Skip to main content
Journal of Clinical Laboratory Analysis logoLink to Journal of Clinical Laboratory Analysis
. 2020 Jun 11;34(9):e23418. doi: 10.1002/jcla.23418

Identification of a nonsense mutation in TNNI3K associated with cardiac conduction disease

Jiang Liu 1, Da Liu 1, Muzheng Li 1, Keke Wu 1, Na Liu 1, Chenyu Zhao 2, Xiaoliu Shi 2,3, Qiming Liu 1,
PMCID: PMC7521241  PMID: 32529721

Abstract

Background

Cardiac conduction disease (CCD) is a common cardiovascular disease which can lead to life‐threatening conditions. The importance of heredity in CCD has been realized in recent years. Several causal genes have been found to be implicated in CCD such as SCN5A, TRPM4, SCN1B, TNNI3K, LMNA, and NKX2.5. To date, only four genetic mutations in TNNI3K have been identified related to CCD.

Methods

Whole‐exome sequencing (WES) was carried out in order to identify the underlying disease‐causing mutation in a Chinese family with CCD. The potential mutations were confirmed by Sanger sequencing. Real‐time qPCR was used to detect the level of TNNI3K mRNA expression.

Results

A nonsense mutation in TNNI3K (NM_015978.2: g.170891C > T, c.1441C > T) was identified in this family and validated by Sanger sequencing. Real‐time qPCR confirmed that the level of TNNI3K mRNA expression was decreased compared with the controls.

Conclusions

This study found the first nonsense TNNI3K mutation associated with CCD in a Chinese family. TNNI3K harboring the mutation (c.1441C > T) implicated a loss‐of‐function pathogenic mechanism with an autosomal dominant inheritance pattern. This research enriches the phenotypic spectrum of TNNI3K mutations, casting a new light upon the genotype‐phenotype correlations between TNNI3K mutations and CCD and indicating the importance of TNNI3K screening in CCD patients.

Keywords: cardiac conduction disease, nonsense mutation, nonsense‐mediated mRNA decay, TNNI3K, whole‐exome sequencing

1. INTRODUCTION

Cardiac conduction disease (CCD) refers to the impaired completeness of conduction system which can be serious and potentially life‐threatening. Based on part upon the site of conduction block, CCD is recognized, namely sick sinus syndrome, intra‐atrial block, atrioventricular block, and intraventricular conduction delay. More than 20 genes have been implicated in harboring rare variants that cause CCD, containing genes that encode ion channel, transcriptional factors, enzymes, and structural proteins such as SCN5A (OMIM#600163; 3p22.2), TRPM4 (OMIM#606936; 19q13.33), NKX2.5 (OMIM#600584; 5q35.1), TBX5 (OMIM#601620; 12q24.21), PRKAG2 (OMIM#602743; 7q36.1), and LMNA (OMIM#150330; 1q22). 1 , 2 CCD continues to be the major cause for pacemaker (PM) implantation irrespective of its diverse underlying pathophysiological mechanisms. 3 , 4

TNNI3K (OMIM #613932), located in chromosome 1 (1p31.1), encodes a dual‐function kinase (both tyrosine and serine/threonine kinase activity) with biased expression in heart. 5 , 6 It contains four domains as follows: an N‐terminal coiled‐coil domain, ankyrin (ANK) repeats, protein kinase domain, and a C‐terminal serine‐rich domain. Interaction partners of TNNI3K embody cardiac troponin I (cTnI), anti‐oxidant protein 1 (AOP‐1), and p38, which make TNNI3K an important factor in cardiovascular diseases. 7 , 8 TNNI3K was related to heart failure and hypertrophy, ischemia/reperfusion injury, cardiac conduction, and heart regeneration. 9 , 10 , 11 , 12 , 13 , 14 , 15 Rare mutations related to cardiovascular diseases have been identified in more than 100 genes which encode proteins belonging to different cellular structures and pathways such as cytoskeleton, sarcomere, nuclear membrane, ion channel, mitochondria, sarcoplasmic reticulum, and desmosomes. To date, there are only four mutations in TNNI3K that have been found to be relevant with cardiovascular diseases, including three missense mutations and one splicing mutation. 16 , 17 , 18 , 19 Here, we found that a nonsense variant in TNNI3K (NM_015978.2:c.1441C > T), which was not seen in the human gene mutation database (HGMD), may be the cause of cardiac abnormalities.

