Skip to main content
NCBI home page
Veterinary World logoLink to Veterinary World
. 2020 Aug 6;13(8):1495–1509. doi: 10.14202/vetworld.2020.1495-1509

Seroprevalence of brucellosis in sheep and goats in the Arabian Gulf region

M Ebid 1, A El Mola 2, F Salib 2
PMCID: PMC7522958  PMID: 33061219

Abstract

Background and Aim:

Brucellosis is a zoonosis that occurs worldwide. There were more efforts to control brucellosis in all countries. This study was performed to determine the seroprevalence of brucellosis in sheep and goats in some areas in the Arabian Gulf.

Materials and Methods:

The study analyzed 8500 sera from non-vaccinated sheep and goats. Animals included 6441 sheep (3420 from farms and 3021 from quarantine) and 2059 goats (1580 from farms and 479 from quarantine). Sera were tested using the Rose Bengal Plate Test (RBPT) and confirmed with an indirect enzyme-linked immunosorbent assay (i-ELISA) test. Final confirmation analyzed blood samples from confirmed infected animals (n=30, 23 sheep and seven goats) using polymerase chain reaction (PCR) and culture.

Results:

The serological examination showed that 62/8500 of animals (0.729%, confidence interval [CI] 95% 0.57-0.94) were seropositive for brucellosis. Thirteen of 5000 (0.26%, CI 95% 0.15-0.45) and 49/3500 (1.4%, CI 95% 1.1-1.8) of animals from farms and quarantine were seropositive, respectively. Out of the 6441, 46 (0.71%) sheep and 16/2059 (0.78%) goats were seropositive. i-ELISA confirmed 41/62 RBPT-positive animals – 41/8500 (0.482%, CI 95% 0.36-0.65). Eight of 5000 of these animals (0.16%, CI 95% 0.08-0.32) and 33/3500 (0.94%, CI 95% 0.67-1.3) were confirmed positive in farms and quarantine, respectively. Thirty of 6441 (0.466%) and 11/2059 (0.534%) cases were positive in sheep and goats, respectively. PCR confirmed 18 of 41 positive animals (0.212% of all sera, CI 95% 0.13-0.34) identified by both RBPT and i-ELISA. Three of 5000 (0.06%, CI 95% 0.019-0.19) and 15/3500 (0.429%, CI 95% 0.26-0.71) from farms and quarantine were confirmed positive. Tissue samples (uterine, supra-mammary, testicular, and accessory glands lymph node) were collected from positive animals, as detected by RBPT and i-ELISA, at culling or slaughtering. Using in vitro culture, 14/30 were confirmed positive – 3/7 from farms (two sheep and one goat) and 11/23 from quarantine (nine sheep and two goats). Biovar 1 was dominant. PCR confirmed 23/30 tissue samples, 4/7 from farms (three sheep and one goat), and 19/23 from quarantine (15 sheep and four goats).

Conclusion:

The overall brucellosis rate in sheep and goats is 0.48%, with fewer animals from farms testing positive (0.16%) in this area of the Arabian Gulf. The infection appears to be well controlled, and continuous effort is still needed to maintain control and completely eradicate brucellosis. Additional support is needed for testing and slaughterhouse monitoring. In quarantine (imported animals), brucellosis infection in the slaughterhouse (0.94%) could pose a risk for transmission and spread of infection. The effort is needed to monitor this threat, and PCR is a sensitive and time-saving test for brucellosis diagnosis. All 14 confirmed positive samples were Biovar 1 dominant.

Keywords: Arabian gulf, Brucellosis, goats, indirect enzyme-linked immunosorbent assay, polymerase chain reaction, Rose Bengal, seroprevalence, sheep

Introduction

Brucella melitensis, in particular, is a reemerging pathogen in the Mediterranean, Arabian Gulf, and Middle East regions. The pathogen causes severe disease in livestock and has an enormous impact on the economy of developing countries [1]. Infection of sheep and goats causes abortions, weak offspring, reduced milk production, weight loss, infertility, and lameness. The disease has been eradicated in some countries, though the cost of surveillance to maintain a B. melitensis-free state remains high. The pathogen displays three Biovars (1, 2, and 3). Brucellosis is a common disease and an important zoonosis in the Mediterranean area. Continuous progress is notable for brucellosis control, yet it is still a significant public health hazard and of great economic importance [2-4]. Various methods of control have been adopted in different countries based on the elimination of infected animals detected by serological and other diagnostic tests, other control methods based on vaccination [5]. One of the most common zoonotic diseases has economic importance worldwide and has significant public health is Brucellosis [6,7]. Brucellosis is caused by a Gram-negative bacterium in the genus Brucella. These bacteria are facultatively anaerobic, non-motile, and intracellular coccobacilli. Brucellosis affects a wide range of mammals, including man, sheep, camels, cattle, goats, swine, and wildlife [1,8-10].

All three biovars cause disease in small ruminants, but their geographic distribution varies. Biovar 1 is most common in Libya and Oman, and Biovar 2 is dominant in Turkey and Saudi Arabia. Biovar 3 is most commonly encountered in Egypt, Jordan, and Tunisia. Saudi Arabia, Iran, the Palestinian Authority, Syria, Jordan, and Oman show the highest incidence rates for human brucellosis. Bahrain is reported as free of B. melitensis [11,12] Typically, Rose Bengal Plate Test (RBPT) is used for field screening for brucellosis, sometimes along with indirect enzyme-linked immunosorbent assay (i-ELISA) [12-16]. Better approaches used more than one serological test, accompanied by molecular detection and culture, for the best diagnosis and control [11,17]. Nucleic acid amplification methods, such as polymerase chain reaction (PCR), are rapid, sensitive, and highly specific and can counteract limitations of conventional detection methods [18,19]. Furthermore, some bacterial infections, such as Chlamydia abortus, interfere with brucellosis in small ruminants [20]. A new PCR method shows high specificity and sensitivity for brucellosis diagnosis [21,22]. The technique can also be used to detect brucellosis in milk and milk products [23,24].

This study was conceived to address the lack of studies on the prevalence of brucellosis in sheep and goats in the gulf area and to update data on infection rate. Especially, the study aims to assess a wide range of incidence previously reported and to evaluate control methods, reporting by local authorities, and veterinary resources. The present study focused specifically on seroprevalence of brucellosis in sheep and goats in some areas surrounding the Arabian Gulf.

Materials and Methods

Ethical approval

This study was approved by the Research Ethics Committee at Cairo University. All samples, including blood samples and tissue samples, were collected following standard procedures without any animal harm with the acceptance of owners and local veterinary authority in Gulf Cooperation Council area.

Study area and study period

The study was performed in the Arabian Gulf region, characterized by a desert climate−scorching in summer and mild in winter. Only two main seasons exist; a hot period from April to October and a cooler period from December to February. Within the hot season, extreme heat extends from May to mid-October. March and November are intermediate warm months [25]. The present cross-sectional study was conducted between September 2014 and May 2018 with sheep and goat from farms, quarantine, and abattoirs in the Arabian Gulf region.

Study population

The study involved 85,000 non-vaccinated small ruminants and 855 farms represented by 8500 animals. The samples were collected animals from unorganized farms in four territories plus quarantine and eight organized farms. In selected localities, smaller administrative units or farms, as well as sheep flocks, and individual animals, were randomly selected and sampled using a simple random method [26].

Test animals included 6441 sheep and 2059 goats. Group 1 includes Four thousand animals from 252 unorganized farms in four territories, and 1000 animals from eight organized farms, (3420 sheep and 1580 goats). Group 2 includes 3500 animals from quarantine after import from different regions and countries (3021 sheep and 479 goats). The random animal selection was applied for farms and for the animals at farms. However, when farms noted gynecological problems, the samples were collected from both sick and healthy animals – full information about each animal – breed, sex, vaccination, and pathogenic condition was recorded. Images of animal conditions, including orchitis, abortion, mastitis, endometritis, and retained placenta, were taken. Figures-1 and 2 are examples of pathological conditions observed in the field.

Figure-1.

