Skip to main content
PLOS One logoLink to PLOS One
. 2020 Sep 30;15(9):e0239457. doi: 10.1371/journal.pone.0239457

PCR-based detection and serovar identification of Salmonella in retail meat collected from wet markets in Metro Manila, Philippines

Pauline Dianne M Santos 1, Kenneth W Widmer 2, Windell L Rivera 1,*
Editor: Frédérique Pasquali3
PMCID: PMC7526908  PMID: 32997676

Abstract

This study aimed to detect Salmonella from retail meat collected from nine wet markets in Metro Manila, and identify the subtypes of Salmonella isolates using molecular serotyping assays from previously developed primers. Of the 720 collected meat samples, 57.64% were found to be Salmonella-contaminated. The most predominant serogroup was Salmonella O:3, and Salmonella serogroups O:4, O:6,7, O:8, O:9, and undetermined serogroups were also found. Most frequently detected isolates in bovine meat were S. 3:e,h:1,6 (putative identity: S. Anatum) and S: 4:e,h:1,2 (putative identity: S. Saintpaul), in porcine meat was S. 3:e,h:1,6 (putative identity: S. Anatum), and S. 8:i:z6 (putative identity: S. Kentucky) was common in poultry products. This study also demonstrated retail meat samples were contaminated with multiple Salmonella serogroups and serovars. This is the first Philippine study that utilized PCR-based assays to characterize Salmonella isolates down to a serovar level and provides baseline information regarding Salmonella prevalence and serovar distribution in retail meat. Molecular serotyping performed in this study can be used as an alternative approach to traditional serotyping in surveillance of Salmonella in the Philippines since the latter is expensive, time-consuming, and requires skilled technicians.

Introduction

Salmonella is considered one of the most significant pathogens associated with food-borne diseases and outbreaks in the world [1,2]. It is estimated to cause approximately 93.8 million human infections and 155,000 deaths annually worldwide [3] and major economic losses in poultry and livestock industries [4]. The genus Salmonella is classified into serovars, which are based on the presence of somatic (O) and flagellar (H) antigens. Serotyping has been essential in public health monitoring of Salmonella infection for more than 80 years [5]. White-Kauffman-Le Minor (WKL) scheme contains the organized list of 2,659 serovars, which were characterized by serological agglutination of 46 somatic and 119 flagellar antigens [6,7]. However, serological agglutination reaction is limited by antisera production, time-consuming, extremely complex procedure, high cost, and at times inconsistent results due to the presence of capsule phenotype, rough phenotype, or non-expression of flagellar phase [8]. These limitations led to the development of molecular-based serotyping using multiplex PCR, which allows for the simultaneous, rapid, sensitive, and specific detection of various Salmonella genes that express somatic [9] and flagellar antigens [10,11]. Several of these primer pairs were tested for specificity and sensitivity by the National Institute for Public Health and the Environment reference laboratory in The Netherlands (RIVM) as an alternative approach to gold standard [12].

In the Philippines, surveillance data regarding Salmonella serogroup and serotype distribution are limited. Salmonella serotyping is not routinely performed due to previously mentioned disadvantages. Most Salmonella isolates from clinical and environmental settings collected in different parts of the country are submitted to the Antimicrobial Resistance Surveillance Reference Laboratory (ARSRL) in the Research Institute for Tropical Medicine (RITM) for serotyping. Molecular subtyping of Salmonella was previously performed in studies by Soguilon & Rivera, Ng & Rivera, and Calayag et al. [1315] in slaughtered swine and meat samples collected from Metro Manila, Philippines. However, these studies were limited to serogrouping and detection of Sdf-I expressing gene. Hence, a study that determines Salmonella serotype using molecular subtyping is needed.

This study aimed to detect Salmonella spp. from various raw meat and meat products collected from nine selected Metro Manila wet markets using PCR-based detection assays described by Ng & Rivera [14] and Soguilon & Rivera [13], and classify Salmonella based on their O-serogroups and serotypes using PCR-based serotyping assays. This study can contribute to the epidemiology of salmonellosis in the Philippines, particularly on reservoirs of clinically important serotypes. Data regarding the Salmonella prevalence and serotype distribution in retail meat are significant in the identification of important Salmonella reservoirs and initiation of long-term prevention and control measures.

Materials and methods

Sample collection

Two hundred seventy-four (274) raw meat (minced beef = 90, chicken wings = 94, ground pork = 90) and 446 processed meat (bacon = 90, burger patties = 70, Filipino-style luncheon meat = 90, sliced ham = 85, Filipino-style sausage = 96, salami = 15) samples were collected from nine wet markets in Metro Manila from 2015–2016. A total of 80 samples were purchased randomly at different stalls in each wet market with varying frequencies depending on market availability of meat products. Raw meat samples were defined as animal muscle and fat that were chopped, minced, or ground, while processed meat samples were defined as meat samples which underwent salting, curing, addition of seasonings and other food materials, and/or heat treatment. Samples were stored in a cooler at approximately 5°C during transport and immediately processed in the laboratory for the pre-enrichment procedure. All raw meat products were freshly slaughtered from a local city abattoir, while processed meat products were either prepared from wet markets or local meat processing plants. Each market location was given a precursory survey of the conditions, operation facilities, and general practices of the workers at the time of collection. Quality of the market sanitation and practices were ranked on an ordinal scale of five values ranging from poor to very good (S1 Appendix).

Salmonella detection and isolation

The culture detection technique for Salmonella detection was based on the modified ISO 6579:2002 protocol previously described by Soguilon-del Rosario & Rivera and Ng & Rivera [1314]. Briefly, 25 g meat sample was aseptically manually homogenized and inoculated into 225 ml buffered peptone water (BPW; BD Diagnostics System DifcoTM USA) in a sterile bottle. The pre-enrichment culture was agitated for at least 2 min and incubated at 37°C for 18–24 h. One hundred microliters of pre-enriched culture was inoculated to 10 ml Rappaport Vassiliadis (RV; BD Diagnostics System DifcoTM USA) broth in duplicate and incubated at 42°C for 18–24 h. A loopful of culture medium from the incubated RV broth was streaked onto Brilliant Green (BG; BD Diagnostics System DifcoTM USA) agar and Xylose Lysine Deoxycholate (XLD; BD Diagnostics System DifcoTM USA) agar plates and incubated at 37°C for 18–24 h. Typical Salmonella colonies were selected and isolated from both BG agar and XLD agar. Each isolate was streaked onto NA (nutrient agar; BD Diagnostics System DifcoTM USA) slants and incubated at 37°C for 24 h. A single colony from the NA slant was inoculated to 1 ml Tryptic Soy Broth (TSB; BD Diagnostics System BactoTM USA). After incubation at 37°C for 24 h, 330 μl of 100% glycerol was added per isolate, vortexed, and stored at -20°C until use. RV broths and putative Salmonella isolates grown on NA slants were saved for subsequent DNA extraction.

Revival and purification

From Salmonella glycerol stocks, 50 μl stock culture was inoculated to 1 ml TSB and incubated at 37°C for 24 h. A loopful of cultured Salmonella in TSB was streaked onto XLD agar plate. After incubation, a single typical Salmonella colony isolate was selected for inoculation into two microcentrifuge tubes with 1 ml TSB each. Isolation steps using XLD agar plates were repeated until a single colony of presumptive Salmonella was obtained. One of the TSB tubes was subjected to DNA extraction, while the other was stored as a glycerol stock.

DNA extraction

Three different template extraction protocols (TEP) were performed in this study, and DNA templates were extracted in the following Salmonella culture steps: (TEP I) after 18–24 h incubation of pre-enriched samples in RV broth, (TEP II) after 18–24 h incubation of putative Salmonella isolates inoculated in NA slants, and (TEP III) after revival and purification of Salmonella isolates from glycerol stocks. TEP I was intended for the rapid identification of Salmonella within samples. Data regarding Salmonella prevalence were gathered from TEP I and TEP II, while results of TEP III verified that the revived and purified isolates were Salmonella and was used as templates to characterize isolate serotypes.

Two milliliters of culture from RV broth (TEP I) and 1 ml of Salmonella culture in TSB (TEP III) were centrifuged at 15,330 ×g for 5 min [13]. The resulting supernatant was discarded while the pooled bacterial pellet was suspended in 1 ml phosphate-buffered saline (PBS). The bacterial suspension was vortexed for 1 min and centrifuged at 15,330 ×g for 5 min. The resulting pellet was suspended in 50 μl and 100 μl sterile Tris EDTA (TE) buffer for RV broth and TSB, respectively. For TEP II, a loopful of Salmonella was collected from the nutrient agar slant and transferred to a microcentrifuge tube containing 100 μl sterile Tris EDTA (TE). Bacterial suspensions were boiled at 100°C for 10 min using a dry heating block. Resulting lysed cells were centrifuged at 2,656 ×g for 5 min. The supernatants were transferred to a new microcentrifuge tube and stored at -20°C until use.

