic acid, l‐pyroglutamic acid, l‐serine, d‐gluconic acid, mucic acid, quinic acid, d‐saccharic acid, l‐lactic acid, citric acid, α‐ketoglutaric acid, l‐malic acid, γ‐aminobutyric acid, β‐hydroxy‐d,l‐butyric acid, propionic acid, acetic acid, and N‐acetyl‐d‐glucosamine, but negative for dextrin, d‐maltose, d‐trehalose, d‐cellobiose, gentiobiose, sucrose, stachyose, d‐raffinose, α‐d‐lactose, d‐melibiose, β‐methyl‐d‐glucoside, d‐salicin, N‐acetyl‐β‐d‐mannosamine, N‐acetyl‐d‐galactosamine, N‐acetyl neuraminic acid, 3‐methyl glucose, l‐rhamnose, inosine, d‐sorbitol, d‐arabitol, myo‐inositol, d‐glucose‐6‐PO4, d‐fructose‐6‐PO4, d‐aspartic acid, d‐serine, gelatin, glycyl‐l‐proline, l‐histidine, pectin, d‐galacturonic acid, l‐galactonic acid lactone, d‐glucuronic acid, glucuronamide, p‐hydroxy‐phenylacetic acid, methyl pyruvate, d‐lactic acid methyl ester, d‐malic acid, Tween‐40, α‐hydroxybutyric acid, α‐ketobutyric acid, acetoacetic acid, and formic acid. According to API 20 NE tests, the organism is positive for the hydrolysis of gelatin, arginine dihydrolase, and assimilation of glucose, arabinose, mannose, mannitol, N‐acetyl‐glucosamine, potassium gluconate, capric acid, malic acid, and trisodium citrate, but negative for the reduction of nitrate to nitrogen and nitrogen, indole production, glucose fermentation, urease, hydrolysis of esculin and β‐galactosidase, and assimilation of maltose, adipic acid, and phenylacetic acid. According to API 50 CH tests, the organism is positive for acid production from l‐arabinose, d‐ribose, d‐xylose, d‐mannose, d‐mannitol, and d‐fucose, but negative for erythritol, d‐arabinose, l‐xylose, d‐adonitol, methyl‐β‐d‐xylopyranoside, d‐galactose, d‐fructose, d‐sorbose, l‐rhamnose, dulcitol, inositol, d‐sorbitol, methyl‐α‐d‐mannopyranoside, methyl‐α‐d‐glucopyranoside, amygdalin, arbutin, esculin, salicin, d‐cellobiose, d‐maltose, d‐melibiose, sucrose, d‐trehalose, inulin, d‐melezitose, d‐raffinose, starch, glycogen, xylitol, gentiobiose, d‐turanose, d‐lyxose, d‐tagatose, l‐fucose, d‐arabitol, l‐arabitol, potassium 2‐ketogluconate, and potassium 5‐ketogluconate. The predominant quinone system is Q‐9. Polar lipids are diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, three unidentified phospholipids, and one unidentified lipid. The type strain is MS586T (LMG 30275T, NRRL B‐65441T), isolated from the rhizosphere of soybean grown in Mississippi. The DNA G+C content of the type strain is 60.48 mol%.

CONFLICT OF INTEREST

None declared.

AUTHOR CONTRIBUTIONS

Jiayuan Jia: Formal analysis (equal); visualization (equal); writing – original draft (equal). Xiaoqiang Wang: Formal analysis (equal); investigation (equal); writing – original draft (equal). Peng Deng: Formal analysis (equal). Lin Ma: Formal analysis (equal); resources (equal). Sonya M. Baird: Methodology (equal). Xiangdong Li: Formal analysis (equal); funding acquisition (equal). Shi‐En Lu: Conceptualization (equal); formal analysis (equal); funding acquisition (equal); project administration (equal); writing – original draft (equal); writing – review & editing (equal).

ETHICS STATEMENT

None required.

ACKNOWLEDGMENTS

This study was supported by the National Institute of Food and Agriculture, United States Department of Agriculture (MIS‐401200). We appreciate Kate Phillips for English proofreading.

Appendix A.

FIGURE A1.

FIGURE A1

Open in a new tab

The cellular morphology of strain MS586T was observed by transmission electron microscopy

FIGURE A2.

FIGURE A2

Open in a new tab

Fingerprinting analysis of strain MS586T and strain MS82 based on analysis of BOX‐PCR: 1, strain MS586T; 2, strain MS82; Mk: 1‐kb DNA ladder (GoldBio) was used with markers

FIGURE A3.

FIGURE A3

Open in a new tab

Two‐dimensional TLC of polar lipids of strain MS586T. DPG, diphosphatidylglycerol; L, lipid; PE, phosphatidylethanolamine; PG, phosphatidylglycerol; PL, phospholipid

TABLE A1.

List of strains used in this study

Species Strain Source collection
Pseudomonas glycinae MS586 This study
Pseudomonas glycinae MS82 Ma et al. (2017)
Pseudomonas moraviensis 1B4 DSMZ
Pseudomonas jessenii CIP105274 DSMZ
Pseudomonas reinekei MT1 DSMZ
Pseudomonas vancouverensis DhA‐51 DSMZ
Pseudomonas baetica a390 DSMZ
Open in a new tab

DSMZ: German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany.

TABLE A2.

Accession numbers of the sequences of different Pseudomonas spp. strains used in the MLSA phylogenetic analysis

Species Gene name Accession number Strain designation Species Gene name Accession number Strain designation
P. glycinae 16S rRNA MG692779 MS586T P. glycinae 16S rRNA CP028826 MS82
rpoB CP014205 MS586T rpoB CP028826 MS82
rpoD CP014205 MS586T rpoD CP028826 MS82
gyrB CP014205 MS586T gyrB CP028826 MS82
P. fluorescens 16S rRNA CP000094 Pf0‐1 P. aeruginosa 16S rRNA CP012001 DSM 50071T
rpoB CP000094 Pf0‐1 rpoB CP012001 DSM 50071T
rpoD CP000094 Pf0‐1 rpoD CP012001 DSM 50071T
gyrB CP000094 Pf0‐1 gyrB CP012001 DSM 50071T
P. anguilliseptica 16S rRNA FNSC00000000 DSM 12111T P. arsenicoxydans 16S rRNA LT629705 CECT 7543T
rpoB FNSC00000000 DSM 12111T rpoB LT629705 CECT 7543T
rpoD FNSC00000000 DSM 12111T rpoD LT629705 CECT 7543T
gyrB FNSC00000000 DSM 12111T gyrB LT629705 CECT 7543T
P. avellanae 16S rRNA AKBS00000000 BPIC 631T P. baetica 16S rRNA PKLC00000000 a390T
rpoB AKBS00000000 BPIC 631T rpoB PKLC00000000 a390T
rpoD AKBS00000000 BPIC 631T rpoD PKLC00000000 a390T
gyrB AKBS00000000 BPIC 631T gyrB PKLC00000000 a390T
P. balearica 16S rRNA CP007511 DSM 6083T P. bauzanensis 16S rRNA FOGN00000000 DSM 22558T
rpoB CP007511 DSM 6083T rpoB FOGN00000000 DSM 22558T
rpoD CP007511 DSM 6083T rpoD FOGN00000000 DSM 22558T
gyrB CP007511 DSM 6083T gyrB FOGN00000000 DSM 22558T
P. brassicacearum 16S rRNA LT629713 LMG 21623T P. brenneri 16S rRNA VFIL00000000 DSM 15294T
rpoB LT629713 LMG 21623T rpoB VFIL00000000 DSM 15294T
rpoD LT629713 LMG 21623T rpoD VFIL00000000 DSM 15294T
gyrB LT629713 LMG 21623T gyrB VFIL00000000 DSM 15294T
P. capeferrum 16S rRNA JMIT00000000 WCS358T P. corrugata 16S rRNA LHVK00000000 DSM 7228T
rpoB JMIT00000000 WCS358T rpoB LHVK00000000 DSM 7228T
rpoD JMIT00000000 WCS358T rpoD LHVK00000000 DSM 7228T
gyrB JMIT00000000 WCS358T gyrB LHVK00000000 DSM 7228T
P. fluorescens 16S rRNA LT907842 ATCC 13525T P. frederiksbergensis 16S rRNA FNTF00000000 LMG 19851T
rpoB LT907842 ATCC 13525T rpoB FNTF00000000 LMG 19851T
rpoD LT907842 ATCC 13525T rpoD FNTF00000000 LMG 19851T
gyrB LT907842 ATCC 13525T gyrB FNTF00000000 LMG 19851T
P. fulva 16S rRNA BBIQ00000000 NBRC 16637T P. gessardii 16S rRNA VFEW00000000 DSM 17152T
rpoB BBIQ00000000 NBRC 16637T rpoB VFEW00000000 DSM 17152T
rpoD BBIQ00000000 NBRC 16637T rpoD VFEW00000000 DSM 17152T
gyrB BBIQ00000000 NBRC 16637T gyrB VFEW00000000 DSM 17152T
P. graminis 16S rRNA FOHW00000000 DSM 11363T P. granadensis 16S rRNA LT629778 LMG 27940T
rpoB FOHW00000000 DSM 11363T rpoB LT629778 LMG 27940T
rpoD FOHW00000000 DSM 11363T rpoD LT629778 LMG 27940T
gyrB FOHW00000000 DSM 11363T gyrB LT629778 LMG 27940T
P. helmanticensis 16S rRNA HG940537 OHA11T P. jessenii 16S rRNA NIWT01000000 DSM 17150T
rpoB HG940518 OHA11T rpoB NIWT01000000 DSM 17150T
rpoD HG940517 OHA11T rpoD NIWT01000000 DSM 17150T
gyrB HG940516 OHA11T gyrB NIWT01000000 DSM 17150T
P. koreensis 16S rRNA LT629687 LMG 21318T P. kribbensis 16S rRNA CP029608 46‐2T
rpoB LT629687 LMG 21318T rpoB CP029608 46‐2T
rpoD LT629687 LMG 21318T rpoD CP029608 46‐2T
gyrB LT629687 LMG 21318T gyrB CP029608 46‐2T
P. laurylsulfatiphila 16S rRNA NIRS00000000 AP3_16T P. laurylsulfativorans 16S rRNA MUJK00000000 AP3_22T
rpoB NIRS00000000 AP3_16T rpoB MUJK00000000 AP3_22T
rpoD NIRS00000000 AP3_16T rpoD MUJK00000000 AP3_22T
gyrB NIRS00000000 AP3_16T gyrB MUJK00000000 AP3_22T
P. libanensis 16S rRNA JYLH00000000 DSM 17149T P. lini 16S rRNA JYLB00000000 DSM 16768T
rpoB JYLH00000000 DSM 17149T rpoB JYLB00000000 DSM 16768T
rpoD JYLH00000000 DSM 17149T rpoD JYLB00000000 DSM 16768T
gyrB JYLH00000000 DSM 17149T gyrB JYLB00000000 DSM 16768T
P. linyingensis 16S rRNA FNZE00000000 LMG 25967T P. litoralis 16S rRNA LT629748 2SM5T
rpoB FNZE00000000 LMG 25967T rpoB LT629748 2SM5T
rpoD FNZE00000000 LMG 25967T rpoD LT629748 2SM5T
gyrB FNZE00000000 LMG 25967T gyrB LT629748 2SM5T
P. lundensis 16S rRNA JYKY00000000 DSM 6252T P. lutea 16S rRNA JRMB00000000 DSM 17257T
rpoB JYKY00000000 DSM 6252T rpoB JRMB00000000 DSM 17257T
rpoD JYKY00000000 DSM 6252T rpoD JRMB00000000 DSM 17257T
gyrB JYKY00000000 DSM 6252T gyrB JRMB00000000 DSM 17257T
P. mandelii 16S rRNA LT629796 LMG 21607T P. migulae 16S rRNA FNTY00000000 LMG 21608T
rpoB LT629796 LMG 21607T rpoB FNTY00000000 LMG 21608T
rpoD LT629796 LMG 21607T rpoD FNTY00000000 LMG 21608T
gyrB LT629796 LMG 21607T gyrB FNTY00000000 LMG 21608T
P. mohnii 16S rRNA FNRV01000000 DSM 18327T P. moorei 16S rRNA VZPP00000000 CCUG 53114T
rpoB FNRV01000000 DSM 18327T rpoB VZPP00000000 CCUG 53114T
rpoD FNRV01000000 DSM 18327T rpoD VZPP00000000 CCUG 53114T
gyrB FNRV01000000 DSM 18327T gyrB VZPP00000000 CCUG 53114T
P. moraviensis 16S rRNA LT629788 LMG 24280T P. oleovorans 16S rRNA UGUV00000000 NCTC10692T
rpoB LT629788 LMG 24280T rpoB UGUV00000000 NCTC10692T
rpoD LT629788 LMG 24280T rpoD UGUV00000000 NCTC10692T
gyrB LT629788 LMG 24280T gyrB UGUV00000000 NCTC10692T
P. oryzihabitans 16S rRNA BBIT00000000 NBRC 102199T P. otitidis 16S rRNA FOJP00000000 DSM 17224T
rpoB BBIT00000000 NBRC 102199T rpoB FOJP00000000 DSM 17224T
rpoD BBIT00000000 NBRC 102199T rpoD FOJP00000000 DSM 17224T
gyrB BBIT00000000 NBRC 102199T gyrB FOJP00000000 DSM 17224T
P. panipatensis 16S rRNA FNDS00000000 CCM 7469T P. peli 16S rRNA FMTL00000000 DSM 17833T
rpoB FNDS00000000 CCM 7469T rpoB FMTL00000000 DSM 17833T
rpoD FNDS00000000 CCM 7469T rpoD FMTL00000000 DSM 17833T
gyrB FNDS00000000 CCM 7469T gyrB FMTL00000000 DSM 17833T
P. pertucinogena 16S rRNA AB021380 IFO 14163T P. prosekii 16S rRNA LT629762 LMG 26867T
rpoB AJ717441 LMG 1874T rpoB LT629762 LMG 26867T
rpoD FN554502 LMG 1874T rpoD LT629762 LMG 26867T
gyrB DQ350613 JCM 11950T gyrB LT629762 LMG 26867T
P. psychrotolerans 16S rRNA FMWB00000000 DSM 15758T P. punonensis 16S rRNA FRBQ00000000 CECT 8089T
rpoB FMWB00000000 DSM 15758T rpoB FRBQ00000000 CECT 8089T
rpoD FMWB00000000 DSM 15758T rpoD FRBQ00000000 CECT 8089T
gyrB FMWB00000000 DSM 15758T gyrB FRBQ00000000 CECT 8089T
P. putida 16S rRNA AP013070 NBRC 14164T P. reinekei 16S rRNA MSTQ00000000 MT1T
rpoB AP013070 NBRC 14164T rpoB MSTQ00000000 MT1T
rpoD AP013070 NBRC 14164T rpoD MSTQ00000000 MT1T
gyrB AP013070 NBRC 14164T gyrB MSTQ00000000 MT1T
P. resinovorans 16S rRNA AUIE00000000 DSM 21078T P. sagittaria 16S rRNA FOXM00000000 JCM 18195T
rpoB AUIE00000000 DSM 21078T rpoB FOXM00000000 JCM 18195T
rpoD AUIE00000000 DSM 21078T rpoD FOXM00000000 JCM 18195T
gyrB AUIE00000000 DSM 21078T gyrB FOXM00000000 JCM 18195T
P. straminea 16S rRNA FOMO01000000 JCM 2783T P. stutzeri 16S rRNA CP002881 CGMCC 1.1803T
rpoB FOMO01000000 JCM 2783T rpoB CP002881 CGMCC 1.1803T
rpoD FOMO01000000 JCM 2783T rpoD CP002881 CGMCC 1.1803T
gyrB FOMO01000000 JCM 2783T gyrB CP002881 CGMCC 1.1803T
P. synxantha 16S rRNA LR590482 NCTC10696T P. syringae 16S rRNA JALK00000000 DSM 10604T
rpoB LR590482 NCTC10696T rpoB JALK00000000 DSM 10604T
rpoD LR590482 NCTC10696T rpoD JALK00000000 DSM 10604T
gyrB LR590482 NCTC10696T gyrB JALK00000000 DSM 10604T
P. taeanensis 16S rRNA AWSQ00000000 MS‐3T P. taetrolens 16S rRNA LS483370 NCTC 10697T
rpoB AWSQ00000000 MS‐3T rpoB LS483370 NCTC 10697T
rpoD AWSQ00000000 MS‐3T rpoD LS483370 NCTC 10697T
gyrB AWSQ00000000 MS‐3T gyrB LS483370 NCTC 10697T
P. tolaasii 16S rRNA PHHD00000000 NCPPB 2192T P. toyotomiensis 16S rRNA NIQV00000000 DSM 26169T
rpoB PHHD00000000 NCPPB 2192T rpoB NIQV00000000 DSM 26169T
rpoD PHHD00000000 NCPPB 2192T rpoD NIQV00000000 DSM 26169T
gyrB PHHD00000000 NCPPB 2192T gyrB NIQV00000000 DSM 26169T
P. tremae 16S rRNA LJRO00000000 ICMP9151T P. umsongensis 16S rRNA NIWU00000000 DSM 16611T
rpoB LJRO00000000 ICMP9151T rpoB NIWU00000000 DSM 16611T
rpoD LJRO00000000 ICMP9151T rpoD NIWU00000000 DSM 16611T
gyrB LJRO00000000 ICMP9151T gyrB NIWU00000000 DSM 16611T
P. vancouverensis 16S rRNA RRZK00000000 Dha‐51T Acinetobacter baumannii 16S rRNA MJHA00000000 ATCC 19606T
rpoB RRZK00000000 Dha‐51T rpoB MJHA00000000 ATCC 19606T
rpoD RRZK00000000 Dha‐51T rpoD MJHA00000000 ATCC 19606T
gyrB RRZK00000000 Dha‐51T gyrB MJHA00000000 ATCC 19606T
Open in a new tab

TABLE A3.

Accession numbers of the sequences of different Pseudomonas spp. strains used in the whole‐genome phylogenetic analysis

Species Accession number Strain designation
P. glycinae GCA_001594225 MS586T
P. glycinae GCA_003055645 MS82
P. fluorescens GCA_000012445 Pf0‐1
P. arsenicoxydans GCA_900103875 CECT 7543T
P. baetica GCA_002813455 LMG 25716T
P. batumici GCA_000820515 UCM B‐321T
P. chlororaphis GCA_001269625 LMG 5004T
P. frederiksbergensis GCA_900105495 LMG 19851T
P. granadensis GCA_900105485 LMG 27940T
P. jessenii GCA_002236115 DSM 17150T
P. koreensis GCA_900101415 LMG 21318T
P. kribbensis GCA_003352185 46‐2T
P. laurylsulfatiphila GCA_002934665 AP3_16T
P. laurylsulfativorans GCA_002906155 AP3_22T
P. lini GCA_001042905 DSM 16768T
P. moorei GCA_900102045 DSM 12647T
P. moraviensis GCA_900105805 LMG 24280T
P. prosekii GCA_900105155 LMG 26867T
P. reinekei GCA_001945365 MT1T
P. vancouverensis GCA_900105825 LMG 202221T
Open in a new tab

Jia J, Wang X, Deng P, et al., Pseudomonas glycinae sp. nov. isolated from the soybean rhizosphere. MicrobiologyOpen. 2020;9:e1101 10.1002/mbo3.1101

DATA AVAILABILITY STATEMENT

The GenBank accession numbers for the complete genome of Pseudomonas glycinae MS586T and the full‐length sequence of 16S rDNA are CP014205 and MG692779, respectively. The type strain MS586T was deposited in the ARS Culture Collection, National Center for Agricultural Utilization Research, Peoria, IL, USA (Culture collection 1 accession #NRRL B‐6544: https://nrrl.ncaur.usda.gov/cgi‐bin/usda/prokaryote/report.html?nrrlcodes=B‐65441), and the BCCM/LMG Bacteria Collection, Laboratorium voor Microbiologie, Universiteit Gent, Belgium (Culture collection 2 accession #LMG 30275: https://bccm.belspo.be/catalogues/lmg-strain-details?NUM=30275).

REFERENCES

  1. Angiuoli, S. V. , Gussman, A. , Klimke, W. , Cochrane, G. , Field, D. , Garrity, G. M. , … White, O. (2008). Toward an online repository of standard operating procedures (SOPs) for (meta) genomic annotation. OMICS A Journal of Integrative Biology, 12(2), 137–141. 10.1089/omi.2008.0017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Camara, B. , Strömpl, C. , Verbarg, S. , Spröer, C. , Pieper, D. H. , & Tindall, B. J. (2007). Pseudomonas reinekei sp. nov., Pseudomonas moorei sp. nov. and Pseudomonas mohnii sp. nov., novel species capable of degrading chlorosalicylates or isopimaric acid. International Journal of Systematic and Evolutionary Microbiology, 57(5), 923–931. 10.1099/ijs.0.64703-0 [DOI] [PubMed] [Google Scholar]
  3. Chang, D.‐H. , Rhee, M.‐S. , Kim, J.‐S. , Lee, Y. , Park, M. Y. , Kim, H. , … Kim, B.‐C. (2016). Pseudomonas kribbensis sp. nov., isolated from garden soils in Daejeon, Korea. Antonie Van Leeuwenhoek, 109(11), 1433–1446. 10.1007/s10482-016-0743-0 [DOI] [PubMed] [Google Scholar]
  4. Chelius, M. K. , & Triplett, E. W. (2000). Immunolocalization of dinitrogenase reductase produced by Klebsiella pneumoniae in association with Zea mays L. Applied and Environmental Microbiology, 66, 783–787. 10.1128/AEM.66.2.783-787.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Doyle, J. J. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19, 11–15. [Google Scholar]
  6. Durfee, T. , Nelson, R. , Baldwin, S. , Plunkett, G. , Burland, V. , Mau, B. , … Blattner, F. R. (2008). The complete genome sequence of Escherichia coli DH10B: Insights into the biology of a laboratory workhorse. Journal of Bacteriology, 190(7), 2597–2606. 10.1128/JB.01695-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Furmanczyk, E. M. , Kaminski, M. A. , Lipinski, L. , Dziembowski, A. , & Sobczak, A. (2018). Pseudomonas laurylsulfatovorans sp. nov., sodium dodecyl sulfate degrading bacteria, isolated from the peaty soil of a wastewater treatment plant. Systematic and Applied Microbiology, 41(4), 348–354. 10.1016/j.syapm.2018.03.009 [DOI] [PubMed] [Google Scholar]
  8. Gomila, M. , Peña, A. , Mulet, M. , Lalucat, J. , & García‐Valdés, E. (2015). Phylogenomics and systematics in Pseudomonas . Frontiers in Microbiology, 6, 214 10.3389/fmicb.2015.00214 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Gu, G. , Wang, N. , Chaney, N. , Smith, L. , & Lu, S.‐E. (2009). AmbR1 is a key transcriptional regulator for production of antifungal activity of Burkholderia contaminans strain MS14. FEMS Microbiology Letters, 297(1), 54–60. 10.1111/j.1574-6968.2009.01653.x [DOI] [PubMed] [Google Scholar]
  10. Hesse, C. , Schulz, F. , Bull, C. T. , Shaffer, B. T. , Yan, Q. , Shapiro, N. , … Paulsen, I. T. (2018). Genome‐based evolutionary history of Pseudomonas spp. Environmental Microbiology, 20(6), 2142–2159. 10.1111/1462-2920.14130 [DOI] [PubMed] [Google Scholar]
  11. Hildebrand, D. , Palleroni, N. , Hendson, M. , Toth, J. , & Johnson, J. (1994). Pseudomonas flavescens sp. nov., isolated from walnut blight cankers. International Journal of Systematic and Evolutionary Microbiology, 44, 410–415. 10.1099/00207713-44-3-410 [DOI] [PubMed] [Google Scholar]
  12. Kim, M. , Oh, H.‐S. , Park, S.‐C. , & Chun, J. (2014). Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. International Journal of Systematic and Evolutionary Microbiology, 64, 346–351. 10.1099/ijs.0.059774-0 [DOI] [PubMed] [Google Scholar]
  13. King, E. O. , Ward, M. K. , & Raney, D. E. (1954). Two simple media for the demonstration of pyocyanin and fluorescein. The Journal of Laboratory and Clinical Medicine, 44(2), 301–307. [PubMed] [Google Scholar]
  14. Koeuth, T. , Versalovic, J. , & Lupski, J. R. (1995). Differential subsequence conservation of interspersed repetitive Streptococcus pneumoniae BOX elements in diverse bacteria. Genome Research, 5(4), 408–418. 10.1101/gr.5.4.408 [DOI] [PubMed] [Google Scholar]
  15. Konstantinidis, K. T. , & Tiedje, J. M. (2005). Genomic insights that advance the species definition for prokaryotes. Proceedings of the National Academy of Sciences of the United States of America, 102(7), 2567–2572. 10.1073/pnas.0409727102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kumar, S. , Stecher, G. , & Tamura, K. (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33(7), 1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Lane, D. J. (1991). 16S/23S rRNA sequencing In Stackebrandt E., & Goodfellow M. (Eds.), Nucleic acid techniques in bacterial systematics (pp. 125–175). New York, NY: John Wiley & Sons. [Google Scholar]
  18. Lopes, L. D. , Davis, E. W. , Pereira e Silva, M. D. C. , Weisberg, A. J. , Bresciani, L. , … Andreote, F. D. (2018). Tropical soils are a reservoir for fluorescent Pseudomonas spp. biodiversity. Environmental Microbiology, 20(1), 62–74. 10.1111/1462-2920.13957 [DOI] [PubMed] [Google Scholar]
  19. López, J. R. , Diéguez, A. L. , Doce, A. , De la Roca, E. , De la Herran, R. , Navas, J. I. , … Romalde, J. L. (2012). Pseudomonas baetica sp. nov., a fish pathogen isolated from wedge sole, Dicologlossa cuneata (Moreau). International Journal of Systematic and Evolutionary Microbiology, 62(4), 874–882. 10.1099/ijs.0.030601-0 [DOI] [PubMed] [Google Scholar]
  20. Ma, L. , Qu, S. , Lin, J. , Jia, J. , Baird, S. M. , Jiang, N. , … Lu, S.‐E. (2019). The complete genome of the antifungal bacterium Pseudomonas sp. strain MS82. Journal of Plant Diseases and Protection, 126(2), 153–160. 10.1007/s41348-019-00205-z [DOI] [Google Scholar]
  21. Ma, L. , Wang, X. , Deng, P. , Baird, S. M. , Liu, Y. , Qu, S. , & Lu, S.‐E. (2017). The PafR gene is required for antifungal activity of strain MS82 against Mycogone perniciosa . Advances in Microbiology, 7(4), 217–230. 10.4236/aim.2017.74018 [DOI] [Google Scholar]
  22. Meier‐Kolthoff, J. P. , Auch, A. F. , Klenk, H.‐P. , & Göker, M. (2013). Genome sequence‐based species delimitation with confidence intervals and improved distance functions. BMC Bioinformatics, 14(1), 60 10.1186/1471-2105-14-60 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Meier‐Kolthoff, J. P. , & Göker, M. (2019). TYGS is an automated high‐throughput platform for state‐of‐the‐art genome‐based taxonomy. Nature Communications, 10(1), 1–10. 10.1038/s41467-019-10210-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Migula, W. (1894). Über ein neues system der bakterien. Arb Bakteriol Inst Karlsruhe, 1, 235–238. [Google Scholar]
  25. Moore, E. R. B. , Mau, M. , Arnscheidt, A. , Böttger, E. C. , Hutson, R. A. , Collins, M. D. , … Timmis, K. N. (1996). The determination and comparison of the 16S rRNA gene sequences of species of the genus Pseudomonas (sensu stricto) and estimation of the natural intrageneric relationships. Systematic and Applied Microbiology, 19, 478–492. 10.1016/S0723-2020(96)80021-X [DOI] [Google Scholar]
  26. Moore, E. R. , Tindall, B. J. , Martins Dos Santos, V. , Pieper, D. H. , Ramos, J.‐L. , & Palleroni, N. J. (2006). Nonmedical: Pseudomonas . The Prokaryotes, 6, 646–703. [Google Scholar]
  27. Mootz, H. D. , & Marahiel, M. A. (1997). Biosynthetic systems for nonribosomal peptide antibiotic assembly. Current Opinion in Chemical Biology, 1(4), 543–551. 10.1016/S1367-5931(97)80051-8 [DOI] [PubMed] [Google Scholar]
  28. Mulet, M. , Bennasar, A. , Lalucat, J. , & García‐Valdés, E. (2009). An rpoD‐based PCR procedure for the identification of Pseudomonas species and for their detection in environmental samples. Molecular and Cellular Probes, 23, 140–147. 10.1016/j.mcp.2009.02.001 [DOI] [PubMed] [Google Scholar]
  29. Murray, R. G. E. , Doetsch, R. N. , & Robinow, C. F. (1994). Determination and cytological light microscopy In Gerhardt P., Murray R. G. E., Wood W. A., & Krieg N. R. (Eds.), Methods for general and molecular bacteriology (pp. 32–34). Washington, DC: American Society for Microbiology. [Google Scholar]
  30. Oueslati, M. , Mulet, M. , Gomila, M. , Berge, O. , Hajlaoui, M. R. , Lalucat, J. , & García‐Valdés, E. (2019). New species of pathogenic Pseudomonas isolated from citrus in Tunisia: Proposal of Pseudomonas kairouanensis sp. nov. and Pseudomonas nabeulensis sp. nov. Systematic and Applied Microbiology, 42(3), 348–359. 10.1016/j.syapm.2019.03.002 [DOI] [PubMed] [Google Scholar]
  31. Palleroni, N. J. (1994). Pseudomonas classification. A new case history in the taxonomy of gram‐negative bacteria. Antonie Van Leeuwenhoek, 64, 231–251. 10.1007/BF00873084 [DOI] [PubMed] [Google Scholar]
  32. Palleroni, N. J. (2005). Genus I. Pseudomonas migula 1894, 237AL (Nom. Cons., Opin. 5 of the Jud. Comm. 1952, 121) In Boone D. R., Brenner D. J., Castenholz R. W., Garrity G. M., Krieg N. R., & Staley J. T. (Eds.), Bergey's manual of systematic bacteriology (2nd ed., pp. 323–379). New York, NY: Springer. [Google Scholar]
  33. Pascual, J. , García‐López, M. , Bills, G. F. , & Genilloud, O. (2015). Pseudomonas granadensis sp. nov., a new bacterial species isolated from the Tejeda, Almijara and Alhama Natural Park, Granada, Spain. International Journal of Systematic and Evolutionary Microbiology, 65(2), 625–632. 10.1099/ijs.0.069260-0 [DOI] [PubMed] [Google Scholar]
  34. Pascual, J. , Macián, M. C. , Arahal, D. R. , Garay, E. , & Pujalte, M. J. (2010). Multilocus sequence analysis of the central clade of the genus Vibrio by using the 16S rRNA, recA, pyrH, rpoD, gyrB, rctB and toxR genes. International Journal of Systematic and Evolutionary Microbiology, 60, 154–165. 10.1099/ijs.0.010702-0 [DOI] [PubMed] [Google Scholar]
  35. Peix, A. , Berge, O. , Rivas, R. , Abril, A. , & Velázquez, E. (2005). Pseudomonas argentinensis sp. nov., a novel yellow pigment‐producing bacterial species, isolated from rhizospheric soil in Cordoba, Argentina. International Journal of Systematic and Evolutionary Microbiology, 55(3), 1107–1112. 10.1099/ijs.0.63445-0 [DOI] [PubMed] [Google Scholar]
  36. Peix, A. , Ramirez‐Bahena, M.‐H. , & Velazquez, E. (2018). The current status on the taxonomy of Pseudomonas revisited: An update. Infection, Genetics and Evolution, 57, 106–116. 10.1016/j.meegid.2017.10.026 [DOI] [PubMed] [Google Scholar]
  37. Richter, M. , & Rosselló‐Móra, R. (2009). Shifting the genomic gold standard for the prokaryotic species definition. Proceedings of the National Academy of Sciences of the United States of America, 106, 19126–19131. 10.1073/pnas.0906412106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rosselló‐Móra, R. , & Amann, R. (2015). Past and future species definitions for bacteria and Archaea . Systematic and Applied Microbiology, 38, 209–216. 10.1016/j.syapm.2015.02.001 [DOI] [PubMed] [Google Scholar]
  39. Rosselló‐Móra, R. , & Whitman, W. B. (2018). Dialogue on the nomenclature and classification of prokaryotes. Systematic and Applied Microbiology, 42(1), 5–14. 10.1016/j.syapm.2018.07.002 [DOI] [PubMed] [Google Scholar]
  40. Sasser, M. (1990). Identification of bacteria by gas chromatography of cellular fatty acids. MIDI Technical Note #101. [Google Scholar]
  41. Sneath, P. H. A. , Stevens, M. , & Sackin, M. J. (1981). Numerical taxonomy of Pseudomonas based on published records of substrate utilization. Antonie Van Leeuwenhoek, 47, 423–448. 10.1007/BF00426004 [DOI] [PubMed] [Google Scholar]
  42. Tayeb, L. A. , Ageron, E. , Grimont, F. , & Grimont, P. (2005). Molecular phylogeny of the genus Pseudomonas based on rpoB sequences and application for the identification of isolates. Research in Microbiology, 156, 763–773. 10.1016/j.resmic.2005.02.009 [DOI] [PubMed] [Google Scholar]
  43. Tvrzová, L. , Schumann, P. , Spröer, C. , Sedláček, I. , Páčová, Z. , Šedo, O. , … Lang, E. (2006). Pseudomonas moraviensis sp. nov. and Pseudomonas vranovensis sp. nov., soil bacteria isolated on nitroaromatic compounds, and emended description of Pseudomonas asplenii . International Journal of Systematic and Evolutionary Microbiology, 56(11), 2657–2663. 10.1099/ijs.0.63988-0 [DOI] [PubMed] [Google Scholar]
  44. Vidaver, A. M. (1967). Synthetic and complex media for the rapid detection of fluorescence of phytopathogenic pseudomonads: Effect of the carbon source. Papers in Plant Pathology, 15, 1523–1524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Yamamoto, S. , Kasai, H. , Arnold, D. L. , Jackson, R. W. , Vivian, A. , & Harayama, S. (2000). Phylogeny of the genus Pseudomonas: Intrageneric structure reconstructed from the nucleotide sequences of gyrB and rpoD genes. Microbiology, 146, 2385–2394. 10.1099/00221287-146-10-2385 [DOI] [PubMed] [Google Scholar]
  46. Ye, Y. , Chen, C. , Ren, Y. , Wang, R. , Zhang, C. , Han, S. , … Wu, M. (2019). Pseudomonas mangrovi sp. nov., isolated from mangrove soil. International Journal of Systematic and Evolutionary Microbiology, 69(2), 377–383. 10.1099/ijsem.0.003141 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The GenBank accession numbers for the complete genome of Pseudomonas glycinae MS586T and the full‐length sequence of 16S rDNA are CP014205 and MG692779, respectively. The type strain MS586T was deposited in the ARS Culture Collection, National Center for Agricultural Utilization Research, Peoria, IL, USA (Culture collection 1 accession #NRRL B‐6544: https://nrrl.ncaur.usda.gov/cgi‐bin/usda/prokaryote/report.html?nrrlcodes=B‐65441), and the BCCM/LMG Bacteria Collection, Laboratorium voor Microbiologie, Universiteit Gent, Belgium (Culture collection 2 accession #LMG 30275: https://bccm.belspo.be/catalogues/lmg-strain-details?NUM=30275).

Articles from MicrobiologyOpen are provided here courtesy of Wiley

RESOURCES