Uncovering the Role of the E1 Protein in Different Stages of Human Papillomavirus 18 Genome Replication

Human papillomavirus (HPV) infections pose serious medical problem. To date, there are no HPV-specific antivirals available due to poor understanding of the molecular mechanisms of virus infection cycle. The infection cycle of HPV involves initial amplification of the viral genomes and maintenance of the viral genomes with a constant copy number, followed by another round of viral genome amplification and new viral particle formation. The viral protein E1 is critical for the initial amplification of the viral genome. However, E1 involvement in other phases of the viral life cycle has remained controversial. In the present study, we show that at least two different replication modes of the HPV18 genome are undertaken simultaneously during the maintenance and vegetative amplification phases, i.e., replication of the majority of the HPV18 genome proceeds under the control of the host cell replication machinery without E1 function, whereas a minority of the genome replicates in an E1-dependent manner.

ABSTRACT

The life cycle of human papillomaviruses (HPVs) comprises three distinct phases of DNA replication: initial amplification, maintenance of the genome copy number at a constant level, and vegetative amplification. The viral helicase E1 is one of the factors required for the initiation of HPV genome replication. However, the functions of the E1 protein during other phases of the viral life cycle are largely uncharacterized. Here, we studied the role of the HPV18 E1 helicase in three phases of viral genome replication by downregulating E1 expression using RNA interference or inducing degradation of the E1 protein via inhibition of casein kinase 2α expression or catalytic activity. We generated a novel modified HPV18 genome expressing Nanoluc and tagged E1 and E2 proteins and created several stable HPV18-positive cell lines. We showed that, in contrast to initial amplification of the HPV18 genome, other phases of viral genome replication involve also an E1-independent mechanism. We characterize two distinct populations of HPV18 replicons existing during the maintenance and vegetative amplification phases. We show that a subset of these replicons, including viral genome monomers, replicate in an E1-dependent manner, while some oligomeric forms of the HPV18 genome replicate independently of E1 function.

IMPORTANCE Human papillomavirus (HPV) infections pose serious medical problem. To date, there are no HPV-specific antivirals available due to poor understanding of the molecular mechanisms of virus infection cycle. The infection cycle of HPV involves initial amplification of the viral genomes and maintenance of the viral genomes with a constant copy number, followed by another round of viral genome amplification and new viral particle formation. The viral protein E1 is critical for the initial amplification of the viral genome. However, E1 involvement in other phases of the viral life cycle has remained controversial. In the present study, we show that at least two different replication modes of the HPV18 genome are undertaken simultaneously during the maintenance and vegetative amplification phases, i.e., replication of the majority of the HPV18 genome proceeds under the control of the host cell replication machinery without E1 function, whereas a minority of the genome replicates in an E1-dependent manner.

INTRODUCTION

Human papillomaviruses (HPVs) are epitheliotropic viruses with a double-stranded circular DNA genome of ∼8,000 bp. The infectious cycle of HPVs can be divided into three distinct stages. First, following the infection of proliferating keratinocytes in the basal layer of the epithelium, the unpacked viral genome enters the nucleus and becomes transcriptionally active. The early viral genes E1 and E2 are activated during this stage of infection, leading to the expression of viral proteins required for the efficient transcription and replication of the viral genome. Then, the expression of viral oncogenes E6 and E7 is initiated. The viral genome is amplified during this stage, usually reaching approximately 100 to 500 copies per cell. One of the consequences of the expression of HPV oncogenes is that the infected keratinocytes are retained in the cell cycle, which allows the initiation of the second stage of the viral life cycle, persistent infection, during which the HPV DNA replicates in concert with the cellular DNA, and the copy number of the viral genome remains constant. The third stage of the PV life cycle is initiated in the terminally differentiated keratinocytes of the upper layers of the stratified epithelium. It involves vegetative amplification of the viral genome and expression of viral capsid proteins, followed by the formation of new infectious particles (reviewed in reference 1).

The viral factors required for the initial amplification of the HPV genome, have been extensively studied. It has been found that three viral elements are needed during the initial amplification of the HPV genome. The replication origin is situated in the noncoding region of the virus genome, and the viral proteins E1 and E2 act as trans-factors to initiate replication from this origin (reviewed in reference 2). E2 is a sequence specific transcription factor (3). It binds to the viral origin and recruits the initiator protein E1 to DNA (4, 5). E1 is a DNA helicase that engages the cellular replication machinery to start bidirectional replication of the viral genome (6, 7). As replication is initiated from the viral origin repeatedly during the S phase, the copy number of the HPV genome increases in cells.

Much less is known about the maintenance replication of the HPV genome during persistent infection. Several observations suggest that the mechanism might be different than that of the initial amplification. First, as mentioned above, the copy number of the viral genome does not change over cell generations (2). The question of whether the maintenance replication of the HPV genome is under the control of the cellular origin licensing machinery and restricted to one replication per cell cycle, or whether replication is statistically completed once per cell cycle, has remained obscure, since both options have been proposed (8, 9). Second, it has been shown that a novel mode of replication is initiated already during the transient replication of the viral genome, as determined by two-dimensional (2D) gel electrophoresis analysis of replication intermediates (10, 11). The exact nature of this novel mode of replication has remained enigmatic, but it has been suggested to involve cellular recombination-dependent replication machinery (10). Third, and possibly connected to the observation of the intermediates, is that the episomal HPV genomes tend to form oligomeric concatemer structures in patient derived and established cell lines, which means that the size and structure of the viral replicons might be different than the viral genome that initially infects the cells (12–15).

Molecular aspects of the replication of HPV genome during the third stage of the infection cycle have also remained largely uncharacterized due to the lack of upscalable cell culture systems, since replication normally takes place only in terminally differentiated cells. Several studies have indicated that the vegetative replication of viral genome is dependent on the cellular DNA damage response (DDR) pathway (16–19). There is no clear consensus about the mode of this replication phase of HPV genome, as it has been proposed to proceed by the rolling circle or bidirectional mechanism (20, 21).

The extent of the dependence of viral genome replication on the viral initiator protein and helicase E1 during the maintenance and vegetative phases has remained unclear. It has been shown that HPV31 E1 is required for maintenance replication, while HPV16 E1 is dispensable (9, 22–24). In addition, while the expression of HPV31 E1 is dramatically induced at the onset of keratinocyte differentiation, it has been proposed that vegetative amplification of viral genome takes place with cellular DDR proteins, for which the role of E1 remains unknown (17, 25–27).

Here, we examine the role of the HPV18 E1 protein in all three stages of the viral genome replication. We utilize U2OS cells, which are permissive for the replication of different HPV types. U2OS cells are not natural hosts for HPV, but they effectively recapitulate transient amplification, maintenance replication, and vegetative amplification of viral genomes (28). Also, the transcript maps of various HPV genomes in U2OS cells are very similar to those of the HPV genomes in keratinocytes (29–31). Furthermore, these cells constitute a well-established model system used to study the DDR response, a cellular function that is required for HPV replication (see reference 32 and references therein).

Here, we show that two distinct populations of viral replicons exist during the maintenance and vegetative amplification phases of HPV18 genome replication. Using E1 RNA interference (RNAi) and inhibition of cellular casein kinase 2 (CK2) activity, we demonstrate that a subset of these replicons, including viral genome monomers, replicates in an E1-dependent manner, while some oligomeric forms replicate independently of E1 function.

RESULTS

The modified HPV18 genome and its wild-type counterpart replicate similarly.

Despite the fact that the U2OS cell line efficiently supports replication of HPV genomes, it has been very difficult to analyze the expression of the endogenous viral replication proteins E1 and E2 due to their very low expression levels and the lack of specific antibodies.

To enable the detection of the endogenous E1 and E2 proteins and facilitate the analysis of the replication efficiency of HPV18 DNA, we generated an HPV18-E1HA-Nluc-E2Flag genome possessing several modifications (Fig. 1A). First, the sequences encoding the codon-optimized Nanoluc (Nluc) and the self-processed peptide 2A were inserted in frame with E2 immediately after the E1 stop codon. The full-length E2 open reading frame (ORF) is followed by the sequence encoding the 2A peptide. Second, the sequences encoding the hemagglutinin (HA) and Flag tags were inserted into the E1 and full-length E2 ORFs, respectively. The HA tag was inserted after the fifth amino acid of E1. The Flag tag was introduced in front of the second amino acid of the full-length E2. Thus, the HPV18-E1HA-Nluc-E2Flag genome expresses the HA-tagged E1, Nluc protein fused with 24 amino acids of the truncated E2 N-terminally and the 2A peptide C terminally, and the Flag-tagged full-length E2.

FIG 1.

The replication efficiency of the HPV18-E1HA-Nluc-E2Flag genome is similar to that of the WT HPV18. (A) Map of the HPV18-E1HA-Nluc-E2Flag genome. Red indicates the position of the tags in the E1 and E2 ORFs. The sequence of Nluc is immediately after 72 nucleotides of the WT E2 ORF, which overlaps with the 3′ end of the E1-HA ORF. The full-length E2 ORF containing the Flag tag sequence follows immediately after the sequence encoding the self-processing 2A peptide situated in the 3′ end of the E2-Nluc ORF (not shown). (B) Transient replication of the HPV18 and HPV18-E1HA-Nluc-E2Flag genomes in the U2OS cells was analyzed using SB. Total DNA was treated with BglI and DpnI restriction enzymes. (C and D, left panel) SB signals corresponding to the replicated HPV18 (C) and HPV18-E1HA-Nluc-E2Flag genome (D) were quantified using ImageQuant software. The percent intensity was calculated for each sample relative to the signals obtained in the 2-day posttransfection cells. (D, right panel) The samples obtained from the cells transfected with HPV18-E1HA-Nluc-E2Flag were analyzed for Nluc activity, which was normalized by the activity of alkaline phosphatase and set as 100% for the 2-day-posttransfection cells (*, P < 0.05; **, P < 0.01; n = 3). (E) U2OS cells were transfected with the HPV18-E1HA-Nluc-E2Flag genome and incubated for 2, 3, and 4 days. Linear regression of the normalized Nluc activity and quantified SB signals was analyzed using GraphPad software. The data are expressed as percentages ± the standard deviations (SD) of the signals obtained in the cells incubated for 2 days (set as 100%).

Analysis of HPV18 transcripts has shown that all viral pre-mRNAs are polycistronic with a complex splicing pattern (29, 33). Exogenous sequences introduced into the viral genome could potentially change this pattern and alter the replication efficiency of the modified genome. In addition, the modified proteins may possess altered biological activity. Therefore, we compared the replication efficiency of the HPV18-E1HA-Nluc-E2Flag and the HPV18 wild-type (WT) genomes in U2OS cells. Southern blotting (SB) showed that both genomes replicated with similar efficiency (Fig. 1B, C, and D, left panel). Quantification of the SB results and comparison of these results with the Nluc activity data measured in the same samples showed that both signals correlated well (R² = 0.963) and increased over time with similar kinetics (Fig. 1D and E). These results confirm the previously demonstrated data verifying Nluc activity as a suitable tool for estimating the replication efficiency of Nluc-positive HPV genomes (34, 35).

E1 RNAi inhibits the initial amplification of HPV18.

The viral helicase E1 has been proven to be absolutely required for the initiation of HPV replication from the viral origin of replication (2). Therefore, to verify our experimental model, we analyzed the impact of E1 RNAi on the initial amplification of the HPV18 genome using transiently transfected U2OS cells.

First, we analyzed the levels of endogenous E1 and E2 proteins in U2OS cells cotransfected with the HPV18-E1HA-Nluc-E2Flag genome and two E1-specific siRNAs. At 4 days posttransfection, the E1 and E2 proteins were immunoprecipitated and analyzed using Western blotting (WB) (Fig. 2A). Both E1 siRNAs effectively inhibited E1 protein expression. Quantification of the WB results showed that the level of the endogenous E1 protein was reduced more than 90 and 99% by E1 siRNA1 and siRNA2, respectively (Fig. 2B). E1 RNAi inhibited not only E1 but also E2 expression approximately 90% (Fig. 2A and B).

FIG 2.

E1 RNAi restrains the transient replication of the modified HPV18 genomes in the U2OS cells. (A) U2OS cells were transfected with either the HPV18 or HPV18-E1HA-Nluc-E2Flag genome in the presence of E1-specific or Neg. siRNAs. The cells were incubated for 4 days. The endogenous HA-tagged E1 and Flag-tagged E2 proteins were immunoprecipitated and analyzed using WB and anti-tag antibodies. E1 was also detected in E2 immunocomplexes. GAPDH was used as a control. (B) WB signals corresponding to the E1-HA and E2-Flag protein levels were quantified and expressed as percentages of the E1-HA and E2-Flag levels, respectively, obtained in the samples transfected with Neg. siRNA (indicated as 100%). The data are expressed as average means ± the SD (***, P < 0.001; n = 4). (C) The U2OS cells were transfected with the HPV18-E1HA-Nluc-E2Flag or HPV18 WT genome, incubated for 3 days, and treated with DMSO or 9 μM CX4945 for 12, 24, or 48 h. Endogenous E1 and E2 proteins were immunoprecipitated and analyzed using WB and tag-specific antibodies. (D) WB signals corresponding to the E1-HA and E2-Flag protein levels were quantified and expressed as percentages of the E1-HA and E2-Flag levels, respectively, obtained in the samples treated with DMSO (indicated as 100%). The data are expressed as average means ± the SD (*, P < 0.05; ***, P < 0.001; n = 4). (E) U2OS cells were cotransfected with the HPV18-E1HA-Nluc-E2Flag genome, E1-specific or Neg. siRNA, and the constructs encoding either E1 or E2 of HPV18. Cells were incubated for 2, 3, or 4 days and subjected to luciferase assay. The Nluc activity was normalized to the activity of AP. The data are shown as a percentage of the normalized Nluc activity obtained in the cells transfected with the HPV18-E1HA-Nluc-E2Flag genome, Neg. siRNA and empty vector and incubated for 2 days (set as 100%) (for statistical analysis, data of each sample was compared to the data of the respective control at the same time point [**, P < 0.01; ***, P < 0.001; n = 3]). (F) U2OS cells were transfected with the HPV18-E1HA genome, E1-specific or Neg. siRNA, and E2-encoding construct. Total DNA was isolated from 2-, 3-, and 4-day-posttransfection cells, treated with BglI and DpnI restriction endonucleases and subjected to SB. (G) Cell cycle profile of the U2OS cells cotransfected with the HPV18-E1HA genome and the siRNAs was analyzed using PI.

One interpretation of these results suggests that the E1 and E2 proteins are translated from the same transcript. The HPV18 transcription maps show that while only one of the HPV18 transcripts encodes E1, four could potentially code the E2 protein. Alternatively, it is possible that E1 stabilizes the E2 protein, as is shown in the case of HPV16 (36), since both proteins form a complex in solution, and we detected the E1 protein in the E2 immuno-complexes (Fig. 2A).

To test whether E1 is required for the maintenance of the E2 protein level in cells, we analyzed the levels of the E1 and E2 proteins in the U2OS cells transfected with the HPV18-E1HA-Nluc-E2Flag genome and subsequently treated with CX4945, a small molecular inhibitor of CK2 kinase. We have previously shown that the catalytic activity of CK2α kinase is required for the stability of the E1 protein but it has no effect on E1 transcription (34). Indeed, the E1 protein level was gradually reduced in response to CX4945, as assessed by immunoblotting assay (Fig. 2C). However, the E2 protein was readily detectable in the cells lacking the E1 protein. Quantification of the WB signals showed that although the E1 protein level was reduced more than 99% after 48 h of treatment with CX4945, the E2 protein was downregulated approximately 25% during the course of the experiments (Fig. 2D). These data indicate that neither the deficiency of the CK2 catalytic activity nor lack of the E1 protein has a dramatic effect on E2 protein stability.

Next, we analyzed the impact of E1 RNAi on the replication efficiency of the HPV18-E1HA-Nluc-E2Flag genome using a luciferase assay. E1 RNAi-induced reduction in the E2 protein level was compensated by overexpressed Flag-tagged E2. In addition, we cotransfected the genome with the construct encoding HA-tagged E1 to estimate the efficiency of the established E1 RNAi experimental settings for higher expression levels of E1. Nluc activity was measured at 2, 3, and 4 days posttransfection and normalized to alkaline phosphatase activity (Fig. 2E).

In the control cells, the overexpression of E1 and E2 enhanced the HPV18-E1HA-Nluc-E2Flag replication efficiency, as indicated by the Nluc activity increase over time. The E1 RNAi led to the inability of the HPV18-E1HA-Nluc-E2Flag genome to replicate since the Nluc activity remained at its initial level during the course of the experiment. This effect also persisted in the presence of the overexpressed E1 and E2, showing that E1 RNAi is completely functional in the case of overexpressed E1 and E2.

These results were corroborated by the data from SB analysis to determine the replication efficiency of the HPV18-E1HA genome in the presence of E1 siRNAs and exogenous E2 (Fig. 2F). Very faint replication signals were obtained in the case of the less-effective E1 siRNA1, while more potent E1 siRNA2 completely abolished HPV18-E1HA replication. The cell cycle-specific effects of E1 RNAi were excluded by the analysis of the cell cycle profile in the U2OS cells cotransfected with the HPV18-E1HA genome and E1 siRNAs and incubated for 2, 4 and 6 days (Fig. 2G). The E1 RNAi had no effect on the cell cycle. Taken together, our results confirm previous data showing that E1 is absolutely required for the initial phase of HPV18 DNA replication.

E1 expressed from the siRNA-resistant ORF rescues the E1 RNAi-induced phenotype.

To analyze the specificity of the observed E1 RNAi-mediated effects, we introduced silent mutations into the E1 siRNA-specific sequences to generate the constructs expressing E1-siRNA1-R and E1-siRNA2-R full-length transcripts resistant to E1 siRNA1 and siRNA2, respectively. WB analysis showed that the expression levels of the overexpressed E1-HA proteins encoded by WT or mutant constructs were similar in U2OS cells (Fig. 3A). The biological activity of the overexpressed E1-HA proteins was tested in U2OS cells using luciferase assay. The cells were cotransfected with the HPV18-Nluc genome and the constructs encoding the E1-HA proteins; incubated for 2, 3, and 4 days; and subjected to the luciferase assay. The E1-HA proteins expressed by the E1-WT, E1-siRNA1-R, and E1-siRNA2-R constructs demonstrated similar activity by increasing the HPV18-Nluc copy number ∼2-fold (Fig. 3B). Next, the generated constructs were subjected to the E1 RNAi to examine their resistance to the E1 siRNAs. U2OS cells were cotransfected with the E1-siRNA1-R or E1-siRNA2-R expression constructs and E1 siRNAs, incubated for 3 days, and subjected to WB analysis (Fig. 3C). The E1-siRNA1-R transcript was resistant to E1 siRNA1, allowing expression of the E1-HA protein, but it remained sensitive to the E1 siRNA2. In the case of the E1-siRNA1-R construct, E1-HA protein was detected in the presence of E1 siRNA2, but E1 siRNA1 interfered with the expression. These data indicate that the introduced silent mutations prevent efficiently degradation of the E1-HA encoding transcripts by the respective E1 siRNAs.

FIG 3.

E1 RNAi is responsible for the suppression of the HPV18 replication. (A) U2OS cells were transfected with the constructs expressing HPV18 E1-WT, E1-siRNA1-R, and E1-siRNA2-R transcripts. E1-siRNA1-R and E1-siRNA2-R ORFs contain silent mutations to generate resistance for E1 siRNA1 and siRNA2, respectively. Housekeeping GAPDH and overexpressed E1-HA proteins were analyzed using WB. (B) U2OS cells were cotransfected with the HPV18-Nluc genome and different E1-HA expression constructs or an empty vector in quadruplicates. The cells were incubated for 2, 3, and 4 days and subjected to a luciferase assay. The Nluc activity was normalized to the total protein amount and set as 100% in the control cells cotransfected with the genome and empty vector and incubated for 2 days. The data are shown as average means ± the SD (n = 2). (C) E1-siRNA1-R and E1-siRNA2-R constructs were cotransfected with the E1 siRNAs into U2OS cells. After 3 days of transfection, GAPDH and E1-HA proteins were analyzed using immunoblotting. (D) U2OS cells were cotransfected with the HPV18-Nluc genome, E1 siRNAs, and E1-siRNA1-R and E1-siRNA2-R expression constructs in quadruplicates; incubated for 2, 3, and 4 days; and analyzed using luciferase assay. Nluc activity was normalized to the total protein amount and set as 100% in the control cells cotransfected with the genome, empty vector and Neg. siRNA and incubated for 2 days. The data are shown as average percentages of the control ± the SD (**, P < 0.01; ***, P < 0.001; n = 3). (E) U2OS cells were transfected with the indicated HPV18 genomes and incubated for 2, 3, and 4 days. Total DNA was extracted, digested with BglI and DpnI restriction enzymes, and analyzed using SB. (F) U2OS cells were cotransfected with either HPV18-E1HA-R1 or HPV18-E1HA-R2 genomes and Neg. or E1 siRNAs. Cells were incubated for 3 days. E1-HA and GAPDH proteins were analyzed using WB. (G) U2OS cells were cotransfected with either HPV18-E1HA-R1 or HPV18-E1HA-R2 genomes, E1 siRNAs, and E1-siRNA1-R or E1-siRNA2-R expression constructs, if indicated. After 3 days of incubation, total DNA was extracted, treated with BglI and DpnI restriction endonucleases, and subjected to SB analysis.

Next, we examined the ability of the overexpressed E1-HA proteins to compensate for the E1 RNAi-mediated inhibition of the HPV18-Nluc replication in U2OS cells (Fig. 3D). U2OS cells were transfected with the HPV18-Nluc genome, E1 siRNAs and E1-siRNA-resistant constructs, or empty vector. The cells were incubated for 2, 3, and 4 days. The luciferase assay showed that the E1-siRNA1-R protein was able to reverse the E1 siRNA1-induced inhibition of the HPV18-Nluc replication but not the inhibitory effect of the E1 siRNA2. Also, the E1-siRNA2-R protein was able to compensate for the HPV18-Nluc copy number reduction in response to E1 siRNA2, but it was inactive in the presence of the E1 siRNA1. These data indicate that the E1 siRNA resistance of the overexpressed E1 protein rescues the HPV18-Nluc copy number decrease induced by E1 RNAi that, in turn, verifies the E1-specific downregulation of the HPV18 replication.

To further corroborate the specificity of the E1 RNAi-dependent decrease in HPV18 replication, we generated the HPV18-E1HA genomes expressing the E1-HA protein from the transcripts resistant to either E1 siRNA1 or siRNA2. The silent mutations introduced into the E1-HA ORF were identical to the once described for the E1-siRNA1-R and E1-siRNA2-R expression constructs. SB analysis showed that the generated HPV18-E1HA-R1 and HPV18-E1HA-R2 genomes replicated similarly to the HPV18-E1HA genome in U2OS cells (Fig. 3E). To analyze the expression of the E1-HA protein, U2OS cells were transfected with the HPV18-E1HA-R1 and HPV18-E1HA-R2 genomes and E1 siRNAs. WB analysis showed that the introduced mutations prevented E1 RNAi induced by the respective E1 siRNA (Fig. 3F). The E1-HA protein was detected in the cells cotransfected with E1 siRNA1 and HPV18-E1HA-R1 genome or E1 siRNA2 and HPV18-E1HA-R2 genome. However, expression of E1-HA was downregulated by another E1 siRNA. Next, we analyzed the replication efficiency of the generated genomes cotransfected with E1 siRNAs and E1-siRNA1-R or E1-siRNA2-R constructs in U2OS cells (Fig. 3G). The HPV18-E1HA-R1 genome replicated in the presence of the E1 siRNA1 but failed to replicate in the cells treated with E1 siRNA2. The HPV18-E1HA-R2 genome was resistant to E1 siRNA2, but E1 siRNA1 inhibited its replication. However, overexpression of the E1-HA proteins from E1-siRNA1-R or E1-siRNA2-R constructs rescued the siRNA2- and siRNA1-mediated downregulation of HPV18-E1HA-R1 and HPV18-E1HA-R2 genome replication, respectively. Taken together, these data confirm that the observed decrease in HPV18 replication occurs specifically due to the E1 knockdown.

Establishment of the stable cell lines possessing modified HPV18 genomes.

To investigate the contribution of the E1 protein in stable replication, we used three stable clonal cell lines bearing the modified HPV18 genomes replicating as multicopy episomes. The cell line bearing the WT HPV18 genome (HPV18⁺ cells) has been described previously as Clone 1.13 (28). The cell line carrying the HPV18-E1HA genome (HPV18-E1HA⁺ cells) is a derivative of U2OS cells. The cell line, which was positive for the HPV18-Nluc genome (HPV18-Nluc⁺ cells), was generated from the U2OS-derived 10.15 cell line carrying the firefly luciferase gene stably incorporated in the genome (37).

To ascertain their stability, HPV18-E1HA⁺ and HPV18-Nluc⁺ cells were propagated for approximately 2 months with regular subculturing. Total DNA was isolated at different passages and analyzed for the status of the viral genome by SB (Fig. 4A). The HPV18 genomes persisted at a stable level. We also measured the copy number of the respective HPV18 genomes in our stable cell lines using quantitative PCR (qPCR). The HPV18-Nluc⁺ cells had approximately 440 copies, the HPV18⁺ cells carried approximately 290 copies, and the HPV18-E1HA⁺ cells had 80 copies of the viral genome per cell.

FIG 4.

U2OS cells support stable replication of the modified HPV18 genomes. (A) U2OS-derived HPV18-E1HA⁺ and HPV18-Nluc⁺ cells containing the stably replicating HPV18-E1HA and HPV18-Nluc genomes, respectively, were cultured for approximately two months. Total DNA was isolated at passages p2 to p12, treated with the restriction enzyme BglI linearizing the indicated HPV18 genomes, and subjected to SB. (B) Prior to SB, the LMW DNA isolated from the nonconfluent HPV18-E1HA⁺ and HPV18-Nluc⁺ cells (left and right panels, respectively) was treated with restriction endonucleases for either linearizing (lin) or not cutting (nc) the indicated modified HPV18 genomes. lin1, BglI; lin2, BglII; lin3, SdaI; nc1, HindIII; nc2, SacI; nc3, ScaI. (C) After seeding, the HPV18-E1HA⁺ and HPV18-Nluc⁺ stable cell lines were continuously propagated for 2, 4, and 7 days, resulting in nonconfluent, subconfluent, and confluent cultures, respectively. The U2OS cells were transfected with the respective modified HPV18 genomes and cultured for the indicated periods of time. Prior to SB, the isolated extrachromosomal DNA was treated with the restriction enzymes for either linearizing (BglI) or not cutting (HindIII) the indicated HPV18 genomes and with DpnI in the case of the transiently replicating genomes. Numbers indicate different forms of the uncut modified HPV18 DNA detected in the LMW DNA pool isolated from the confluent stable cell lines. ccc, covalently closed circular DNA; lin, linear DNA; oc, open circular DNA. (D) SB signals corresponding to the bands numbered in panel C were quantified. The sum of the pixels obtained from each sample was set as 100%, and the intensity of each particular band was calculated relative to 100%. The data are presented as average means ± the SD of at least five different samples.

To verify the episomal nature of the replicating HPV18 genomes, low-molecular-weight (LMW) DNA was isolated from the HPV18-E1HA⁺ and HPV18-Nluc⁺ cells, digested with three different restriction enzymes either linearizing or not cutting the HPV18 genomes, and analyzed using SB (Fig. 4B). The pattern of differently linearized or nondigested HPV18 genomes was similar, confirming the absence of the chromosomal integrations in both of these cell lines.

It has been previously reported that the copy number of HPV genomes increases in stable cell lines propagated in dense culture (28). These conditions are suggested to mimic those of the terminally differentiating keratinocytes, in which the vegetative amplification phase of the HPV life cycle occurs. These observations were made using HPV18⁺ cells (28). To examine whether the above-described tendencies also occur in the HPV18-E1HA⁺ and HPV18-Nluc⁺ cell lines, we propagated the cells for 2, 4, or 7 days without subculturing. The confluence of the cells reached 100% on day 4 after passaging. LMW DNA was isolated, treated with the restriction endonucleases for either linearizing or not cutting the HPV18 genomes, and analyzed using SB (Fig. 4C).

Both cell lines demonstrated an increase in the copy number of the viral genomes during propagation in dense cultures (Fig. 4C, lanes 1 to 3). In addition, the oligomeric nature of the viral genomes was confirmed. However, the pattern of the viral genome oligomers changed in the confluent cells. A single oligomeric form of the HPV18-E1HA genome could be observed in the subconfluent cells (Fig. 4C, left panel, lane 4), and this form remained the most prevalent in the densely cultured cells (lanes 5 and 6). However, multiple additional forms of viral DNA appeared in the highly confluent cells (lane 6). Some of these forms of the viral genome migrated similarly to the respective HPV18 genome monomers and oligomers found during transient replication (Fig. 4C, lanes 7 and 8). Generally, the HPV18-Nluc⁺ cells demonstrated similar tendencies with one exception: the multiple monomeric and oligomeric forms of the HPV18-Nluc genome were also detectable in the nonconfluent cells (Fig. 4C, right panel, lane 4).

At least 7 differently migrating viral DNA replicons were detected in the LMW DNA of the HPV18-E1HA⁺ and HPV18-Nluc⁺ cells by SB. The intensity of the bands in each lane was quantified. The sum of the pixels obtained for a particular sample was set as 100%, and the quantity of the pixels of each band was calculated relative to 100%. The most prevalent replicon of viral DNA accounted for approximately 80% in the HPV18-E1HA⁺ cells and for approximately 50% in the HPV18-Nluc⁺ cells (Fig. 4D). Similar results were obtained using the HPV18⁺ cells, which exhibited five differentially migrating HPV18 configurations, and approximately 80% of the viral DNA isolated from the confluent cells corresponded to a single form detectable in the LMW DNA in the nonconfluent cells (data not shown).

To further characterize the HPV18 genomic oligomers in our stable cell lines, we performed a partial digestion analysis, which allowed us to distinguish between the concatemeric and catenated episomes. Equal amounts of LMW DNA isolated from the subconfluent HPV18-E1HA⁺ and HPV18-Nluc⁺ cells were digested with different amounts of BglI, a single cutter enzyme for the HPV18 genome, and subjected to SB (Fig. 5A). We observed that undigested HPV18 genomic forms disappeared gradually in the presence of increased amounts of the BglI restriction endonuclease. Novel forms of viral DNA molecules with different sizes, corresponding to linear mono-, di-, tri-, and tetrameric forms of HPV18 genomes emerged. These molecules were eventually converted into a single linear form, as a result of complete digestion. Similar restriction patterns were obtained using other single cutters BglII and SdaI (data not shown). Taken together, our results indicate that the HPV18 genomes are arranged as head-to-tail concatemers in our HPV18-E1HA⁺ and HPV18-Nluc⁺ stable cell lines, as it has been previously described for transient and maintenance replication of the WT HPV18 genome (12).

FIG 5.

The HPV18-E1HA⁺ and HPV18-Nluc⁺ cells carry head-to-tail concatemeric episomes that replicate via non-theta-type intermediates. (A) LMW DNA was extracted via Hirt lysis from the subconfluent HPV18-E1HA⁺ and HPV18-Nluc⁺ cells. Prior to SB, equal amounts of LMW DNA (20 μg for HPV18-E1HA⁺ cells and 15 μg for HPV18-Nluc⁺ cells) were treated with 1 μl of HindIII and the indicated amounts of BglI restriction endonucleases, which serve as a noncutter and a single cutter, respectively. Reaction mixtures were incubated at 37°C for 30 min. DNA molecules with sizes corresponding to single, dimeric, trimeric, and tetrameric linear forms are indicated as 1 lin, 2 lin, 3 lin, and 4 lin, respectively. ccc, covalently closed circular DNA; oc, open circular DNA. (B) LMW DNA was isolated from the nonconfluent HPV18-Nluc⁺ cells and was subjected to neutral-neutral 2D analysis, using 0.4% agarose in Tris-borate-EDTA (TBE) in the first dimension and 1.2% agarose plus ethidium bromide in TBE in the second dimension. Viral DNA was detected using SB. Different forms of viral episomes from monomeric to hexameric genomes were detected. ccc, covalently closed circular DNA; oc, open circular DNA. (C) LMW DNA was isolated from the U2OS cells transiently transfected with the HPV18-Nluc genome (left panel) and from the HPV18-Nluc⁺ cells (right panel). DNA was digested with BglI, which cuts the viral genomes once at the origin of replication, and subjected to neutral-neutral 2D analysis as in panel B. Both the theta type (arrowhead) and the non-theta type of replication intermediates (arrows) were observed in the transiently transfected cells, while the non-theta type of replication intermediates prevailed in the HPV18-Nluc⁺ cells. Asterisks depict the almost fully replicated HPV DNA.

To analyze the status of the viral DNA in more detail, 2D gel analysis of LMW DNA from the HPV18-Nluc⁺ cells was performed (Fig. 5B). The analysis clearly showed closed circular and open circular forms of monomeric and oligomeric episomal HPV18-Nluc genomes.

Given that oligomerization of the viral genomes during transient replication is accompanied by a change in the replication mechanism, as indicated by the analysis of replication intermediates (10, 12), we were interested in the nature of the HPV replication mode in our stable cell lines, in which the oligomeric forms of the genome were predominant. We used 2D gel analysis of the linearized HPV18-Nluc genomes from the either transiently transfected U2OS or stable HPV18-Nluc⁺ cells (Fig. 5C). Our analysis showed that, in accordance with the previously published data, two mechanisms coexisted in the transiently transfected U2OS cells. First, bidirectional replication via theta-type intermediates was observed. Second, an unknown replication mechanism that accompanied oligomerization of HPV18-Nluc genome was detected. As the majority of the viral genome in the HPV18-Nluc⁺ cells were in an oligomeric state (Fig. 4C and 5A and B), the bidirectional theta-type of replication was almost nondetectable.

Taken together, our results show that two important changes transpire in the stable cell lines continuously propagated at high cellular density. First, there is an increase in the copy number of the HPV18 genomes. Second, there is a change in the structure of the HPV18 replicons, indicating a switch in the replication mode, which is a feature of the vegetative replication of this virus type.

Inhibition of CK2α kinase and E1 RNAi downregulates E1 protein in the stable cell lines.

Next, we downregulated the E1 helicase in the stable HPV18⁺, HPV18-E1HA⁺, and HPV18-Nluc⁺ cells. First, E1 expression was suppressed using the E1-specific siRNAs. Since we could not analyze the level of E1 protein in the HPV18⁺ or HPV18-Nluc⁺ cells because of lack of a specific antibody, we applied qPCR to measure the E1 mRNA expression levels in the cells treated with the E1 siRNAs for 2 and 5 days (Fig. 6A). At 2 days after transfection, both siRNAs suppressed E1 mRNA expression by at least 80% (Fig. 6A, left panel). However, the level of E1 transcript increased on day 5 of the experiment despite repeated siRNA delivery on day 3 after the first transfection (Fig. 6A, right panel). These data could be explained by the inappropriate conditions for efficient transfection of the siRNAs, since the cellular density substantially exceeded the optimal level on day 3 of culturing.

FIG 6.

Downregulation of the endogenous E1 protein expression was achieved by different treatments of the stable cell lines. (A) HPV18-E1HA⁺, HPV18-Nluc⁺, and HPV18⁺ cells were transfected with E1-specific or Neg. siRNA and propagated for 2 or 5 days (left and right panels, respectively). In the case of prolonged culturing, the cells were transfected with the indicated siRNAs also on day 3 after the first transfection. E1 mRNA expression levels were analyzed using qPCR in triplicate and normalized to the GAPDH expression levels. The data were calculated relative to the normalized E1 mRNA expression level in the control cells transfected with Neg. siRNA (referred to as “1”). The data are expressed as average means ± the SD (*, P < 0.05; **, P < 0.01; ***, P < 0.001). (B and D) HPV18-E1HA⁺ cells were either transfected with E1-specific siRNAs (B) or siCK2α or were treated with the CK2 inhibitor CX4945 (D). Cells were propagated for the indicated periods of time without subculturing. The HA-tagged E1 protein was immunoprecipitated and analyzed by WB. GAPDH was used as a control. (C and E) The WB signals corresponding to the levels of the E1 protein were quantified and expressed as percentages ± the SD relative to the levels obtained in the control cells transfected with Neg. siRNA (set as 100%). **, P < 0.01; ***, P < 0.001; n = 3; ND, not detected. (F) Cell cycle profile of the HPV18-Nluc⁺ cells transfected with the siRNAs and incubated for the indicated periods of time was determined using PI.

The immunoblot assay showed a strong reduction in the E1 protein levels in response to the E1 RNAi in the HPV18-E1HA⁺ cells (Fig. 6B, left panel, lanes 4 to 6 for siRNA1 and lanes 7 to 9 for siRNA2). In addition to the results described above, an increase in the copy number of the HPV18-E1HA genome was accompanied by an ∼2-fold increase in the E1 protein level in the confluent cells (Fig. 4C and 6B, lanes 1 to 3, and Fig. 6C).

We have previously demonstrated that inhibition of CK2α kinase leads to the degradation of the E1 protein in transiently transfected U2OS cells (34). To determine whether a similar phenomenon also occurs during HPV18 maintenance replication, we tested E1 protein levels in the HPV18-E1HA⁺ cells inhibiting either the expression or activity of CK2α kinase using CK2α RNAi or CX4945, respectively. Two different concentrations of CX4945, 6 and 9 μM, were used. The level of the E1 protein was examined using WB after 2 or 6 days of treatment (Fig. 6D). Both treatments resulted in profound attenuation of the E1 protein level.

The WB signals obtained in different experiments were quantified, and the E1 protein level was set as 100% in the control cells (Fig. 6E). Similar to the E1-specific siRNAs, the efficiency of CK2α RNAi was higher on day 2 of treatment, at which point the E1 protein level dropped more than 90%. However, the efficiency of the RNAi decreased in the dense cultures, which led to an increase in the E1 protein level up to 30% on day 6 of the experiment. In contrast, the degradation of the E1 protein escalated over time in response to CX4945. Relative to the respective control, the E1 protein level decreased from 16% on day 2 to 7% on day 6 in response to 6 μM CX4945, and remained under the detectable limit on day 6 of the treatment with 9 μM CX4945.

In addition, our data from qPCR and WB showed that, in contrast to that in the initial amplification phase, E1 mRNA was more sensitive to E1 siRNA1 during the stable phase of HPV18 genome replication (Fig. 2A and 6A and C), which could be a consequence of the different levels of E1 transcripts expressed in each particular replication phase.

The cell cycle profile was analyzed in the HPV18-Nluc⁺ cells treated with the E1 siRNAs and incubated for 2, 4, and 6 days. E1 RNAi per se had no effect on the cell cycle, but the percentage of cells in G₀/G₁ increased substantially on day 6, indicating cell cycle arrest in the dense cultures (Fig. 6F).

Maintenance replication of the HPV18 genomes occurs mostly in an E1-independent manner.

To study the involvement of E1 in the maintenance phase of HPV18 replication, E1 RNAi and CX4945 were applied to the HPV18⁺, HPV18-E1HA⁺, and HPV18-Nluc⁺ cells cultured between sparse and subconfluent density for 7 days. Treatment with E1 siRNA1 was combined with E2 overexpression to compensate for a possible loss of E2, as observed in the transient replication experiments (Fig. 2A). The SB analysis of LMW DNA showed no substantial alterations in HPV18 genome copy numbers in the HPV18⁺ and HPV18-E1HA⁺ cells (Fig. 7A). Similarly, E1 RNAi had no effect on the copy number of the HPV18-Nluc genome in the HPV18-Nluc⁺ cells (Fig. 7B, left panel, lanes 1 to 4). Since the nonconfluent HPV18-Nluc⁺ cells exhibited multiple mono- and oligomeric forms of viral DNA, we also analyzed the pattern of the uncut HPV18-Nluc genome. Surprisingly, all the minor forms of the viral DNA, except the dominant form, disappeared over time in response to E1 knockdown (Fig. 7B, left panel, lanes 5 to 8, with the dominant replicon shown by an asterisk). Treatment with CX4945 resulted in a more rapid loss of the same forms of viral DNA, which was accompanied by a decrease in the overall copy number of HPV18-Nluc (Fig. 7B, right panel, compare lanes 1 and 2 to lanes 3 and 4 for the linearized viral genome and lanes 5 and 6 to lanes 7 and 8 for the uncut HPV18-Nluc). However, the level of the dominant replicon remained similar to that in the control cells. These results suggest that the HPV18 genome is maintained at a stable level mostly via E1-independent mechanisms in the U2OS-derived cells. However, there is also potential for an E1-dependent mode of replication, which depends on the initial status of the viral DNA.

FIG 7.

Deficiency of E1 does not abrogate the stable replication of the HPV18 genomes. (A and B) The HPV18⁺, HPV18-E1HA⁺ and HPV18-Nluc⁺ cell lines were repeatedly treated either with E1 siRNA or CX4945 and propagated at low cellular density for 3, 6, or 7 days. LMW DNA was isolated and treated with BglI restriction endonuclease linearizing the HPV18 genomes. Also, LMW DNA of the HPV18-Nluc⁺ cells was treated with HindIII to analyze the pattern of the uncut HPV18-Nluc genome (B). The DNA was analyzed using SB. *, Dominant replicon of HPV18-Nluc.

E1 is involved in the amplification of the HPV18 genome in confluent U2OS cells.

Our analysis showed that culturing of the stable cell lines at high cellular density mimics, to some extent, the conditions required for the induction of HPV copy number in the terminally differentiating keratinocytes during the vegetative amplification of the viral life cycle (Fig. 4C). However, these conditions stimulated not only an increase in HPV18 genome copy number but also the appearance of multiple monomeric and oligomeric forms of viral DNA in addition to the single form detected in the nonconfluent stable cell lines. To analyze the consequences of E1 downregulation during the vegetative amplification phase, we analyzed the copy number and status of the HPV18 genomes in the stable cell lines propagated at high cellular density after administrating E1-downgrading treatments.

HPV18-E1HA⁺ cells were cotransfected either with E1-specific siRNAs and E2-Flag encoding construct or with CK2α and CK2α′ siRNAs. The cells were incubated for 6 days without subculturing. LMW DNA was extracted and digested with either BglI or HindIII restriction endonucleases producing linearized and uncut HPV18-E1HA genomes, respectively, which were analyzed using SB (Fig. 8A and B).

FIG 8.

Stable replication of the HPV18-E1HA genome occurs via E1-dependent and E1-independent mechanisms. (A and B) The HPV18-E1HA⁺ cells of were cotransfected with E1-specific or Neg. siRNA and E2-Flag-encoding construct (A) or CK2-specific siRNAs or treated with the indicated concentrations of CX4945 (B). Cells were propagated for the indicated periods of time without subculturing. LMW DNA was isolated via Hirt lysis; treated with either BglI or HindIII for linearizing or not cutting the HPV18-E1HA genome, respectively; and analyzed using SB. Images were captured after short and long exposure times (A, upper and lower panels, respectively). Monomeric closed circular (ccc), linear (lin), and open circular/dimeric closed circular (oc/2ccc) forms of HPV18-E1HA replicons are indicated. (C and D) The SB signals corresponding to the linearized HPV18-E1HA genome or the major band of the uncut HPV18-E1HA DNA (numbered as band 4) were quantified. The data are presented as percentages of the signals obtained in the LMW DNA isolated from the cells treated with Neg. siRNA, incubated for 2 days and subjected to SB (set as 100%). The average means ± the SD of at least three independent experiments are shown. NA, not analyzed.

Analysis of the linearized HPV18-E1HA genome revealed that the viral genome copy number increased during the course of the experiment not only in the control cells treated with scrambled negative (Neg.) siRNA (Fig. 8A, lanes 1 to 3), but also in the cells treated with the E1 siRNAs (Fig. 8A, lanes 4 to 6 and lanes 7 to 8 for E1 siRNA1 and siRNA2, respectively). However, the amount of the linearized HPV18-E1HA genome was slightly lower in the cells treated with the more potent E1 siRNA1 (compare lanes 2 and 3 and lanes 5 and 6 in Fig. 8A).

Analysis of the uncut HPV18-E1HA genome showed an increase in the intensity of the dominant replicon during propagation. However, E1 RNAi caused low levels or no other minor viral DNA conformers to emerge, which represents monomeric and dimeric forms of the viral genome. This effect was more noticeable in the case of E1 siRNA1 triggering more profound downregulation of E1 expression (Fig. 8A, compare lanes 12, 15, and 18).

A similar result was achieved using either CK2α siRNA or CX4549 treatment (Fig. 8B). CK2 RNAi and drug had minor effect on the copy number of the HPV18-E1HA DNA, as assessed by analyzing the linearized genome (Fig. 8B, lanes 1 to 8). However, the level of the monomeric and dimeric viral DNA conformers emerging in dense culture was reduced in response to CK2α RNAi and challenge with CX4945 after 6 days of culturing (Fig. 8B, compare lane 12 to lanes 13, 15, and 16). Since CK2α′ knockdown did not affect the stability of the E1 protein, the pattern of uncut viral DNA in the cells treated with CK2α′ siRNA resembled that of the control (Fig. 8B, compare lanes 12 and 14).

SB signals of the linearized and uncut dominant form of HPV18-HA DNA (band 4, as shown in Fig. 4C) obtained from different experiments were quantified and set as 100% in the control cells treated with either Neg. siRNA or dimethyl sulfoxide (DMSO) in the case of RNAi or CX4945 challenge, respectively (Fig. 8C and D). The analysis revealed no significant changes in the signals obtained from SB at each particular time point.

Similar experiments involving E1 RNAi and challenge with CX4945 were conducted using HPV18-Nluc⁺ and HPV18⁺ cells (Fig. 9A and C, respectively). The SB signals corresponding to the linearized and major conformers of uncut viral genomes (dominant band for the HPV18⁺ cells and band 5 for the HPV18-Nluc⁺ cells, as shown in Fig. 4C) obtained in the E1 RNAi experiments were quantified (Fig. 9B). No significant differences were observed. In general, the results were consistent with those of the HPV18-E1HA⁺ cells with one exception. The HPV18-Nluc⁺ cells demonstrated higher sensitivity to the treatment with CX4945, and the levels of the linearized HPV18-Nluc genome, as well as the dominant replicon detected in the uncut viral DNA, decreased over time (Fig. 9C, left panels).

FIG 9.

E1-dependent and E1-independent mechanisms of HPV18 replication are a common feature of different stable cell lines. (A and C) The HPV18-Nluc⁺ and HPV18⁺ cells were cotransfected with the E1-specific or Neg. siRNA and the E2-Flag encoding construct (A); alternatively, the cells were treated with 9 μM CX4945 (C). The cells were incubated for the indicated time without subculturing. LMW DNA was isolated by the Hirt extraction method; digested with BglI or HindIII restriction enzymes to produce linearized or uncut HPV18 genomes, respectively; and analyzed using SB. Images were acquired with short and long exposure times (C, upper and lower panels, respectively). Monomeric closed circular (ccc), linear (lin), and open circular/dimeric closed circular (oc/2ccc) forms of HPV replicons are indicated. (B) SB signals corresponding to the linearized and uncut forms of the HPV18 genomes (bands 5 for the HPV18-Nluc⁺ cells and dominant band for the HPV18⁺ cells) of the E1 RNAi experiments were quantified. The data are presented as percentages of the signals obtained in the samples transfected with Neg. siRNA and incubated for 2 days (set as 100%).

Taken together, our data confirm the existence of at least two replication mechanisms of the HPV18 genome in the dense cultures of U2OS cells. Some forms of the viral DNA were efficiently replicated in the absence of the E1 helicase. However, other viral DNA conformers replicated in an E1-dependent manner. Since these monomers and oligomers form only a minor portion of the viral DNA in cells, E1 deficiency had no significant effect on the overall copy number of the HPV18 genome.

E1 overexpression induces increase in HPV18 genome copy number in a cell line-specific manner and rescues the E1 RNAi-induced phenotype.

To analyze whether the observed changes in the viral DNA pattern occur due to the downregulation of E1 in the confluent HPV18⁺ and HPV18-Nluc⁺ cells, we combined the E1 RNAi with overexpression of the E1-siRNA-R constructs to compensate for the loss of E1. After 4 days of incubation, LMW DNA was isolated, treated with DpnI and BglI or HindIII to analyze the linear and uncut HPV18 DNA, respectively, and subjected to SB (Fig. 10A). SB analysis of the linearized HPV18 genome revealed that the overexpression of E1 up-regulated the overall copy number of the HPV18-Nluc genome but had no profound effect on replication of the HPV18 genome (Fig. 10A upper left and right panels, respectively). E1 RNAi inhibited the appearance of the multiple oligomeric replicons in both cell lines grown under confluent conditions. However, the pattern and intensity of the HPV18 replicons were restored in the cells treated with E1-specific siRNA combined with the respective construct encoding the siRNA-resistant E1. These data show that the E1 protein is responsible for the alterations in HPV18 replication in confluent cells.

FIG 10.

The overexpressed E1 regulates the HPV18 genome copy number in a cell line-specific manner and is capable of rescuing the E1 RNAi-induced phenotype. (A) The HPV18⁺ and HPV18-Nluc⁺ cells were cotransfected with Neg. or E1-specific siRNAs and E1-siRNA1-R or E1-siRNA2-R expression constructs encoding the E1-HA protein. The cells were incubated for 4 days and subjected to the isolation of LMW DNA via Hirt lysis. Prior to SB, the LMW DNA was treated either BglI or HindIII restriction enzymes to produce linearized or uncut HPV18 genomes (upper and lower panels, respectively). (B and C) E1 and/or E2 proteins were overexpressed in the HPV18-E1HA⁺, HPV18⁺, and HPV18-Nluc⁺ cells. The cells were propagated at low cellular density for 48 h. E2 was immunoprecipitated using anti-Flag M2 affinity resin. (B) The levels of the overexpressed E1 and E2 proteins were analyzed with immunoblotting and anti-tag antibodies; GAPDH was used as a loading control. (C) LMW DNA was isolated; treated with BglI or HindIII restriction enzymes to generate linearized or uncut HPV18 genomes, respectively; and analyzed using SB.

To obtain deeper insight into the role of E1 in the stable replication of the HPV18 genome, we examined whether upregulation of E1 is a prerequisite for the increase in the genome copy number and/or appearance of different monomeric and oligomeric forms of the viral genome, as was observed during the vegetative amplification phase of replication. The E1 and/or E2 proteins were overexpressed in the nonconfluent HPV18-E1HA⁺, HPV18⁺, and HPV18-Nluc⁺ cells for 48 or 72 h until cultures reached approximately 70% confluence. WB analysis showed that the levels of the overexpressed proteins were similar in all the cell lines (Fig. 10B). However, an E1-dependent increase in HPV18-Nluc copy number, as well as the appearance of multiple forms of the viral genome, was clearly detected only in the nonconfluent HPV18-Nluc⁺ cells (Fig. 10C, middle panel). The HPV18-E1HA⁺ and HPV18⁺ cells had a slightly elevated viral genome copy number only in the case of E1 and E2 coexpression (Fig. 10C, left and right panels, respectively). However, overexpression of the viral replication proteins per se was insufficient to induce the appearance of multiple viral DNA replicons specific to the confluent cells. These data suggest that an increase in the E1 and/or E2 expression levels is not the only factor required for induction of amplification of viral DNA in dense cultures of the U2OS cells.

DISCUSSION

Numerous studies have identified E1 and E2 proteins as core factors for HPV genome replication (reviewed in reference 2). Most of these studies, however, addressed only the first stage of the HPV life cycle, the initial amplification of the genome. The roles of the E1 and E2 proteins in the maintenance and productive phases of viral genome replication have remained controversial. It has been suggested, but not formally shown, that the roles of E2 in maintenance replication are to recruit the cellular ORC initiator protein to the viral origin of replication and to promote partitioning of the HPV genomes at mitosis (38). The function of E2 during vegetative amplification of the viral genome has not been addressed. The roles of E1 in HPV replication are to recruit cellular replication machinery to the origin of replication and to act as a helicase (6). Several studies have shown that E1 is dispensable for the maintenance replication of HPV16, while it is required in the case of HPV31 (9, 22–24). Surprisingly, one of these studies found that HPV16 E1 was not required for initial replication either (9).

In the present article, we studied the contribution of HPV18 E1 in the initial amplification, maintenance replication, and vegetative amplification of the viral genomes in U2OS cells. To facilitate the analysis of the endogenous E1 and E2 proteins and quantification of the genome copy number, we generated a modified HPV18-E1HA-Nluc-E2Flag genome expressing Nluc, HA-tagged E1, and Flag-tagged E2 proteins. These modifications did not change the replication capacity of the viral genome, and the Nluc activity correlated adequately with the viral genome copy number. The novel genome has been proven to be a useful tool for the investigation of the endogenous E1 and E2, since both proteins encoded by this genome were detectable by immunoblot assay using anti-tag antibodies. By using E1 RNAi, we showed that, in accordance with the generally accepted understanding about HPV replication, E1 was absolutely required for the initial amplification of the HPV18 genome. Surprisingly, the E1 siRNAs also interfered with the E2-encoding transcript(s). This observation may be explained by the fact that E1 and E2 are mostly expressed from the longest HPV18 transcript found in the transiently transfected U2OS and in the HPV18⁺ clone 1.13 cells (29). Both E1 siRNAs are specific for this transcript. We also observed a slightly reduced level of E2 protein in E1-deficient cells treated with CK2 inhibitor CX4945, which likely resulted from some stabilizing effect due to the physical interaction between these proteins.

To address the question of whether E1 is required for the maintenance replication of the HPV18 genomes, we generated three different U2OS-derived cell lines bearing either the WT or the modified HPV18 genomes, each replicating as extrachromosomal multicopy episomes: first, a cell line containing the WT HPV18 genome (HPV18⁺ cells); second, a cell line with a modified HPV18 genome containing the Nluc reporter to allow the rapid detection of copy number changes (HPV18-Nluc⁺ cells); and third, a cell line bearing an HPV18 genome expressing HA-tagged E1 to facilitate detection of endogenous E1 (HPV18-E1HA⁺ cells). The common feature of these cell lines is the predominantly oligomeric status of the replicating viral genomes. However, oligomerization of the viral genomes has been previously observed in most stable cell lines and in human tissues containing episomal HPV genomes (12–15). Interestingly, oligomers of this particular size are negligible during the initial amplification phase of HPV18 replication, suggesting that, during the establishment of stable infection, some minor viral replicons become the preferential substrates of the replication machinery, whereas others (in particular, the monomeric forms) disappear over time.

First, we established that E1 is expressed in these cell lines. Using E1 RNAi, we showed that the viral genome copy number did not change significantly when E1 was efficiently knocked down in the HPV18-E1HA⁺ and HPV18⁺ cells. We have recently shown that CK2α-mediated phosphorylation is needed for the stability of E1, as indicated by the inhibition of CK2α expression or catalytic activity leading to the rapid degradation of the E1 protein (34). Therefore, to further strengthen our argument, we used CX4945-induced inhibition of CK2 catalytic activity and obtained similar results. These data indicate that, despite the expression of E1 during the persistent infection phase of the viral life cycle, it is dispensable for the replication of the oligomeric HPV18 genome at this stage in the analyzed cell lines. Indeed, it has been shown that several cellular helicases can, in principle, take over the function of E1 and participate in the replication of various HPV types (11, 39, 40). The reason for this phenomenon is unclear, since both E1 and E2 proteins are present in the system, and there are therefore no constraints on the origin activation by these viral proteins. Moreover, even overexpression of E1 and E2 proteins could not effectively trigger the replication of the oligomeric HPV18 genomes in the HPV18-E1HA⁺ and HPV18⁺ cells.

One possible explanation for this paradox may lie in the structure of the HPV replicons during the maintenance replication phase. As described above, the viral genomes are mostly oligomeric in our stable cell lines. We and others have previously shown that the HPV replication mode changes upon oligomerization of the viral genomes, from bidirectional replication involving theta-type intermediates to a mode possibly involving DNA break-induced replication (10, 11). Consistent with these observations, we also showed that the predominant replication mode in our stable cell lines was not bidirectional theta replication.

One of our established cell lines, HPV18-Nluc⁺, contained, along with the oligomeric forms, detectable amounts of monomeric viral genomes. In this case, we have demonstrated that suppression of E1 expression by E1 RNAi or use of the CK2 inhibitor CX4945 led to the disappearance of the monomeric HPV18 replicons and other minor oligomeric replicons from the system with the major replicons mostly unaffected. These data indicate that two populations of HPV18 replicons can coreplicate during persistent infection. One population, in our cell lines, the dominant one, replicates independently of E1, whereas replication of other replicons is dependent on E1 and likely on E2. Since E1-independent replication is likely under the control of the cellular replication machinery, it is possible that it occurs once per cell cycle, as Doorbar and colleagues showed in the case of E1-independent HPV16 replication in keratinocytes (9). These data also explain the conflicting results obtained regarding the synchrony of HPV replication in the stable cell lines. One article reports that HPV16 replication occurs once per cell cycle in W12 cells, whereas another study argues that HPV31 replication occurs statistically once per cell cycle in CIN612 cells (8, 9). However, it has been shown that HPV16 genomes are mostly oligomeric in W12 cells, whereas substantial amounts of monomeric HPV31 genomes are retained in CIN612 cells.

Further, we studied the effect of the suppression of E1 function on the vegetative replication of the HPV18 genome. We realize that U2OS cell line is not ideal model to study the productive infection of HPV, which normally replicates in a keratinocyte differentiation-dependent manner. However, culturing of the U2OS-derived stable cell lines at high cellular density mimicked the keratinocytes surprisingly well in terms of the events taking place during the vegetative replication of HPV, including the induction of the viral genome copy number, appearance of monomeric HPV genomes, and increased expression of E1. We demonstrated that the appearance of monomeric HPV18 genomes was abolished in E1-deficient cells, indicating that E1 is involved in the vegetative replication of HPV18 genomes. However, because the monomeric forms represent only a minor fraction of the overall viral DNA in cells, the lack of E1 function had no significant effect on the overall HPV genome copy number in our stable cell lines. Taken together, these data indicate the coexistence of E1-dependent and E1-independent modes of HPV18 replication, which is consistent with the results obtained in other cellular systems.

Based on our data and the data from other laboratories, we hereby propose a model of E1 function during the HPV18 life cycle. Upon the initial infection, the HPV18 genome becomes activated, and E1/E2-dependent replication leads to the amplification of the genome in the cells followed by the expression of viral oncogenes E6 and E7. Viral proteins, likely induced in combination with replication stress accompanying the amplification of foreign DNA in the cell, trigger the activation of the cellular recombination-dependent replication (RDR) machinery. Activation of the RDR machinery, in turn, initiates homologous recombination-dependent oligomerization of the viral genome, as circular replicons exhibit problems in completing the replication process. Depending on the strength of the RDR induction, two possible scenarios can initiate the maintenance replication. First, if the induction of RDR is sufficiently strong, it completely hijacks HPV genome replication from E1 and E2. This scenario leads to either eventual integration of the viral DNA into the host cell genome or generation of once-per-cell cycle replication of oligomeric viral genomes as mammalian autonomously replicating sequence elements. In either case, the fate of the infection is abortive, since monomeric genomes cannot be produced during vegetative phase of the viral life cycle. Second, if RDR induction is at an intermediate or low level, it partially takes over viral genome replication, leading to a situation, in which the formed oligomeric viral genomes replicate once per cell cycle, whereas E1- and E2-dependent replication of monomeric HPV genomes persists, replicating statistically once per cell cycle. The ratio between monomers and oligomers depends on the strength of the RDR activity. Only the latter type of maintenance replication leads to productive infection.

MATERIALS AND METHODS

Plasmids.

HPV18, HPV18-E1HA, and HPV18-Nluc genomes and their parental plasmids were described previously (10, 12, 34). The HPV18-E1HA-Nluc-E2Flag genome was generated on the basis of the HPV18-E1HA genome by inserting the sequences encoding the codon-optimized Nluc and 2A region of the foot-and-mouth disease virus (FMDV) after the 72nd nucleotide in the E2 ORF, which corresponds to the E1 stop codon. The full-length WT E2 ORF begins next to the 2A sequence. The Flag tag-encoding sequence was inserted into the 5′ end of the full-length E2 ORF after the first ATG. The resulting construct encodes the HA-tagged E1 followed by Nluc fused with 24 amino acids of E2 in the N terminus and self-processed FMDV-2A peptide in the C terminus, and the Flag-tagged E2 protein. The above-mentioned HPV genomes were generated as minicircle plasmids in Escherichia coli strain ZYCY10P3S2T using minicircle DNA technology as previously described (41).

The plasmid encoding the Flag-tagged E2 of HPV18 was generated by cloning the E2 ORF lacking the 1^st ATG into the pCMV-Flag-4 vector (Sigma-Aldrich) between the HindIII and BamHI sites. The plasmid encoding the HA-tagged E1 of HPV18 was described previously (42). To generate the E1 siRNA-resistant HPV18-E1HA genomes and E1-HA expression vectors, the siRNA1-and siRNA2-specific sequences were changed to GAATTCAACCTCCCACTTTTG and GCTATCACCAAGATTACAAGA, respectively (the changed nucleotides are underlined). These substitutions did not change the amino acids of the siRNA1- and siRNA2-resistant E1 proteins.

Cell culture.

Human osteosarcoma cell line U2OS (ATCC no HTB-96) and its derivatives were propagated in normal growth medium (NGM) containing Iscove modified Dulbecco medium (Pan Biotech), 10% fetal calf serum, and 1% penicillin-streptomycin (Sigma-Aldrich). The cells were transfected by electroporation (220 V and 975 μF) using a Gene Pulser XCell system (Bio-Rad Laboratories). Approximately 1.5 μg of the WT or modified HPV18 minicircle genomes was used for transfection of 10⁶ U2OS cells.

The HPV18⁺ stable cell line containing the extrachromosomal HPV18 genome was described previously as clone 1.13 (28). The HPV18-Nluc⁺ stable cell line was generated on the basis of a 10.15 cell line containing a chromosomally integrated firefly luciferase-encoding sequence. The HPV18-E1HA⁺ stable cell line was established as a derivative of the U2OS cells. For the generation of the stable cell lines, approximately 2 × 10⁶ cells were cotransfected with 3 μg of the respective HPV18 genome, together with the pBABE-hygro plasmid at a ratio of 10:1. After 48 h of incubation, the cells were seeded at an approximate density 3 × 10³ cells/cm² and propagated in the presence of 200 μg/ml hygromycin B (Sigma-Aldrich) until individual hygromycin B-resistant colonies developed. The colonies were selected and cultured separately in NGM supplemented with 175 μg/ml hygromycin B for 2 weeks with subsequent switching to pure NGM.

The seeding density of the stable cell lines was approximately 2 × 10⁴ cells/cm². Approximately 80% confluent cell cultures contained nearly 6.9 × 10⁴ cells/cm², and the cell cultures with cellular density greater than 8.5 × 10⁴ cell/cm² were considered confluent cells. U2OS cells and their derivatives were treated with 6 or 9 μM CX4945 (Santa Cruz Biotechnologies) or DMSO in NGM. The medium was replenished every 2 days during all experiments. All cells were propagated at 37°C and 5% of CO₂.

E1 and E2 overexpression studies.

Approximately 10⁶ of U2OS or stable cells were transfected with 300 ng of the plasmid encoding the HA-tagged E1 and/or with 200 ng of the Flag-tagged E2-encoding construct. The cells were incubated for 2 or 3 days until they reached approximately 80% confluence and then subjected to WB or SB analysis.

RNA interference.

The following HPV18 E1-specific siRNAs containing a dTdT overhang were used: E1 siRNA1 GAAUUCCACUAGUCAUUUUUG and E1 siRNA2 GUUAAGUCCACGGUUACAAGA (Microsynth) (43). The sequences of the E1 siRNA1 and siRNA2 corresponded to the nucleotides 2440 to 2460 and 1237 to 1257 of the HPV18REF genome (Papillomavirus Episteme database, https://pave.niaid.nih.gov), respectively. Scrambled Neg. and CK2 siRNAs were described previously (34). Cells were transfected with 20 nM siRNAs, together with the modified HPV18 genomes, if indicated, using electroporation. In the case of prolonged experiments, 40 nM siRNA was added using Lipofectamine RNAiMax reagent (Thermo Fisher Scientific) on day 3 after electroporation.

DNA isolation, restriction, and SB.

Total and extrachromosomal DNA was extracted as previously described (28). To analyze the pattern of the uncut WT or modified HPV18 genomes, LMW DNA was treated with restriction endonucleases HindIII, SacI, or ScaI. The following amounts of LMW DNA were used: HPV18-E1HA⁺ cells, 25 μg; HPV18-Nluc⁺ cells, 15 μg; HPV18⁺ cells, 20 μg; and U2OS, 20 μg. An analysis of the linearized HPV18 genomes was performed using 5 μg of the LMW or total DNA treated with restriction endonuclease BglI, BglII, or SdaI. In the case of the transiently replicating genomes, the LMW or total DNA was also treated with DpnI to cut the bacterially methylated input DNA. All restriction reactions were performed in FastDigest Green buffer (Thermo Fisher Scientific). DNA was separated on 0.6% agarose gel. Prior capillary transfer to the Hybond-N+ membrane (GVS), the DNA was denatured by incubating the gel in 0.25 N NaCl for 10 min and solution A (0.5 M NaOH, 1.5 M NaCl) for 1 h, with subsequent neutralization in solution B (1 M Tris [pH 7.4], 1.5 M NaCl) for 30 min at room temperature. Transfer, DNA crosslinking, and hybridization with the linearized HPV18 genome labeled with [α-³²P]dCTP were performed as previously described at hybridization temperature of 68°C.

A 2D analysis of HPV18-Nluc replicons and replication intermediates was performed as described previously using 150 μg of the uncut or BglI-digested LMW DNA (10, 44).

Immunoprecipitation and WB.

Endogenous HA-tagged E1 expressed by the HPV18-E1HA or HPV18-E1HA-Nluc-E2Flag genomes was immunoprecipitated as described previously using ∼10⁶ transiently transfected U2OS or HPV18-E1HA⁺ cells per sample (34). For the Flag-tagged E2 immunoprecipitation, the subconfluent cells from day 4 or 5 posttransfection grown on a 10-cm plate were lysed in 3 ml of radioimmunoprecipitation assay buffer supplemented with cOmplete ULTRA protease inhibitor cocktail (Sigma-Aldrich). The lysates were homogenized with a 22-g syringe, incubated at 4°C for 30 min under slow rotation, diluted 4-fold with a lysis buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100), and incubated for an additional 30 min at 4°C under slow rotation. After centrifugation for 10 min at 10⁴ × g and 4°C, the supernatants were transferred into new tubes and incubated overnight with anti-Flag M2 affinity gel (Sigma-Aldrich) under slow rotation at 4°C. The immunocomplexes were washed three times with 3 ml of the lysis buffer and subjected to immunoblot analysis. The following antibodies were used: anti-HA-HRP clone 3F10 (Sigma-Aldrich, 1:1,500), anti-Flag-HRP clone M2 (Sigma-Aldrich, 1:3,000), anti-GAPDH (Sigma-Aldrich, 1:5,000), and goat anti-mouse IgG conjugated with horseradish peroxidase (Invitrogen, 1:10,000). Signals were detected by exposure to X-ray film (AGFA) after incubation with SuperSignal West Dura extended duration substrate (Pierce, endogenous E1 and E2 proteins) or WB detection reagent (GE Healthcare, overexpressed E1 and GAPDH).

RNA isolation and qPCR.

The stable cell lines were transfected with Neg. or E1-specific siRNAs and incubated for 2 or 5 days. Total RNA was isolated using a Direct-Zol RNA Miniprep Plus kit (Zymo Research). Approximately 6 μg of total RNA was treated with 3 μl of Turbo DNase (Invitrogen) for 3 h at 37°C. DNase was inactivated by incubation of the samples at 75°C for 10 min in the presence of 15 mM EDTA, and total RNA was precipitated with 7.5 M LiCl supplemented with 50 mM EDTA. Complementary DNA was synthesized using 1 μg of the total RNA and a RevertAid cDNA synthesis kit (Thermo Fisher Scientific). The expression levels of the housekeeping gene GAPDH and HPV18 E1 transcripts were measured in triplicate by quantitative PCR using 5×HOT FIREPol Blend Master Mix with 12.5 mM MgCl₂ (Solis Biodyne) and primers listed elsewhere (34).

Cell cycle analysis.

Approximately 10⁶ U2OS or stable cells were transfected with 20 nM Neg. or E1-specific siRNAs (and 2 μg of the HPV18 genome, if indicated), incubated for 3 or 5 days, and subjected to the cell cycle analysis using propidium iodide (PI). The experimental procedures were performed as previously described (34).

Luciferase assay.

U2OS cells were cotransfected with the HPV18-E1HA-Nluc-E2Flag genome (2 μg per 10⁶ cells), 20 nM siRNAs, and E1- and E2-encoding plasmids. The cells were seeded on 96-well plates in four replicates; incubated for 2, 3, and 4 days; washed with PBS; and lysed in passive lysis buffer (40 μl per well; Promega) for 15 min at room temperature. The Nluc activity was measured by using a Nano-Glo luciferase assay system and normalized with alkaline phosphatase activity measured using CSPD substrate (Invitrogen) (in both cases, 10 μl of the lysate was used for each measurement).

Statistical analysis.

The P values for the two-tailed t test were based on assumed equal variances and calculated using Excel software.