Molecular detection and characterization

Four-step PCR-based assays using T100 Thermal Cyclers (Bio-Rad, USA) were employed in molecular detection and serotyping of Salmonella from meat samples. Step 1 involved the detection of Salmonella spp. using PCR that targeted the invA gene in DNA extracted from TEP I and II. In step 2, Salmonella positive samples were run as multiplex PCR experiments using DNA extracted from TEP I and TEP III. Step 3 determined the presence of phase 1 flagellar antigen (H1) encoding genes while step 4 determined the presence of phase 2 flagellar (H2) antigen and Sdf-I encoding genes. The results of the last three PCR assays defined the banding pattern of each Salmonella isolate, which would correspond to a serovar identity. Steps 3 and 4 analyzed DNA extracted from TEP III.

Polymerase Chain Reaction (PCR)-based detection of Salmonella spp.

The amplification of the invA gene was performed in a 12.5 μl reaction volume. Each reaction consisted of 6.25 μl 2× Promega Green master mix (1 U i-TaqTM DNA polymerase, 2× PCR buffer, 3 mM MgCl2 and 0.4 mM dNTPs; Promega, USA), 0.5 μl each of forward and reverse primer (10 uM; Table 1, Reaction group 1), 1 μl DNA template and 4.25 μl of PCR water. PCR was performed using the following conditions: initial denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, repeated for 35 times, and a final extension at 72°C for 5 min.

Table 1. Primers for Salmonella identification and characterization.

List of primers for Salmonella detection, serogrouping, and serotyping assays.

Primer name F/ R Sequence (5’-3’) Reaction group Target Amplicon length (bp) Reference
invA-1 F ACAGTGCTCGTTTACGACCTGAAT 1 Salmonella spp. 244 [16]
invA-2 R AGACGACTGGTACTGATCGATAAT 1
abe1 F GGCTTCCGGCTTTATTGG 2 O:4 (B) 561 [9]
R TCTCTTATCTGTTCGCCTGTTG 2
wbaD- F ATTTGCCCAGTTCGGTTTG 2 O:6,7 (C1) 341
manC R CCATAACCGACTTCCATTTCC 2
abe2 F CGTCCTATAACCGAGCCAAC 2 O:8 (C2-C3) 397
R CTGCTTTATCCCTCTCACCG 2
wzx- wzyE1 F GATAGCAACGTTCGGAAATTC 2 O:3 (E1-E4) 281
R CCCAATAGCAATAAACCAAGC 2
Tyv F GAGGAAGGGAAATGAAGCTTTT 2 O:9 (D1) 614 [17]
R TAGCAAACTGTCTCCCACCATAC 2
prt F CTTGCTATGGAAGACATAACGAACC 2 O:2; O:9 256
R CGTCTCCATCAAAAGCTCCATAGA 2 (A; D)
P1 F TTATTAGGATCGCGCCAGGC 2 oriC gene 163 [18]
P2 R AAAGAATAACCGTTGTTCAC 2
S60 F GCAGATCAACTCTCAGACCCTGGG 3 - [11]
as-z10 R CGTCGCAGCTTCTGCAACC 3 fliC-z10 448
as-r R AAGTGACTTTTCCATCGGCTG 3 fliC-r 281
as-i R ATAGCCATCTTTACCAGTTCC 3 fliC-i 253
as-e,h R AACGAAAGCGTAGCAGACAAG 3 fliC-e,h 200
as-b R CGCACCAGTCYWACCTAAGGCGG 3 fliC-b 169
G F GTGATCTGAAATCCAGCTTCAAG 3 G 509
R AAGTTTCGCACTCTCGTTTTTGG 3
D F CCCGAAAGAAACTGCTGTAACCG 3 fliC-d 87
R TGGATATCAGTATTGCTCTGGGC 3
F1mod F CTTATGCCRATAATGGTACTACACTG 4 - - [10]
R1mod R TTTGACCAAYKYMGCGSCAT 4 fljB-1,2 388
R6 R CTCCTGTACTTCTGTTTTGGTTGTA 4 fljB-1,6 290
R7 R TAATCGCCATTTTTGTCGAG 4 fljB-1,7 190
Sense-Fe F GGCAACCCGACAGTAACTGGCGATAC 4 - -
as-Rx R CCATCCTTAAAGGATACGGC 4 fljB-e,n,x 56
as-Rz15 R ATCAACGGTAACTTCATATTTG 4 fljB-e,n,z15 135
Sense-lw F GTGGGGCAACMCTCAATACTG 4 fljB-l,w 241
as-lw R CCTGCCACTTTCGTGGTTGC 4
Z6-F F GCTGTGACAGTAGCTGCCAAT 5 fljB-z6 240 [8]
Z6-R R CGTACCAGCGGTCATAGACAC 5
Sdf-I F TGTGTTTTATCTGATGCAAGAGG 6 Sdf-I 333 [19]
R CGTTCTTCTGGTACTTACGATGAC 6

F-forward, R-reverse, g—g-complex. s-sense. as-anti-sense.

O-serogrouping of Salmonella spp

The O-serogrouping assay was performed in a 12.5 μl reaction. Each reaction was composed of 6.25 μl 2× KAPA2G Fast multiplex mix (1 U i-TaqTM DNA polymerase, 1.5× PCR buffer, 3 mM MgCl2, and 0.2 mM dNTPs; Kapa Biosystems, USA), 0.25 μl each of 7 forward and reverse primer (10 uM; Table 1, Reaction group 2), 1 μl DNA template and 1.75 μl of PCR water. Multiplex PCR was accomplished using the following conditions: initial denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec and extension at 72°C for 1 min run in 35 cycles, and a final extension at 72°C for 5 min.

H-typing I assay

H-typing I assay was performed in a 12.5 μl reaction, wherein each reaction was composed of 6.25 μl 2× KAPA2G Fast multiplex mix (Kapa Biosystems, USA), 3 forward and 7 reverse primers (10 uM; Table 1, Reaction group 3), 1 μl DNA template and 2 μl of PCR water. Multiplex PCR was run using the following conditions: initial denaturation at 95°C for 3 min; denaturation at 95°C for 40 sec, annealing at 58°C for 30 sec and extension at 72°C for 30 sec for 30 cycles, and a final extension at 72°C for 7 min.

H-typing II assay

Samples were further characterized in H-typing II assays and primer pairs shown in Table 1 were used for these experiments. H-typing II assay was performed in a 12.5 μl reaction, which was composed of 6.25 μl 2× KAPA2G Fast multiplex mix (Kapa Biosystems, USA), 3 forward and 6 reverse primers (10 uM; Table 1, Reaction group 4), 1 μl DNA template and 0.75 μl of PCR water. Multiplex PCR was run using the following conditions: initial denaturation at 95°C for 3 min; denaturation at 95°C for 40 sec, annealing at 58°C for 20 sec and extension at 72°C for 20 sec for 30 cycles, and a final extension at 72°C for 7 min.

Serogroup O:9 was further characterized by a primer pair that detects the Sdf-I gene (Table 1, Reaction group 5), while samples with a missing band that determined their phase 2-flagellin were further characterized with z6 primers (Table 1, Reaction group 6). PCR reaction mix and conditions for amplification were similar to step 1.

Gel electrophoresis

Amplicons from steps 1 and 2 PCR assays were run in 2% agarose gels (Promega, USA) with 15% GelRedTM nucleic acid gel stain (Biotium, USA) at 280 V for 30 min (Bio-Rad, USA) using 1× Tris-Acetic Acid-EDTA (TAE) as running buffer. Amplicons from steps 3 and 4 PCR assays were run in 3% agarose gels (Promega, USA) with 15% GelRedTM nucleic acid gel stain (Biotium, USA) at 280 V for 50 min (Bio-Rad, USA). Amplicon sizes were estimated using 100-bp plus molecular weight marker (Kapa Biosystems, USA). Gels were viewed under UV using a gel documentation system (Vilber Lourmat, France).

Traditional serotyping

Serological agglutination assays of 16 selected Salmonella isolates with pre-determined antigenic formulae derived from molecular serotyping were outsourced to Antimicrobial Resistance Surveillance Reference Laboratory (ARSRL) at the Research Institute for Tropical Medicine (Metro Manila, Philippines).

Data analyses

Fischer’s Exact Test was used to evaluate differences between the number of Salmonella-contaminated samples in raw and processed meat, as well as comparisons of Salmonella detection frequencies for culture versus PCR methods and different TEPs. Statistical tests were performed using IBM SPSS Statistics Version 20 and R 4.0.

Results and discussion

In this study, we investigated the Salmonella prevalence in raw and processed meat samples collected from nine wet markets in Metro Manila, Philippines from 2015–2016 using PCR-based assay. We also characterized the serogroups and serotypes of Salmonella isolates using molecular serotyping assays developed by previous published studies [8,10,11,19]. These aims were achieved by performing three template extraction protocols (TEPs). Using TEP I, Salmonella detection in meat samples was achieved within 2 days, while traditional culture techniques requires 3–4 days to obtain negative results and 5–7 days to obtain confirmed positive results [20]. Putative Salmonella colonies from selective growth media were confirmed by extracting the DNA of these colonies grown in NA slants (TEP II). Combined results of PCR targeting Salmonella using DNA extracted using TEP I and II determined the prevalence of the pathogen in collected meat samples. Multiple Salmonella serogroups were detected in DNA extracted using TEPs I and II, thus, further isolation and purification steps were applied to revived Salmonella isolates. Salmonella serogroup frequencies were compared between DNA extracted from TEP I and III. Molecular serogrouping and serotyping assays were performed to DNA of Salmonella isolates extracted using TEP III.

Presence and distribution of Salmonella in retail meat

A wet market is a type of traditional food retailer in the Philippines that offers affordable grains, fresh produce such as meat, fish, fruits, and vegetables [21]. However, this type of market has been linked to major diseases due to poor hygienic conditions [22]. Various studies have detected wet markets as an important source of Salmonella, where prevalence ranged from 6.8–87.5% in various retail meat [13,2230]. This study found that 415 (57.64%) of 720 purchased raw and processed meat products were contaminated with Salmonella using PCR-based Salmonella detection (Table 2). Extraction protocols TEP I (n = 392) and TEP II (n = 306) yielded different frequencies of Salmonella positive meat samples. Despite utilizing different DNA extraction protocols, there were no statistically significant differences in the detection of Salmonella between TEP I and TEP II (p = 0.162) in both processed and raw meat samples. Also, combining the number of Salmonella positive samples from TEP I and II (overall) had resulted in relatively higher Salmonella positive results (n = 415), but the overall Salmonella prevalence in retail meat was not significantly different when compared to the results of TEP I (p = 0.8314) and TEP II (0.1075). TEP I detected relatively higher Salmonella positives samples than TEP II, however, TEP I also missed 23 positive samples that were confirmed by TEP II. This suggests that utilizing both TEP I and TEP II was important to have a relatively higher sensitivity in the detection of Salmonella. Additionally, comparisons for culture method detection of Salmonella versus TEP I (p = 0.453) and TEP II (p = 0.519) in both raw and processed meat samples also had no significant differences. This Salmonella prevalence in this study was relatively higher compared to previous studies that detected Salmonella in the Philippines, such as Soguilon and Rivera (30.63%, n = 320) [13], Baldrias & Capistrano (19.76%, n = 167) [24], Vismanos et al. (8.96%, n = 212) [25], and Balala et al. (9.33%, n = 150) [31], and other Asian countries, such as Vietnam (35.52%, n = 608) [32], China (6.8%, n = 1414) [23], Malaysia (35.4%, n = 96) [26], and Nepal (11.4%, n = 123) [33]. Although this report was relatively lower compared to studies done in Thailand (72%, n = 100) [34], Laos (87.75%, n = 49) [35], and different reports in Malaysia (64.6% n = 82 and 87.5% n = 72) [26,36]. Prevalence of Salmonella contamination among different countries might be affected by differences in sampling procedures, sample types, and Salmonella detection and isolation techniques [37].

Table 2. Salmonella-positive retail meat samples from different animal origins and meat types.

The number and percentage of samples found positive with Salmonella based on the food matrix using putative culture positives, TEPs I-III and overall positives from TEPs I and II. Short description regarding the animal origins, treatment, and packaging of meat sample weres also included.

Meat Samples Meat type Animal-origin Treatment/Packaging Number of samples XLD/BG Agar plate Putative Salmonella TEP I TEP II TEP III Overall (Percentage)
Minced beef Raw Cow Minced, no packaging 90 68 75 67 59 78 (86.67)
Chicken wings Raw Chicken Chopped, no packaging 94 66 75 61 55 78 (82.98)
Ground pork Raw Pig Ground, no packaging 90 72 75 64 59 79 (87.78)
Bacon Processed Pig Minced, no packaging, additives, and preservatives, sometimes packaged in plastic 90 50 53 46 41 56 (62.22)
Burger Processed Cow Ground, heat treatment, additives and preservatives, packaged in plastic 70 18 23 14 9 26 (37.14)
Filipino-style luncheon meat Processed Pig Ground, heat treatment, additives and preservatives, packaged in aluminum foil or plastic 90 8 19 5 5 23 (25.56)
Ham Processed Pig Sliced, heat treatment, additives, and preservatives sometimes packaged in plastic 85 9 21 7 6 22 (25.88)
Filipino-style sausage Processed Pig Ground, additives, and preservatives, hog-casing. No packaging 96 47 50 42 40 52 (54.17)
Salami Processed Pig Ground, additives, and preservatives, cellulose-casing. No packaging 15 4 1 0 0 1 (6.67)
Total       720 342 392 306 274 415 (57.64)

Ground pork (87.78%) was found to have the highest prevalence of Salmonella-contamination, followed by minced beef (86.67%), chicken wings (82.98%), bacon (62.22%), Filipino-style sausage (54.17%), burger (37.14%), Filipino-style luncheon meat (25.88%), ham (25.56%), and salami (6.67%) (Table 2). Significantly higher number of Salmonella-contaminated samples were observed in raw meat (p = 0.00001) (85.77%, n = 235) compared to processed meat samples (40.36%, n = 180). High prevalence of Salmonella contamination in ground pork can be associated with high frequency (45%, n = 240) of Salmonella found in slaughtered swine from different Metro Manila abattoirs [14,15]. Data regarding Salmonella frequencies in chicken and cows from slaughterhouses and farms are currently lacking. Significantly higher Salmonella contamination rates in raw meat compared to processed meat can be attributed to the absence of interventions which could regulate microbial growth [38]. Also, manual meat handling such as grinding may contribute to an increase of S. enterica counts in raw meat [39]. Cross-contamination of microbes in raw meat is highly probable since they were often presented and sold without packaging. Even in the presence of additives and preservatives, bacon and Filipino style sausage were observed to have a relatively higher percentage of Salmonella contamination (>50%) compared to other processed meat products (<38%). We observed that these meat products were processed directly in wet markets, and without heat treatment. Salmonella contamination in Filipino-style sausage may also come from connective and muscle tissues of the animal’s gut which serve as their natural casing [38]. Ham, Filipino-style luncheon meat, and salami had undergone heat and chemical treatments [4044] and were packaged with either plastic or aluminum foil, hence, a lower rate of Salmonella contamination in these products was expected. But on several occasions, we observed that some vendors opened packaged meat products and sold them separately. The presence of Salmonella in ham, Filipino-style luncheon meat, and salami might also be associated with failure of treatment or cross-contamination during the manufacturing and retailing stages [4547], however, a more elaborate study must be performed to prove this hypothesis.

We found considerable variation (5–76.25%) of Salmonella-contamination rate among different wet markets (Table 3), even though the handling procedures of retail meat products and environmental conditions were almost similar in all visited wet markets (S1 Appendix). Specifically, practices of meat being displayed by either hanging or lying on the counter without any covering for several hours, exposure to ambient temperature, excess moisture, and handled using bare hands made the retail meat highly vulnerable to microbial population growth and further microbial cross-contamination. Remarkably, we only found four (5%) Salmonella contaminated meat products (Filipino style sausages) at Quezon City District IV wet market, even in the presence of poultry evisceration activities near the meat retail area. We also noticed that the meat display counters in Makati and Paranaque wet markets were relatively drier and cleaner compared to other wet markets, and their meat counters were made up of metal or smooth concrete finishing, still, Salmonella-contamination rates in these markets were high (71.25% and 66.25%, respectively). Further investigation of other hygienic parameters in the wet market, such as water, equipment, vendors, and potentially other animal vectors must be performed to determine the important factors that affect Salmonella prevalence in wet markets [48]. Initial Salmonella contamination of animals from farms, slaughterhouses, and distribution may also have affected the different rates of Salmonella-contamination in wet markets. In previous Salmonella prevalence studies in abattoirs, varying Salmonella frequencies in slaughtered swine were observed in different slaughterhouses in Metro Manila [14,15]. We strongly suggest implementing strict hazard analysis and critical control point (HACCP) practices in slaughterhouses and transport. Hygienic practices and proper product segregation must be ensured in wet markets to prevent contamination of Salmonella to other fresh produce such as fruits and vegetables. Meat consumers must cook their meat thoroughly before consumption to kill microbial pathogens. Also, consumers must be cautious in handling and preparing meat to prevent cross-contamination in the kitchen and spread the pathogens to ready-to-eat food.

Table 3. Salmonella-positive retail meat samples from nine wet markets in Metro Manila.

The number and percentage of samples found positive with Salmonella based on the wet market using putative culture positives, results of TEPs I-III and overall positives using results from TEP I and II.

Wet Markets Number of samples XLD/BG Agar plate Putative Salmonella TEP I TEP II TEP III Overall (Percentage)
Makati 80 38 53 36 35 57 (71.25)
Malabon 80 39 49 38 37 53 (66.25)
Mandaluyong 80 45 53 40 32 61 (76.25)
Manila 80 41 34 32 30 36 (45.00)
Muntinlupa 80 44 58 42 39 59 (73.75)
Paranaque 80 45 53 42 42 53 (66.25)
Pasig 80 46 46 39 24 48 (60.00)
Quezon City District IV 80 10 4 3 3 4 (5.00)
Quezon City District V 80 34 42 34 32 44 (55.00)
Total 720 342 392 306 274 415 (57.64)

Salmonella serogroup and serovar distribution in retail meat

Salmonella-positive DNA extracted using TEP I (n = 392 meat samples) and TEP III (n = 641 Salmonella isolates from 274 meat samples) were characterized using the molecular serogrouping assay. Most meat samples were contaminated with more than one Salmonella serogroups using DNA from TEP I (Fig 1A; 73.47%). Since multiple putative Salmonella colonies (both from XLD and BG agars, if present) were isolated per samples, contamination with more than one serogroup per sample was also observed but to a lesser quantity (Fig 1B; 31.75%). These results were expected since DNA from TEP I was extracted from Salmonella selective enrichment broth and will likely contain mixed groups of Salmonella, while DNA from TEP III was isolated and purified from a single colony. Multiple Salmonella serogroup contaminations were also observed in slaughtered pigs from Metro Manila [14]. Detection of the same Salmonella serogroups from multiple isolates was also observed in several samples, hence, frequencies of Salmonella serogroup from TEP III (isolates) were 1.5–1.8 times higher than TEP III (samples) (Fig 1C). The Salmonella serogroup data produced from TEP I provide a more comprehensive overview of serogroup distribution in retail meat and the presence of mixed Salmonella serotype contamination. A possible underestimation of samples containing multiple serogroup contamination may have occurred since the primer pairs used in this study was limited to the detection of six Salmonella serogroups.

Fig 1. Salmonella serogroup frequencies in retail meat samples.

Fig 1

1A: Venn diagram of Salmonella serogroups acquired from each sample using TEP I. 1B: Venn diagram of Salmonella serogroups acquired from each sample using TEP III. 1C: Frequencies of Salmonella serogroups detected using DNA extracted in TEP I and TEP III (per isolate and per sample). Venn diagrams were created using Bioinformatics & Evolutionary Genomics webpage (URL: http://bioinformatics.psb.ugent.be/webtools/Venn/).

Salmonella serogroup O:3 was the most frequently detected serogroup in meat samples, followed by serogroup O:4 using both TEP I and TEP III. Frequencies of serogroup O:6,7 were relatively higher than O:8 using TEP I, but their frequencies were almost the same using TEP III (per sample and per isolate). The number of Salmonella serogroup O:9 and undetermined serogroups was almost similar in TEP I, but relatively higher frequencies of undetermined serogroup compared to serogroup O:9 were found in TEP III (per samples and per isolate). Salmonella serogroup O:2 was not detected in any meat sample. There was a portion of samples that did not exhibit amplification band on the internal amplification control in O-serogrouping assay likely due to either poor DNA recovery or PCR inhibitors. Previous Salmonella studies in Metro Manila demonstrated that Salmonella serogroup O:3 was the most dominant serogroup detected in raw and processed meat (78.57%) from wet markets [13], and slaughtered swine (75%) from slaughterhouses [15]. However, Ng & Rivera [14] found that serogroup O:4 (73%) was the most frequently isolated serogroup in slaughtered swine in abattoirs followed by serogroup O:3 (24%). Reports of Calayag et al. and Soguilon et al. accounted for the distribution of Salmonella serogroups per sample, while Ng and Rivera reported frequencies of Salmonella serogroups per isolate.

We detected 29 Salmonella band patterns that correspond to putative Salmonella serotypes (Table 4). Among them are 17 band patterns that correspond to a certain Salmonella serotype, namely, S. Kentucky, S. Saintpaul, S. Stanley, S. Typhimurium, S. Livingstone, S. Schwarzengrund, S. Weltevreden, S. Enteritidis, S. Virchow, S. Heidelberg, S. 4,[5],12:i:- (monophasic S. Typhimurium), S. Agama, S. Augustenborg, S. Mbandaka, S. Rechovot, S. Newlands, and S. Podiensis. Six band patterns corresponded to two serotypes since the O-serogrouping primers for O:3 detected both O:3,10 (S. Anatum, S. Meleagridis, S. Nyborg, S. Yeerongpilly) and O:1,3,19 (S. Hayindogo, S. Calabar, S. Sanktmarx, S. Taksony), and primer for serogroup O:8 detected both O:6,8 (S. Newport, S. Chomedey) and O:8,20 (S. Bardo, S. Glostrup) (Table 4). Serological serotyping of band patterns: S. 3:e,h:1,6, S. 8:e,h:1,2, and S: 3:eh:l,w resulted in S. Anatum, S. Newport, and S. Meleagridis, respectively. The serovar identities of the remaining six band patterns need further confirmation since the primers that target the missing somatic or flagellar antigens were not included in this study. The putative serovar identities of 6,7:g:-, 3:g:-, -:b:enx, 4:g:1,2, and 3:-:1,6, were designated as S. Rissen, S. Senftenberg, S. Hvitingfoss, S. Agona, and S. London, respectively, since they had been previously reported in the Philippines [4951]. Further analyses of these band patterns together with S. 4:g:- must be performed to confirm serovar identity. Isolates with multiple band patterns and/or unknown serovar identities were observed in more than 100 meat samples. Further purification of the samples must be done and more primers that target different somatic and flagellar antigens must be tested to unravel the identities of these Salmonella isolates. This is the first study to report Salmonella serovars S. Agama, S. Livingstone, S. Meleagridis, S. Schwarzengrund, S. Gabon, S. 1,4,[5],12:i:-, S. Augustenborg, S. Rechovot, S. Newlands and S. Podiensis in the Philippines. Sixteen isolates with distinct Salmonella band patterns were sent to ARSRL for serological sequencing (Table 4), only one Salmonella isolate with band pattern S. 6,7:r:1,2 (S. Virchow) did not match with the serotype identity from serological testing (S. Gabon; band pattern: 6,7:l,w:1,2). This disagreement may have arisen from the primer pair targeting fliC-r gene. It was reported that this primer pair had a 99.5% specificity [12]. Hence, it is suggested to design a more specific primer pair that targets fliC-r gene. It is also possible that the gene that expresses the flagellar phase I (l,w) antigen was present in the isolate, but not detected due to the limited number of primers pairs used in the study. As observed in the serogroup data, contamination with multiple Salmonella serovars per sample was also observed. In one chicken sample, four Salmonella isolates were identified as S. Schwarzengrund, S. Livingstone, S. Rissen, and S. Anatum, while three Salmonella isolates from a burger sample were identified as S. Augustenborg, S. Kentucky and S. Typhimurium. More evidence of multiple Salmonella serovar contamination can be discovered when more primers that targeted other somatic and flagellar antigens are used in the future.

Table 4. Frequencies of Salmonella serovars in retail meat.

Frequencies of Salmonella band patterns and their putative Salmonella serovar identities in retail meat that originated from cow, chicken, and pork. Results of serological serotyping of 16 Salmonella isolates from ARSRL were also included. Some band patterns have more than one possible identity.

Salmonella banding patterns Source of uncertainty Putative Salmonella enterica serotype Serological serotyping Animal Origin
Cow Chicken Pig Total
3:e,h:1,6 Somatic antigen (O:3) Anatum/Hayindogo Anatum 14 (30) 14 (21) 52 (81) 80 (132)
6,7:g:- Flagellar I and II antigens (-) Rissen1 Rissen 8 (13) 2 (3) 32 (52) 42 (68)
8:i:z6 Confirmed Kentucky Kentucky 5 (6) 24 (38) 2 (2) 31 (46)
4:g:- Flagellar I and II antigens (-) Essen2 not tested 2 (2) 2 (2) 21 (30) 25 (34)
4:e,h:1,2 Confirmed Saintpaul Saintpaul 14 (16) 0 9 (12) 23 (28)
8:e,h:1,2 Somatic antigen (O:8) Newport/Bardo Newport 7 (9) 3 (5) 6 (11) 16 (25)
4:d:1,2 Confirmed Stanley Stanley 3 (3) 4 (8) 9 (14) 16 (25)
3:-:1,6 Flagellar I antigens (-) London3 not tested 1 (2) 0 12 (16) 13 (18)
3:g:- Flagellar I and II antigens (-) Senftenberg4 Senftenberg 1 (2) 1 (1) 7 (13) 9 (16)
-:b:enx Somatic antigen (-) Hvittingfoss5 Hvittingfoss 4 (4) 0 4 (5) 8 (9)
4:i:1,2 Confirmed Typhimurium Typhimurium 4 (4) 0 3 (3) 7 (7)
6,7:d:lw Confirmed Livingstone Livingstone 1 (1) 3 (5) 2 (4) 6 (10)
4:d:1,7 Confirmed Schwarzengrund Schwarzengrund 0 4 (6) 2 (2) 6 (8)
4:i:- Confirmed Monophasic S. Typhimurium not tested 0 2 (2) 4 (9) 6 (11)
3:r:z6 Confirmed Weltevreden Weltevreden 1 (2) 1 (1) 3 (4) 5 (7)
6,7:r:1,2 Confirmed Virchow Gabon 1 (1) 3 (5) 0 4 (6)
9:g:- (sdf-I +) Confirmed Enteritidis Enteritidis 0 2 (4) 2 (2) 4 (6)
3:eh:lw Somatic antigen (O:3) Meleagridis/Calabar Meleagridis 0 0 4 (6) 4 (6)
4:r:1,2 Confirmed Heidelberg not tested 0 1 (3) 1 (1) 2 (4)
4:i:1,6 Confirmed Agama not tested 0 2 (2) 0 2 (2)
3:eh:1,7 Somatic antigen (O:3) Nyborg/Sanktmarx not tested 1 (1) 0 1 (1) 2 (2)
6,7:i:1,2 Confirmed Augustenborg not tested 1 (2) 1 (2) 0 2 (4)
4:g:1,2 Flagellar I and II antigens Agona6 not tested 0 0 1 (1) 1 (1)
6,7:z10:enz15 Confirmed Mbandaka Mbandaka 0 0 1 (1) 1 (1)
8:eh:z6 Confirmed Rechovot not tested 1 (1) 0 0 1 (1)
8:z10:enz15 Somatic antigen (O:8) Chomedey/Glostrup not tested 0 0 1 (1) 1 (1)
3:eh:enx Confirmed Newlands not tested 1 (1) 0 1 (1) 1 (1)
3:z10:enx Confirmed Podiensis not tested 0 0 1 (1) 1 (1)
3:i:z6 Somatic antigen (O:3) Yeerongpilly/Taksony not tested 0 0 1 (1) 1 (1)
Multiple/Incomplete annotation            
O:4 Unknown     7 (8) 4 (4) 8 (10) 19 (22)
O:6,7 Unknown     4 (4) 4 (4) 6 (7) 14 (15)
O:8 Unknown     9 (15) 4 (4) 6 (7) 19 (26)
O:9 Unknown     2 (5) 0 2 (3) 4 (8)
O:3 Unknown     16 (17) 7 (7) 36 (59) 59 (83)
Unknown Unknown     3 (4) 8 (12) 5 (8) 0

1Other possible serovar identities: S. Eingedi/ S. Montevideo/ S. II 6,7:g,m,s,t:z39/S. II 6,7:g,[m],s,t:[z42]/ S. Othmarschen/ S. Plumaugat/ S. Riggil/ S. IV 6,7:g,z51:-/ S. Haelsingborg/ S. Oakey/ S. II 6,7:m,t:-.

2S. Essen/ S. California/ S. Budapest/ S. Banana/ S. II 1,4,12,[27]:g,[m],t:[1,5]/ S. II 4,12:g,m,t:z39/ S. II 4,12:g,z62:-.

3S. Ikayi/ S. Regent/ S. Kainji/ S. Harleystreet/ S. Ratchaburi/ S. Albertslund/ S. Bida/ S. Winterthur.

4S. Regent/ S. Suberu/ S. Amsterdam/ S. II 3,{10}{15}:g,m,s,t:[1,5]/ S. Cannstatt/ S. Westhampton/ S. II 3,10:g,t:-/ S. Southbank/ S. Kouka.

5S. Abony/ S. II 1,4,[5],12,[27]:b:[e,n,x]/ S. Lockleaze/ S. Konstanz/ S. Gatuni/ S. II 1,9,12:b: [e,n,x]/ S. Worb/ S. II 9,46:b: [e,n,x]/ S. Benfica/ S. II 3,10:b: [e,n,x]/ S. Tambacounda/ S. VI 11:b: [e,n,x]/ S. Vaertan/Ullevi/ S. IIIb (6),14:b: [e,n,x]/ S. II 16:b: [e,n,x]/ S. Mattenhof/ S. Minnesota/ S. Soumbedioune/II 28:b: [e,n,x]/ S. Urbana/ S. Johannesburg/ S. Elbeuf/ S. Flottbek/ S. Tonev.

6S. Agona/ S.Derby/ S.Hato/ S. Kingston.

The most frequently detected serovar in chicken was S. Kentucky, while S. Anatum was the most frequently detected in meat originating from pigs and cows. In addition to S. Anatum, S. Saintpaul had the same detection frequency in minced beef and burger. In the Philippines, Salmonella Kentucky was isolated from cloacal swabs of healthy layer chickens in San Jose, Batangas in 2011 [51]. In other countries, S. Kentucky was the most commonly reported serovar for poultry in Canada and the US, ground chicken and broilers in the US, and broiler meat in 11 European countries in 2007 [3]. Salmonella Kentucky was also the most commonly isolated serovar in retail chicken meat in Vietnam [29], and Trinidad [52]. Salmonella Anatum was previously reported in mesenteric lymph nodes of asymptomatic cattle in Laguna and Batangas [53], and bile specimens of healthy cattle [54] in the Philippines. In other countries, S. Anatum was included in ten most frequently isolated serovars in cattle in the United Kingdom, US and Tunisia, in bovine meat in Canada, ground beef in the US, included in the seven most common serovars isolated in pigs and livestock in the United Kingdom in 2007, and most frequently isolated serovar in pork within Thailand for 2003 [55]. This serovar was also the most prevalent in cattle and swine from Vietnam in 2004 [56]. Salmonella Saintpaul was previously detected in asymptomatic cattle from Laguna and Batangas, Philippines [53]. And frequently isolated in apparently healthy cattle in Australasia (5.4%) and Africa (2.1%) [57]. Other Salmonella serovars such as S. Newport, S. Stanley, S. Derby, S. Weltevreden, and S. Enteritidis were previously reported in animal and retail meat [15,31,53,54], while S. Senftenberg and S. Hvittingfoss were reported in peanut butter products in the Philippines.

These detected serovars can pose risks to retail meat vendors and consumers through unhygienic handling, cross-contamination with ready-to-eat food such as fresh produce, and consumption of poorly cooked meat. All previously reported serovars in the Philippines had been isolated in human clinical cases in the country. Although S. Anatum, S. Kentucky, and S. Saintpaul were the most frequently detected serovars in retail meat, reports regarding their incidence rates among submitted clinical isolates from 2004–2018 were very low. The incidence rate of S. Anatum was 0.54% (n = 13) in clinical isolates in the Philippines from 2004–2018 [58], while the incidence rates of S. Kentucky and S. Saintpaul were both 0.26% (n = 2) from 2014–2018 [59,6063]. These serovars may possess low virulence and induce moderate symptoms in humans, wherein patients no longer seek medical care. Hence, clinical cases caused by these serovars may be underreported. It was estimated that the true incidence of salmonellosis is at least 29-fold greater than the number of reported cases [64]. The most commonly reported non-typhoidal Salmonella serovars in human clinical cases in the Philippines are S. Enteritidis and S. Typhimurium from 2003–2018 [49,50,59,65], however, they ranked 11th and 10th frequently isolated Salmonella serovars in this study. Low prevalence rates of these serovars in meat samples suggest that their mode of transmission may come from other significant reservoirs, which have not yet been fully studied. It is recommended to perform more screening and serotype distribution studies in live and slaughtered animals, meat and other food sources (eggs, fresh produce, milk, etc.), and environmental samples in different parts of the country to obtain a more comprehensive picture of the extent of atypical Salmonella serovars associated with food contamination. Another hypothesis is that these serovars are more virulent to humans compared to other predominant Salmonella serovars, which resulted in infections that required medical attention to patients and were followed up by strain isolation and incidence reports. In contrast to this findings, most commonly reported serovars in human clinical cases in the United States (S. Enteritidis, S. Typhimurium, S. Newport, S. Javiana, S. I 4,[5],12:I:-, and S. Muenchen) were also reported as commonly isolated Salmonella serotypes (except for S. Javiana and S. Muenchen) in meat and meat-producing animals in the US [64].

Published reports of Salmonella serogroup and serovar distribution in animal, food, and environmental samples are limited and outdated in the Philippines. Studies that characterized Salmonella up to the serovar level were performed mostly by researchers from different academic institutions more than a decade ago [31,54,55]. Moreover, the determination of Salmonella serovar distribution in the food production chain is often neglected. Reports from the Philippine Department of Agriculture (DA)-mandated laboratories regarding Salmonella were focused on faster detection of the pathogen in animal, food, and environmental samples, and determination of their antimicrobial susceptibility profiles (personal communication with the National Meat Inspection Service, Philippines). Thus, this study offers a more recent overview of prevailing Salmonella serogroups and serovars present in retail meat that originates from cattle, poultry, and swine. Surveillance of Salmonella and its serovars in different reservoirs is important in source tracking and attribution, mitigation, and control of Salmonella-related outbreaks. In Denmark, Salmonella surveillance data were used in their targeted national control program incorporating HACCP, a systemic preventive approach to food safety, wherein key steps in the food to fork chain were identified for interventions that have an impact on reduction (or elimination) of food safety hazards. This control program caused a significant reduction in human salmonellosis in Denmark. The prevalence of salmonellosis in the broiler, pork, and eggs was also reduced by 95%, 85%, and 75%, respectively [66].

Conclusion

The molecular identification and characterization of Salmonella provide baseline information regarding its prevalence and serovar distribution in food samples originated from chicken, pigs, and cows. The PCR-based assay that targeted invA gene revealed that 415 (57.64%) retail meat samples were contaminated with Salmonella, while molecular serotyping showed that most retail meats were contaminated with multiple Salmonella serovars. We have demonstrated a faster means of Salmonella detection in food using the TEP I method, which confirmed the pathogen within 2 days compared to the traditional culture technique that requires 5–7 days, and higher sensitivity of Salmonella detection when the protocols TEP I and II were combined. Classical serotyping of Salmonella in animal and environmental samples are not routinely performed in the Philippines since the technique is expensive, time-consuming, and requires skilled technicians. Thus, there is a need for the development or adaptation of rapid, specific, sensitive, less costly, and high throughput techniques. This study adapted previously developed primers to characterize the serogroups and serovars of Salmonella isolates from retail meat using multiplex PCR. We detected five serogroups and at least 29 band patterns that lead to putative Salmonella serovar identities. We also found evidence of multiple Salmonella serogroup and serovar contaminations per sample using TEP I and TEP III. It is highly recommended to adapt or design more primers that target somatic and flagellar genes to determine the identities of unknown isolates. This molecular Salmonella serotyping assay may be adapted by laboratories from health and agricultural departments, particularly for developing countries, as an alternative approach to classical serotyping techniques to increase the Salmonella surveillance data in these regions.

This surveillance data is important in the development of Salmonella control strategy, intervention, and prevention schemes. We determined the most predominant Salmonella serovars in retail meat originating from were S. 3:e,h:1,6 (putative identity: S. Anatum) from pig, S. 3:e,h:1,6 (putative identity: S. Anatum), and S. 4:e,h:1,2 (putative identity: S. Saintpaul) from cow, and S. 8:i:z6 (putative identity: S. Kentucky) from chicken. On the other hand, we observed the low prevalence of S. Typhimurium and S. Enteritidis in retail meat even when they are the most commonly reported serovars in human clinical samples. This is also the first study to report Salmonella serovars S. Agama, S. Livingstone, S. Meleagridis, S. Schwarzengrund, monophasic S. Typhimurium, S. Augustenbirg, S. Rechovot, S. Newlands, S. Podiensis, and S. Gabon in the Philippines. It is proposed to include non-human and non-clinical isolates in routine Salmonella serotyping, particularly in the food production chain, to track the sources of Salmonella contamination in food and future outbreaks in humans and/or animals. Investigation of the antimicrobial susceptibility of Salmonella isolates acquired from this study shall be performed in future studies to identify emerging resistant strains circulating in foods of animal origin, in particular from cows, swine, and poultry.

Supporting information

S1 Appendix. Wet market assessment sheets.

Guide questions used to assess the hygienic conditions of each wet markets in Metro Manila. The name of wet markets was concealed. “Tocino”, “Embutido” and “Longganisa” are Filipino terms for bacon, Filipino style meatloaf, and Filipino style sausage.

(DOCX)

Acknowledgments

We thank Alyzza Marie B. Calayag, Phyllis Anne P. Paclibare, and Jonah Feliza B. Mora for their technical assistance.

Data Availability

All relevant data are within the manuscript and Supporting Information files.

Funding Statement

This study was funded by the Department of Agriculture-Biotechnology Program Office, Philippines (Project Codes: DABIOTECH-R1704 and DABIOTECH-R1706); University of the Philippines Diliman Office of the Vice-Chancellor for Research and Development Thesis and Dissertation Grant 2017; Department of Science and Technology Accelerated Science and Technology Human Resource Development Program (ASTHRDP) Dissertation and Thesis Grants; Gwangju Institute of Science and Technology (GIST) Spring 2014 Internship hosted by United Nations University (UNU)-GIST Joint Programme under the operation of the International Environmental Research Institute (IERI), Gwangju, Korea; and the University of the Philippines System Emerging Inter-Disciplinary Research Program (EIDR) of the Office of the Vice President for Academic Affairs (Project Code: C04-003).