Figure-1

Open in a new tab

Unilateral orchitis in ram.

Figure-2.

Figure-2

Open in a new tab

Aborted fetus of sheep.

Sample size

The sample size (n) needed to assess the prevalence of brucellosis, 8500, was calculated using a standard formula [26,27]. The sample distribution between localities was 41.2% (n=3500), samples were from quarantine, 47% (n=4000) from unorganized farms, and 11.8% (n=1000) from organized farms. Animals were selected from unorganized farms in four territories, the Northern Territory, 17.6% (n=1500), Southern, 14.1% (n=1200), Moharaq, 2.4% (n=200), and Middle, 12.9% (n=1100). Data are summarized in Table-1. The sample size calculation used a confidence level of 95% and an error margin of 1%.

Table-1.

Sample collected from animals in farms and quarantine.

Group Type Territory Number of animals Number of farms Number of samples Percentage of sample Number of farms Number of sheep samples Number of farms Number of goat samples Number of farms
Group 1 farms Unorganized farms Northern terr. 12000 356 1500 17.6 85 789 74 711 52
Southern terr. 28000 236 1200 14.1 72 912 69 288 27
Moharaq terr. 3000 73 200 2.4 32 148 19 52 5
Middle terr. 7000 182 1100 12.9 62 688 75 412 39
Organized farms 5000 8 1000 11.8% 8 883 8 117 5
Total (Group 1) farms 55000 855 5000 58.8% 259 3420 245 1580 128
Group 2 Quarantine 30000 0 3500 41.2% 0 3021 0 479 0
Total 85000 855 8500 100% 259 6441 238 2059 124
Open in a new tab

Sample collection

Blood samples

Whole blood was collected from the jugular vein of each animal using two sterile Vacutainer tubes (10 ml of each). One tube without anticoagulant was used for serological tests, and the second tube with anticoagulant (EDTA) was labeled with codes describing animal and herd data recorded on investigation forms. Blood samples were kept in an upright position for 30 min in a cool place and then centrifuged at 3000 rpm for 20 min. The serum was collected by a micropipette and placed in Eppendorf tubes. Serum samples and blood samples were kept at −20°C until used, as recommended by OIE [28]. Blood samples (Table-2) were collected for analysis by RBPT, i-ELISA, and PCR.

Table-2.

Blood sample collected from animals.

Group Type Territory Number of samples Number of farms Number of sheep samples Number of farms Number of goat samples Number of farms
Group 1 farms Unorganized farms Northern terr. 1500 85 789 74 711 52
Southern terr. 1200 72 912 69 288 27
Moharaq terr. 200 32 148 19 52 5
Middle terr. 1100 62 688 75 412 39
Organized farms 1000 8 883 8 117 5
Total (Group 1) farms 5000 259 3420 245 1580 128
Group 2 Quarantine 3500 0 3021 0 479 0
Total 8500 259 6441 238 2059 124
Open in a new tab

Tissue samples

Tissue specimens from Brucella seropositive animals after slaughter were collected for bacteriological and PCR examination. Tissue samples included uterus, uterine, and supra-mammary lymph nodes in females, testis, testicular lymph nodes, ampules, and epididymis, including surround fat. Some lymph nodes, especially retropharyngeal nodes, were also collected. Tissues were packed as resected in disposable packaging, transferred hygienically to the laboratory, and kept frozen at −20°C till cultured and tested, as recommended by OIE [28]. All samples collected from one animal considered as one sample. Tissues were collected from 30 animals (Table-3) for examined by bacterial culture and PCR.

Table-3.

Tissue samples collected from confirmed positive reactors.

Group Type Territory Total Sheep tissue sample Goats tissue sample
Sheep Number of samples Sample collected Goats Number of samples Sample collected
Group 1 Unorganized farms Nortdern terr. 2 1 1 Uterus, ovaries, and lymph nodes 1 1 Uterus, ovaries and lymph nodes
Soutdern terr. 2 2 2 Uterus, ovaries, and lymph nodes 0 0 -----------------
Moharaq terr. 0 0 0 ----------------------------- 0 0 ------------------
Middle terr. 2 1 1 Uterus, ovaries, and lymph nodes 1 1 Uterus, ovaries and lymph nodes
Organized farms 1 1 1 Uterus, ovaries, and lymph nodes 0 0 --------------
Group 2 Quarantine 23 18 1 Uterus, ovaries, and lymph nodes 5 2 Testis and its accessory glands and lymph node
7 Testis and its accessory glands and lymph node 3 Accessory glands and lymph node (castrated male)
10 Accessory glands and lymph node (castrated male)
Total 30 23 23 7 7
Open in a new tab

Serological analysis of samples

RBPT

Serum samples were tested using the RBPT antigen, according to Alton et al. [29]. Briefly, 30 μL of serum and 30 μL of RBT antigen combined on the white ceramic plate and carefully mixed. The plate was agitated for 4 min, and the degree of agglutination was recorded as a grade from 0, +, ++, and +++ [29]. Grade (0) indicates the absence of agglutination, grade (+) indicate barely visible agglutination, grade (++) indicates finely dispersed agglutination, and grade (+++) indicates coarse clumping. The samples with grade (+, ++, and +++) were considered positive. Positive and negative control sera for comparison of the results were used.

i-ELISA

All samples that tested positive by RBPT were further analyzed by i-ELISA for confirmation. i-ELISA was performed following ELISA kit manufacturer’s instructions “(ID. vet, ID screen, Brucellosis serum indirect multispecies, rue Louis Pasteur-Grabels – France).”

PCR

All positive samples that tested positive in both RBPT and i-ELISA assays were further tested by PCR.

DNA isolation used a DNA Purification Kit (Promega, USA) according to the manufacturer’s instructions. Briefly, 300 μL of the blood sample was placed in a sterile Eppendorf tube (1.5 mL size) and 900 μL of erythrocyte lysis solution as added. The mixture was incubated for 10 min at room temperature (22-25°C), and then centrifuged using a refrigerated Eppendorf centrifuge at 16,000 rpm for 1 min. The leukocyte pellet was dispersed by vortexing for 20 s at high speed after discarding the supernatant. Three hundred microliter of nucleic lysis solution was added to the resuspended white pellet and pipetted for 3-5 times to lyse the white blood cells. The suspension was then incubated at 37°C for 1 h, and 1.5 μL of RNase solution was added by micropipette. Incubation was continued for 15-20 min and then a 100 μL aliquot vortexed for 20 s at high speed. A small clump of protein was visible. After 4 min at room temperature, the lysate was centrifuged at 16,000 rpm. A dark brown protein pellet after centrifugation was visible. The supernatant containing total DNA was transferred to a clean 1.5 mL Eppendorf tube containing 300 μL isopropanol at room temperature. The solution was gently mixed 5-8 times by inversion until white thread-like strands of DNA formed a visible mass. The samples were then centrifuged at 16000 rpm for 5 min to recover DNA. DNA pellet was washed with 300 μL of 70% ethanol, dried, and resuspended in 60 μL of DNA rehydration solution. Extracted DNA was kept at −20°C until use in PCR analyses. Concentration and purity of DNA were confirmed spectrophotometrically. Furthermore, agarose gels with 5 μL of DNA were used to examine the quality and quantity of DNA. Finally, sheep glyceraldehyde 3-phosphate dehydrogenase was also used to confirm the quality of extracted DNA [30].

Extraction of DNA from tissues

Briefly, 3 mL of 1× phosphate-buffered saline and 1 g of a pooled sample of tissues (uterus, testes, accessory organ, and lymph node) were added to a 10 mL tube and tissue homogenized with a tissue homogenizer. After homogenization, the suspension was centrifuged at 3000 rpm for 5 min at 4°C. Two hundred microliter of supernatants and 600 μL of nucleic lysis solution were mixed and pipetted repeatedly until no clumps of the cell were visible. The lysate was then incubated at 65°C for 15-30 min in a water bath. Three microliter of RNase was added and incubation was continued at 37°C for 15-30 min. After cooling, DNA was obtained as described above.

Primers

Primer pairs specific to the IS711 element of B. melitensis, 5’AAATCGCGTCCTTGCTGGTCTGA3’ and 5’TGCCGATCACTTAAGGGCCTTCAT3’, were used to confirm B. melitensis in tissue and blood samples. The amplified product of this primer set was 731-bp identified with agarose gel electrophoresis [30] (Figure-3).

Figure-3.

Figure-3

Open in a new tab

Polymerase chain reaction result in agar gel.

PCR

PCR amplification was performed using a Promega Go Taq Green Master Mix (USA). Briefly, the PCR mix included 12.5 μL of Go Taq Green Master Mix, 4.5 μL nuclease-free water, 2 μL MgCl2, 2 μL of every forward and reverse primers, and 2 μL of genomic DNA. A total volume of 25 μL after that was initially incubated at 94°C for 4 min. PCR was then performed with 35 cycles with 1 min for DNA denaturation at 94°C, 1 min at 50°C for primer annealing for the OMP 2 primers set, and 56°C for the B. melitensis specific primer set, and for polymerase-mediated primer extension at 72°C for 1.5 min. The last (45) cycle included sample incubation for 10 min at 72°C and the retained at 4°C for an unlimited time. Seven microliters of the amplified product were analyzed by electrophoresis in 1.5% agarose gels in TBE buffer with ethidium bromide. DNA bands were visualized under UV light and photographed using an AlphaImager (Alpha Innotech) image documentation system [30].

Identification of Brucella species from Brucella isolates

Presumptive identification of B. melitensis was made based by observing small Gram-negative coccobacilli, and biochemical tests positive for “oxidase, catalase, and urease,” and further confirmed by antigen-antibody reaction agglutination with specific antisera (Remel Europe Ltd.). Moreover, identification, using Vitek 2 systems (version 07.01, BioMerieux), was performed with a Gram-negative bacteria colorimetric identification card (GN card) that contains different biochemical tests recommended by FAO/WHO expert committee on brucellosis [5,30].

Statistical analysis

Statistical analyses used the Statistical Package for the Social Sciences (SPSS) for Windows® version 20.0 (SPSS Inc., Chicago, Illinois). Descriptive statistics of the variables included frequencies and prevalence.

Variables of category – Brucella species, territory, farm, and animal sex – were expressed in numbers and percentages. The prevalence proportion was calculated as the number of animals testing positive by RBPT, i-ELISA, or PCR, divided by the total number of animals. Correlation among factors and outcome variables were assessed using Chi-square tests. For all analyses, p<0.05 was considered significant.

Results

Blood test

RBPT

RBPT showed that 62/8500 of animals (0.729%, confidence interval [CI] 95% 0.57-0.94) were seropositive. Thirteen of 5000 (0.26%, CI 95% 0.15-0.45) and 49/3500 (1.4%, CI 95% 1.1-1.8) animals were positive in farms and quarantine, respectively. Forty-six of 6441 sheep (0.71%, CI 95% 0.54-0.95) were seropositive with 10/3420 (0.292%, CI 95% 0.16-0.54) and 36/3021 (1.192%, CI 95% 0.86-1.65) animals from farms and quarantine, respectively. Sixteen of 2059 goats (0.78%, CI 95% 0.48-1.27) were seropositive with 3/1580 (0.19%, CI 95% 0.06-0.59) and 13/479 (2.7%, CI 95% 1.6-4.6) animals farms and quarantine, respectively (Tables-4 and 5).

Table-4.

RBPT test result.

Group Type Territory RBPT results
Total % Sheep % Goats %
Group 1 Unorganized farms Northern terr. 5 0.33 3 0.38 2 0.28
Southern terr. 3 0.25 3 0.33 0 0.00
Moharaq terr. 0 0.00 0 0.00 0 0.00
Middle terr. 2 0.18 1 0.15 1 0.24
Organized farms 3 0.30 3 0.34 0 0.00
Total (Group 1) farms 13 0.26 10 0.29 3 0.19
Group 2 Quarantine 49 1.40 36 1.19 13 2.71
Total 62 0.73 46 0.71 16 0.78
Open in a new tab

RBPT=Rose Bengal plate test

Table-5.

RBPT result CI 95%.

Group 1 farms Group 2 quarantine Total
Number of positive RBPT 13/5000 49/3500 62/8500
% 0.26 1.4 0.73
CI 95 0.15-0.45 1.1-1.8 0.57-0.94
Number of positive RBPT sheep 10/3420 36/3021 46/6441
% 0.29 1.19 0.71
CI 95 0.16-0.54 0.86-1.65 0.54-0.95
Number of positive RBPT goats 3/1580 13/479 16/2059
% 0.19 2.71 0.78
CI 95 0.06-0.59 1.6-4.6 0.48-1.27
Open in a new tab

CI=Confidence interval, RBPT=Rose Bengal plate test

ELISA

i-ELISA confirmed 41 of 62 RBPT-positive results, 0.482% of 8500 animals (CI 95% 0.36-0.65). Eight of 5000 (0.16%, CI 95% 0.08-0.32) and 33/3500 (0.94%, CI 95% 0.67-1.3) were confirmed positive in animals from farms and quarantine, respectively. In sheep, 30 of 6441 (0.466%, CI 95% 0.33-0.67) were positive. Of which 5/4320 (0.146%, CI 95% 0.06-0.35) and 25/3021 (0.828%, CI 95% 0.56-1.2) from farms and quarantine, respectively. Similar results for goats were 11/2059 (0.534%, CI 95% 0.3-0.96) total, 3/1580 (0.192%, CI 95% 0.06-0.59) for farms, and 8/479 (1.68%, CI 95% 0.84-3.32) for quarantine (Tables-6 and 7).

Table-6.

i-ELISA test results.

Group Type Territory i-ELISA results
Total % Sheep % Goats %
Group 1 Unorganized farms Northern terr. 3 0.20 1 0.13 2 0.28
Southern terr. 2 0.17 2 0.22 0 0.00
Moharaq terr. 0 0.00 0 0.00 0 0.00
Middle terr. 2 0.18 1 0.15 1 0.24
Organized farms 1 0.10 1 0.11 0 0.00
Total (Group 1) farms 8 0.16 5 0.15 3 0.19
Group 2 Quarantine 33 0.94 25 0.83 8 1.67
Total 41 0.48 30 0.47 11 0.53
Open in a new tab

i-ELISA=Indirect enzyme-linked immunosorbent assay

Table-7.

i-ELISA test result CI 95%.

Group 1 farms Group 2 Quarantine Total
Number of positive i-ELISA 8/5000 33/3500 41/8500
% 0.16 0.94 0.48
CI 95 0.08-0.32 0.67-1.3 0.36-0.65
Number of positive i-ELISA Sheep 5/3420 25/3021 30/6441
% 0.15 0.83 0.47
CI 95 0.06-0.35 0.56-1.2 0.33-0.67
Number of positive i-ELISA goats 3/1580 8/479 11/2059
% 0.19 1.67 0.53
CI 95 0.06-0.59 0.84-3.32 0.3-0.96
Open in a new tab

CI=Confidence interval, i-ELISA=Indirect enzyme-linked immunosorbent assay

Territory distribution

For Group 1 (farms), 13/5000 (0.26%) animals were seropositive. The prevalence was 0.33%, 0.25%, 0%, 0.18%, and 0.3% for Northern, Southern, Moharaq, Middle, and organized farms, respectively. Positive results confirmed that i-ELISA was obtained for 8/5000 (0.16%) animals. The prevalence was 0.2%, 0.17%, 0%, 0.182%, and 0.1% for Northern, Southern, Moharaq, Middle, and conventional farms, respectively. For sheep, RBPT indicated that 10/3420 (0.292%) animals were seropositive. The prevalence was 0.38%, 0.33%, 0%, 0.15%, and 0.34% for Northern, Southern, Moharaq, Middle, and conventional farms, respectively. Results confirmed by i-ELISA showed that 5/3420 (0.15%) sheep were seropositive. The prevalence was 0.13%, 0.22%, 0%, 0.15%, and 0.11% for Northern, Southern, Moharaq, Middle, and conventional farms, respectively.

RBPT results showed that 3/1580 (0.19%) goats were seropositive. The prevalence was 0.28%, 0%, 0%, 0.24%, and 0% Northern, Southern, Moharaq, Middle, and conventional farms, respectively. i-ELISA confirmed all positive sera identified by RBPT.

For Group 2 (quarantine), RBPT identified 49/3500 (1.4%) animals and 1.19% and 2.71% for sheep and goats, respectively, as seropositive. For i-ELISA, 33/3500 (0.94%) and 0.83% and 1.67% for sheep and goats, respectively, were confirmed (Tables-4 and 6, Figures-4-6)

Figure-4.

Figure-4

Open in a new tab

Chart of total infection rates by Rose Bengal Plate Test and indirect enzyme-linked immunosorbent assay.

Figure-6.

Figure-6

Open in a new tab

Chart showing infection rates by Rose Bengal Plate Test and indirect enzyme-linked immunosorbent assay in goats.

Figure-5.

Figure-5

Open in a new tab

Chart of infection rates by Rose Bengal Plate Test and indirect enzyme-linked immunosorbent assay in sheep.

Farm view rates

Examining data by showed 5/259 (1.93%) of farms were seropositive by RBPT for one or more animals. Two, 1, 0, 1, and 1 farms show the prevalence Brucella of 2.35%, 1.39%, 0%, 1.61%, and 12.5% in Northern, Southern, Moharaq, Middle, and conventional farms, respectively. i-ELISA confirmed that 4/259 (1.54%) of farms were seropositive. The one farm that was not confirmed was in the Northern Territory (Table-8). RBPT analyses for sheep farms showed that 4/245 (1.68%) farms were seropositive. One, 1, 0, 1, and 1 farms show the prevalence of 1.35%, 1.45%, 0%, 1.33%, and 12.5% in Northern, Southern, Moharaq, Middle, and conventional farms. i-ELISA confirmed all RBPT results (Table-9). RBPT analyses found that 2/128 (1.56%) farms were seropositive. One, 0, 0, 1, and 0 farms show the prevalence of 1.92%, 0%, 0%, 2.56%, and 0% in Northern, Southern, Moharaq, Middle, and conventional farms, respectively. The same result was obtained when confirmed by i-ELISA (Table-10).

Table-8.

Farm rate tests results.

Group Type Territory Sample RBPT i-ELISA
Number of samples Number of farms Result Number of positive farms Percentage of positive farms Result Number of positive farms Percentage of positive farms
Group 1 Unorganized farms Northern terr. 1500 85 5 2 2.35 3 1 1.18
Southern terr. 1200 72 3 1 1.39 2 1 1.39
Moharaq terr. 200 32 0 0 0.00 0 0 0.00
Middle terr. 1100 62 2 1 1.61 2 1 1.61
Organized farms 1000 8 3 1 12.50 1 1 12.50
Total (Group 1) farms 5000 259 13 5 1.93 8 4 1.54
Open in a new tab

RBPT=Rose Bengal plate test, i-ELISA=Indirect enzyme-linked immunosorbent assay

Table-9.

Sheep in farms rate results.

Group Type Territory Sample RBPT i-ELISA
Number of samples Number of farms Result Number of positive farms Percentage of positive farms Result Number of positive farms Percentage of positive farms
Group 1 Unorganized farms Nortdern terr. 789 74 3 1 1.35 1 1 1.35
Soutdern terr. 912 69 3 1 1.45 2 1 1.45
Moharaq terr. 148 19 0 0 0.00 0 0 0.00
Middle terr. 688 75 1 1 1.33 1 1 1.33
Organized farms 883 8 3 1 12.50 1 1 12.50
Total (Group 1) farms 3420 245 10 4 1.68 5 4 1.68
Open in a new tab

RBPT=Rose Bengal plate test, i-ELISA=Indirect enzyme-linked immunosorbent assay

Table-10.

Goats in farms rate results.

Group Type Territory Sample RBPT i-ELISA
Number of samples Number of farms Result Number of positive farms Percentage of positive farms Result Number of positive farms Percentage of positive farms
Group 1 unorganized farms Nortdern terr. 711 52 2 1 1.92 2 1 1.92
Soutdern terr. 288 27 0 0 0.00 0 0 0.00
Moharaq terr. 52 5 0 0 0.00 0 0 0.00
Middle terr. 412 39 1 1 2.56 1 1 2.56
Organized farms 117 5 0 0 0.00 0 0 0.00
Total (Group 1) farms 1580 128 3 2 1.56 3 2 1.56
Open in a new tab

RBPT=Rose Bengal plate test, i-ELISA=Indirect enzyme-linked immunosorbent assay

Sex-related rate

RBPT analyses found that 1/423 (0.24%) males were seropositive with the single positive result from an animal in the Northern Territory. In contrast, 12/4577 (0.26%) female animals were seropositive. The prevalence was 0.3%, 0.28%, 0%, 0.2%, and 0.31% in Northern, Southern, Moharaq, Middle, and conventional farms, respectively.

i-ELISA did not confirm the single seropositive result in the male animals. Eight of 4577 (0.16%) females were seropositive in i-ELISA. The prevalence was 0.22%, 0.19%, 0%, 0.2%, and 0.1% in Northern, Southern, Moharaq, Middle, and conventional farms, respectively.

For Group 2 (quarantine), 47/3450 (1.36%) and 32/3450 (0.93%) male animals were identified by RBPT and i-ELISA, respectively, and were 2/50 (4.0%) and 1/50 (2.0%) female animals using RBPT and i-ELISA, respectively (Table-11 and Figure-7).

Table-11.

Male and female rate.

Group Type Territory Sample RBPT i-ELISA
Number of samples Number of sample male Number of sample female RBPT result RBPT result male RBPT result female i-ELISA result i-ELISA result male i-ELISA result female
Group 1 Unorganized farms Northern terr. 1500 150 1350 5 1 4 3 0 3
Northern terr. % 0.33 0.67 0.30 0.20 0.00 0.22
Southern terr. 1200 123 1077 3 0 3 2 0 2
Southern ter. % 0.25 0.00 0.28 0.17 0.00 0.19
Moharaq terr. 200 38 162 0 0 0 0 0 0
Moharaq terr. % 0.00 0.00 0.00 0.00 0.00 0.00
Middle terr. 1100 87 1013 2 0 2 2 0 2
Middle terr. % 0.18 0.00 0.20 0.18 0.00 0.20
Organized farms 1000 25 975 3 0 3 1 0 1
0.30 0.00 0.31 0.10 0.00 0.10
Total farms 5000 423 4577 13 1 12 8 0 8
Total farms % 0.26 0.24 0.26 0.16 0.00 0.17
Group 2 Quarantine 3500 3450 50 49 47 2 33 32 1
Quarantine % 1.40 1.36 4.00 0.94 0.93 2.00
Total 8500 3873 4627 62 48 14 41 32 9
Total % 0.73 1.24 0.30 0.48 0.83 0.19
Open in a new tab

RBPT=Rose Bengal plate test, i-ELISA=Indirect enzyme-linked immunosorbent assay

Figure-7.

Figure-7

Open in a new tab

Chart showing male and female rate.

PCR results

PCR confirmed brucellosis in blood samples in 41 samples that were positive in RBPT and i-ELISA analyses. PCR confirmed 18/8500 samples (0.21%, CI 95% 0.13-0.34). Three of 5000 (CI 95%, 0.019-0.19) and 15/3500 (0.43%, CI 95% 0.26-0.71) were confirmed animals from Group 1 (farms) and Group 2 (quarantine), respectively. Fifteen of 6441 (0.466%) samples from sheep were confirmed with 2/4320 (0.06%) and 13/3021 (0.43%) in animals from farms and quarantine, respectively. Confirmation results for goats were 3/2059 (0.146%), 1/1580 (0.06%), and 2/479 (0.42%) total, farm, and quarantine animals, respectively (Tables-12 and 13).

Table-12.

PCR results blood samples.

Group Type Area PCR serum
Total % Sheep % Goats %
Group 1 Unorganized farms Northern terr. 1 0.07 0 0.00 1 0.14
Southern terr. 1 0.08 1 0.11 0 0
Moharaq terr. 0 0 0 0 0 0
Middle terr. 1 0.09 1 0.15 0 0
Organized farms 0 0 0 0 0 0
Total (Group 1) farms 3 0.06 2 0.06 1 0.06
Group 2 Quarantine 15 0.43 13 0.43 2 0.42
Total 18 0.21 15 0.23 3 0.15
Open in a new tab

PCR=Polymerase chain reaction

Table-13.

PCR results blood samples CI 95%.

Group PCR serum
Total % Sheep % Goats %
Group 1 farms 3/5000 0.06 2 0.06 1 0.06
CI 95 0.019 - 0.19
Group 2 Quarantine 15/3500 0.43 13 0.43 2 0.42
CI 95 0.26-0.71
Total 18/8500 0.21 15 0.23 3 0.15
CI 95 0.13-0.34
Open in a new tab

PCR=Polymerase chain reaction, CI=Confidence interval

Tests on tissue samples

Brucella isolation and identification

Brucella was isolated and identified for brucellosis in tissue samples from 14 to 30 culled or slaughtered animals that were seropositive by RBPT and i-ELISA. All B. melitensis isolates were Biovar 1 and were less prevalent in farm animals (3/5000, 0.06%) than quarantined animals (11/3500, 0.31%). Eleven of 6441 sheep (0.18%) were confirmed positive, 2/4320 (0.07%) and 9/3021 (0.3%) from Group 1 (farms) and Group 2 (quarantine), respectively. The results for goats were 3/2059 (0.16%), 1/1580 (0.072%), and 2/479 (0.42%) for total, farm, and quarantined animals, respectively (Table-14).

Table-14.

Results of tissue samples examination.

Group Type Territory Media culture PCR t. sample
Total Sheep Goats Total Sheep Goats
Group 1 Unorganized farms Northern terr. 2 1 1 1 1 0
Northern terr. % 0.13 0.13 0.14 0.07 0.13 0
Southern terr. 1 1 0 1 1 0
Southern terr. % 0.08 0.11 0 0.08 0.11 0
Moharaq terr. 0 0 0 0 0 0
Moharaq terr. % 0 0 0 0 0 0
Middle terr. 0 0 0 1 0 1
Middle terr. % 0 0 0 0.09 0 0.24
Organized farms 0 0 0 1 1 0
Organized farms % 0 0 0.10 0.11 0
Total farms 3 2 1 4 3 1
Total farms % 0.06 0.07 0.07 0.08 0.09 0.08
Group 2 Quarantine 11 9 2 19 15 4
Quarantine % 0.31 0.30 0.42 0.54 0.50 0.84
Total 14 11 3 23 18 5
Total % 0.17 0.18 0.16 0.27 0.28 0.26
Open in a new tab

PCR=Polymerase chain reaction

PCR for tissue samples

PCR confirmed B. melitensis in 23/30 tissue samples (0.27%) with 4/5000 (0.08%) and 19/3500 (0.54%) in animals from Group 1 (farms) and Group 2 (quarantine), respectively (Table-14). Eighteen of 6441 (0.28%) sheep were confirmed with 3/4320 (0.09%) and 15/3021 (0.5%) in sheep from Group 1 (farms) and Group 2 (quarantine), respectively. The results were 5/2059 (0.26%) for goats with 1/1580 (0.08%) and 4/479 (0.84%) in animals from farms and quarantine (Table-14).

Discussion

Brucellosis is an important zoonosis that causes abortion in naturally infected small ruminants and is of great public health concern in many countries [30,31]. The results of the study were part of an effort to develop a method for rapid and accurate brucellosis diagnosis. Such a method is critical to support effective eradication and monitoring programs.

Many factors that affect brucellosis seroprevalence in small ruminants could be associated with frequent introduction of purchased animals into flocks, including the absence of quarantine/segregation, mixing of different species of infected flocks, improper safe hygienic disposal of aborted fetuses placental membranes, contact of healthy animals with contaminated drinking water, grassing yards and feed, and lack of vaccination and control strategies for small ruminants [30-32].

Brucellosis control and eradication from small ruminants (sheep and goats) require an appropriate serological method for brucellosis diagnosis in the infected or endemic areas. Diagnostic tests used may not reveal all animals infected (false-negatives) or may show infection when it not present (false-positives) due to a long period of incubation, latency, or criteria used to interpret the results [31,32]. Isolation and identification of organisms are the diagnosis gold standard, but it is cumbersome, takes several days to weeks, and poses a higher risk to laboratory personnel. Hence, the diagnosis of brucellosis largely depends on the use of two or more tests to confirm infection [32]. RBPT is a current screening test, and i-ELISA is used as a confirmatory test used for B. melitensis infection in small ruminants (sheep and goats) [31-36]. In comparison to i-ELISA, Sn, and Sp of the RBPT are lower. However, RBPT is convenient because of low cost, feasibility, and reliability as a field diagnostic test compared with i-ELISA [37,38]. The latter technique provides acceptable sensitivity and specificity [39,40].

The overall brucellosis prevalence seropositivity in the study area was 0.48% by RBT and i-ELISA, which is lower than that found in Al-Ahsa KSA which was 1.1% [41], Alkamil, KSA 5.88% [10], Abu Dhabi Emirate 8.3% [42], Oman 2.4%, (Dhofar) 8.6%, Northern governorates 0.97%, Al Aqaieb 24%, and Al Helailat 40%. While in Al Ghilayil, Al Qasha’e, Da’anAlhamra, Al Sarah, Hail Al Hedap, and Shnoot are free from brucellosis [13,43].

Brucella infection seroprevalence in small ruminants was determined based on screening with RBPT and confirmation by i-ELISA. Twenty-one samples tested positive by RBPT but negative by i-ELISA. The higher sensitivity of i-ELISA due to its recognition of cytosolic antigen S-LPS fragments may decrease cross-reaction with other Gram-negative bacteria [5,44,45]. Other bacteria share similar epitopes with Brucella [5].

Secondary can refer acidified antigens in RPBT usually produce prozoning phenomena (false positive result), [44]. Hence, i- ELISA has been evaluated for many years for their better sensitivity to detect anti-Brucella antibodies in all species especially small ruminant, several studies reported that i-ELISA is more sensitive than conventional tests [13] assessed the indirect ELISA efficacy in comparison with CFT and RBPT on sera from B. melitensis infected ewes. Indirect ELISA can be a useful screening tool and could be used alone or in addition to RBT. The present i-ELISA performance is consistent with the study of Nielsen et al. [46]. The performance evaluation of infected and vaccinated sheep and goats showed that i-ELISA outperformed other tests and recommended it for diagnosis of Ovine-Caprine brucellosis. However, low performance with vaccinated animals limits i-ELISA to instances where animals have no history of vaccination to avoid false-positive results [11,47].

Estimated infection rates in sheep were 0.71% and 0.47% by RBT and i-ELISA, respectively, and in goats, 0.78% and 0.53% by RBT and i-ELISA, respectively. No significant difference existed between these species. Furthermore, a significant difference was observed between species in Group 2 (quarantine). Results for goats (2.7%) and (1.7%) were higher than for sheep (1.2) and (0.8%) by RBT and i-ELISA, respectively. This result may reflect infection rates in the country of origin and local control programs. Sheep and goats were imported from different countries. In contrast, a higher prevalence of sheep has also been reported [38,41,43].

Sheep behavior may also be a factor since they tend to gather in parturition and at night, which increases the potential for disease transmission. Goats do not display this behavior [48]. Larger herds of sheep may be more likely to show at least one positive case than small herds and are typically associated with mass livestock management. Infection in these herds may spread due to closer contact among animals and their Brucella-containing excretions [49].

Seroprevalence was not significantly different between males and females in Group 1 (farms) but showed a higher incidence in males in Group 2 (quarantine). This result contrasts with other reports [6,50,51]. Statistical analysis shows that males and females are equally susceptible to Brucella infection. Thus, the present results may be affected by the small number of males examined from farms and the few females from quarantine.

Serological testing with RBT and i-ELISA for Brucella infections is widely accepted. However, serum agglutination tests (and to a lesser extent RBPT) are less suitable for diagnosis of chronic brucellosis since they mainly depending on IgM and IgG detection. IgM found in sera in chronic infection will decline and become undetectable [50]. ELISA remains a useful epidemiological tool that provides for investigation of the infective status of herds [5,51-56].

Information on Brucella prevalence in small ruminants (goats and sheep) is critical to preventive control measures for brucellosis. However, seroprevalence information for brucellosis in the gulf province has been scant, though small ruminants are major livestock and traditionally the main sources of meat. Infection is often under-detected in this region despite inflicting a high economic and health burden, mainly due to a lack of concern at the individual level in rural areas. Moreover, the present study results are useful for policymakers to evaluate the status of the disease in livestock. Finally, the study provides baseline data for further study of Brucella infections and for planning control and eradication strategies.

PCR and other genetic techniques are broadly used for the rapid detection of brucellosis [57] and could be considered in future studies in the gulf. PCR confirmed brucellosis in blood samples in 18 of 41 samples that were seropositive by RBPT and i-ELISA. Of these samples, 3 and 15 were confirmed positive in animals from farms and quarantine, respectively. Fifteen sheep were confirmed positive, 2 and 13 in animals from farms and quarantine, respectively. Three samples from goats 3/2059 (0.146%) were confirmed positive, with one from farms. The results indicate that diagnosis of brucellosis by PCR using blood as a sample is applicable but not simple. In the present investigation, further effort was made for diagnosing brucellosis from blood samples [22,57].

Only 18 samples were positive by PCR compared to 62 by RBPT and 41 by i-ELISA. Wide variation in samples detected could be due to many factors. PCR detects DNA, which may be in low quantity in blood samples even though antibody titer is quite high. Alternatively, titer in serum may be below detectable levels, but the amount of DNA may be sufficient for detection by PCR. PCR may detect as little as five fg of DNA [58]. Furthermore, standardized conditions for RBPT antigen suitable for diagnosing bovine infection are not adequate for sheep and accounts for the low sensitivity of RBPT in small ruminants [59]. This report is preliminary and indicates that PCR can also be applied for the diagnosis of brucellosis in animals, using blood samples, for more rapid and accurate brucellosis diagnosis.

From 30 tissue samples collected from culled or slaughtered animals that were seropositive, only 23 samples were detected as positive by PCR. Thus, PCR did not identify seven seropositive samples as positive. Isolation identified only 14 samples of B. melitensis, and confirmed Biovar 1. No bacteria could be isolated from 16 seropositive samples. Isolation and cultivation are a gold standard diagnostic technique for brucellosis since it is specific and permits biotyping to aide epidemiological analysis [60]. Only the organism can provide a definitive profile and firm confirmation of infection. However, negative result does not exclude the presence of brucellosis [61]. Typing of Brucella was performed for strains isolated from tissue samples and lymph nodes from slaughtered animals verified to be serologically positive. All isolates were typical of B. melitensis and were identified as Br. melitensis Biovar 1. These results are consistent with the previous reports [61-64]. The primary hosts for B. melitensis are small ruminants, suggesting that the sensitivity of serological tests is higher than that of the culture method. A similar conclusion was reached by Sayour [62], who concluded that the best specific diagnostic assay is the isolation of the causative organism; however, this method suffers the disadvantages of low sensitivity and a requirement for extended time for tissue preparation and culture.

Some research indicates that PCR-ELISA is more sensitive than other molecular methods. This method is more effective and accurate than PCR, serology, and culture of bacteria [65]. PCR is more sensitive and easily applicable than bacterial culture [6,11]. Further, some studies indicate a real transmission risk to both butchery personnel and consumers. Accurate and sensitive testing of animals before slaughter and marketing is needed to prevent the spread of human infection [66].

Conclusion

The overall incidence of brucellosis is 0.48%, and 0.16% in farms. In this area of the gulf, the disease seems to be under control, and a continuous effort is needed to maintain control and eventually completely eradicate brucellosis. Additional support is needed for testing and slaughterhouse monitoring. In quarantined (imported) animals, brucellosis infection in the slaughterhouse (0.94%) could pose a risk for transmission and spread of infection. Effort is needed to monitor this threat, and PCR is a sensitive and time-saving test for brucellosis diagnosis. All 14 confirmed positive samples were Biovar 1 dominant.

Authors’ Contributions

ME, AE, and FS planned the study. ME collected the samples, performed the experiments, processed the experimental data, performed the analysis, drafted the manuscript, and designed the figures and performed the calculations. AE and FS supervised the findings of this work. All authors discussed the results and contributed to the final manuscript.

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.

Acknowledgments

The authors are grateful to Prof. Dr. Tamer Mohamed for his help in data analysis. The present study was a part of brucellosis control and eradication project work in Gulf Cooperation Council area. The authors did not receive any funds for this study.

References

  • 1.Radostits O.M, Gay C, Blood C.D, Hinchclift W.K. 10th. London, UK: ELBS Bailliere Tindall; 2007. Veterinary Medicine, Textbook of the Diseases of Cattle, Sheep, Pigs, Goats and Horses; pp. 963–994. [Google Scholar]
  • 2.Rossetti C.A, Arenas-Gamboa A.M, Maurizio E. Caprine brucellosis: A historically neglected disease with significant impact on public health. PLoS Negl. Trop. Dis. 2017;11(8):e0005692. doi: 10.1371/journal.pntd.0005692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.World Health Organization. Geneva, Switzerland: World Health Organization; 2006. Brucellosis in Humans and Animals. [Google Scholar]
  • 4.World Health Organization. Geneva, Switzerland: WHO Document Production Services; 2009. Integrated Control of Neglected Zoonotic Diseases in Africa: Applying the One Health Concept. [Google Scholar]
  • 5.OIE. Paris, France: OIE; 2018. Manual of Standards for Diagnostic Tests and Vaccines for Terrestrial Animals Ch. 2.1.4 Brucellosis (Brucella abortus B. melitensis and B. suis) (infection with B. abortus B. melitensis and B. suis) [Google Scholar]
  • 6.Samadi A, Ababneh M.M.K, Giadinis N.D, Lafi S.Q. Ovine and caprine brucellosis (Brucella melitensis) in aborted animals in Jordanian sheep and goat flocks. Vet. Med. Int. 2010;Volume 2010:7. doi: 10.4061/2010/458695. |Article ID 458695 |. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rubach P, Halliday J.E.B, Cleaveland S, Crump J.A. Brucellosis in low-income and middle-income countries. Curr. Opin. Infect. Dis. 2013;26(5):404–412. doi: 10.1097/QCO.0b013e3283638104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Godfroid J. Brucellosis in livestock and wildlife:Zoonotic diseases without pandemic potential in need of innovative one health approaches. Arch. Public Health. 2017;75(1):34. doi: 10.1186/s13690-017-0207-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mohamed E.M.A, Elfadil A.A.M, El-Sanousi E.M, Ibrahaem H.H, Mohamed-Noor E.E, Abdalla M.A, Shuaib Y.A. Seroprevalence and risk factors of caprine brucellosis in Khartoum state, Sudan. Vet. World. 2018;11(4):511–518. doi: 10.14202/vetworld.2018.511-518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kandeel A.E, Gamal M.T, Sediek A.A, Salauddin H.S, Fadlelmoula A.A.A. Seroprevalence of brucellosis within sheep and goat flocks in Alkamil province in Saudi Arabia. Bothalia J. 2014;44(5):131–138. [Google Scholar]
  • 11.El-Sharkawy H, Ahmed S.A, Salem M.A.M, Soliman S.M, Soliman H.S. Egypt: Ph.D. Thesis, Cairo University; 2019. Some Epidemiological Studies on Sheep and Goats Brucellosis in Egypt. [Google Scholar]
  • 12.Shuaib Y.A, Mansour M.E, Ibrahaem H.H, Mohamed-Noor S.E, Boukhari M.I, Issa M.H, El-Sanousi E.M, Suliman S.E, El-Fadil A.A.M, Abdalla M.A. Seroprevalence of sheep brucellosis in three different locations in Kassala state:A Short communication. J. Dairy Vet. Anim. Res. 2018;7(2):53–57. [Google Scholar]
  • 13.ElTahir Y, Al Toobi A.G, Al-Marzooqi W, Mahgoub O, Jay M, Corde Y, Al Lawati H, Bose S, Al Hamrashdi A, Al Kharousi K, Al-Saqri N, Al Busaidi R, Johnson E.H. Serological, cultural and molecular evidence of Brucella melitensis infection in goats in Al Jabaal Al Akhdar, Sultanate of Oman. Vet. Med. Sci. 2018;4(3):190–120. doi: 10.1002/vms3.103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Olufemi O.T, Dantala D.B, Shinggu P.A, Dike U.A, Otolorin G.R, Nwuku J.A, Baba-Onoja E.B.T, Jatau T.D, Amama F.I. Seroprevalence of brucellosis and associated risk factors among indigenous breeds of goats in Wukari, Taraba State. Niger. J. Pathog, 2018;Volume 2018:5. doi: 10.1155/2018/5257926. |Article ID 5257926 |. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Abdalla M.A, El-Sanousi E.M, Shuaib Y.A, Ibrahaem H.H, Fadle-Al-Mola K.M, Mohamed-Noor S.E, Suliman S.E, Idris S.H, Abdalla M.A. Sero-prevalence of brucellosis in sheep in El-Gadarif state. EC Vet. Sci. 2019;4(1):15–19. [Google Scholar]
  • 16.Saxena N, Singh B.B, Saxena H.M. Brucellosis in sheep and goats and its serodiagnosis and epidemiology. Int. J. Curr. Microbiol. Appl. Sci. 2018;7(1):1848–1877. [Google Scholar]
  • 17.El-Diasty M.M, Wareth G, Melzer F, Mustafa S, Sprague L.D, Neubauer H. Isolation of Brucella abortus and Brucella melitensis from seronegative cows is a serious impediment in brucellosis control. Vet. Sci. 2018;5(1):28. doi: 10.3390/vetsci5010028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Elfaki M.G, Al-Hokail A, Nakeeb S.M, Al-Rabiah F.A. Evaluation of culture, tube agglutination, and PCR methods for the diagnosis of brucellosis in humans. Int. Med. J. Exp. Clin. Res. 2005;11(11):69–74. [PubMed] [Google Scholar]
  • 19.Wareth G, Melzer F, Tomaso H, Roesler U, Neubauer H. Detection of Brucella abortus DNA in aborted goats and sheep in Egypt by real-time PCR. BMC Res. Notes. 2015;8 doi: 10.1186/s13104-015-1173-1. Article number: 212 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bhandi S, Pfukenyi D.M, Matope G, Murondoti A, Tivapasi M, Ndengu M, Scacchia M, Bonfini B, de Garine-Wichatitsky M. Brucellosis and chlamydiosis seroprevalence in goats at livestock wildlife interface areas of Zimbabwe. Onderstepoort J. Vet. Res. 2019;86(1):1670. doi: 10.4102/ojvr.v86i1.1670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kaden R, Ferrari S, Alm E, Wahab T. A novel real-time PCR assay for specific detection of Brucella melitensis. BMC Infect. Dis. 2017;(1):17, 230. doi: 10.1186/s12879-017-2327-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Singh M, Ingh D.K.S, Shivaramu K.V, Biswas R, Rawat S, Boral R, Singh S, Cheema P.S. Serum as clinical specimen in PCR for diagnosis of ovine brucellosis. Indian J. Anim. Sci. 2010;80(1):17–18. [Google Scholar]
  • 23.Shakerian A, Deo P, Rahimi E, Shahjavan A.R, Khamesipour F. Molecular detection of Brucella melitensis in sheep and goat milk in Iran. Trop. J. Pharm. Res. 2016;15(5):913–918. [Google Scholar]
  • 24.Sabrina R, Mossadak H.T, Bakir M, Asma M, Khaoula B. Detection of Brucella spp in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria. Vet. World. 2018;11(3):363–367. doi: 10.14202/vetworld.2018.363-367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. [Retrieved on 26-07-2020]. Available from:http://www.climate-data.org(Damamm, Manama)
  • 26.Thrusfield M. 3rd. Ch. 15. United Kingdom, Black Well Science Ltd; 2007. Veterinary Epidemiology; pp. 220–221. [Google Scholar]
  • 27.Ben-Shlomo Y, Brookes S, Hickman M. 6th ed. Wiley-Blackwell, Oxford: 2013. Lecture Notes:Epidemiology, Evidence-Based Medicine and Public Health. [Google Scholar]
  • 28.OIE. Paris, France: World Organization for Animal Health, OIE; 2019. Terrestrial Manual Chapter 2.4.3 Bovine Brucellosis. [Google Scholar]
  • 29.Alton G.G, Jones L.M, Angus R.D, Verger J.M. Paris: de Luniversite; 1988. Techniques for Brucellosis Institute National de le RecherchéAgronomique; p. 75007. [Google Scholar]
  • 30.Unver A, Erdogan H.M, Atabay H.I, Sahin M, Celebi O. Isolation, identification, and molecular characterization of Brucella melitensis from aborted sheep fetuses in Kars, Turkey. Rev. Med. Vet. 2006;157(1):42–46. [Google Scholar]
  • 31.Benkirane A, Essamkaoui S, Idrissi E.L, Lucchese L, Natale A. A serosurvey of major infectious causes of abortion in small ruminants in Morocco. Vet. Ital. 2015;51(1):25–30. doi: 10.12834/VetIt.389.1814.1. [DOI] [PubMed] [Google Scholar]
  • 32.Sadhu D.B, Panchasara H.H, Chauhan H.C, Sutariya D.R, Parmar V.L, Prajapati H.B. Seroprevalence and comparison of different serological tests for brucellosis detection in small ruminants. Vet. World. 2015;8(5):561–566. doi: 10.14202/vetworld.2015.561-566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wogayehu Seria, Yosefdeneke Diriba Tadese, Eshetu Shumi. A Review on Brucellosis in Small Ruminants, American Journal of Zoology. 2020;3(1):17–25. [Google Scholar]