2. MATERIALS AND METHODS

2.1. Patients enrollment and ethical approval of the study

A Chinese family with cardiovascular diseases was enrolled in our studies. Parents of the proband are not related biologically. The pedigree of the family is shown in Figure 1A. Written informed consent was obtained from each individual, and the investigation was approved by the Ethics Committee of The Second Xiangya Hospital of Central South University.

Figure 1.

Figure 1

The clinical data and genetic analysis in our study. A, Pedigree. TNNI3K c.1441C > T variant was positive in individuals (II‐7, II‐9, and III‐10) and negative in individuals (III‐12 and IV‐1). B, Filter strategies in our research. C, The ECG record of the proband (III‐10) before PM implantation. D, The echocardiography of III‐10. E‐F, Sanger sequencing confirmation of III‐10 and III‐12.G, RNA expression of TNNI3K in affected individuals and controls. Mean expression (±SEM) of TNNI3K in affected individual and control measured by real‐time qPCR.**** represents P < .0001. H, Mapping of the domain with TNNI3K variants identified in previous studies (denoted by black arrows) and this study (denoted by red arrow). ANK, ankyrin; CVD, cardiovascular diseases; ECG, electrocardiogram; PM, pacemaker

2.2. DNA extraction and whole‐exome sequencing

DNA was extracted from blood samples of the proband (III‐10) and family members (II‐7, II‐9, III‐12, and IV‐1). Other members' blood samples were not available. Whole‐exome sequencing (WES) was performed on the proband. WES and basic bioinformatics analyses were finished in the Novogene Bioinformatics Institute (Beijing, China). Platform for high‐throughput sequencing was Illumina novaSeq. The reads data were mapped to the human reference genome 19 (UCSC hg19) using BWA. Single‐nucleotide variants (SNVs) and insertion‐deletion variants (INDELs) were annotated by ANNOVAR. Low‐quality data (cover depth<20×) and high‐frequency mutation sites (minor allele frequency [MAF] >0.001 in ExAC, ESP6500,1000 Genome Project, and gnomAD) in general population were eliminated from raw data. SIFT, PolyPhen‐2, MutationTaster, and PROVEAN were used for predicting pathogenicity of mutations. Interpretation of mutations pathogenicity was guided by American College of Medical Genetics and Genomics guideline (ACMG). 20 The filter strategies are shown in Figure 1B and Table 1. The validation of potential mutations in the proband and his family members was done by means of Sanger sequencing. Primer 3 was used to design the primer pairs (primers Tm and sequences that have been used in co‐segregation were showed in Table. S1). ABI 3730 sequencer (Applied Biosystems) was used for Sanger sequencing.

Table 1.

The gene list of Sanger sequencing validation and co‐segregation analysis in this family

Gene OMIM CHR POS RB AB AAChange SIFT PolyPhen‐2 Mutationtaster
TNNI3K 613932 1p31.1 74834917 C T NM_015978:exon15:c.C1441T 1.000, D
RYR2 180902 1q43 237947718 T G NM_001035:exon90:c.T12706G 0.5, T 0.257, B 1.000, D
TTN 188840 2q31.2 179425543 C T NM_001267550:exon326:c.G85316A 0, D 0.701, P 1.000, D
CACNA1C 114205 12p13.33 2788847 C T NM_000719:exon42:c.C5329T 0.002, D 0.999, D 1.000, D
NUBPL 613621 14q12 32319403 A C NM_001201573:exon8:c.A605C 0.23, T 0.002, B 0.764, N
MYOM1 603508 18p11.31 3164344 C A NM_003803:exon10:c.G1433T 0.31, T 1.000, D 0.764, N

Abbreviations: AB, alternative base identified; B, benign; CHR, chromosome; D, disease‐causing; N, neural; POS, position; RB, reference sequencing base; T, tolerated.

2.3. Real‐time qPCR analysis

Total RNA was extracted by the PureLink® RNA Mini (Thermo Fisher Scientific; #12183025) from mononuclear cells in the affected patients and healthy controls. cDNA was synthesized from a total of 1 μg of RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific; #K1621) with oligo (dT) primers. Real‐time qPCRs were carried out in Fast 7500 Real‐Time PCR Systems (Applied Biosystems) using Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Fisher Scientific, #K0221). And 2 (−△△ C t) was used to anal

yze the comparative TNNI3K mRNA expression levels between mutation group and healthy group. Each assay was performed in five independent tests. The data were analyzed by unpaired two‐tailed tests using GraphPad Prism V.5 software (V.5.0). The primers used for cloning TNNI3K cDNA were as follows: forward 5′‐CTAGAGGCTGCTGATGTGCTGTTG‐3′; reverse 5′‐GGCGAGTTACCTGTTCATGTCCATAG‐3′.

3. RESULTS

3.1. Clinical data

The index case (III‐10) is a 56‐year‐old man from China with the clinical manifestation of chest tightness. The electrocardiogram (ECG) showed complete right bundle branch block (CRBBB)and third‐degree atrioventricular block (Figure 1C). The 24‐hour Holter indicated an average heartbeat of 46 bpm, maximum RR interval of 5.26 seconds, complete atrioventricular block, and CRBBB. His Echocardiography displayed enlargement of left atrial (LA = 40 mm), thickened left ventricular posterior wall (LVPW = 13 mm), and interventricular septum (IVS = 14 mm; Figure 1D). His father and uncles (II‐9, II‐5, II‐7, and II‐11) were also suffered from third‐degree atrioventricular block and were treated with PM therapy among their 50s. Results of echocardiography were all normal before their PM implantation. Cardiac enlargement of his uncles (II‐5 and II‐7) emerged after a period of PM implantation. The proband's aunt (II‐14) died of heart disease at her 30s recalled by him (no more details available). Owing to the implantation of PM, cardiac magnetic resonance is not performed in this family (Table 2 and Figure S1A‐D).

Table 2.

Clinical characteristics and phenotype of family members

Subject Sex Age (y/old) Age of PM Implantation (y/old) UCG Manifestation

III‐10

Proband

M 56 56 LA = 40 mm, LV = 46 mm, RA = 35 mm, RV = 34 mm, IVS = 14 mm, LVPW = 13 mm, EF = 65% 3rd‐degree AVB, RBBB, PVC

II‐5

Uncle

M 91 55 LA = 38 mm, LV = 65 mm, RA = 37 mm, RV = 37 mm, EF = 55% 3rd‐degree AVB, PVC, AT

II‐7

Uncle

M 89 54 LA = 42 mm, LV = 62 mm, RA = 37 mm, RV = 39 mm, EF = 40% 3rd‐degree AVB, PVC, RBBB

II‐9

Father

M 86 59 LA = 38 mm, LV = 50 mm, RA = 34 mm, RV = 35 mm, EF = 54% 3rd‐degree AVB, PVC

II‐11

Uncle

M 84 55 LA = 33 mm, LV = 49 mm, RA = 30 mm, RV = 34 mm, EF = 60% 3rd‐degree AVB, RBBB

III‐12

Sister

F 52 / LA = 29 mm, LV = 44 mm, RA = 28 mm, RV = 26 mm, EF = 66% /

IV‐1

Daughter

F 26 / LA = 27 mm, LV = 43 mm, RA = 27 mm, RV = 28 mm, EF = 66% /

Abbreviations: AT, atrial tachycardia; AVB, atrioventricular block; EF, ejection fraction; F, female; IVS, interventricular septum; LA, left atrial; LV, left ventricle; LVPW, left ventricular posterior wall; M, male; PM, pacemaker; PVC, premature ventricular contraction; RA, right atrial; RBBB, right bundle branch block; RV, right ventricle; UCG, ultrasonic cardiography.

3.2. Genetic testing

A nonsense mutation in TNNI3K (c.1441C > T, p.R481X) was found through WES and confirmed by Sanger sequencing (Figure 1E‐F and Figure S1E‐F). This variant produces a truncated protein with 480 amino acids which is significantly shorter than the wild‐type protein (835 amino acids). It is a rare mutation with MAF of 0.0017%(2/119514 alleles) in ExAC database. In addition, this mutation was not seen in our 200 local control cohorts. 21 The c.1441C > T mutation in the TNNI3K gene co‐segregated with the clinical phenotype in this family. Thus, we believed that this mutation seems to be the causative mutation of cardiac abnormalities in this family.

3.3. Real‐time qPCR analysis

The nonsense mutation results in the early appearance of stop codon which is anticipated to activate a process called nonsense‐mediated mRNA decay (NMD). 22 We isolated the mRNA from the mononuclear cells in the patients and healthy family members. Real‐time qPCR regarded the healthy control levels of mRNA in TNNI3K as “1.” The results revealed a decreased level of TNNI3K mRNA expression in patients compared with the controls (P < .0001; Figure 1G).

4. DISCUSSION

Herein, using WES we have identified a nonsense mutation of the TNNI3K gene associated with CCD. Cardiovascular disease caused by the TNNI3K mutation is an autosomal dominant disease, which means individuals will have the disease if only one chromosome carries the mutant allele. In our study, the nonsense mutation (c.1441C > T) is co‐segregated with the affected ones. The real‐time qPCR test revealed that the expression level of TNNI3K mRNA in affected members was decreased compared with healthy controls. Our study is consistent with previous studies which demonstrated that TNNI3K mutations were related to CCD with or without dilated cardiomyopathy.

The gene TNNI3K holds a place in cardiac physiology. A preponderance of evidence suggested that TNNI3K is associated with a broad spectrum of cardiac phenotypes including CCD, dilated cardiomyopathy, and supraventricular tachycardia. Only four disease‐causing mutations in TNNI3K, namely three missense mutations and one splicing mutation, have been reported so far (Figure 1H). Our study reported the first nonsense mutation that was linked with cardiovascular diseases, located in kinase activity domain. This mutation results in the early appearance of stop codon which is anticipated to produce truncated protein lacking partial protein kinase domain along with the C‐terminus. For all we know, a premature termination codon (PTC) may result in loss of function (LOF) through NMD. 23 , 24 NMD refers to rapid degradation of mRNAs in transcripts harboring a PTC existing in all eukaryotic cells, which prevents the synthesis of truncated and potentially toxic proteins. Mutations that lead to NMD can cause a pathological state owing to marked reductions in specific gene expression, predispose patients to some disorders. In our research, the decreased expression of TNNI3K mRNA caused by the mutation may lead to CCD through haploinsufficiency.

Nonsense mutation has larger effects in protein function in comparison with missense mutation. Thus, it is anticipated to have more serious phenotype than missense mutation correspondingly. The clinical presentation of cases with TNNI3K mutation has been summarized in Table 3. Conduction abnormalities of TNNI3K mutation carriers in our case seem to be more serious than previously reported cases based on the fact that all of them had PMs implanted. Cardiac structures were all normal in them except for II‐5 and II‐7 whose heart was enlarged in follow‐up period. Based on the fact that II‐5 and II‐7 are old highly pacing‐dependent male patients with over 30 years' history of PM implantation, we hold the opinion that cardiac enlargement in them was PM‐related and remotely connected with the mutation. 25 Considering the oldest patient in this family is 93 and four of the five affected members are over 80 years old, it seems that mutation TNNI3K c.1441C > T has little effect on life expectancy with appropriate treatments. However, II‐14 died of heart disease at an early age and over half of previously reported families had a history of sudden cardiac death (SCD), which indicated that TNNI3K mutation may have connections with high risk of SCD. Further research needs to be done to assess risk of SCD in TNNI3K mutation carriers and draw clear genotype‐phenotype relationships of TNNI3K.

Table 3.

Comparison of clinical presentation of cases with TNNI3K mutation

Family 1 Family 2 Family 3 Family 4 Family 5 Family 6 Our case
Mutation c.1577G > A c.1615A > G c.333 + 2T>C c.2303G > A c.2303G > A c.2303G > A c.1441C > T
First author Theis, et al (2014) 16 Xi, et al (2015) 17 Fan, et al (2018) 18 Podliesna, et al (2019) 19 Podliesna, et al (2019) 19 Podliesna, et al (2019) 19
Affected individuals 7 6 6 15 6 9 5
Conduction disorders LAFB, RBBB, AVB AVB, LAFB, RBBB SB Prolonged HV interval AVB, prolonged HV interval AVB AVB, RBBB
Rhythm SR, PAF, MAT, AFL, AT SR, JET SR SVT, AF, MAT SVT, AT, MAT SVT, AT, VT SR, AT
DCM 3 / 4 3 / 1 1
SCD 1 1 1 2 / / /
ICD/PM‐implanted 1 a 1 / 3 / 3 5

Abbreviations: AT, atrial tachycardia; AVB, atrioventricular block; DCM, dilated cardiomyopathy; JET, junctional ectopic tachycardia; LAFB, left anterior fascicular block; MAT, multifocal atrial tachycardia; PAF, paroxysmal atrial fibrillation; PM, pacemaker; RBBB, right bundle branch block; SB, sinus bradycardia; SCD, sudden cardiac death; SR, sinus rhythm; SVT, supraventricular tachycardia; VT, ventricular tachycardia.

a

PM‐implanted because of atrioventricular node ablation.

However, there are several limitations in our research. This study lacks direct evidence in elucidating the underlying pathways between TNNI3K and CCD. An animal model harboring specific mutation will be needed to elucidate the underlying signaling pathways.

In conclusion, our study successfully identified the first nonsense mutation in TNNI3K (c.1441C > T) that was associated with CCD, paying the way for genetic diagnosis for CCD. Considering the obscure pathophysiological mechanisms and complicated variant spectrum of CCD, we suggest that WES could be applied in potential inherited patients to identify novel mutations and improve our understanding of CCD etiology.

AUTHOR CONTRIBUTIONS

Q‐M L and JL conceived the design and performed the study. JL and DL analyzed the data. JL wrote the original manuscript. Q‐M L, DL, K‐K W, M‐Z L, NL, C‐Y Z, and X‐L S revised the article. All authors reviewed and approved the final manuscript.

Supporting information

Figure S1

Table S1

Supplementary Material

ACKNOWLEDGMENTS

The authors thank all study participants.

Liu J, Liu D, Li M, et al. Identification of a nonsense mutation in TNNI3K associated with cardiac conduction disease. J Clin Lab Anal. 2020;34:e23418 10.1002/jcla.23418

Funding information

This study was supported by National Nature Science Foundation of China (81570310 and 81770337).

REFERENCES

  • 1. Baruteau AE, Probst V, Abriel H. Inherited progressive cardiac conduction disorders. Curr Opin Cardiol. 2015;30(1):33‐39. [DOI] [PubMed] [Google Scholar]
  • 2. Asatryan B, Medeiros‐Domingo A. Molecular and genetic insights into progressive cardiac conduction disease. Europace. 2019;21(8):1145‐1158. [DOI] [PubMed] [Google Scholar]
  • 3. Kaess BM, Andersson C, Duncan MS, et al. Familial clustering of cardiac conduction defects and pacemaker insertion. Circ Arrhythm Electrophysiol. 2019;12(7):e7150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Brignole M, Auricchio A, Baron‐Esquivias G, Bordachar P, Boriani G, Breithardt OA, et al. 2013 ESC Guidelines on cardiac pacing and cardiac resynchronization therapy: the Task Force on cardiac pacing and resynchronization therapy of the European Society of Cardiology (ESC). Developed in collaboration with the European Heart Rhythm Association (EHRA). Eur Heart J. 2013;34(29):2281‐2329. [DOI] [PubMed] [Google Scholar]
  • 5. Zhao Y, Meng XM, Wei YJ, et al. Cloning and characterization of a novel cardiac‐specific kinase that interacts specifically with cardiac troponin I. J Mol Med (Berl). 2003;81(5):297‐304. [DOI] [PubMed] [Google Scholar]
  • 6. Szabo L, Morey R, Palpant NJ, et al. Statistically based splicing detection reveals neural enrichment and tissue‐specific induction of circular RNA during human fetal development. Genome Biol. 2015;16:126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Feng Y, Liu DQ, Wang Z, et al. AOP‐1 interacts with cardiac‐specific protein kinase TNNI3K and down‐regulates its kinase activity. Biochemistry (Mosc). 2007;72(11):1199‐1204. [DOI] [PubMed] [Google Scholar]
  • 8. Wang H, Wang L, Song L, et al. TNNI3K is a novel mediator of myofilament function and phosphorylates cardiac troponin I. Braz J Med Biol Res. 2013;46(2):128‐137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Lodder EM, Scicluna BP, Milano A, et al. Dissection of a quantitative trait locus for PR interval duration identifies Tnni3k as a novel modulator of cardiac conduction. Plos Genet. 2012;8(12):e1003113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Lai ZF, Chen YZ, Feng LP, et al. Overexpression of TNNI3K, a cardiac‐specific MAP kinase, promotes P19CL6‐derived cardiac myogenesis and prevents myocardial infarction‐induced injury. Am J Physiol Heart Circ Physiol. 2008;295(2):H708‐H716. [DOI] [PubMed] [Google Scholar]
  • 11. Tang H, Xiao K, Mao L, Rockman HA, Marchuk DA. Overexpression of TNNI3K, a cardiac‐specific MAPKKK, promotes cardiac dysfunction. J Mol Cell Cardiol. 2013;54:101‐111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Wang X, Wang J, Su M, et al. TNNI3K, a cardiac‐specific kinase, promotes physiological cardiac hypertrophy in transgenic mice. PLoS One. 2013;8(3):e58570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Patterson M, Barske L, Van Handel B, et al. Frequency of mononuclear diploid cardiomyocytes underlies natural variation in heart regeneration. Nat Genet. 2017;49(9):1346‐1353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Wheeler FC, Tang H, Marks OA, et al. Tnni3k modifies disease progression in murine models of cardiomyopathy. Plos Genet. 2009;5(9):e1000647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Gan P, Patterson M, Velasquez A, et al. Tnni3k alleles influence ventricular mononuclear diploid cardiomyocyte frequency. Plos Genet. 2019;15(10):e1008354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Theis JL, Zimmermann MT, Larsen BT, et al. TNNI3K mutation in familial syndrome of conduction system disease, atrial tachyarrhythmia and dilated cardiomyopathy. Hum Mol Genet. 2014;23(21):5793‐5804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Xi Y, Honeywell C, Zhang D, et al. Whole exome sequencing identifies the TNNI3K gene as a cause of familial conduction system disease and congenital junctional ectopic tachycardia. Int J Cardiol. 2015;185:114‐116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Fan LL, Huang H, Jin JY, et al. Whole exome sequencing identifies a novel mutation (c.333+2T>C) of TNNI3K in a Chinese family with dilated cardiomyopathy and cardiac conduction disease. Gene. 2018;648:63‐67. [DOI] [PubMed] [Google Scholar]
  • 19. Podliesna S, Delanne J, Miller L, et al. Supraventricular tachycardias, conduction disease, and cardiomyopathy in 3 families with the same rare variant in TNNI3K (p.Glu768Lys). Heart Rhythm. 2019;16(1):98‐105. [DOI] [PubMed] [Google Scholar]
  • 20. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405‐424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Xiang R, Fan LL, Huang H, et al. A novel mutation of GATA4 (K319E) is responsible for familial atrial septal defect and pulmonary valve stenosis. Gene. 2014;534(2):320‐323. [PubMed] [Google Scholar]
  • 22. Baker KE, Parker R. Nonsense‐mediated mRNA decay: terminating erroneous gene expression. Curr Opin Cell Biol. 2004;16(3):293‐299. [DOI] [PubMed] [Google Scholar]
  • 23. Lykke‐Andersen S, Jensen TH. Nonsense‐mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 2015;16(11):665‐677. [DOI] [PubMed] [Google Scholar]
  • 24. Kurosaki T, Maquat LE. Nonsense‐mediated mRNA decay in humans at a glance. J Cell Sci. 2016;129(3):461‐467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Merchant FM, Mittal S. Pacing‐induced cardiomyopathy. Card Electrophysiol Clin. 2018;10(3):437‐445. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Table S1

Supplementary Material


Articles from Journal of Clinical Laboratory Analysis are provided here courtesy of Wiley

RESOURCES