References

  • 1.Hassanein R, Ali SFH, El-Malek AMA, Mohamed MA, Elsayh KI. Detection and identification of Salmonella species in minced beef and chicken meats by using multiplex PCR in Assiut City. Vet World. 2011;4: 5–11. [Google Scholar]
  • 2.Malkawi HI, Gharaibeh R. Multiplex PCR for the direct detection of Salmonella enterica from chicken, lamb and beef food products. J Basic Microbiol. 2003;43: 328–336. 10.1002/jobm.200390035 [DOI] [PubMed] [Google Scholar]
  • 3.Hendriksen RS, Vieira AR, Karlsmose S, Lo Fo Wong DMA, Jensen AB, Wegener HC, et al. Global monitoring of Salmonella serovar distribution from the World Health Organization Global Foodborne Infections Network Country Data Bank: results of quality assured laboratories from 2001 to 2007. Foodborne Pathog Dis. 2011;8: 887–900. 10.1089/fpd.2010.0787 [DOI] [PubMed] [Google Scholar]
  • 4.Nowak B, von Müffling T, Chaunchom S, Hartung J. Salmonella contamination in pigs at slaughter and on the farm: A field study using an antibody ELISA test and a PCR technique. Int J Food Microbiol. 2007;115: 259–267. 10.1016/j.ijfoodmicro.2006.10.045 [DOI] [PubMed] [Google Scholar]
  • 5.Center for Disease Control and Prevention. Serotypes and the Importance of Serotyping Salmonella. 2014.
  • 6.Issenhuth-Jeanjean S, Roggentin P, Mikoleit M, Guibourdenche M, De Pinna E, Nair S, et al. Supplement 2008–2010 (no. 48) to the White-Kauffmann-Le Minor scheme. Res Microbiol. 2014;165: 526–530. 10.1016/j.resmic.2014.07.004 [DOI] [PubMed] [Google Scholar]
  • 7.Seyfarth AM, Lo Fo Wong D.M.A., Aarestrup FM, Wegener HC. The external quality assurance system of the WHO Global Salmonella Surveillance and Laboratory Support Project. Switzerland, Geneva: World Health Organization; 2003. [Google Scholar]
  • 8.Cardona-Castro N, Sánchez-Jimenez M, Lavalett L, Muňoz N, Moreno J. Development and evaluation of a multiplex polymerase chain reaction assay to identify Salmonella serogroups and serotypes. Diagn Microbiol Infect Dis. 2009;65: 327–330. 10.1016/j.diagmicrobio.2009.07.003 [DOI] [PubMed] [Google Scholar]
  • 9.Hong Y, Liu T, Lee MD, Hofacre CL, Maier M, White DG, et al. Rapid screening of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg and Typhimurium using a serologically-correlative allelotyping PCR targeting the O and H antigen alleles. BMC Microbiol. 2008;8: 178 10.1186/1471-2180-8-178 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Echeita MA, Herrera S, Garaizar J, Usera MA. Multiplex PCR-based detection and identification of the most common Salmonella second-phase flagellar antigens. Res Microbiol. 2002;153: 107–113. 10.1016/s0923-2508(01)01295-5 [DOI] [PubMed] [Google Scholar]
  • 11.Herrera-León S, McQuiston JR, Usera MA, Fields PI, Garaizar J, Echeita MA. Multiplex PCR for distinguishing the most common phase-1 flagellar antigens of Salmonella spp. J Clin Microbiol. 2004;42: 2581–2586. 10.1128/JCM.42.6.2581-2586.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Herrebrugh C, Kuiling S, Maas H, Verbruggen A. Molecular serotyping of Salmonella. In: National Institute for Public Health and Environment; 2014. [Google Scholar]
  • 13.Soguilon-del Rosario S, Rivera WL. Incidence and molecular detection of Salmonella enterica serogroups and spvC virulence gene in raw and processed meats from selected wet markets in Metro Manila, Philippines. Int J Philipp Sci Technol. 2015;8: 52–55. [Google Scholar]
  • 14.Ng KCS, Rivera WL. Multiplex PCR-based serogrouping and serotyping of Salmonella enterica from tonsil and jejunum with jejunal lymph nodes of slaughtered swine in Metro Manila, Philippines. J Food Prot. 2015;78: 873–880. 10.4315/0362-028X.JFP-14-342 [DOI] [PubMed] [Google Scholar]
  • 15.Calayag AMB, Paclibare PAP, Santos PDM, Bautista CAC, Rivera WL. Molecular characterization and antimicrobial resistance of Salmonella enterica from swine slaughtered in two different types of Philippine abattoir. Food Microbiol. 2017;65: 51–56. 10.1016/j.fm.2017.01.016 [DOI] [PubMed] [Google Scholar]
  • 16.Chiu C, Ou J. Rapid Identification of Salmonella serovars in feces by specific detection of virulence genes, invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. J Clin Microbiol. 1996;34: 2619–2622. 10.1128/JCM.34.10.2619-2622.1996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hirose K, Itoh KI, Nakajima H, Kurazono T, Yamaguchi M, Moriya K, et al. Selective amplification of tyv (rfbE), prt (rfbS), viaB, and fliC genes by multiplex PCR for identification of Salmonella enterica serovars Typhi and Paratyphi A. J Clin Microbiol. 2002;40: 633–636. 10.1128/jcm.40.02.633-636.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Widjojoatmodjo MN, Fluit AC, Torensma R, Keller BH, Verhoef J. Evaluation of the magnetic immuno PCR assay for rapid detection of Salmonella. Eur J Clin Microbiol Infect Dis. 1991;10: 935–938. 10.1007/BF02005447 [DOI] [PubMed] [Google Scholar]
  • 19.Agron PG, Walker RI, Kinde H, Sawyer SJ, Hayes DC, Wollard J, et al. Identification by subtractive hybridization of sequences specific for Salmonella enterica serotype Enteritidis. Appl Environ Microbiol. 2001;67: 4984–4991. 10.1128/AEM.67.11.4984-4991.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bansal NS, Gray V, McDonell F. Validated PCR assay for the routine detection of Salmonella in food. J Food Prot. 2006;69: 282–287. 10.4315/0362-028x-69.2.282 [DOI] [PubMed] [Google Scholar]
  • 21.Claridades-Rubio J. Philippines Retail Foods 2017 Food Retail Sectoral Report. 2017. [Google Scholar]
  • 22.Regalado-Pineda ID, Rodarte-Medina R, Resendiz-Nava CN, Saenz-Garcia CE, Castañeda-Serrano P, Nava GM. Three-year longitudinal study: Prevalence of Salmonella enterica in chicken meat is higher in supermarkets than wet markets from Mexico. Foods. 2020;9 10.3390/foods9030264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yin M, Yang B, Wu Y, Wang L, Wu H, Zhang T, et al. Prevalence and characterization of Salmonella enterica serovar in retail meats in market place in Uighur, Xinjiang, China. Food Control. 2016;64: 165–172. 10.1016/j.foodcont.2015.12.029 [DOI] [Google Scholar]
  • 24.Baldrias LR, Capistrano RV. Occurrence of Salmonella on dressed chicken in wet markets of Metro Manila [Philippines]. Philipp J Vet Med. 1997;34: 41–44. [Google Scholar]
  • 25.Vismanos MF. C, Baldrias LR. Occurrence of Salmonella in fresh pork, beef, and poultry in Laguna. University of the Philippines Los Banos; 1998. [Google Scholar]
  • 26.Shafini AB, Son R, Mahyudin NA, Rukayadi Y, Tuan Zainazor TC. Prevalence of Salmonella spp. in chicken and beef from retail outlets in Malaysia. Int Food Res J. 2017;24: 437–449. [Google Scholar]
  • 27.Ta YT, Nguyen TT, To PB, Pham DX, Le HTH, Alali WQ, et al. Prevalence of Salmonella on chicken carcasses from retail markets in Vietnam. J Food Prot. 2012;75: 1851–1854. 10.4315/0362-028X.JFP-12-130 [DOI] [PubMed] [Google Scholar]
  • 28.Zulfakar SS, Baharudin N, Bakar NFA. Bacterial contamination on beef sold at selected wet markets in Selangor and Kuala Lumpur. J Agric Sci. 2017;9: 89 10.5539/jas.v9n13p89 [DOI] [Google Scholar]
  • 29.Nhung NT, Van NTB, Cuong N Van, Duong TTQ, Nhat TT, Hang TTT, et al. Antimicrobial residues and resistance against critically important antimicrobials in non-typhoidal Salmonella from meat sold at wet markets and supermarkets in Vietnam. Int J Food Microbiol. 2018;266: 301–309. 10.1016/j.ijfoodmicro.2017.12.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yang B, Xi M, Wang X, Cui S, Yue T, Hao H, et al. Prevalence of Salmonella on raw poultry at retail markets in China. J Food Prot. 2011;74: 1724–1728. 10.4315/0362-028X.JFP-11-215 [DOI] [PubMed] [Google Scholar]
  • 31.Balala LM, Rovira HG, Vizmanos MFC, Bernardo FAEM, Divina BP. Isolation, serologic identification and antibiotic sensitivity testing of Salmonella spp. in chickens. Philipp J Vet Med. 2006;43: 63–70. [Google Scholar]
  • 32.Tran TP, Khai LTL, Ogasawara N, Nguyen TT, Okatani AT, Akiba M, et al. Contamination of Salmonella in retail meats and shrimps in the Mekong Delta, Vietnam. J Food Prot. 2005;68: 1077–1080. 10.4315/0362-028x-68.5.1077 [DOI] [PubMed] [Google Scholar]
  • 33.Maharjan M, Joshi V, Joshi DD, Manandhar P. Prevalence of Salmonella species in various raw meat samplesof a local market in Kathmandu. Ann N Y Acad Sci. 2006;1081: 249–256. 10.1196/annals.1373.031 [DOI] [PubMed] [Google Scholar]
  • 34.Boonmar S, Bangtrakulnonth A, Pornrunangwong S, Marnrim N, Kaneko K, Ogawa M. Salmonella in broiler chickens in Thailand with special reference to contamination of retail meat with Salmonella Enteritidis. J Vet Med Sci. 1998;60: 1233–1236. 10.1292/jvms.60.1233 [DOI] [PubMed] [Google Scholar]
  • 35.Boonmar S, Morita Y, Pulsrikarn C, Chaichana P, Pornruagwong S, Chaunchom S, et al. Salmonella prevalence in meat at retail markets in Pakse, Champasak Province, Laos, and antimicrobial susceptibility of isolates. J Glob Antimicrob Resist. 2013;1: 157–161. 10.1016/j.jgar.2013.05.001 [DOI] [PubMed] [Google Scholar]
  • 36.Tan CW, Noor Hazirah MZ, Shu’aibu I, New CY, Malcolm TTH, Thung TY, et al. Occurrence and antibiotic resistance of Salmonella spp. in raw beef from wet market and hypermarket in Malaysia. Food Res. 2019;3: 21–27. 10.26656/fr.2017.3(1).202 [DOI] [Google Scholar]
  • 37.Dong P, Zhu L, Mao Y, Liang R, Niu L, Zhang Y, et al. Prevalence and profile of Salmonella from samples along the production line in Chinese beef processing plants. Food Control. 2014;38: 54–60. 10.1016/j.foodcont.2013.09.066 [DOI] [Google Scholar]
  • 38.Bender A. Methods of processing and preservation of meat Meat and meat products in human nutrition in developing countries. Food and Nutrition Paper; 1992. [PubMed] [Google Scholar]
  • 39.Stock K, Stolle A. Incidence of Salmonella in minced meat produced in an EU approved cutting plant. Fleischwirtschaft. 2001;64: 1435–1438. [DOI] [PubMed] [Google Scholar]
  • 40.Hue JJ, Baek DJ, Lee YE, Lee KN, Nam SY, Yun YW, et al. Antibacterial activity of sodium phytate, sodium pyrophosphate, and sodium tripolyphosphate against Salmonella typhimurium in meats. Korean J Vet Res. 2007;47: 449–456. [Google Scholar]
  • 41.Indu MN, Hatha AAM, Abirosh C, Harsha U, Vivekanandan G. Antimicrobial activity of some of the South-Indian spices against serotypes of Escherichia coli, Salmonella, Listeria monocytogenes and Aeromonas hydrophila. Brazilian J Microbiol. 2006;37: 153–158. 10.1590/S1517-83822006000200011 [DOI] [Google Scholar]
  • 42.Marques A, Encarnação S, Pedro S, Nunes ML. In vitro antimicrobial activity of garlic, oregano and chitosan against Salmonella enterica. World J Microbiol Biotechnol. 2008;24: 2357–2360. 10.1007/s11274-008-9721-7 [DOI] [Google Scholar]
  • 43.Murugan MS, Chaturvedi VK, Karthik K, Bincy J, Sunitha C, Sumithra T., et al. Antibacterial effect of garlic (Allium sativum) on Staphyloccus aureus: An in vitro study. African J Biotechnol. 2013;10: 666–669. 10.5897/AJB09.553 [DOI] [Google Scholar]
  • 44.Sadeghi-Mehr A, Lautenschläger R, Drusch S. Behavior of Salmonella spp. and Listeria monocytogenes throughout the manufacture and shelf-life of dry-cured formed ham. Food Control. 2016;64: 22–28. 10.1016/j.foodcont.2015.12.023 [DOI] [Google Scholar]
  • 45.Gkana EN, Doulgeraki AI, Nychas G-JE. Survival and transfer efficacy of mixed strain Salmonella enterica ser. Typhimurium from beef burgers to abiotic surfaces and determination of individual strain contribution. Meat Sci. 2017;130: 58–63. 10.1016/j.meatsci.2017.04.006 [DOI] [PubMed] [Google Scholar]
  • 46.Carrasco E, Morales-Rueda A, García-Gimeno RM. Cross-contamination and recontamination by Salmonella in foods: A review. Food Res Int. 2012;45: 545–556. 10.1016/j.foodres.2011.11.004 [DOI] [Google Scholar]
  • 47.Smadi H, Sargeant JM, Shannon HS, Raina P. Growth and inactivation of Salmonella at low refrigerated storage temperatures and thermal inactivation on raw chicken meat and laboratory media: Mixed effect meta-analysis. J Epidemiol Glob Health. 2012;2: 165–179. 10.1016/j.jegh.2012.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ribas A, Saijuntha W, Agatsuma T, Prantlová V, Poonlaphdecha S. Rodents as a source of Salmonella contamination in wet markets in Thailand. Vector-Borne Zoonotic Dis. 2016;16: 537–540. 10.1089/vbz.2015.1894 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Lee HY, Su LH, Tsai MH, Kim SW, Chang HH, Jung SI, et al. High rate of reduced susceptibility to ciprofloxacin and ceftriaxone among nontyphoid Salmonella clinical isolates in Asia. Antimicrob Agents Chemother. 2009;53: 2696–2699. 10.1128/AAC.01297-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.ABS-CBN News. Salmonella type found in Samuya heat resistant. 2009.
  • 51.Bautista VALM, Mendoza BC. Multiple drug resistance profile of Salmonella enterica subsp. enterica serovar Kentucky obtained from apparently healthy layer chickens in San Jose, Batangas, Philippines. Philipp J Vet Med. 2016;53: 17–25. [Google Scholar]
  • 52.Khan AS, Georges K, Rahaman S, Abdela W, Adesiyun AA. Prevalence and serotypes of Salmonella spp. on chickens sold at retail outlets in Trinidad. PLoS One. 2018;13: 1–17. 10.1371/journal.pone.0202108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Vismanos MFC, Sichann T, Padilla MA, Baldrias LR. Isolation and serotyping of Salmonella in cattle slaughtered in Laguna and Batangas [Philippines]. Philipp J Vet Med. 1999;36: 55–60. [Google Scholar]
  • 54.Sarmiento RV, Arambulo PV, Westerlund NC. A study on the role of pigs and cattle as healthy carriers of salmonellae and other human enteric pathogens in the Philippines. J Philipp Med Assoc. 1969. [Google Scholar]
  • 55.Hendriksen R. Global epidemiology of non-typhoidal Salmonella infections in humans. World Health. Technical University of Denmark; 2010. [Google Scholar]
  • 56.Vo ATT, Van Duijkeren E, Fluit AC, Heck MEOC, Verbruggen A, Maas HME, et al. Distribution of Salmonella enterica serovars from humans, livestock and meat in Vietnam and the dominance of Salmonella Typhimurium phage type 90. Vet Microbiol. 2006;113: 153–158. 10.1016/j.vetmic.2005.10.034 [DOI] [PubMed] [Google Scholar]
  • 57.Gutema FD, Agga GE, Abdi RD, De Zutter L, Duchateau L, Gabriël S. Prevalence and serotype diversity of Salmonella in apparently healthy cattle: Systematic review and meta-analysis of published studies, 2000–2017. Front Vet Sci. 2019;6: 1–11. 10.3389/fvets.2019.00001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Sia S.; Lagrada M.; Olorosa A.; Limas M.; Jamoralin M. Jr.; Macaranas P. K.; et al. A fifteen-year report of serotype distribution and antimicrobial resistance of Salmonella in the Philippines. Philipp J Pathol. 2020;5 Available: https://philippinejournalofpathology.org/index.php/PJP/article/view/169 [Google Scholar]
  • 59.Antimicrobial Resistance Surveillance Reference Laboratory. Antimicrobial Resistance 2015 Data Summary Report. 2015. Available: available: http://www.ritm.gov.ph/arsp/ARSP 2014 Summary Report.pdf
  • 60.Department of Health. Antimicrobial Resistance Surveillance Program 2017. Available: http://arsp.com.ph/publications/antimicrobial-resistance-surveillance-program-2017-data-summary-report/
  • 61.Department of Health; Research Institute for Tropical Medicine. ASRP 2014 Data Summary Report. J Chem Inf Model. 2014;53: 1689–1699. 10.1017/CBO9781107415324.004 [DOI] [Google Scholar]
  • 62.Department of Health. Antimicrobial Resistance Surveillance Program 2016 Data Summary Report Antimicrobial Resistance Surveillance Reference Laboratory Antimicrobial Resistance Surveillance Program -Philippines. Antimicrob Resist Surveill Progr. 2016;4: 1–48. [Google Scholar]
  • 63.Department of Health. Antimicrobial Resistance Surveillance Program 2018 Annual Report. J Chem Inf Model. 2019;53: 1689–1699. 10.1017/CBO9781107415324.004 [DOI] [Google Scholar]
  • 64.Doyle ME. White Paper on human illness caused by Salmonella from all food and non-food vectors. FRI Briefings. 2013; 1–51. [Google Scholar]
  • 65.Antimicrobial Resistance Surveillance Reference Laboratory. Antimicrobial Resistance 2014 Data Summary Report. 2014.
  • 66.Wegener H, Hald T, Lo Fo Wong D, Madsen M, Korsgaard H, Bager F, et al. Salmonella control programmes in Denmark. Emerg Infect Dis. 2003;9: 774–780. 10.3201/eid0907.030024 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Appendix. Wet market assessment sheets.

Guide questions used to assess the hygienic conditions of each wet markets in Metro Manila. The name of wet markets was concealed. “Tocino”, “Embutido” and “Longganisa” are Filipino terms for bacon, Filipino style meatloaf, and Filipino style sausage.

(DOCX)

Data Availability Statement

All relevant data are within the manuscript and Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES