Skip to main content
International Journal of Reproductive Biomedicine logoLink to International Journal of Reproductive Biomedicine
. 2020 Sep 20;18(9):733–746. doi: 10.18502/ijrm.v13i9.7668

Improvement in the epigenetic modification and development competence in PCOS mice oocytes by hydro-alcoholic extract of Nigella sativa during in-vitro maturation: An experimental study

Fatemeh Eini 1, Khojasteh Joharchi 2, Maryam Azizi Kutenaei 1, Pegah Mousavi 1,3
PMCID: PMC7521171  PMID: 33062919

Abstract

Background

Nigella Sativa (NS) and its active component, thymoquinone, have beneficial protective effects on experimental animal models of polycystic ovary syndrome (PCOS) and different human diseases.

Objective

The present study aimed to investigate the effects of NS hydro-alcoholic extract (NSE) on the oocyte quality of PCOS mice during in vitro maturation.

Materials and Methods

For induction of PCOS, 40 prepubertal 21-days old female B6D2F1 mice (18-22 g body weight) received subcutaneous dehydroepiandrosterone daily. After validation of the model, germinal vesicle-stage oocytes of superovulated mice were collected and placed in the culture medium containing different concentrations (0, 1, 50, and 100 μg/ml) of NSE. For the measurement of developmental competency, some mature oocytes were fertilized with epididymal spermatozoa. Other mature oocytes were assessed for oxidative stress. Also, some mRNA expression levels involved in oocyte maturation and epigenetic modification were evaluated.

Results

The 50 μg/ml NSE treated group showed significantly higher r ates o f maturation, f ertilization, and blastocyst formation in comparison with both control and PCOS groups. A high level of glutathione concentration and glutathione peroxidase mRNA expression, besides a low level of reactive oxygen species content all, were observed in oocytes treated with 50 μg/ml NSE, indicating the modification of oxidative statue. Furthermore, the oocytes in the 50 μg/ml-treated group showed an upregulation of mRNA expression in epigenetic-related genes (Dnmt1 and Hdac1) and maternally derived genes (Mapk and Cdk1), correspondingly downregulation of cyclooxygenase2 mRNA expression, in comparison to other groups.

Conclusion

The results of this study indicated that 50 μg/ml NSE improves oocyte maturation, oxidative statues and epigenetic modifications. These may be the all reasons for the developmental competency in the control and PCOS mice oocytes.

Keywords: Epigenetic modification, In-vitro maturation, Nigella sativa, Oxidative stress, Polycystic ovary syndrome

1. Introduction

In vitro maturation (IVM) of oocytes has been introduced as an alternative treatment to traditional stimulated in vitro fertilization (IVF) technique, as IVM could be safely used by patients who are at a high risk of ovarian hyperstimulation, especially polycystic ovary syndrome (PCOS) (1). Although many newborns have been registered after human IVM treatment, in vitro condition can be improved by natural supplements (2). Adding typical supplements such as cysteine, homocysteine, melatonin, vitamin E, vitamin C, etc. can upgrade basal clinical IVM media (3-5). The beneficial protective activities of these additives are attributed to the potent antioxidant property during IVM. Nigella sativa (NS) and its potent constituent, thymoquinone (TQ), is widely known as a medicinal plant for improving general health due to the various pharmacological properties and therapeutic potentials (6).

A basic animal study suggested that NS with adequate concentration has many therapeutic effects such as anti-inflammatory (7) and antioxidant (8) properties. Furthermore, TQ induces some endogenous antioxidants such as superoxide dismutase, catalase, glutathione S-transferases (GST), glutathione peroxidase (GPX), and glutathione (GSH), all modulating oxidative stress in a suboptimal state like organ dysfunction (6). However, it should be noted that the beneficial effects of NS may not be limited only due to the presence of TQ, because other components in the extract such as GSH and vitamins may also influence oocyte maturation (9). Epigenetic modification showed to be affected by the culture medium and its ingredients (10). Generally, epigenetic modification is modulated by enzymes such as DNA methyltransferase and histone deacetylase, the key regulators during oocyte maturation (11, 12). Chromosomal condensation, appropriate stored mRNA levels, and synchronized nuclear and cytoplasmic maturation are three crucial factors for the developmental competency in oocyte (13, 14). At present, there is a gap of knowledge about how epigenetic modification aspects could be changed by antioxidant supplements. A recent study reported that hyperandrogenism and reactive oxygen species (ROS) production impaired chromosome condensation in PCOS mice model (15).

Therefore, in this study, NS extract was taken into account due to some competent activities which directly modulated epigenetic-related enzymes during IVM. Besides, nuclear and cytoplasmic maturation, ROS and GSH contents, oxidative stress levels, and expression of epigenetic-related genes in oocytes were investigated for both control and PCOS mice models. The effects of the different concentrations of NS hydro-alcoholic extract (NSE) were investigated on oocyte quality along with the potential mechanisms involved in this development.

2. Materials and Methods

In this experimental study, all chemicals were purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA) (exceptions included).

Preparation of alcoholic NS extraction

The seeds of NS were purchased from a local herb market and the taxonomic identification of the seeds was confirmed by a senior plant taxonomist while giving the herbarium number of PMP-1735. The extract was prepared according to the Word Health Organization (WHO) protocol CG-04 (16). The dried seeds (100 gr) were powdered and then applied to Soxhlet for the extraction with 50% ethanol. The resultant alcoholic extract was filtered using a filter paper (Whatman No. 3) and then evaporated at 40°C to dry in vacuum. The extract was stored at -20°C until use (yield 12%). A stock solution of NSE was prepared in dimethyl sulfoxide (DMSO), and suitable working concentrations were prepared from the stock using a complete medium. The stock solution of NS was prepared as 100 mg/ml in DMSO, and was diluted in IVM medium to reach the final concentrations of 0, 1, 50, and 100 µg/ml. In the control group, oocytes were only cultured in IVM medium containing 0.1% (v/v) of DMSO (final concentration of DMSO ≤ 0.1%). No difference was observed between the presence or absence of DMSO, indicating that the DMSO at the tested concentrations did not influence the results.

Induction and validation of PCOS mice model

In this experimental study, 80 prepubertal 21-day old female B6D2F1 (18-22 g body weight) mice were randomly divided into two groups, treatment and control (n = 40/ each). They were housed in an animal room with an ambient temperature of 20-24°C and a 12 hr light/dark cycle. All mice had free access to food and water. They received a daily subcutaneous shot of either a mixture of 100 µl solution of dehydroepiandrosterone (DHEA) 60 mg/kg body weight dissolved in a 9/1 mixture of sesame oil/95% ethanol (treatment) or 100 µl sesame oil/95% ethanol (control) for 20 consecutive days. Model validity was described and confirmed by acyclicity, ovarian histopathology and hormonal abnormality in our recent study (15, 17). During oocyte quality assessment, 2 to 3 mice per group were used in each experiment except for 3 or 5 per group used in IVM and IVF.

Collection of mice oocytes

After PCOS confirmation, the mice in both groups, 6-8 wks of age, were superovulated with intraperitoneal injection of 10 IU pregnant mare's serum gonadotropin and sacrificed 46-48 hr later. Both the ovaries were excised and washed twice in 37°C sterile physiological saline (containing 100 IU/L penicillin and 50 mg/L streptomycin). Cumulus oocyte complexes (COCs) were physically retrieved fromantral follicles (2-8 mm in diameter) in HEPES-buffered tissue culture medium using a pair of 27-G needles under a stereomicroscope (Nikon, SMZ645, Tokyo, Japan). The buffer was improved with 5% (v/v) heat-inactivated fetal bovine serum (FBS; GIBCO BRL Invitrogen, USA). After washing 3-times with tissue culture medium (TCM-199), only the COCs with at least three layers of compact cumulus cells and uniform ooplasm were taken as normal for use in all experiments. Approximately 20-30 COCs per animal were isolated from the mice (17).

In vitro maturation

Maturation medium contained of TCM-199, supplemented with 10 μg/mL follicle-stimulating hormone (FSH), 10 μg/mL luteinizing hormone (LH), 10% (v/v) fetal bovine serum (FBS, 24.2 mg/l sodium pyruvate, and 1 μg/ml 17-β estradiol at 37°C and 5% CO2. Then, immediately, NSE from prepared stock was added to the maturation medium for preparation of different IVM groups (0, 1, 50, and 100 µg/ml). After that, a total number of 10-15 normal COCs were cultured in 50 µL microdrop of 4 mentioned concentrations. The oocytes were then separated from cumulus cells by mechanical pipetting after 22-24 hrs. The first polar body extrusion was considered as the criteria for the metaphase II (MII)-stage oocyte rate. Moreover, oocytes were selected according to normal morphological criteria with a round, clear zona pellucida, a small perivitelline space, and a pale moderately granular cytoplasm that did not contain inclusions (18). Only normal oocytes were used in following tests.

In vitro fertilization and embryo culture

After oocyte maturation, IVF was performed with normal spermatozoa retrieved from the cauda-epididymis and vas deferens of 10-12-wk-old B6D2F1 male mice in different IVM groups. The washed sperm were capacitated in enhanced ham's-F10 with 5 mg/ml BSA. Then, Groups of 20 MII oocytes were placed to 120 μl fertilization droplets (potassium simplex optimized medium, KSOM, with 15 mg/ml BSA) with capacitated spermatozoa at the concentration of about 3 × 106/ml. Then, dishes were incubated for 6 hrs. at 37°C in a humidified 5% CO2 atmosphere. Fertilization was evaluated by the observation of two pronuclei (2PN). Finally, the culture was done in 30 μl of culture droplets (KSOM supplemented with 4 mg/ml BSA) (one embryo per 2 µl) under mineral oil. The day of insemination was taken as day 0, and the cleavage rate was evaluated 24 hrs. later. The blastocyst rate was documented at the end of day 5 (17).

Measurement of intracellular ROS and GSH levels

In order to detection of intracellular ROS and GSH levels, the 2',7'-dichlorodihydrofluorescein diacetate (H2DCFDA; Cell Tracker Green; Molecular Probes, Invitrogen, USA) and 4-chloromethyl-6, 8-difluoro-7-hydroxycoumarin (CMF2HC; Cell Tracker Blue; Molecular Probes, Invitrogen, USA) were used. For this, the oocytes were incubated for 30 mins. At 37°C in 10 µM droplet of each marker as described previously (19). The incubated oocytes were analyzed for florescence intensity using fluorescence microscope (Labomed Lx 400; Labo America) with ultraviolet filters (460 nm for intracytoplasmic ROS, 370 nm for GSH). The details were described in our recent study (17).

RNA isolation and quantitative real-time polymerase chain reaction

After denuding and washing of mature oocytes, 10-15 oocytes were accumulated four times, and total RNA was isolated from these accumulations. The RNeasy Micro kits (Qiagen Inc., Valencia, CA, USA) and transcript nova kit (Qiagen Inc., Valencia, CA, USA) were used for RNA isolation and reverse-transcription into cDNA as a described previously (20). The reverse-transcribed yields of two subunits of maturation-promoting factor (MPF: Cdk1, cyclin B), mitogen-activated protein kinase (Mapk), Cyclooxygenase (Cox2), Glutathione peroxidase (Gpx1), DNA methyltransferase-1 (Dnmt1) and histone deacethylase-1 (Hdac1) were amplified by real-time polymerase chain reaction (PCR) with SYBR Green (Takara, Japan) on an ABI real-time PCR system (Applied Biosystems, ABI, Foster City, CA, USA), according to the manufacturer's instructions. Finally, all data were analyzed by the standard formula, while glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as an internal reference gene. The details of real-time PCR reaction was described in our previous article (17). Table I lists the primer sequences.

Table 1.

Primer sequences


Gene Primer sequences (5'-3') Accession number length TM (°C)
Dnmt1 F:CCTAGTTCCGTGGCTACGAGGAGAA R:TCTCTCTCCTCTGCAGCCGACTCA NM_010066 137 58
Hdac1 F:CTGAATACAGCAAGCAGATGCAGAG R:TCCCGTGGACAACTGACAGAAC NM_008228 92 57
Cox2 F:GAAGTCTTTGGTCTGGTGCCT R:GCTCCTGCTTGAGTATGTCG NM_011198 91 60
Gpx1 F:CGC TTT CGT ACC ATC GAC ATC R:GGG CCG CCT TAG GAG TTG NM_001329527 77 59
Cdk1 F:TTGGAGAAGGTACTTACGGTGTGGTG R:CCAGGAGGGATGGAGTCCAGGT NM_007659 89 58
Cyclin B F:CTGACCCAAACCTCTGTAGTG R:CCTGTATTAGCCAGTCAATGAGG NM_172301 150 61
Mapk F:TTTGCATAGGGAGGTCCAAG R:GGTGCCATCATCAACATCTG NM_0119449 150 60
Gapdh F:TGACGTGCCGCCTGGAGAAA R:AGTGTAGCCCAAGATGCCCTTCAG NM_008084 98 58
Dnmt1: DNA methyltransferase1, Hdac1: Histone deacethylase1, Cox2: Cyclooxygenase, Gpx1: Glutathione peroxidase, Cdk1: Cyclin-dependent kinase 1, Mapk: Mitogen-activated protein kinase, Gapdh: Glyceraldehyde-3-phosphate dehydrogenase

Ethical consideration

All study procedures were conducted regarding guidelines of the International Association (http://www.iasp-pain.org) to reduce animal's pain (21), and were approved by the Internal Deputy for Animal Study, based on local Institutional Animal Welfare law, which is recommended by an independent research ethics committee in Shahid Beheshti University of Medical Sciences with the ethical committee code: IR.SBMU.RAM.REC.1394.523 (17).

Statistical analysis

All experiments were run in triplicate, and the data were presented as mean ± SEM. Student's t test was used to analyze all measurements between PCOS and control group. A one-way analysis of variance (ANOVA), followed by Duncan's multiple comparisons tests were performed using Prism v5 (Graphpad Software, Inc., San Diego, CA) for all measurements between four concentrations of NSE in both control and PCOS groups. Two-tailed p < 0.05 was taken as the significance level. The fluorescence intensities of oocytes were analyzed using Image J, version 1.40 (National Institutes of Health) and were normalized against values in the control group.

3. Results

Effect of NSE on oocyte maturation

Table II and III summarizes the results of oocyte maturation and abnormal morphologh in both control and PCOS groups with different concentrations of NSE during IVM. They show that MII rate was significantly higherand the abnormality rate was lower in the control group than in the PCOS model with 0 and 1 µg/ml NSE concentrations respectively (Table II). The percentage of MII oocytes in the PCOS oocytes was significantly higher in 1, 50, and 100 µg/ml of NSE than the control. However, only supplementation with 50 µg/ml NSE had a strong effect on the reduction of abnormality rate in PCOS-treated oocytes as compared to the control. In the control group, the MII rate was significantly higher in 1 and 50 µg/ml of NSE concentrations when compared to the control. Besides, the reduction of abnormality was significantly lower in 1 and 50 µg/ml NSE-treated oocytes as compared to the control. Finally, a comparison of abnormality rate for different concentrations of NSE showed that lower and higher-value concentrations cannot reduce the abnormality rate (Table III).

Effect of NSE on embryonic development

Table IV and V summarizes the results of embryonic development following the maturation of oocytes, via IVM. Fertilization, 2-cell, 8-cell, and blastocyst rates were significantly higher in the control than in the PCOS group of untreated oocytes. In 1 µg/ml NSE group only fertilization rate was higher in the control than in the PCOS group (Table IV). In the control mice, the fertilization rate was not different across different concenterations of NSE; however, the 2-cell, 8-cell, and blastulation rates were significantly higher in 50 µg/ml NSE-treated oocytes in comparison with the untreated. Moreover, fertilization, 2-cell, 8-cell, and blastulation rates were significantly higher in the 50 µg/ml NSE-treated PCOS mice oocytes than the untreated (Table V).

Antioxidant effect of NSE on ooplasmic GSH and ROS levels and Gpx1 gene expression

The CellTracker TM Blue and Green dyes were used to detect intracytoplasmic GSH (Figure 1) as blue fluorescence and ROS (Figure 2) as green fluorescence, respectively. In these two figures, the enhanced fluorescent intensity of the oocytes is representative of more GSH and ROS levels. In this regard, our results showed that the GSH and Gpx1 mRNA expression levels were significantly higher in the control than the PCOS. The details are shown in Figure 1. Moreover, both the control and PCOS oocytes showed an increase in intracellular GSH level in the 1 (227.9 ± 12.64 vs 191.3 ± 8.38, p = 0.017 and 158 ± 6.32 vs 102.83 ± 3.14, p = 0.0083) and 50 (236.9 ± 12.64 vs 191.3 ± 8.38, p = 0.0057 and 164.67 ± 15.8 vs 102.83 ± 3.14, p = 0.0023) µg/ml NSE-treated oocytes as compared to the untreated oocytes, respectively (Figure 1). However, the intracellular ROS level was significantly lower in the control group than the PCOS. Furthermore, the intracellular ROS levels were significantly lower in the control and PCOS oocytes treated with 1 (103.9 ± 11.46 vs 165.4 ± 12.86, p = 0.023 and 141 ± 13.85 vs 220.21 ± 6.97, p = 0.0067) and 50 (94.7 ± 17.0 vs 165.4 ± 12.86, p = 0.0081; 131 ± 12.19 vs 220.21 ± 6.97, p = 0.0035) µg/ml NSE as compared to untreated oocytes, respectively (Figure 2). In addition, the Gpx1 expression was significantly higher in 50 µg/ml NSE-treated group versus untreated oocytes in both control (1.8 ± 0.06 vs 1.33 ± 0.06, p = 0.043) and PCOS (1.47 ± 0.08 vs 1.03 ± 0.03, p = 0.015) groups (Figure 1).

Effect of NSE on MPF (Cdk1 & Cyclin B) and MAPK genes expression

As an assessment of oocyte nuclear maturation, three nuclear maturation-related genes were evaluated in real-time PCR. In the control group, Cyclin B (0.96 ± 0.09 vs 0.56 ± 0.06, p = 0.022), Cdk1 (1.03 ± 0.12 vs 0.56 ± 0.09, p = 0.035), and Mapk (0.96 ± 0.18 vs 0.47 ± 0.13, p = 0.041) mRNA levels were significantly higher than PCOS. The details are shown in Figure 3. However, the Cdk1 mRNA expression was significantly higher in the 50 µg/ml NSE-treated oocytes than that the untreated in both control (1.47 ± 0.11 vs 1.03 ± 0.05, p = 0.037) and PCOS (1.17 ± 0.23 vs 0.56 ± 0.09, p = 0.012). Although, treatment with NSE had no effect on the gene expression of Cyclin B., the Mapk mRNA expression in both control (1.85 ± 0.06 vs 0.96 ± 0.18, p = 0.025) and PCOS (1.2 ± 0.09 vs 0.47 ± 0.13, p = 0.0067) mice oocytes was significantly higher in 50 µg/ml NSE-treated oocytes than in the untreated (Figure 3).

Effect of NSE on Cox2 genes expression

In order to assess the inhibitory effect of NSE on the apoptotic pathway, the Cox2 gene expression was evaluated in mature oocytes. Cox2 mRNA expression was significantly decreased in the 50 µg/ml NSE-treated oocytes as compared to the untreated in both control (0.82 ± 0.08 vs 1.33 ± 0.08, p = 0.047) and PCOS (1.09 ± 0.06 vs 1.63 ± 0.08, p = 0.035) groups. Moreover, the results showed that there was no significant difference in Cox2 expression between the PCOS and control mice in all groups of NSE concentrations (Figure 4).

Effect of NSE on the expression of epigenetic-related gene (Hdac1 and Dntm1)

Epigenetic defects particularly reduce DNA methylation and interfere with the transcription of certain enzymes in oocytes. The expression of enzymes may also be affected by ROS production. Therefore, our results showed that the Dnmt1 and Hdac1 mRNA levels were significantly higher in the control than the PCOS group. The details are shown in Figure 5. Moreover, during IVM, treatment with 50 µg/ml NSE resulted in higher gene expression of Dnmt1 (1.4 ± 0.17 vs 0.56 ± 0.09, p = 0.0071), (1.24 ± 0.03 vs 0.54 ±0.03, p = 0.014) and Hdac1 (1.1 ± 0.12 vs 0.52 ±0.09, p = 0.0097), (1.06 ± 0.12 vs 0.52 ±0.04, p = 0.0065) levels in comparison to untreated oocytes in both control and PCOS mice, respectively (Figure 5).

Table 2.

The comparision of different concentrations of NSE on oocyte maturation and abnormal morphology between the control and PCOS mice oocytes during in vitro maturation


Groups MII (%) Abnormal morphology (%)
Control PCOS P-value Control PCOS P-value
Control (0) 84.93 ± 1.10, n =146 71.38 ± 3.61, n =121 0.025 4.51 ± 0.18 10.57 ± 1.06 0.012
NES 1 μg/ml 93.52 ± 1.98, n =167 83.00 ± 2.45, n =105 0.043 3.10 ± 0.71 6.87 ± 0.64 0.037
NES 50 μg/ml 93.63 ± 2.29, n =130 86.75 ± 2.10, n =123 0.134 2.98 ± 0.60 3.96 ± 0.80 0.971
NES 100 μg/ml 87.08 ± 1.86, n = 135 83. 86 ± 2.54, n =111 0.865 4.87 ± 0.35 8.72 ± 0.36 0.046
MII %: The percentage of mature oocytes; Abnormal morphology %: The percentage of oocyte with abnormal morphology after maturation; NES: Nigella sativa extract; PCOS: Polycystic ovary syndrome. N: number of oocytes. Values are expressed as Mean ± SEM; P-value are presented between two groups (Control versus PCOS) by student's t test

Table 3.

The effect of different concentrations of NSE on oocyte maturation and abnormal morphology in the control and PCOS mice oocytes during in vitro maturation


Groups MII (%) Abnormal morphology (%)
Control mice PCOS mice Control mice PCOS mice
Control (0) 84.93 ± 1.10, n = 146 71.38 ± 3.61, n = 121 4.51 ± 0.18 10.57 ± 1.06
NES 1 μg/ml 93.52 ± 1.98, n = 167 (p = 0.031) 83.00 ± 2.45, n = 105 (p = 0.042) 3.10 ± 0.71 (p = 0.027) 6.87 ± 0.64 (p = 0.145)
NES 50 μg/ml 93.63 ± 2.29, n = 130 (p = 0.027) 86.75 ± 2.10, n = 123 (p = 0.002) 2.98 ± 0.60 (p = 0.018) 3.96 ± 0.80 (p = 0.0004)
NES 100 μg/ml 87.08 ± 1.86, n = 135 (p = 0.556) 83. 86 ± 2.54, n = 111 (p = 0.032) 4.87 ± 0.35 (p = 0.728) 8.72 ± 0.36 (p = 0.723)
MII %: The percentage of mature oocytes; Abnormal morphology %: The percentage of oocyte with abnormal morphology after maturation; NES: Nigella sativa extract; PCOS: Polycystic ovary syndrome. N: number of oocytes. Values are expressed as Mean ± SEM. P: P-value between each concentration group of NSE and control (0 μg/ml of NSE) by one-way ANOVA

Table 4.

The comparision of different concentrations of NSE on embryonic development between the control and PCOS mice oocytes during in vitro maturation


Groups Fertilization (%) 2-cell (%) 8-cell (%) Blastocyst (%)
Control PCOS Control PCOS Control PCOS Control PCOS
Control (0) 78.50 ± 2.45 (p = 0.038) 68.50 ± 2.34 66.83 ± 2.84 (p = 0.025) 55.16 ± 3.57 49.00 ± 4.11 (p = 0.015) 40.67 ± 4.12 42.50 ± 3.16# (p = 0.045) 30.83 ± 2.54
NES 1 μg/ml 87.50 ± 2.67 (p = 0.042) 75.16 ± 2.18 73.17 ± 3.52 (p = 0.831) 69.83 ± 2.77 51.66 ± 3.47 (p = 423) 45.00 ± 4.10 46.33 ± 2.86 (p = 128) 37.00 ± 3.52
NES 50 μg/ml 88.83 ± 1.85 (p = 0.242) 82.17 ± 1.9 81.50 ± 2.86 (p = 0.541) 77.50 ± 2.41 65.00 ± 3.01 (p = 0.971) 63.33 ± 3.86 57.83 ± 2.70 (p = 0.089) 50.33 ± 2.94
NES 100 μg/ml 76.17 ± 3.10 (p = 0.098) 71.17 ± 2.98 69.00 ± 3.52 (p = 0.086) 59.50 ± 3.22 48.00 ± 3.61 (p = 0.121) 44.67 ± 3.45 42.50 ± 3.56 (p = 0.345) 37.50 ± 3.44
Percentage rates of fertilization, 2-cell, 8-cell, and blastocyst formation of control and PCOS mice oocytes cultured in maturation medium, supplemented with 0, 1, 50, and 100 μg/ml NSE. NES: Nigella sativa extract; PCOS: Polycystic ovary syndrome. Data are presented as Mean ± SEM. P-value are presented between two groups (Control versus PCOS) by student's t test

Table 5.

The effect of different concentrations of NSE on embryonic development in the control and PCOS mice oocytes during in vitro maturation


Groups Fertilization (%) 2-cell (%) 8-cell (%) Blastocyst (%)
Control PCOS Control PCOS Control PCOS Control PCOS
Control (0) 78.50 ± 2.45 68.50 ± 2.34 66.83 ± 2.84 55.16 ± 3.57 49.00 ± 4.11 40.67 ± 4.12 42.50 ± 3.16 30.83 ± 2.54
NES 1 μg/ml 87.50 ± 2.67 (p = 0.112) 75.16 ± 2.18 (p = 0.225) 73.17 ± 3.52 (p = 0.276) 69.83 ± 2.77 (p = 0.167) 51.66 ± 3.47 (p = 0.368) 45.00 ± 4.10 (p = 0.651) 46.33 ± 2.86 (p = 0.425) 37.00 ± 3.52 (p = 0.327)
NES 50 μg/ml 88.83 ± 1.85 (p = 0.145) 82.17 ± 1.9 (p = 0.027) 81.50 ± 2.86 (p = 0.025) 77.50 ± 2.41 (p = 0.015) 65.00 ± 3.01 (p = 0.033) 63.33 ± 3.86 (p = 0.017) 57.83 ± 2.70 (p = 0.037) 50.33 ± 2.94 (p = 0.008)
NES 100 μg/ml 76.17 ± 3.10 (p = 0.625) 71.17 ± 2.98 (p = 0.341) 69.00 ± 3.52 (p = 0.725) 59.50 ± 3.22 (p = 0.635) 48.00 ± 3.61 (p = 0.976) 44.67 ± 3.45 (p = 0.725) 42.50 ± 3.56 (p = 0.951) 37.50 ± 3.44 (p = 0.542)
Percentage rates of fertilization, 2-cell, 8-cell, and blastocyst formation of control and PCOS mice oocytes cultured in maturation medium, supplemented with 0, 1, 50, and 100 μg/ml NSE. NES: Nigella sativa extract; PCOS: Polycystic ovary syndrome. Data are presented as Mean ± SEM. P: P-value between each concentration group of NSE and control (0 μg/ml of NSE) by one-way ANOVA

Figure 1.

Figure 1

The GSH level of in vitro-matured control and PCOS mice oocytes according to the different concentrations of NSE in the maturation medium. (A) Representative images of intracellular GSH levels in the control and PCOS mice. (B) Quantification data. (C) The relative mRNA expressions of Gpx1 gene of in vitro-matured control and PCOS mice oocytes according to the different concentrations of NSE in the maturation medium. Scale bars = 100 μm. Data are expressed as Mean ± SEM. *P < 0.05 and **P < 0.01 vs. control (0μg/ml) by one-way ANOVA. #P < 0.05, ##P < 0.01, ###P < 0.001, between two groups (Control vs. PCOS) by student's t test.

Figure 2.

Figure 2

The ROS level of in vitro-matured control and PCOS mice oocytes according to the different concentrations of NSE in the maturation medium. (A) Representative images of intracellular ROS level in the control and PCOS mice. (B) Quantification data. Scale bars = 100 μm. Data are expressed as Mean ± SEM. *P < 0.05 and **P < 0.01 vs. control (0 μg/ml) by one-way ANOVA. #P < 0.05, between two groups (Control vs. PCOS) by student's t test.

Figure 3.

Figure 3

The relative mRNA expressions of nuclear maturation-related genes of in vitro-matured control and PCOS mice oocytes according to the different concentrations of NSE in the maturation medium. (A) Cyclin B mRNA expression. (B) Cdk1 mRNA expression. (C) Mapk mRNA expression. Data are expressed as Mean ± SEM. *P < 0.05 and **P < 0.01 versus control (0 μg/ml) by one-way ANOVA. #P < 0.05, between two groups (Control vs. PCOS) by student's t test.

Figure 4.

Figure 4

The Relative mRNA expressions of cyclooxygenase (Cox2) gene of in vitro-matured control and PCOS mice oocytes according to the different concentrations of Nigella sativa hydro-alcoholic extract (NSE) in the maturation medium. *P < 0.05 vs. control (0 μg/ml) by one-way ANOVA.

Figure 5.

Figure 5

(A) The relative mRNA expression of DNA methyltransferase1 (Dnmt1) gene of in vitro-matured control and PCOS mice oocytes according to the different concentrations of Nigella sativa hydro-alcoholic extract (NSE) in the maturation medium. (B) The relative mRNA expression of histone deacetylase (Hdac1) gene of in vitro-matured control and PCOS mice oocytes according to the different concentrations of NSE in the maturation medium. Data are expressed as Mean ± SEM. *P < 0.05 and **P < 0.01 vs. control (0 μg/ml) by one-way ANOVA. #P < 0.05, between two groups (Control vs. PCOS) by student's t test.

4. Discussion

The present research showed that maturation, developmental competency, epigenetic alteration, and oxidative statues were significantly different between the control and PCOS mice oocytes. Moreover, these results showed that 50 µg/ml NS NSE in culture medium was associated with a significant increase in Dnmt1, Hdac1, Cdk1, Mapk, and Gpx1 genes and a significant decrease of Cox2 gene expression of mature oocytes. Moreover, we found that both 1 and 50 µg/ml NSE in the PCOS and control mice had lower levels of ROS and higher levels of GSH than those in other groups during oocyte maturation. Since cdk1 and Mapk are two key genes in oocyte maturation (22), in addition to the fact that Dnmt1 and Hdac1 are two essential genes for normal epigenetic modification and development (11), the difference in the maturation fertilization and embryonic development outcome may be partly induced by the expression alterations of genes in the oocytes of the PCOS and control groups.

According to a relevant report by Salarinia and colleagues, treatment of ovary cells with 12.5-200 μg/mL NSE had no significant effect on the viability of these cells (23). Based on work of research, we tried to choose the most appropriate NSE concentration in the culture medium of oocyte maturation. To evaluate oocyte maturation, normal and induced PCOS mice oocytes were exposed to different NSE concentrations added to the IVM medium. Our results showed that NSE could improve the rate of maturation, as well as those of fertilization and blastocyst formation in in-vitro-matured oocytes in both control and PCOS mice. In our pilot experiment, the IVM medium was supplemented with 0-100 µg/ml NSE. Then, the dose-dependent effects of NSE concentrations from 0 to 100 µg/ml (0, 1, 10, 50, 70, and 100 µg/ml) were assessed. Maturation and normal morphology rates were progressively improved as the concentration of NSE increased up to 50 µg/ml, but then the rates decreased to concentrations of 70 and 100 µg/ml NSE. Thus, 0, 1, 50, and 100 µg/ml NSE concentrations were added to the culture medium to evaluate oxidative stress, epigenetic alteration, and embryonic development. A comparison of oocyte maturation for different doses of NSE showed that lower doses could enhance the maturation rate and, therefore, a high concentration of NSE may be linked to abnormal morphology rate. Besides, NSE acts in a dose-dependent manner, which is associated with the pathological condition of the body.

The protective activity of NS oil in reproductive organs is evaluated by Al-Seeni et al., who observed NS oil induced regeneration of spermatogenesis in seminiferous tubules in tartrazine treated rats (24). Also, testicular toxicity after colchicine exposure in rats was prevented by NS oil (25). Another study Besides, the protective effect of NS against cyclophosphamide induced toxicity on the testicular and acrosomal function of spermatozoa in mice (26). Pharmacological studies demonstrated that NS could be involved in the induction of antioxidant mechanisms, thus, preventing the oxidative stress of adverse conditions (8). It was previously shown that NSE of NS increased fertility potential as well as LH and testosterone concentration in male rats, all accompanied by the induction of gonadotropin activity (16). Likewise, the prophylactic effects of NS against cyclophosphamide-induced female mice were suggested by the increase in primary and secondary follicles in ovarian volume (27). Thus, NS reduces the adverse effects of in-vivo pathological conditions as well as in-vitro adverse manipulations.

In vitro oocyte maturation was conducted by nuclear and cytoplasmic maturation. MPF and MAPK play an important role in oocyte maturation because they regulate cell cycle progression during both mitosis and meiosis. These kinas activities are essential for proper fertilization and preimplantation embryo development (28). We did not measure kinase activity levels; instead, we evaluated the Cdk1 as catalytic subunit, cyclin B as a regulatory subunit of MPF and Mapk gene expression using real-time PCR method. We showed that although NSE had a significant effect on nuclear oocyte maturation by inducing the overexpression of Cdk1 and Mapk genes, it did not have any effect on cyclin B gene expression. A previous report in bovine oocyte maturation showed that Cdk1 is upregulated in IVM medium supplemented with resveratrol as an antioxidant (19). Moreover, the addition of L-carnitin in IVM medium had a significant effect on the overexpression of Cdk1 gene in mice oocytes (29).

Synthesis and accumulation of GSH content as a non-enzymatic antioxidant in the ooplasm play a key role in cytoplasmic maturation and regulating sperm decondensation. Moreover, GSH is necessary for the replacement of protamine by histone protein in sperm head chromatin after sperm penetration. Thus, oocyte-developing competence and fertilization rate in cytoplasmic level are associated with the intracytoplasmic content of GSH (3). In the present study, supplementing IVM medium with 50 µg/ml NSE increased fertilization rate in oocytes. This finding may be partly explained by the upregulation of GSH level and its insufficient expression which can lead to fertilization failure. Other recent studies also showed that NSE could induce GSH in streptozotocin-induced diabetic male Wistar rats and also improve the adverse conditions resulting from tartrazine administration (24, 30). Due to its nature, NSE can increase the activity of CAT and GSH levels against cisplatin-induced renal toxicity and oxidative stress in Wistar rats (31).

Oocytes and embryos are equipped with both enzymatic and non-enzymatic antioxidants that are crucial for the acquisition of full developmental competency and avoiding or slowing the initiation of apoptosis (32). In the present study, exposure to NSE with 50 µg/ml in the IVM medium was found to be associated with an induction in Gpx1 gene expression, an enzymatic antioxidant in the oocytes indicating an improved function of the oocyte antioxidant defense system. These results are consistent with Busari et al., who illustrated that NSE affected the activity of enzymes constituting cell antioxidative system (31). Supplementation of cyclophosphamide-induced rats with NS oil regulated the assayed antioxidants, representative of its ability to reestablish antioxidative homeostasis (33). It was reported that NSE could induce the activity of several antioxidant enzymes such as CAT, GPx, and GST as well as scavenge free radicals. Other studies have shown that TQ, an active component of NS, can overcome the oxidative stress induced during diethylnitrosamine metabolism by upregulation of GST, GPx, and CAT genes in hepatic cells (6).

Another study clearly confirmed that administering TQ resulted in a significant progression of normal follicular development of PCOS rats. This result was obtained from suppressing NF-ĸB signaling which inhibits Cox2 expression (34). It was suggested that DHEA cab induces the overexpression of Cox2 in PCOS mice model (35). The overexpression of Cox2 is positively correlated with ROS production which coincided with the change of cytoplasmic development and apoptosis induction (36). The data presented here show that NSE reduced Cox2 expression and avoided ooplasmic ROS production induced by both DHEA and manipulation in culture condition in both control and PCOS mice oocytes. Additionally, in agreement with our results, Arif et al. found that exposure of granulose cell line with TQ could inhibit ROS production and the overexpression of Cox2 gene (34). This unique property of NSE, as an herbal antioxidant to inhibit the negative effect of ROS production, highlights its pivotal role in antioxidant activity besides its effect on free radical scavenging.

In our previous study, mice treated with DHEA showed a significant increase in the state of oxidative stress and epigenetic alteration compared to a control after three weeks. The increase of ROS generation, linked to the downregulation of Hdac1 gene, resulted in an aberrant epigenetic pattern in DHEA-treated oocytes (15). Inhibition of histone deacetylation mediated by the Hdac1 enzyme during meiosis may be linked to the high incidence of aneuploidy and embryo abnormality (37). The results of the present study showed that treatment with 50 µg/ml NSE in culture medium increased epigenetic enzymes including Dnmt1 and hdac1, compared with the untreated oocytes. It is notable that epigenetic enzymes regulate the methylation of 5-methyl cytosine and histone proteins leading to methylated oocyte genome, and finally the condensation of chromosome (11). As we know, manipulative procedures such as IVM resulting in damages related to nuclear-cytoplasmic interactions may alter the correct performance of these epigenetic processes and lead to abnormal embryo development (38). Therefore, prevention of adverse constituents such as ROS production via modifying culture medium might provide further insight into the epigenetic modifications that occur during oocyte maturation.

5. Conclusion

Maturation, developmental competency, oxidative stress, and epigenetic modification were significantly different between mice oocytes in the control and PCOS roups. The present study showed that NSE improves specific development competence. Differences in the features of oocyte maturation and developmental competence were reduced for mice both in the control and PCOS when NSE was supplemented at the dose of 50 µg/ml concentration during IVM. Our results showed that the beneficial effects of NSE are dose-dependent and increase at the concentration of 50 µg/ml during oocyte maturation. Further studies are required to explore NSE effects on mice in control and PCOS groups.

Conflict of Interest

None to declare.

Acknowledgments

This work was supported by Shahid Beheshti University of Medical Sciences (Tehran, Iran) and the Fertility and Infertility Research Center of Hormozgan University of Medical Sciences (Bandar, Iran). The authors would also like to thank Mohammad Reza Eini for his help with this study.

References

  • 1.Zhao JZ, Zhou W, Zhang W, Ge HS, Huang XF, Lin JJ. In vitro maturation and fertilization of oocytes from unstimulated ovaries in infertile women with polycystic ovary syndrome. Fertil Steril 2009; 91: 2568–2571. [DOI] [PubMed]
  • 2.Agarwal A, Durairajanayagam D, Du Plessis SS. Utility of antioxidants during assisted reproductive techniques: an evidence based review. Reprod Biol Endocrinol 2014; 12: 112–130. [DOI] [PMC free article] [PubMed]
  • 3.Choe C, Shin YW, Kim EJ, Cho SR, Kim HJ, Choi SH, et al. Synergistic effects of glutathione and β-mercaptoethanol treatment during in vitro maturation of porcine oocytes on early embryonic development in a culture system supplemented with L-cysteine. J Reprod Dev 2010; 56: 575–582. [DOI] [PubMed]
  • 4.Wang X, Falcone T, Attaran M, Goldberg JM, Agarwal A, Sharma RK. Vitamin C and vitamin E supplementation reduce oxidative stress-induced embryo toxicity and improve the blastocyst development rate. Fertil Steril 2002; 78: 1272–1277. [DOI] [PubMed]
  • 5.Nikmard F, Hosseini E, Bakhtiyari M, Ashrafi M, Amidi F, Aflatoonian R. Effects of melatonin on oocyte maturation in PCOS mouse model. Anim Sci J 2017; 88: 586–592. [DOI] [PubMed]
  • 6.Goyal SN, Prajapati CP, Gore PR, Patil CR, Mahajan UB, Sharma C, et al. Therapeutic potential and pharmaceutical development of thymoquinone: A multitargeted molecule of natural origin. Front Pharmacol 2017; 8: 656–674. [DOI] [PMC free article] [PubMed]
  • 7.Chehl N, Chipitsyna G, Gong Q, Yeo CJ, Arafat HA. Anti-inflammatory effects of the Nigella sativa seed extract, thymoquinone, in pancreatic cancer cells. HPB 2009; 11: 373–381. [DOI] [PMC free article] [PubMed]
  • 8.Ismail M, Al-Naqeep G, Chan KW. Nigella sativa thymoquinone-rich fraction greatly improves plasma antioxidant capacity and expression of antioxidant genes in hypercholesterolemic rats. Free Radic Biol Med 2010; 48: 664–672. [DOI] [PubMed]
  • 9.Sharma NK, Ahirwar D, Jhade D, Gupta S. Medicinal and phamacological potential of nigella sativa: a review. Ethnobotanical Review 2009; 13: 946–955.
  • 10.Barrera AD, García EV, Hamdi M, Sanchez-Calabuig MJ, Lopez-Cardona AP, Balvís NF, et al. Embryo culture in presence of oviductal fluid induces DNA methylation changes in bovine blastocysts. Reproduction 2017; 154: 1–12. [DOI] [PubMed]
  • 11.Uysal F, Akkoyunlu G, Ozturk S. Dynamic expression of DNA methyltransferases (DNMTs) in oocytes and early embryos. Biochimie 2015; 116: 103–113. [DOI] [PubMed]
  • 12.Ma P, Pan H, Montgomery RL, Olson EN, Schultz RM. Compensatory functions of histone deacetylase 1 (HDAC1) and HDAC2 regulate transcription and apoptosis during mouse oocyte development. Proc Nati Acad Sci USA 2012; 109: E481–E489. [DOI] [PMC free article] [PubMed]
  • 13.Racedo SE, Wrenzycki C, Lepikhov K, Salamone D, Walter J, Niemann H. Epigenetic modifications and related mRNA expression during bovine oocyte in vitro maturation. Reprod Fertil Dev 2009; 21: 738–748. [DOI] [PubMed]
  • 14.Salhab M, Dhorne-Pollet S, Auclair S, Guyader-Joly C, Brisard D, Dalbies-Tran R, et al. In vitro maturation of oocytes alters gene expression and signaling pathways in bovine cumulus cells. Mol Reprod Dev 2013; 80: 166–182. [DOI] [PubMed]
  • 15.Eini F, Ghaffari Novin M, Joharchi K, Hosseini A, Nazarian H, Piryaei A, et al. Intracytoplasmic oxidative stress reverses epigenetic modifications in polycystic ovary syndrome. Reprod Fertil Dev 2017; 29: 2313–2323. [DOI] [PubMed]
  • 16.Parandin R, Yousofvand N, Ghorbani R. The enhancing effects of alcoholic extract of Nigella sativa seed on fertility potential, plasma gonadotropins and testosterone in male rats. Iran J Reprod Med 2012; 10: 355–362. [PMC free article] [PubMed]
  • 17.Eini F, Bidadkosh A, Nazarian H, Piryaei A, Ghaffari Novin M, Joharchi K. Thymoquinone reduces intracytoplasmic oxidative stress and improves epigenetic modification in polycystic ovary syndrome mice oocytes, during in-vitro maturation. Mol Reprod Dev 2019; 86: 1053–1066. [DOI] [PubMed]
  • 18.Ubaldi F, Rienzi L. Morphological selection of gametes. Placenta 2008; 29 (Suppl.): 115–120. [DOI] [PubMed]
  • 19.Wang F, Tian X, Zhang L, He C, Ji P, Li Y, et al. Beneficial effect of resveratrol on bovine oocyte maturation and subsequent embryonic development after in vitro fertilization. Fertil Steril 2014; 101: 577–586. [DOI] [PubMed]
  • 20.Diaz FJ, O'brien MJ, Wigglesworth K, Eppig JJ. The preantral granulosa cell to cumulus cell transition in the mouse ovary: development of competence to undergo expansion. Dev Biol 2006; 299: 91–104. [DOI] [PubMed]
  • 21.Zimmermann M. Ethical guidelines for investigations of experimental pain in conscious animals. Pain 1983; 16: 109–110. [DOI] [PubMed]
  • 22.Hara M, Abe Y, Tanaka T, Yamamoto T, Okumura E, Kishimoto T. Greatwall kinase and cyclin B-Cdk1 are both critical constituents of M-phase-promoting factor. Nat Commun 2012; 3: 1059–1067. [DOI] [PMC free article] [PubMed]
  • 23.Salarinia R, Rakhshandeh H, Oliaee D, Ghasemi SG, Ghorbani A. Safety evaluation of Phytovagex, a pessary formulation of Nigella sativa, on pregnant rats. Avicenna J Phytomed 2016; 6: 117–123. [PMC free article] [PubMed]
  • 24.Al-Seeni MN, El Rabey HA, Al-Hamed AM, Zamazami MA. Nigella sativa oil protects against tartrazine toxicity in male rats. Toxicol Rep 2017; 5: 146–155. [DOI] [PMC free article] [PubMed]
  • 25.Elshama SS, Shehab GM, El-Kenawy AE, Osman H-EH, Farag MM. Role of Nigella Sativa Seeds on modulation testicular toxicity of colchicine repeated use in adult albino rats. Life Sci J 2013; 10: 1629–1639.
  • 26.Rahman SA, Shaik Dawood NF, Basha SS, Kamarzaman S. Protective effect of black seed Nigella sativa (L.) against cyclophosphamide-induced toxicity on reproductive and acrosomal function in mice. Middle East J Sci Res 2013; 17: 955–964.
  • 27.Kamarzaman S, Shaban M, Abdul Rahman S. The prophylactic effect of Nigella sativa against cyclophosphamide in the ovarian follicles of matured adult mice: a preliminary study. J Anim Plant Sci 2014; 24: 81–88.
  • 28.Zhang DX, Park WJ, Sun SC, Xu YN, Li YH, Cui XS, et al. Regulation of maternal gene expression by MEK/MAPK and MPF signaling in porcine oocytes during in vitro meiotic maturation. J Reprod Dev 2011; 57: 49–56. [DOI] [PubMed]
  • 29.Zare Z, Masteri Farahani R, Salehi M, Piryaei A, Ghaffari Novin M, Fadaei Fathabadi F, et al. Effect of L-carnitine supplementation on maturation and early embryo development of immature mouse oocytes selected by brilliant cresyle blue staining. J Assist Reprod Genet 2015; 32: 635–643. [DOI] [PMC free article] [PubMed]
  • 30.Abdelrazek HMA, Kilany OE, Muhammad MAA, Tag HM, Abdelazim AM. Black Seed thymoquinone improved insulin secretion, hepatic glycogen storage, and oxidative stress in streptozotocin-induced diabetic male wistar rats. Oxid Med Cell Longev 2018; 2018: 8104165. [DOI] [PMC free article] [PubMed]
  • 31.Busari AA, Adejare AA, Shodipe AF, Oduniyi OA, Ismail-Badmus KB, Oreagba IA. Protective but non-synergistic effects of nigella sativa and vitamin E against cisplatin-induced renal toxicity and oxidative stress in wistar rats. Drug Res 2018; 68: 696–703. [DOI] [PubMed]
  • 32.Lian HY, Gao Y, Jiao GZ, Sun MJ, Wu XF, Wang TY, et al. Antioxidant supplementation overcomes the deleterious effects of maternal restraint stress-induced oxidative stress on mouse oocytes. Reproduction 2013; 146: 559–568. [DOI] [PubMed]
  • 33.Alenzi FQ, El-Bolkiny YE, Salem ML. Protective effects of Nigella sativa oil and thymoquinone against toxicity induced by the anticancer drug cyclophosphamide. Br J Biomed Sci 2010; 67: 20–28. [DOI] [PubMed]
  • 34.Arif M, Thakur SC, Datta K. Implication of thymoquinone as a remedy for polycystic ovary in rat. Pharm Biol 2016; 54: 674–685. [DOI] [PubMed]
  • 35.Luchetti CG, Mikó E, Szekeres-Bartho J, Paz DA, Motta AB. Dehydroepiandrosterone and metformin modulate progesterone-induced blocking factor (PIBF), cyclooxygenase 2 (COX2) and cytokines in early pregnant mice. J Steroid Biochem Mol Biol 2008; 111: 200–207. [DOI] [PubMed]
  • 36.Sancho P, Martín-Sanz P, Fabregat I. Reciprocal regulation of NADPH oxidases and the cyclooxygenase-2 pathway. Free Radic Biol Med 2011; 51: 1789–1798. [DOI] [PubMed]
  • 37.Van den Berg IM, Eleveld C, van der Hoeven M, Birnie E, Steegers EAP, Galjaard RJ, et al. Defective deacetylation of histone 4 K12 in human oocytes is associated with advanced maternal age and chromosome misalignment. Hum Reprod 2011; 26: 1181–1190. [DOI] [PubMed]
  • 38.Wang N, Le F, Zhan QT, Li L, Dong MY, Ding GL, et al. Effects of in vitro maturation on histone acetylation in metaphase II oocytes and early cleavage embryos. Obstet Gynecol Int 2010; 2010: 989278: 1–9. [DOI] [PMC free article] [PubMed]

Articles from International Journal of Reproductive Biomedicine are provided here courtesy of Shahid Sadoughi University of Medical Sciences and Health Services

RESOURCES