  • 34.Sharifi H, Mashayekhi K, Tavakoli M.M. Risk factors of small ruminant brucellosis: A cross-sectional study in Southeast Iran 2012. Hum. Vet. Med. Int. J. Bioflux Soc. 2015;7(1):42–45. [Google Scholar]
  • 35.Nicoletti P. The eradication of brucellosis in animals. Saudi Med. J. 1993;14(4):288–292. [Google Scholar]
  • 36.Mahajan N.K, Kulshreshtha R.C. Comparison of serological tests for Brucella melitensis infection in sheep. Trop. Anim Health Prod. 1991;23(1):11–16. doi: 10.1007/BF02361263. [DOI] [PubMed] [Google Scholar]
  • 37.Kanani A, Dabhi S, Patel Y, Chandra V, Kumar O.R.V, Shome R. Seroprevalence of brucellosis in small ruminants in organized and unorganized sectors of Gujarat state, India. Vet. World. 2018;11(8):1030–1036. doi: 10.14202/vetworld.2018.1030-1036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Padher R.R, Nayak J.B, Brahmbhatt M.N, Mathakiya R.A. Comparative sensitivity and specificity of various serological tests for detection of brucellosis in small ruminants. Int. J. Curr. Microbiol. Appl. Sci. 2017;6(5):2090–2099. [Google Scholar]
  • 39.Radulescu R.A, Petriceanu G, Ragalie A, Gutu E. Comparative evaluation of serological assays for brucellosis diagnosis. Rev. Rom. Med. Vet, 17? 2007:83–92. [Google Scholar]
  • 40.Gusi A.M, Bertu W.J, de Miguel M.J, Dieste-Pérez L, Smits H.L, Ocholi R.A, Blasco J.M, Moriyón I, Muñoz P.M. Comparative performance of lateral flow immunochromatography, iELISA and Rose Bengal tests for the diagnosis of cattle, sheep, goat and swine brucellosis. PLoS Negl. Trop. Dis. 2019;13(6):e0007509. doi: 10.1371/journal.pntd.0007509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Albukair A. A Thesis Presented in Partial Fulfillment of the Requirements for the Degree of Master of Science (M.Sc.) in Animal Health, Preventive Medicine Department of Clinical Studies College of Veterinary Medicine and Animal Resources, KFU; 2008. Sero-Epidemiological Study on Brucellosis in Sheep and Goats in Al-Ahsa Province, Kingdom of Saudi Arabia. [Google Scholar]
  • 42.Mohammed M.A, Shigidy M.T, Al JubooriJuboori A.Y. Sero-Prevalence and epidemiology of brucellosis in camels, sheep and goats in Abu Dhabi emirate. Int. J. Anim. Vet. Adv. 2013;5(2):82–86. [Google Scholar]
  • 43.Abdulmajeed A. Australia: Ph.D. Thesis, Murdoch University; 2015. The Epidemiology of Brucellosis in the Sultanate of Oman. [Google Scholar]
  • 44.Nielsen K. Diagnosis of brucellosis by serology. Vet. Microbiol. 2002;90(1-4):447–459. doi: 10.1016/s0378-1135(02)00229-8. [DOI] [PubMed] [Google Scholar]
  • 45.Corbel M.J. Geneva: World Health Organization; 2006. Brucellosis in Humans and Animals. [Google Scholar]
  • 46.Nielsen K, Gall D, Smith P, Balsevicius S, Garrido F, Ferrer M.D, Biancifiori F, Dajer A, Luna E, Samartino L, Bermudez R, Moreno F, Renteria T, Corral A. Comparison of serological tests for the detection of ovine and caprine antibody to Brucella melitensis. Rev. Sci. Tech. 2004;23(3):979–987. doi: 10.20506/rst.23.3.1532. [DOI] [PubMed] [Google Scholar]
  • 47.Bevins J.S, Blake J.E, Adams L.G, Templeton J.W, Morton J.K, Davis D.S. The pathogenicity of Brucella suis biovar 4 for bison. J. Wildlife Dis. 1996;32(4):581–585. doi: 10.7589/0090-3558-32.4.581. [DOI] [PubMed] [Google Scholar]
  • 48.Reviriego F.J, Moreno M.A, Domínguez L. Risk factors for brucellosis seroprevalence of sheep and goat flocks in Spain. Prev. Vet. Med. 2000;44(3-4):167–173. doi: 10.1016/s0167-5877(00)00108-2. [DOI] [PubMed] [Google Scholar]
  • 49.European Commission. Brussels, Belgium: European Commission; 2001. Brucellosis in Sheep and Goats (Brucella melitensis). Scientific Committee on Animal Health and Animal Welfare; p. 89. [Google Scholar]
  • 50.Kabagambe E.K, Elzer P.H, Geaghan J.P, Opuda-Asibo J, Scholl D.T, Miller J.E. Risk factors for Brucella seropositivity in goat herds in Eastern and Western Uganda. Prev. Vet. Med. 2001;52(2):91–108. doi: 10.1016/s0167-5877(01)00251-3. [DOI] [PubMed] [Google Scholar]
  • 51.Al-Majali A.M. Seroepidemiology of caprine brucellosis in Jordan. Small Rumin. Res. 2005;58(1):13–18. [Google Scholar]
  • 52.Coelho A.M, Coelho A.C, Roboredo M, Rodrigues J. A case-control study of risk factors for brucellosis seropositivity in Portuguese small ruminants herds. Prev. Vet. Med. 2007;82(3-4):291–301. doi: 10.1016/j.prevetmed.2007.06.001. [DOI] [PubMed] [Google Scholar]
  • 53.Rahman M.S. Jeonju: Ph.D. Dissertation. Chonbuk National University; 2003. Experimental Infection and Protective Immunity of Sprague-Dawley Rats with Brucella abortus. [Google Scholar]
  • 54.Godfroid J, Käsborer A. Brucellosis in the European Union and Norway at the turn of the twenty-first century. Vet. Microbiol. 2002;90(1-4):135–145. doi: 10.1016/s0378-1135(02)00217-1. [DOI] [PubMed] [Google Scholar]
  • 55.Fevziye Çetinkaya, Melis Naçar, Tülay Aydın, Nedret Koç, Selma Gökahmetoğlu. Prevalence of brucellosis in the rural area of Kayseri, Central Anatolia, Turkey International Journal of Infectious Diseases. 2006;10(2):179–181. doi: 10.1016/j.ijid.2004.10.009. [DOI] [PubMed] [Google Scholar]
  • 56.Avila-Granados L.M, Garcia-Gonzalez D.G, Zambrano-Varon J.L, Arenas-Gamboa A.M. Brucellosis in Colombia:Current status and challenges in the control of an endemic disease. Front. Vet. Sci. 2019;6:321. doi: 10.3389/fvets.2019.00321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Zerva L, Bourantas K, Mitka S, Kansouzidou A, Legakis NJ. Serum is the preferred clinical specimen for diagnosis by PCR. J. Clin. Microbiol. 2001;51:1661–1664. doi: 10.1128/JCM.39.4.1661-1664.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Kaushik P, Singh D.K, Tiwari A.K, Kataria R.S. Rapid detection of Brucella species in cattle by PCR. J. Appl. Anim. Res. 2006;30:25–28. [Google Scholar]
  • 59.Garin-Bastuji B, Blasco J.M. 5th ed. OIE; 2004. Caprine and Ovine Brucellosis (excluding B jovis). Manual of Diagnostic Tests and Vaccines for Terrestrial Animals; pp. 598–606. [Google Scholar]
  • 60.Smirnova E.A, Vasin A.V, Baev N.T.S, Klotchenko S.A, Plotnikova M.A, Chevryakova O.V, Sansyzbay A.R, Kiselev O.I. Current methods of human and animal brucellosis diagnostics. Adv. Infect. Dis. 2013;3(3):177–184. [Google Scholar]
  • 61.Robertson L, Farrell D, P.M. Highlife:The isolation of Brucella melitensis from contaminated sources. Brucella Vet. J. 1977;133:193–195. doi: 10.1016/s0007-1935(17)34142-8. [DOI] [PubMed] [Google Scholar]
  • 62.Sayour A.E. Ph.D. Thesis, Faculty of Veterinary Medicine, Cairo University; 2004. The Use of Recent Bacteriological Techniques in the Differentiation of Brucella Group of Microorganisms. [Google Scholar]
  • 63.Afifi M, Abdul-Raouf U.M, El-Bayoumy E, Montasser A.M, Mohamad H.A. Isolation and Bio typing of Brucella melitensis from Upper Egypt. J. Am. Sci. 2011;7(3):659. [Google Scholar]
  • 64.Ibrahim H.H, Rouby S, Menshawy A, Ghazy N. Seroprevalence of camel brucellosis and molecular characterization of Brucella melitensis recovered from dromedary camels in Egypt. Res. J. Vet. Pract. 2016;4(1):14–17. [Google Scholar]
  • 65.Hasani S.M, Mirnejad R, Amani J, Vafadar M.J. Comparing rapid and specific detection of Brucella in clinical samples by PCR-ELISA and multiplex-PCR method Iran. J. Pathol. 2016;11(2):144–150. [PMC free article] [PubMed] [Google Scholar]
  • 66.Kaaboub E.A, Ouchene N, Ouchene-Khelifi N.A, Khelef D. Serological and histopathological investigation of brucellosis in cattle in Medea region, Northern Algeria. Vet. World. 2019;12(5):713–718. doi: 10.14202/vetworld.2019.713-718. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES