Skip to main content
eLife logoLink to eLife
. 2020 Sep 11;9:e59686. doi: 10.7554/eLife.59686

Dichotomous role of the human mitochondrial Na+/Ca2+/Li+ exchanger NCLX in colorectal cancer growth and metastasis

Trayambak Pathak 1,†, Maxime Gueguinou 1,†, Vonn Walter 2,3,4, Celine Delierneux 1, Martin T Johnson 1, Xuexin Zhang 1, Ping Xin 1, Ryan E Yoast 1, Scott M Emrich 1, Gregory S Yochum 3,5, Israel Sekler 6, Walter A Koltun 5, Donald L Gill 1, Nadine Hempel 1,4,7, Mohamed Trebak 1,✉
Editors: Mark T Nelson8, Richard W Aldrich9
PMCID: PMC7529464  PMID: 32914752

Abstract

Despite the established role of mitochondria in cancer, the mechanisms by which mitochondrial Ca2+ (mtCa2+) regulates tumorigenesis remain incompletely understood. The crucial role of mtCa2+ in tumorigenesis is highlighted by altered expression of proteins mediating mtCa2+ uptake and extrusion in cancer. Here, we demonstrate decreased expression of the mitochondrial Na+/Ca2+/Li+ exchanger NCLX (SLC8B1) in human colorectal tumors and its association with advanced-stage disease in patients. Downregulation of NCLX causes mtCa2+ overload, mitochondrial depolarization, decreased expression of cell-cycle genes and reduced tumor size in xenograft and spontaneous colorectal cancer mouse models. Concomitantly, NCLX downregulation drives metastatic spread, chemoresistance, and expression of epithelial-to-mesenchymal, hypoxia, and stem cell pathways. Mechanistically, mtCa2+ overload leads to increased mitochondrial reactive oxygen species, which activate HIF1α signaling supporting metastasis of NCLX-null tumor cells. Thus, loss of NCLX is a novel driver of metastasis, indicating that regulation of mtCa2+ is a novel therapeutic approach in metastatic colorectal cancer.

Research organism: Human, Mouse

eLife digest

Colorectal cancer is the second largest cause of cancer deaths worldwide. Even in cases where the cancer is diagnosed and treated early, cells can sometimes survive treatment and spread to other organs. Once the cancer has spread, the survival rate is less than 15%.

Mitochondria are compartments in the cell that produce energy, and they play an important role in supporting the rapid growth of cancer cells. The levels of calcium ions in mitochondria control how they produce energy, a process that is altered in cancer cells. To better understand how calcium ions influence colorectal cancer growth, Pathak, Gueguinou et al. studied a protein called NCLX, which controls calcium levels by pumping them out of the mitochondria.

Two mouse strains that were used to study what happens if NCLX is missing. The first strain was genetically modified to disable the gene for NCLX and then exposed to carcinogens. The second strain was injected with colorectal cancer cells from a human tumor that were lacking NCLX. In both strains, the tumors that formed were smaller than in mice with NCLX. However, the human cancer cells in the second model were more likely to spread to other organs. This is likely because the build-up of calcium ions in the mitochondria of mice lacking NCLX led to an increase in the production of hypoxia-inducible factor-1a, a protein that is a common driver of cancer spread.

Pathak, Gueguinou et al. demonstrated how NCLX can affect colorectal cancer progression. It suggests that it may have opposing effects during early and late-stage colorectal cancer, encouraging tumor growth but also decreasing the spread to other organs. Further research could help refine treatments at different stages of the disease.

Introduction

Mitochondria are adaptable cellular organelles critical for a spectrum of essential functions including ATP generation, cell signaling, metabolism, proliferation, and death (Vyas et al., 2016). This central function causes mitochondria to fulfill a crucial role as mediators of tumorigenesis. Mitochondria sense changes in energetic, biosynthesis, and cellular stress, and adapt to the surrounding tumor environment to modulate cancer progression and drug resistance (Tosatto et al., 2016; Vyas et al., 2016). One critical function of mitochondria that is poorly understood in cancer cells is the role of these organelles as a major hub for cellular Ca2+ signaling (De Stefani et al., 2016; Pathak and Trebak, 2018). Essentially all mitochondrial functions are controlled by changes in mitochondrial Ca2+ (mtCa2+) levels. Increased mitochondrial Ca2+ uptake stimulates mitochondrial bioenergetics through the activation of Ca2+-dependent dehydrogenases of the tricarboxylic acid (TCA) cycle in the mitochondrial matrix (Hansford, 1994; McCormack et al., 1990; Montero et al., 2000). In turn, mtCa2+-mediated changes in mitochondrial metabolism can alter the generation of mitochondrial reactive oxygen species (mtROS). In addition, through changes in Ca2+ uptake and extrusion, mitochondria shape the spatial and temporal nature of cytosolic Ca2+ signals to regulate downstream gene expression programs (De Stefani et al., 2016; Pathak and Trebak, 2018).

Mitochondria form very close contact sites with the endoplasmic reticulum (ER) known as mitochondria-associated membranes (Booth et al., 2016). These contact sites are hotspots of communication through which Ca2+ release from the ER via inositol-1,4,5-trisphosphate receptors (IP3R) is efficiently transferred to the mitochondrial matrix through the mitochondrial Ca2+ uniporter (MCU) channel complex (Baughman et al., 2011; Booth et al., 2016; De Stefani et al., 2011; Wu et al., 2018). This ensures that the bioenergetic output of the cell is tailored to the strength of cell stimulation by growth factors (Pathak and Trebak, 2018). The major mtCa2+ extrusion route is mediated by the mitochondrial Na+/Ca2+/ Li+ exchanger (NCLX) (Palty et al., 2010). The balance between Ca2+ uptake by MCU and Ca2+ extrusion by NCLX is critical for maintaining mtCa2+ homeostasis, which in turn regulates metabolism and cell fate. Perturbations in mtCa2+ homeostasis have been linked to a multitude of diseases including cancer (De Stefani et al., 2016; Pathak and Trebak, 2018), and altered mtCa2+ homeostasis has recently emerged as a novel hallmark of cancer cells (Danese et al., 2017; Kerkhofs et al., 2018; Paupe and Prudent, 2018). However, the underlying molecular mechanisms by which mtCa2+ regulate cancer progression are still poorly understood.

In recent studies, altered MCU expression has been reported in cancer cells, and increased expression of MCU and alterations in proteins that regulate MCU channel activity have been associated with increased mtCa2+ and downstream effects that contribute to proliferation and tumor progression (Koval et al., 2019; Marchi et al., 2013; Ren et al., 2017; Tosatto et al., 2016; Vultur et al., 2018). In comparison to MCU, NCLX activity is ~100 fold slower, thus NCLX operation is the rate-limiting factor in mtCa2+ homeostasis (Ben-Kasus Nissim et al., 2017; Palty et al., 2010). For instance, cardiomyocyte-specific MCU knockout mice have unaltered levels of mitochondrial matrix Ca2+ and no obvious phenotype, whereas cardiomyocyte-specific NCLX knockout mice display mtCa2+ overload and die from sudden cardiac arrest (Luongo et al., 2017). This suggests that although lack of MCU is compensated for by an alternative pathway, the lack of NCLX is not (Pathak and Trebak, 2018). Given the importance of NCLX as the major extrusion mediator of mitochondrial matrix Ca2+, it is imperative to understand how aberrant expression of this protein influences mitochondrial and cellular function in cancer. However, to date, the role of NCLX in tumor biology has not been directly investigated.

Colorectal cancer (CRC) is the third most commonly diagnosed cancer type and the third leading cause of cancer deaths in both men and women in the United States (Siegel et al., 2020). Patient diagnosis at an advanced stage with significant metastatic spread is associated with a 5 year overall survival rate in less than 15% of these CRC patients, demonstrating a need to further understand the underlying mechanisms driving CRC metastasis, recurrence, and development of chemoresistance (Siegel et al., 2020). In order to better classify and inform therapeutic interventions the CRC Subtyping Consortium derived four CRC consensus molecular subtypes (CMS) based on comprehensive molecular signatures including mutation, DNA copy number alteration, DNA methylation, microRNA, and proteomics data. These four subtypes differ in their metastatic potential and in survival outcomes of patients (Guinney et al., 2015). For example, CMS4, which is characterized as mesenchymal, is associated with an epithelial-to-mesenchymal transition (EMT) phenotype and poor patient survival statistics. In addition, colorectal cancer cell-intrinsic transcriptional signatures (CRIS), which exclude the contribution of tumor-associated stroma, similarly demonstrate the existence of distinct subtypes based on transcriptional profiling (Dunne et al., 2017; Isella et al., 2017).

Here, we show that the expression of NCLX is significantly downregulated in human colorectal adenocarcinomas. We demonstrate that a loss of NCLX decreases mtCa2+ extrusion in CRC cells and that this increase in mtCa2+ has important consequences on colorectal tumor cells: NCLX loss (1) inhibits proliferation and primary tumor growth, while (2) enhances metastasis, and drug resistance, suggesting that a loss of NCLX contributes to CRC metastatic progression. Importantly, decreased NCLX expression leads to transcriptional changes reminiscent of highly metastatic mesenchymal CMS4 CRC subtype, including increased expression of genes regulating EMT and cancer stemness, and decreased expression of cell-cycle progression mediators. Mechanistically, decreased expression or loss of NCLX results in mtCa2+ overload, causing depolarization of mitochondria, increased mtROS production, which drives ROS-dependent HIF1α protein stabilization and pro-metastatic phenotypes of NCLX-low CRC cells. Thus, we show a novel dichotomous role of NCLX in cancer, where reduced NCLX function lead to reduced tumor growth, while driving a mesenchymal phenotype that leads to increased metastasis and drug resistance.

Results

NCLX expression is reduced in colorectal tumors

Using the publicly available Cancer Genome Atlas (TCGA) database, we found that NCLX (SLC8B1) mRNA levels were significantly downregulated in both colon and rectal adenocarcinoma (COADREAD) tumors as compared to the adjacent normal tissue (Figure 1A). Consistent with the TCGA data, we observed a substantial reduction to a near loss in SLC8B1 mRNA in colorectal tumor samples isolated from patients undergoing surgery at Penn State University Medical Center as compared to the paired normal adjacent tissues (Figure 1B). There was no difference in SLC8B1 mRNA levels between male and female tumor tissues (Figure 1—figure supplement 1A) and between patients bearing mutated and normal proto-oncogene KRAS and phosphoinositide 3-kinases (PI3K) (Figure 1C). However, low NCLX expression was associated with TP53 mutations and wild type BRAF tumors (Figure 1D). TCGA data analysis from UALCAN (Chandrashekar et al., 2017) revealed that SLC8B1 mRNA was appreciably reduced in CRC patients of all age groups (Figure 1—figure supplement 1B). Both adenocarcinoma and mucinous adenocarcinoma had a significant reduction in SLC8B1 mRNA levels as compared to the normal tissue (Figure 1—figure supplement 1C). Subsequent analysis revealed a significant loss of NCLX in adenomas with malignant transformation from stage I through stage IV (Figure 1E). There was a significant reduction in SLC8B1 mRNA level in late-stage (stage III and IV) colorectal tumors as compared to early-stage (stages I and II) tumors from the TCGA database (Figure 1E,F), with similar results when we analyzed the patient samples obtained from Penn State University Medical Center (Figure 1G). Together, these results show that NCLX expression is significantly downregulated in CRC specimens, and that NCLX loss correlates with late-stage colorectal adenocarcinomas.

Figure 1. The expression of NCLX, a mtCa2+ extrusion mediator in CRC cells, is decreased in CRC tumor samples from human patients.

(A) TCGA data analysis showing SLC8B1 mRNA levels in tumor tissues and adjacent normal tissues of COADREAD (colon and rectal adenocarcinoma) patients. Each data point represents an individual sample. (B) RT-qPCR analysis of SLC8B1 mRNA in tumor tissues (n = 30) and adjacent normal tissues (n = 30) of CRC patients from Penn State University Hospital. (C, D) TCGA data analysis showing SLC8B1 mRNA level in patients with and without KRAS, PI3K, (C) TP53, and BRAF (D) mutation. (E–F) TCGA data analysis showing NCLX mRNA in tumors at different cancer stages (stages I–IV) (E) or combined stage I/II (early stage) and stage III/IV (late-stage) (F) of COADREAD tissues compared to adjacent normal tissues. NA = stage not known (G) RT-qPCR analysis of SLC8B1 mRNA in combined stage I/II (n = 9) and stage III/IV (n = 20) CRC tumor samples compared to their adjacent normal tissues obtained from Penn State University hospital. (H) Schematic representation of the colitis-associated regimen of AOM and DSS treatment. (I–K) Five representative colons from each experimental group are shown (I), quantification of the number of tumors (J), and tumor volume (K) in NCLX KO and control littermate mice at day 78 after AOM/DSS treatment. The red arrow indicates polyps in the colon and the white star represents fat tissue; n ≥ 30 mice per group. (L, M) Three replicates of representative H and E staining of colon sections where black arrows indicate dysplasia (scale bar 500 µm) (L), histology score of dysplasia (scale bar 500 µm) (M). Kruskal-Wallis ANOVA was performed to test single variables between the two groups. *p<0.05, **p<0.01, and ***p<0.001.

Figure 1—source data 1. Source data Figure 1.

Figure 1.

Figure 1—figure supplement 1. Loss of NCLX reduces tumor number and size in the colitis-associated cancer model.

Figure 1—figure supplement 1.

(A) TCGA data analysis showing SLC8B1 mRNA levels in tumors of male and female COADREAD patients. (B, C) TCGA data analysis showing a comparison of SLC8B1 mRNA levels in COAD patients based on age (B) and the origin of adenocarcinoma (C). (D) Cartoon depicting the position of the nucleotides deleted from the Slc8b1 gene in Slc8b1-/-(NCLX KO) mice. The red color depicts the deleted region, the light green bar represents the Slc8b1 gene, and the dark green boxes represent the coding regions in the exons. (E) Cartoon representing the annealing position of the primer pair sets used for genotyping NCLX KO mice, and products of the PCR performed on genomic DNA from wild type (WT), heterozygotes (Slc8b1-/+), and NCLX KO mice tails. (F, G) Magnified image of a colon from an NCLX KO mouse and a littermate control mouse where the tumors are marked by red arrows (F) and colons isolated at day 78 from fifteen NCLX KO mice and control littermate mice subjected to AOM/DSS treatment (G). In TCGA analysis, each data point represents individual patients. Kruskal-Wallis ANOVA was used to calculate statistics. *p<0.05, **p<0.01, and ***p<0.001.

Loss of NCLX has a dichotomous role on tumor growth and metastasis in vivo

To determine the functional link between loss of NCLX expression and the development of CRC in vivo, we first used global NCLX (Slc8b1) KO (NCLX KO) mice that were generated using CRISPR/Cas9, where 13 nucleotides (120513241–120513253 on chromosome 13, a region coding for five amino acids) were deleted from the first exon of Slc8b1, resulting in a frameshift mutation and an early stop codon in exon 2 at nucleotide 248 of the coding sequence (Figure 1—figure supplement 1D). This deletion was confirmed by genotyping of genomic DNA using specific primers for wildtype and knockout alleles (Figure 1—figure supplement 1E). We then used the NCLX KO mice and their wildtype littermate controls to determine the contribution of NCLX to the development of colorectal tumors in the colitis-associated colorectal cancer model. We subjected NCLX KO mice (n ≥ 30) and littermate control mice (n ≥ 30) to one intraperitoneal injection of azoxymethane (AOM; 100 µl of 1 mg/ml) and three cycles of dextran sodium sulfate (DSS; 1.5%) in drinking water with two weeks of normal water between each DSS cycle (Figure 1H). At day 78, mice were sacrificed, and their colorectal tracts were harvested. Colorectal tissues from five representative mice from each experimental group are shown in (Figure 1I), and the tissues from fifteen additional mice are depicted in (Figure 1—figure supplement 1F,G). Although there is a clear association between NCLX loss and CRC in TCGA data, the colons of NCLX KO mice displayed approximately 50% less tumors than those of littermate control mice (Figure 1I,J and Figure 1—figure supplement 1F,G). Further, the tumors that developed in the colons of NCLX KO mice were markedly smaller than those in the colons of littermate control mice, as determined by measurements of tumor size (Figure 1K). Histological analyses of colon tissues revealed significantly reduced dysplasia in the colons of NCLX KO mice compared with colons from littermate control mice (Figure 1L,M).

The DSS/AOM administration in mice is an excellent tumor growth model that is not associated with tumor metastases. Therefore, to further investigate the role of NCLX on CRC tumor growth and metastatic spread in vivo, we utilized the human CRC parental cell line HCT116 and its NCLX knockout counterpart in an intrasplenic xenograft model. While the overall efficiency of liver metastasis and colonization is low during intrasplenic injection, this model remains nonetheless is a well established method to study metastasis to distant organs such as the colon and liver (Heijstek et al., 2005). For in vivo studies NCLX KO clone #33 was used, which was generated using a guide RNA (g2) resulting in a single cut at nucleotide 150 in exon one causing a frameshift mutation and introduction of a stop codon at predicted position 181-183 bp and 184-186 bp in the NCLX open reading frame (Figure 2A). The HCT116 NCLX KO cells and their control HCT116 counterparts were tagged with luciferase and injected (5 × 105 cells/mouse) in the spleens of two groups of NOD-SCID mice for a total of 15 mice per experimental group (Figure 2A). In vivo metastasis to the colon and liver was assessed by monitoring luciferase bioluminescence. The mice were injected IP with 100 µl luciferin, and the total flux was measured using the In Vivo Imaging System (IVIS) by exposing the mice for 2 min. There was a significant reduction in the total luciferase bioluminescence flux in mice xenografted with HCT116 NCLX KO cells by comparison to the HCT116 control-injected mice (Figure 2B,C), indicating that the loss of NCLX in CRC cells caused reduced tumor growth. The luciferase flux at 2, 4, and 6 weeks from five representative mice per experimental group are shown in (Figure 2B) with the remaining 10 mice represented in (Figure 2—figure supplement 1). Similarly, the primary tumor volumes (at the time of sacrifice, at six weeks) in the spleens of HCT116 NCLX KO-injected mice were significantly reduced compared to control HCT116-injected mice (Figure 2D,E), consistent with the in vivo tumor growth in the AOM-DSS model. Interestingly, SCID mice injected with the HCT116 NCLX KO cells showed strikingly increased metastasis (Figure 2B), specifically to the liver and colon as compared to control HCT116-injected mice at the time of sacrifice (Week 6; Figure 2F–H). We did not observe any metastasis to the lung, heart or brain of mice of both groups in this xenograft model. Significantly, the SCID mice with intra-splenic injection of HCT116 NCLX KO cells had reduced overall survival compared to mice injected with control HCT116 cells (Figure 2I), suggesting that increased CRC metastasis is the primary cause of lethality in the HCT116 NCLX KO xenograft model. Altogether, our results show that loss of NCLX causes reduced primary tumor growth with increased metastatic progression of colorectal cancer.

Figure 2. Loss of NCLX has a dichotomous role in tumor growth and metastasis in vivo.

(A) Schematic representation of CRISPR-generated HCT116 NCLX KO #33 cells. Luciferase-tagged control HCT116 and HCT116 NCLX KO #33 cells were injected at 5 × 105 cells/mice into spleens of male NOD-SCID mice. (B–C) Representative bioluminescence images (five mice per group) of cancer progression and metastasis in male NOD-SCID mice injected with luciferase-tagged HCT116 cells or HCT116 NCLX KO #33 cells (B) and quantification of whole-body luciferase count (C). (n = 15 mice per group). (D, E) Representative images of the primary tumors at the site of injection (D) and quantification of primary tumor volume at the time of sacrifice (E). Scale bar, 5 mm. (F–H) Representative image of the liver (scale bar, 5 mm) and corresponding colon (scale bar, 1 cm) (F), quantification of luciferase count from the liver (G) and the colon (H) from NOD-SCID mice injected with HCT116 cells or HCT16 NCLX KO #33 cells. (I) Survival curve of NOD-SCID mice injected with either HCT116 cells or HCT116 NCLX KO #33 cells (*p<0.0194, n = 15 mice per group). Kruskal-Wallis ANOVA was performed to test single variables between the two groups. *p<0.05, **p<0.01, and ***p<0.001.

Figure 2—source data 1. Source data Figure 2.

Figure 2.

Figure 2—figure supplement 1. Xenografts of HCT116 cells and HCT116 NCLX KO #33 cells in NOD/SCID.

Figure 2—figure supplement 1.

Bioluminescence images of male NOD/SCID mice injected with luciferase-tagged HCT116 cells or HCT116 NCLX KO #33 cells.

Loss of NCLX inhibits proliferation but enhances migration and invasion of CRC cells

To elucidate the mechanisms by which loss of NCLX elicits these seemingly dichotomous functions on CRC, we investigated the effects of CRISPR/Cas9-mediated knockout, and si/shRNA-driven decreases in NCLX expression in HCT116 and DLD1 CRC cell lines (see Methods and Figure 3—figure supplement 1A–H). To alleviate potential off-target effects of the CRISPR/Cas9 system, we generated several independent clones obtained with three independent guide RNAs (gRNAs; see methods) (Figure 3—figure supplement 1A–H). Genome sequencing and PCR on genomic DNA confirmed NCLX KO (Figure 3—figure supplement 1G). With the exception of one commercially available polyclonal NCLX antibody (Ben-Kasus Nissim et al., 2017) that is now discontinued, there are currently no reliable NCLX antibodies. All commercially available NCLX antibodies have failed our validation assays and our own attempts to generate a monoclonal antibody against NCLX have not yet produced a reliable clone that detects native levels of NCLX expression. We thus resorted to mRNA quantification, and in all three clones of HCT116 NCLX KO cells, RT-qPCR showed complete absence of SLC8B1 mRNA (Figure 3—figure supplement 1D). Similarly, NCLX KO #06, 24, and 32 of DLD1 cells all had an almost complete deletion of the NCLX open reading frame (Figure 3—figure supplement 1E), which was confirmed by PCR on genomic DNA (Figure 3—figure supplement 1F,G) and RT-qPCR quantifying mRNA (Figure 3—figure supplement 1H).

Since the loss of NCLX reduced tumor size in both AOM-DSS and xenograft models (Figures 1 and 2), we assessed the effect of reduced NCLX function on the proliferation of CRC cells by CyQUANT proliferation assays. A significant reduction in proliferation was observed in NCLX KO clones of both HCT116 and DLD1 cells (Figure 3A,B). To rule out the possibility of long-term compensation in NCLX KO clones, we downregulated NCLX in HCT116 cells using two independent shRNAs and validated the downregulation by qPCR, showing around 60% reduction in SLC8B1 mRNA levels in HCT116 cells (Figure 3—figure supplement 1I). Similarly, transient knockdown of NCLX (NCLX KD) using shRNA reduced HCT116 cell proliferation (Figure 3—figure supplement 1J). The decrease in NCLX KO cell proliferation was accompanied by appreciable changes in apoptotic cells. We observed significant increase in cleaved caspase-3 protein using immunofluorescence staining in HCT116 NCLX KO clones as compared to control HCT116 cells, suggesting an increase in apoptosis of NCLX KO CRC cells (Figure 3—figure supplement 1K,L). These data suggest that the reduced tumor sizes observed in vivo (Figures 1 and 2) due to NCLX knockout are likely a consequence of reduced CRC cell proliferation and increased apoptosis.

Figure 3. Loss of NCLX inhibits proliferation but enhances migration and invasion of CRC cells.

(A, B) CyQUANT proliferation assays of HCT116 cells (A), DLD1 cells (B), and their respective NCLX KO clones. (C, D) Representative bright-field images of in vitro wound healing migration assay (C), and quantification of % gap closure for HCT116 cells and clones of HCT116 NCLX KO cells after 24 hr (D). Scale bar, 1 mm. (E, F) In vitro migration assays of control HCT116 cells infected with either scramble shRNA or two different shRNA sequences against NCLX (E) and quantification of % gap closure (F). Scale bar, 1 mm. (G, H) Representative images of invasion assays performed in triplicates (G), and quantification of normalized invasion of HCT116 cells and clones of HCT116 NCLX KO cells (H). Scale bar, 50 µm. (I–K) RT-qPCR data showing mRNA expression for MMP1 (I), MMP2 (J), and MMP9 (K) in HCT116 cells and clones of HCT116 NCLX KO cells. (L, M) Western blot probed with anti-MMP1, anti-MMP2, anti-MMP9, and anti-HSC70 antibody as a loading control (L), and quantification of MMPs band intensities normalized to that of HSC70 (M). (N, O) Representative gelatin zymogram showing MMP2 and MMP9 activity from HCT116 cells, and their respective clones of HCT116 NCLX KO cells (N), quantification of band intensities of MMP2 and MMP9 activities (O). All experiments were performed ≥three times with similar results. Statistical significance was calculated using one-way ANOVA followed by a post-hoc Tukey test, except for M and O, where the paired t-test was performed. *p<0.05, **p<0.01 and ***p<0.001.

Figure 3—source data 1. Source data Figure 3.

Figure 3.

Figure 3—figure supplement 1. Deletion of NCLX results in reduced proliferation and increased migration and invasion.

Figure 3—figure supplement 1.

(A–D) CRISPR/Cas9 knockout strategy of the SLC8B1 gene in NCLX KO clones #33 (A), #37 (B), and #59 (C) with g1 and g2 representing the cut site and red box non-translated region. Location of primers used for RT-qPCR are shown in (A), and SLC8B1 mRNA levels in clones of HCT116 NCLX KO cells compared to control HCT116 cells (D). (E–H) The binding site of guide RNA (gRNA) g3 and g4 on the SLC8B1 gene, the subsequent deletion, and location of primers used for RT-qPCR (E). The position on the SLC8B1 gene of the genotyping primers used to screen gene knockout of NCLX KO clones (F), PCR data on genomic DNA showing amplified products with primer pair sets (G), and RT-qPCR data from DLD1 cells and clones of DLD1 NCLX KO cells normalized to tubulin (H). (I) RT-PCR data showing SLC8B1 mRNA relative to tubulin in HCT116 cells transfected with shRNA against NCLX (shNCLX #2, shNCLX #3, and shNCLX #2+3) and normalized to scramble control. (J) Comparison of proliferation between HCT116 cells infected with scramble shRNA and two different NCLX shRNA sequences. (K, L) Representative image of HCT116 cells and HCT116 NCLX KO #33 cells stained with Hoechst and anti-cleaved caspase-3 antibody (K), and quantification of the percentage of cells showing cleaved caspase-3 staining (L). Each data point represents one replicate with each replicate representing the average values from at least three image fields. Total cell counted, HCT116 cells (n = 100), and HCT116 NCLX KO #33 cells (n = 135). (M, N) Quantification of % gap closure for HCT116 cells and clones of HCT116 NCLX KO cells after 6 hr (M), and with and without mitomycin (300 µM) treatment for 12 and 24 hr (N). (O) Quantification of in vitro invasion of DLD1 cells and clones of DLD1 NCLX KO cells. (P, Q) Western blots probed with anti-MMP1, anti-MMP9, and anti-GAPDH antibodies (P). Quantification of protein band intensities between DLD1 cells and DLD1NCLX KO clones relative to GAPDH (Q). (R, S) Western blots probed with anti-MMP1, anti-MMP9, and anti-GAPDH antibodies (R). Quantification of protein band intensities between HCT116 cells infected with scramble shRNA and NCLX shRNA #2, #3, and #2+three relative to GAPDH (S). All experiments were replicated ≥three times with similar results. Statistical significance was calculated using one-way ANOVA followed by a post-hock Tukey test, except for L, O, Q, and S, where paired t-test was used. *p<0.05, **p<0.01, and ***p<0.001.
Figure 3—figure supplement 1—source data 1. Source data Figure 3—figure supplement 1.

Given that NCLX knockout increased metastatic spread in xenograft models (Figure 2), we investigated the effect of NCLX knockout and knockdown on the migration pattern of CRC cells. A gap closure assay revealed that all NCLX KO clones of both HCT116 cells (Figure 3C,D) and DLD1 cells (Figure 7—figure supplement 1J light colors) had a marked increase in migration at 24 hr. Similar to knockout, shRNA-mediated knockdown of NCLX in HCT116 cells also caused a significant increase in cell migration at 12 and 24 hr time points (Figure 3E,F). Although we showed above that the proliferation of NCLX KO clones of HCT116 cells was inhibited compared to control HCT116 cells (Figure 3A), we ruled out any potential contribution from proliferation in the cell migration assays by analyzing the migration of HCT116 cells and the HCT116 NCLX KO #33 cells at the 6 hr time point. At 6 hr, we observed a significant increase in migration of NCLX KO #33 cells as compared to HCT116 control cells (Figure 3—figure supplement 1M). Effects of proliferation on cell migration were further ruled out by documenting that the increased cell migration of HCT116 NCLX KO cells is preserved in the presence of the cytostatic compound, mitomycin C at 12 hr and 24 hr time points (Figure 3—figure supplement 1N).

Further, the invasive behavior of NCLX KO cells was determined using a Matrigel-coated Boyden chamber assay. A marked increase in invasion was observed in all NCLX KO clones of both HCT116 and DLD1 as compared to their respective controls (Figure 3G,H, Figure 3—figure supplement 1O). Supporting this invasive phenotype are our observations that mRNA levels of the matrix metalloproteinases MMP1, 2, and 9 were significantly upregulated in all the HCT116 NCLX KO clones, as compared to control HCT116 cells (Figure 3I–K). Similarly, the protein levels of MMP1, 2, and 9 were also significantly increased in NCLX KO clones of both HCT116 and DLD1 cells (Figure 3L,M, Figure 3—figure supplement 1P,Q). MMP9 and MMP1 protein levels were slightly increased in HCT116 cells in which NCLX was knocked down by shRNA (NCLX KD), although for MMP1, this increase was not statistically significant (Figure 3—figure supplement 1R,S). We then tested the MMPs activity using zymography and revealed that the activity of MMP2 and 9 were markedly increased in all the NCLX KO clones of HCT116 cells compared to control HCT116 cells (Figure 3N,O). This was more prominent than changes observed at the mRNA and protein levels, suggesting that the loss of NCLX expression in CRC cells mostly contributes to post-transcriptional regulation of MMPs. Collectively, these results suggest that the loss of NCLX in CRC cells causes an increase in migration and invasion of CRC cells through increased MMP1, 2, and 9 protein levels and activity. The data also confirm the dichotomous role of NCLX knockout observed in vivo, demonstrating that NCLX loss results in decreased cell proliferation and an increase in migratory and invasive phenotypes.

Loss of NCLX in CRC cells inhibits mtCa2+ extrusion, causes mitochondrial perturbations, and enhances mitochondrial ROS

We and others have previously shown that NCLX is the major molecular mediator of mtCa2+ extrusion and that inhibiting NCLX expression and function prevents mtCa2+ extrusion (Ben-Kasus Nissim et al., 2017; Palty et al., 2010). We measured mtCa2+ extrusion in all NCLX KO clones by loading the cells with the mitochondrial Ca2+ sensitive dye Rhod-2 AM. Cells were co-loaded with the mitochondrial specific dye MitoTracker Green FM as a control. Cells were then stimulated with ATP, a purinergic G protein-coupled receptor (P2Y) agonist that couples to phospholipase Cβ (PLCβ) activation and subsequent inositol-1,4,5-trisphosphate (IP3)-dependent release of Ca2+ from the ER through IP3 receptors (Buvinic et al., 2009; Gonzalez et al., 1989). Upon stimulation with 300 µM ATP in the presence of extracellular Ca2+, a portion of Ca2+ released from the ER through IP3 receptors is transferred to mitochondria. Hence, cells showed a biphasic response with an increase in Rhod-2 fluorescence followed by a decrease in fluorescence, corresponding to mtCa2+ uptake and mtCa2+ extrusion, respectively. All NCLX KO clones showed a significant reduction in mtCa2+ extrusion (Figure 4—figure supplement 1A–L) with no significant change in the rate of mtCa2+ uptake. To rule out the possibility of long-term compensation in NCLX KO clones, we transiently downregulated NCLX expression in HCT116 and DLD1 cells using siRNA and validated NCLX knockdown by RT-qPCR. We observed around ~60% reduction in SLC8B1 mRNA levels in both HCT116, DLD1, and HT29 cells (Figure 4—figure supplement 1M). Similar to the NCLX KO cells, HCT116 cells, DLD1 cells, and HT29 cells transfected with siRNA against NCLX (siNCLX) exhibited a significant reduction in mtCa2+ extrusion with no significant change in mtCa2+ uptake (Figure 4—figure supplement 1N–V). We previously showed that inhibition of mtCa2+ extrusion through NCLX knockdown in several cell types leads to the inhibition of plasma membrane ORAI1 channels, reduced Ca2+ entry from the extracellular space, and decreased cytosolic Ca2+ (Ben-Kasus Nissim et al., 2017). Therefore, we measured cytosolic Ca2+ in response to stimulation with ATP in HCT116 cells and their NCLX KO #33 counterparts using the dye Fura-2 and showed a reduction in Ca2+ entry in NCLX KO cells with no effect on Ca2+ release from the ER (Figure 4—figure supplement 1W,X). Collectively, these results show that inhibition of NCLX function in CRC cell lines leads to enhanced mitochondrial matrix Ca2+ concentration due to reduced mtCa2+ extrusion and to decreased cytosolic Ca2+ due to reduced Ca2+ entry across the plasma membrane.

The decrease in mtCa2+ extrusion in HCT116 and DLD1 cell clones in which NCLX expression was either reduced by siRNA knockdown or ablated by CRISPR/Cas9 knockout suggested that these clones may be experiencing mitochondrial Ca2+ overload. In normal cells, mitochondrial Ca2+ overload alters bioenergetics and causes drastic cellular dysfunction leading to cell death (Celsi et al., 2009; Santulli et al., 2015). This occurs mainly through the opening of the mitochondrial permeability transition pore (mPTP) (Bernardi and Di Lisa, 2015; Halestrap, 2009) and subsequent mitochondrial membrane depolarization. Therefore, the effects of NCLX knockout on mitochondrial membrane potential were measured using the tetramethylrhodamine methyl ester (TMRE) dye. We observed a significant decrease in the accumulation of TMRE in NCLX KO cells, indicating that mitochondria of NCLX KO cells are more depolarized than control HCT116 and DLD1 cells (Figure 4A,B).

Figure 4. Abrogation of NCLX function in CRC cells causes mitochondrial damage, and enhances mitochondrial ROS.

(A, B) Flow cytometric analysis of mitochondrial membrane potential using the dye TMRE in HCT116 cells (A) and DLD1 cells (B) and their respective NCLX KO clones. Each data point represents one experimental replicate. 100 µM CCCP was added to cells as a positive control, and unstained cells were used as a negative control. (C) Representative images of a transmission electron micrograph of HCT116 cells and HCT116 NCLX KO cells. Red arrows indicate damaged mitochondria. (D–F) Quantification of mitochondrial area (D), number of damaged mitochondria (E), and number of cristae per mitochondria (F) in HCT116 cells and clones of HCT116 NCLX KO cells. (G–I) Western blots labeled with indicated antibodies with anti-GAPDH used as a loading control (G) and quantification of band intensity of LC3B II (H) and p62 (I) normalized to GAPDH in HCT116 cells and clones of HCT116 NCLX KO cells. (J–M) Oxygen consumption rate (OCR) of HCT116 cells and HCT116 NCLX KO clones (J,L), and quantification of basal respiration (Basal Res), spare respiratory capacity (Spare Res Cap), ATP generation (ATP Gen), and maximum respiration (Maximal Res) (K, M). (N, O) Flow cytometric analysis of mitochondrial ROS levels measured with the dye MitoSox in HCT116 cells (N) and DLD1 cells (O) and their respective NCLX KO clones. As a positive control, 50 µM antimycin was used and unstained cells were used as a negative control. All experiments were performed ≥three times with similar results. Statistical significance was calculated using one-way ANOVA followed by a post-hock Tukey test, except figure H, and I, where paired t-test was used. *p<0.05, **p<0.01, and ***p<0.001.

Figure 4—source data 1. Source data Figure 4.
elife-59686-fig4-data1.xlsx (329.2KB, xlsx)

Figure 4.

Figure 4—figure supplement 1. Loss of NCLX in CRC cells inhibits mtCa2+ extrusion.

Figure 4—figure supplement 1.

(A) Representative images of HCT116 cells and HCT116 NCLX KO cells loaded with the mitochondrial Ca2+ dye Rhod-2 AM. Cells were stimulated with 300 µM ATP in 5 mM extracellular Ca2+ at time 0, and the intensity of Rhod-2 was monitored at different times after ATP stimulation. (B–D) The fluorescence ratio of Rhod-2/mt-Green in response to ATP stimulation is monitored as a function of time in HCT116 cells (n = 370), and HCT116 NCLX KO#33 cells (n = 340) loaded with Rhod-2 and the mitochondrial marker mt-Green (used to normalize the Rhod-2 signal). Stimulation with 300 µM ATP in 5 mM extracellular Ca2+ causes rapid mitochondrial Ca2+ uptake (ascending phase) followed by Ca2+ extrusion (descending phase) (B). Quantification of Ca2+ uptake rate (C) and Ca2+ extrusion rate (D) from all cells in (B). (E) Representative images of DLD1 cells and DLD1 NCLX KO#6 cells loaded with the mitochondrial Ca2+ dye Rhod-2 AM and stimulated with 300 µM ATP in 5 mM extracellular Ca2+ in a manner similar to (A). (F–H) Similar recordings and analysis as (B–D), except that DLD1 cells (n = 63) and DLD1 NCLX KO #6 cells (n = 60) were utilized. (I–L) ATP-stimulated mitochondrial Ca2+ uptake and Ca2+ extrusion measured with the dye Rhod-2 in HCT116 (n = 72), HCT116 NCLX KO #37 (n = 118) cells (I), HCT116 (n = 198), and HCT116 NCLX KO #59 (n = 256) cells (J). Similar recordings in DLD1 (n = 109), DLD1 NCLX KO #24 (n = 90) cells (K), DLD1 (n = 179) and DLD1 NCLX KO #32 (n = 107) cells (L). The Rhod-2 intensity was normalized to mitoGFP intensity. The traces are represented as mean ± S.E. (M) RT-qPCR data depicting SLC8B1 mRNA levels in HCT116, DLD1, and HT29 cells transfected with siRNA against NCLX compared to their respective siRNA control-transfected cells. (N–P) ATP-stimulated mitochondrial Ca2+ uptake and Ca2+ extrusion measured with the dye Rhod-2 in scramble HCT116 (n = 48) and siNCLX HCT116 (n = 38) (N), with rates of Ca2+ uptake (O) and Ca2+ extrusion (P). (Q–S) Similar recordings to (N–P) in DLD1 cells with scramble DLD1(n = 16) and siNCLX DLD1(n = 17) (Q), rates of Ca2+ uptake (R) and Ca2+ extrusion (S). (T–V) Similar recordings to (N–P) and (Q–S) in HT29 cells with scramble HT29 (n = 14) and siNCLX HT29 (n = 8) (T) and rates of Ca2+ uptake (U) and Ca2+ extrusion (V). All traces are represented as mean ± S.E. (W, X) Representative cytosolic Ca2+ measurements in HCT116 (n = 110) and HCT116 NCLX KO #33 cells (n = 100) measured with Fura-2 in response 300 µM ATP applied first in nominally Ca2+-free external solution and subsequently with 10 mM external Ca2+. The traces are represented as mean ± S.E (O), and peak SOCE after addition of 10 mM Ca2+ is quantified in (P). All experiments were replicated ≥three times with similar results. Kruskal-Wallis ANOVA was used to calculate statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Figure 4—figure supplement 1—source data 1. Source Data Figure 4—figure supplement 1.
Figure 4—figure supplement 1—source data 2. Source Data Figure 4—figure supplement 2.
Figure 4—figure supplement 2. Loss of NCLX causes mitochondrial damage.

Figure 4—figure supplement 2.

(A–C) Representative transmission electron micrographs (TEM) of mitochondria in HCT116, HCT116 NCLX KO #37 cells, HCT116 NCLX KO #59 cells (A), DLD1 cells, DLD1 NCLX KO#06 cells (B) with red arrows point to damaged mitochondria. TEM of mitochondria in HCT116 and HCT116 NCLX KO #33 cells, and the magnified image shows mitochondria encapsulated in a phagosome (C) with red arrow showing mitophagosomes (D, E) Quantification of autophagosome (D) and mitophagosomes (E) in HCT116 and HCT116 NCLX KO clones. (F, G) Western blots showing levels of LC3B and p62 in control DLD1 cells NCLX KO clones of DLD1 cells (F), and quantification of band intensity relative to loading control GAPDH (G). (H, I) Western blots probed with anti-LC3B and anti-p62 in HCT116 cells infected with control scrambled shRNA or three different NCLX shRNA conditions (H). Quantification of band intensity relative to HSC70 (I). (J–M) Measurement of OCR in DLD1 cells and DLD1 NCLX KO clone #06 (J, K) and from DLD1 NCLX KO clone #24, and clone #32 and (L, M). Quantification of Basal respiration (Basal Res), Spare respiratory capacity (Spare Res Cap), ATP generation (ATP Gen), and maximal respiration (Max Res) (K, M).(N, O) Western blots probed with a cocktail of antibody against electron transport chain complexes, including ATP5A for Complex-V, UQCRC2 for Complex-III, MTCO1 for Complex IV, SDHB for Complex-II, and NDUFB8 for Complex-I (N), and quantification of their band intensity (O). Same blot was probed with LC3B (Figure 4G) and OXPHOS proteins (Figure 4—figure supplement 2N). (P, Q) Representative images of mitoSox, and Hoechst fluorescence in siRNA control-transfected HCT116, HT29, and DLD1 cells with their respective siRNA NCLX-transfected cells (P). The mitoSox fluorescence intensity was quantified using flow cytometry (Q). All experiments were performed ≥three times. The statistics were calculated by paired t-test unless mentioned otherwise, *p≥0.05, **p≥0.01, ***p≥0.001.

Mitochondrial depolarization is a sign of mitochondrial damage and a major driver of mitophagy, by mediating Pink1 accumulation at the outer mitochondrial membrane (Jin et al., 2010). Examining mitochondrial structure using transmission electron microscopy (TEM) imaging revealed that 60–70% of mitochondria in NCLX KO CRC clones showed altered shape and disrupted cristae compared to control cells (Figure 4C and Figure 4—figure supplement 2A–C). We discovered that mitochondrial membranes and cristae of the NCLX KO clones of HCT116 and DLD1 cells were disrupted (Figure 4C, Figure 4—figure supplement 2A–C). Specifically, while overall mitochondrial area was not changed in NCLX KO clones (Figure 4D), we observed a greater number of mitochondria with disordered cristae (Figure 4E) and a decrease in the number of intact cristae per mitochondrion (Figure 4F). We also observed a significant increase in autophagic vesicles in NCLX KO cells compared to control HCT116 cells (Figure 4—figure supplement 2D). The number of mitophagic vesicles were slightly increased in NCLX KO cells compared to control HCT116 cells (e.g., see images in Figure 4—figure supplement 2C), although this increase was not statistically significant (Figure 4—figure supplement 2E). The autophagy/mitophagy vesicle marker LC3BII was significantly increased in all NCLX KO clones of HCT116 and DLD1 cells (Figure 4G,H, and Figure 4—figure supplement 2F,G). Interestingly, the levels of the p62 protein, a signaling molecule that is downstream of LC3BII that is degraded on induction of autophagy (Liu et al., 2016; Youle and Narendra, 2011), were also increased in all the NCLX KO clones of HCT116 and DLD1 cells (Figure 4G,I and Figure 4—figure supplement 2F,G). Similarly, the shRNA-mediated knockdown of NCLX in HCT116 (see Figure 3—figure supplement 1I for evidence of SLC8B1 mRNA knockdown using shRNA) resulted in increased LC3BII and p62 protein levels (Figure 4—figure supplement 2H,I).

To assess if these mitochondrial perturbations have consequences on mitochondrial electron transport chain function, we measured mitochondrial oxygen consumption rate (OCR) of NCLX KO HCT116 and DLD1 cells using Seahorse extracellular flux assays. We observed a significant reduction in maximal respiration and spare respiratory capacity in NCLX KO clones of both HCT116 and DLD1 cell (Figure 4J–M, and Figure 4—figure supplement 2J–M). Interestingly, basal respiration and ATP generation were significantly reduced in DLD1 NCLX KO clones, and remained mostly unaltered in HCT116 NCLX KO clones as compared to their respective controls (Figure 4—figure supplement 2J–M, and Figure 4J–M). We determined whether reduced OCR in NCLX KO clones was due to altered protein expression of the mitochondrial respiratory complexes I-V. To access the changes in mitochondrial respiratory complexes, we measured the protein levels of one component from each of the five complexes including NADH dehydrogenase [ubiquinone] 1 β subcomplex subunit 8 (NDUFB8, Complex-I), Succinate dehydrogenase [ubiquinone] iron-sulfur subunit (SDHB, Complex-II), Cytochrome b-c1 complex subunit 2 (UQCRC2, Complex-III), Cytochrome c oxidase subunit 1 (MTCO1, Complex IV), and ATP synthase subunit α (ATP5A, Complex-V). Interestingly, we did not observe any significant change in the expression of any of the above described components of the mitochondrial respiratory Complexes I–V between HCT116 cells and their NCLX KO clones (Figure 4—figure supplement 2N,O). These data suggest that lack of NCLX does not completely abrogate basal mitochondrial respiration, but negatively affects respiratory reserve, which is an indication of the cells ability to enhance mitochondrial respiration in response to higher energy demands.

A further consequence of mtCa2+ overload is the generation of mitochondrial reactive oxygen species (mtROS) (Bertero and Maack, 2018; Brookes et al., 2004). In normal cells, enhanced mtROS can lead to mitochondrial dysfunction and cell death; however, many tumor cells utilize mitochondria-derived ROS as cellular signals to drive pro-survival adaptations, including changes in downstream transcription (Vyas et al., 2016). Hence, we measured mtROS in HCT116 and DLD1 CRC cells and their respective NCLX KO clones using the dye MitoSOX and flow cytometry. MitoSOX dye intensity was significantly increased in all the NCLX KO clones of both HCT116 and DLD1 cells (Figure 4N,O), indicating increased mtROS in these cells. Using fluorescence microscopy, we also show that downregulation of NCLX with siRNA in HCT116 and DLD1 cells (and in another CRC cell line, HT29; See Figure 4—figure supplement 1M for evidence of SLC8B1 mRNA knockdown in HT29) results in a significant increase in mtROS levels (Figure 4—figure supplement 2P,Q). The above data demonstrate that loss of NCLX decreases mtCa2+ extrusion, which affects mitochondrial cristae morphology and depolarization of the mitochondrial membrane, leading to formation of autophagic vesicles and possibly mitophagy, decreased respiratory reserve capacity, and enhanced mtROS production.

Loss of NCLX leads to pro-metastatic transcriptional reprogramming

To further delineate the role of NCLX loss in CRC, we performed transcriptional profiling of HCT116 cells and their NCLX KO counterparts using RNA sequencing. Gene Set Enrichment Analysis (GSEA) revealed that NCLX knockout drives the positive enrichment of pathways involved in hypoxia, epithelial-to-mesenchymal transition (EMT), TGF-β, pro-inflammatory, glycolysis, apoptosis and angiogenesis pathways, while negatively influencing gene expression of Myc targets, cell-cycle regulation, and oxidative phosphorylation (Figure 5A–G, and Figure 5—figure supplement 1A–F). Thus, GSEA analysis revealed that NCLX loss drives gene expression signatures associated with metastatic progression and inhibition of proliferation, mirroring the phenotypic changes we observed following NCLX knockout and knockdown. Interestingly, these gene expression signatures are shared by the mesenchymal CMS4 CRC subtype, which is characterized by high rates of recurrence, and predictive of poor patient outcome (Guinney et al., 2015).

Figure 5. Loss of NCLX leads to pro-metastatic transcriptional reprogramming.

(A) Volcano plot of differentially expressed genes between HCT116 cells and HCT116 NCLX KO #33 cells showing Log2 fold change vs. false discovery rate. The thresholds in the figure correspond to a false discovery rate <0.05 and log2 fold change <−1.5 or>1.5. Genes that are significantly upregulated and downregulated are represented in pink and light blue, respectively. (B) Pathway analysis showing normalized enrichment score. Positive enrichment score shows upregulated pathways, and negative enrichment score depicts downregulated pathways. (C–F) GSEA analysis of HCT116 cells and HCT116 NCLX KO #33 cells show a positive correlation in the enrichment of hallmark of glycolysis genes (C), a negative correlation of hallmark of G2M checkpoint genes (D), a positive correlation of hallmark of hypoxia-related genes (E), and hallmarks of epithelial-to-mesenchymal transition genes (F). (G) The heat map shows significantly increased expression of EMT genes in HCT116 NCLX KO #33 cells as compared to control HCT116 cells. (H–J) RT-qPCR showing mRNA levels NANOG (H), octamer-binding transcription factor 4 (Oct4) (I), and SRY-Box Transcription Factor 2 (Sox2) (J) in HCT116 cells and clones of HCT116 NCLX KO cells. (K) The proliferation of HCT116 cells and HCT116 NCLX KO #33 cells with and without 10 µM 5-FU treatment. All experiments were performed ≥three times with similar results. Statistical significance was calculated using a paired t-test except for K, where one-way ANOVA followed by a post-hock Tukey test was used. *p<0.05, **p<0.01, and ***p<0.001.

Figure 5—source data 1. Source data Figure 5.

Figure 5.

Figure 5—figure supplement 1. Abrogation of NCLX function leads to transcriptional reprogramming.

Figure 5—figure supplement 1.

(A) Heat map of expression of glycolytic genes that are significantly different between HCT116 cells and HCT116 NCLX KO #33 cells. (B, C) Gene set enrichment analysis (GSEA), and of HCT116 cells, and HCT116 NCLX KO #33 shows enrichment of positive correlation of hallmark of apoptotic genes (B) and heat map of differentially expressed apoptosis-related genes in NCLX KO #33 cells (C). (D) Heat map of differentially regulated cell-cycle genes in HCT116 cells and HCT116 NCLX KO #33 cells. (E, F) Gene set enrichment analysis (GSEA) (E) and heat map (F) of significantly different genes between HCT116 cells and HCT116 NCLX KO #33 cells. (G–N) RT-qPCR data plotted as the 2-ΔCt mRNA value of SLC7A11 (G), GCLM (H) in clones of HCT116 NCLX KO cells normalized to control HCT116 cells, and SLC7A11 (I), GCLM (J) NANOG (K), Sox2 (L), Foxo3 (M), and Oct4 (N) in clones of DLD1 NCLX KO cells relative to tubulin and normalized to control DLD1 cells. (O) Schematic representation of HIF1α induced transcriptional activation of SLC7A11 and GCLM, leading to increased transcription of stem cell genes NANOG, Oct4, and Sox2 in CRC cells. Statistical significance was calculated by one-way ANOVA followed by a post-hock Tukey. *p<0.05, **p<0.01, and ***p<0.001.
Figure 5—figure supplement 1—source data 1. Source Data Figure 5—figure supplement 1.

NCLX deficiency causes stem cell-like phenotype and chemoresistance of CRC cells

A phenotype of mesenchymal CRC is the enrichment of cancer stem cell traits (Guinney et al., 2015; Polyak and Weinberg, 2009). In agreement with these findings, we found that transcript levels of stem cell markers NANOG, Oct4, Sox2, and Foxo3, as well as regulators of the glutathione synthesis pathway implicated in regulating these transcription factors in breast cancer, SLC7A11 and GCLM (Lu et al., 2015), were significantly upregulated in NCLX KO cells (Figure 5H–J, Figure 5—figure supplement 1G–O). One exception was the mRNA levels of Oct4 in DLD1 NCLX KO clones, which were not significantly different from those of control DLD1 cells (Figure 5—figure supplement 1N). These data suggest that NCLX KO clones acquire stem cell-like properties.

In most cancer types, a stem cell-like phenotype is associated with enhanced invasion and chemoresistance (Blank et al., 2018; Munro et al., 2018; Reya et al., 2001; Touil et al., 2014). The chemoresistance properties of the NCLX KO clones and respective control HCT116 and DLD1 cells were tested in response to treatment with the antimetabolite agent 5-Fluorouracil (5-FU), which is widely used in the treatment of CRC. First, we performed titration experiments with doses of 5-FU ranging from 1 to 25 µM. The control HCT116 cells and the HCT116 NCLX KO cells showed a dose-dependent reduction in proliferation in response to 5-FU treatment (Figure 6—figure supplement 1A). The IC50 of 5-FU for HCT116 NCLX KO cells (15 ± 1.2 µM) was significantly higher than the control HCT116 cells (8.2 ± 1.2 µM) (Figure 6—figure supplement 1B). Therefore, subsequent experiments were performed with 10 µM 5-FU. The treatment with 10 µM 5-FU caused a significant reduction in proliferation of control HCT116 and DLD1 cells at 24 and 72 hr (Figure 5K, Figure 6—figure supplement 1C). Treatment of the NCLX KO clones of HCT116 (Figure 5K) and DLD1 (Figure 6—figure supplement 1C) cells with 10 µM 5-FU yielded only a marginal reduction in proliferation at 72 hr as compared to non-treated NCLX KO clones, although this reduction was statistically significant for two NCLX KO clones of DLD1 cells at 72 hr time point (Clone#24 and #32; Figure 6—figure supplement 1C). 5-FU also caused a significant inhibition in migration of control HCT116 cells (Figure 6—figure supplement 1D,E), but did not affect the migratory capabilities of the NCLX KO clones of both HCT116 and DLD1 cells (Figure 6—figure supplement 1D,E).

NCLX deficiency stabilizes HIF1α and regulates migration in a mtROS-dependent manner

The mesenchymal, invasive, and chemoresistance phenotypes of NCLX KO cells, as well the majority of enriched pathways identified by GSEA, including hypoxia, EMT, glycolysis, angiogenesis, and the suppression of OXPHOS, share a common regulator, the hypoxia-inducible factor HIF1α (Figure 5A–G and Figure 5—figure supplement 1A-F). This was intriguing in light of our observations that NCLX knockdown decreases respiration and increases mitochondrial ROS production in CRC (Figure 4J–O), as mtROS is a known activator of HIF1α (Bell et al., 2007; Dan Dunn et al., 2015; Hamanaka and Chandel, 2010; Pan et al., 2007). Hence, we measured HIF1α protein levels and found that HIF1α protein levels were strikingly increased in the NCLX KO clones of both HCT116 and DLD1 cells in the absence of a hypoxic stimulus (Figure 6A–D). Similarly, HIF1α protein levels were also increased in HCT116 cells in which NCLX was knocked down with shRNA (NCLX KD; Figure 6E,F). Importantly, we were able to demonstrate that HIF1α protein stabilization was significantly abrogated in NCLX KO cells when mtROS were scavenged using the mitochondria-targeted antioxidant mitoTEMPO (Figure 6G,H). Both AMPK and mTORC1 are known regulators of HIF1α (Dodd et al., 2015; Hudson et al., 2002; Tandon et al., 2011). Therefore, we assessed the phosphorylation levels of AMPK and the ribosomal protein S6K (a readout of mTORC1 activation) in HCT116 and clones of HCT116 NCLX KO cells. Assessment of AMPK and S6K1 phosphorylation revealed no difference between control HCT116 and clones of HCT116 NCLX KO cells (Figure 6—figure supplement 1F–I), suggesting that mTORC1 does not contribute to the regulation of HIF1α in response to NCLX ablation. Taken together, these results suggest that the major regulator of HIF1α protein levels in NCLX KO CRC cells is mtROS. Further, a significant reduction in migration was observed when HCT116 NCLX KO cells were treated with mitoTEMPO (Figure 6I,J), while this had no effect on the proliferation of either control HCT116 cells or their NCLX KO counterparts (Figure 6K).

Figure 6. NCLX deficiency stabilizes HIF1α and regulates migration in a mtROS-dependent manner.

(A–F) Western blot of HCT116 cells and clones of HCT116 NCLX KO cells (A), DLD1 cells and clones of DLD1 NCLX KO cells (C) and HCT116 cells infected with either scramble shRNA or three combinations of shRNA against NCLX (E) probed with anti-HIF1α, anti-GAPDH and anti-HSC70 antibody as a loading control, and quantification of HIF1α band intensity relative to HSC70 or GAPDH (B, D, and F). (G, H) Western blot showing HIF1α proteins in HCT116 cells and clones of HCT116 NCLX KO cells after treatment with 5 µM mitoTEMPO overnight (G), and quantification of HIF1α band intensity normalized to GAPDH (H). (I, J) Representative bright-field images of in vitro migration assay (I), and quantification of % gap closure (J) of HCT116 cells and clones of HCT116 NCLX KO cells, with and without treatment with 5 µM mitoTEMPO. Scale bar, 1 mm. (K) Proliferation of HCT116 cells and HCT116 NCLX KO #33 cells with and without 5 µM mitoTEMPO. All experiments were performed ≥three times with similar results. Statistical significance was calculated using the paired t-test unless mentioned otherwise. *p<0.05, **p<0.01, and ***p<0.001.

Figure 6—source data 1. Source data Figure 6.

Figure 6.

Figure 6—figure supplement 1. NCLX KO CRC cells show chemoresistance to 5-FU.

Figure 6—figure supplement 1.

(A) The proliferation of HCT116 cells and HCT116 NCLX KO #33 cells in the presence of 0 µM, 1 µM, 10 µM, and 25 µM 5-FU (n = 3). (B) Measurement of IC50 of 5-FU for HCT116 and HCT116 NCLX KO #33 cells after treating the cells with 0 µM, 1 µM, 10 µM, and 25 µM 5-FU for 72 hr. (C) The proliferation of DLD1 cells and clones of DLD1 NCLX KO cells in the absence and presence of 10 µM 5-FU. (D, E) Quantification of migration of HCT116, clones of HCT116 NCLX KO cells (L), and DLD1 cells and clones of DLD1 NCLX KO cells (M) in the presence and absence of 10 µM 5-FU. (F–I) Immunoblot for phospho-AMPK, total AMPK (F), phosphor-S6K, total S6K (H) and loading control GAPDH protein levels, and quantification of band intensity normalized to GAPDH from HCT116 cells and HCT116 NCLX KO #33, #37, and #59 clones (G, I). All the experiments were replicated ≥three times with similar results. Statistical significance was calculated using the paired t-test, except for C, D, and E, where one-way ANOVA followed by a post-hock Tukey test was performed. *p<0.05, **p<0.01, and ***p<0.001.
Figure 6—figure supplement 1—source data 1. Source Data Figure 6—figure supplement 1.

Glycolysis is critical for migration of NCLX-deficient colorectal cancer cells

HIF1α is an important regulator of glycolysis. The transcriptomic analysis (Figure 5A and Figure 5—figure supplement 1A), GSEA pathway, and enrichment analysis (Figure 5B,C) showed that glycolysis-related genes were upregulated in HCT116 NCLX KO cells. RT-qPCR results confirmed that the glycolysis-related genes GLUT1 (glucose transporter one or SLC2A1), HK2 (hexokinase 2), ALDOA (aldolase A), ENO1 (enolase 1), and LDHA (lactate dehydrogenase A) were distinctly upregulated in all the NCLX KO HCT116 clones (Figure 7A). Loss of NCLX in either HCT116 or DLD1 increased the protein levels of HK2, ALDOA, and LDHA (Figure 7B,C, and Figure 7—figure supplement 1A–D). We also validated this further using shRNA-mediated knockdown of NCLX (NCLX KD) in HCT116 cells. SLC8B1 mRNA levels were reduced by 60–70% in NCLX KD cells compared to cells transfected with shRNA scramble control (Figure 3—figure supplement 1I). Similar to NCLX KO, the HCT116 NCLX KD cells showed a modest but significant increase of HK2, ALDOA, and LDHA protein levels (Figure 7—figure supplement 1E,F). Interestingly, we observed a significant downregulation of the pentose phosphate pathway genes in HCT116 NCLX KO cells, including decreased mRNA expression of the enzymes glucose 6-phosphate dehydrogenase (G6PD), 6-phosphogluconate dehydrogenase (PGD) and Transketolase (TKT) (Figure 7—figure supplement 1G).

Figure 7. Glycolysis is critical for migration of NCLX-deficient colorectal cancer cells.

(A) RT-qPCR analysis of glycolytic gene expression in HCT116 cells and three clones of HCT116 NCLX KO cells. RT-qPCR results are plotted as 2-ΔCt relative to tubulin and normalized to control. (B, C) Representative western blots probed with anti-ALDOA, anti-HK2, and anti-LDHA antibodies in HCT116 cells and HCT116 NCLX KO #33 cells. Anti-HSC70 antibody is used as a loading control (B) and quantification of band intensity relative to that of HSC70 (C). (D, E) Extracellular acidification rate (ECAR) of HCT116 cells (D) and DLD1 cells (E) and their respective NCLX KO clones were measured with Seahorse using the glycolysis stress test, as described in methods. (F) The percentage of metabolite dependency of HCT116 cells and HCT116 NCLX KO #33 cells measured using the Mitochondrial Fuel Flexibility, Dependency, and Capacity test, as described in methods. (G–J) Measurement of glucose consumption and lactate generation in HCT116, clones of HCT116 NCLX KO (G, H), DLD1, and clones of DLD1 NCLX KO (I, J) cells normalized to the amount of protein. (K) Proliferation of HCT116 cells and clones of HCT116 NCLX KO cells in the presence and absence of 2.5 mM 2-DG. (L, M) In vitro migration (L), and quantification (M) of HCT116 cells and clones of HCT116 NCLX KO cells in the presence and absence of 2.5 mM 2-DG for 24 hr (scale bar, 1 mm). (N) Summary of the findings from the present study. All experiments were performed ≥three times with similar results. Statistical significance was calculated using paired t-test, except for K, M, where one-way ANOVA followed by a post-hock Tukey test was used. *p<0.05, **p<0.01, and ***p<0.001.

Figure 7—source data 1. Source data Figure 7.

Figure 7.

Figure 7—figure supplement 1. Loss of NCLX enhances glycolysis and diminishes mitochondrial respiration.

Figure 7—figure supplement 1.

(A–D) Western blots for HK2, ALDOA, LDHA, with GAPDH as a loading control from HCT116, HCT116 NCLX KO #37, #59 (A), DLD1, clones of DLD1 NCLX KO cells (C), and quantification of band intensity normalized to GAPDH (B, D). (E, F) Western blots probed with anti-HK2, anti-ALDOA, anti-LDHA, and anti-HSC70 loading control (E), and quantification of band intensity (F) from HCT116 cells transfected with scramble and two different constructs of shNCLX. (G) RT-qPCR data plotted as 2-ΔCt mRNA values relative to tubulin and normalized to control, for Glucose-6-phosphate dehydrogenase (G6PD), Phosphogluconate dehydrogenase (PGD), and Transketolase (TKT) in HCT116 cells and HCT116 NCLX KO #33 cells. (H) Extracellular acidification rate (ECAR) measurement from DLD1 cells and clones of DLD1 NCLX KO cells. (I) The proliferation of DLD1 cells and clones of DLD1 NCLX KO cells in the presence and absence of 2.5 mM 2-DG. (J) Quantification of in vitro migration of DLD1 cells and clones of DLD1 NCLX KO cells in the presence and absence of 2.5 mM 2-DG for 24 hr. All experiments were performed ≥three times. The statistics were calculated by one-way ANOVA followed by post-hock Tukey's test except for B, D, and F where paired t-test was performed, *p≥0.05, **p≥0.01, ***p≥0.001.
Figure 7—figure supplement 1—source data 1. Source Data Figure 7—figure supplement 1.

Since inhibition of NCLX function caused upregulation of glycolytic genes, we used Seahorse extracellular flux analysis to determine whether NCLX knockout affects the extracellular acidification rate (ECAR) of HCT116 and DLD1 cells. Consistent with the upregulation of glycolytic genes, ECAR, and glucose dependency were increased in all NCLX KO clones (Figure 7D–F and Figure 7—figure supplement 1H). Furthermore, direct measurements of glucose and lactate in growth media using the YSI system also revealed that the glucose consumption and lactate production were markedly increased in NCLX KO clones of both HCT116 and DLD1 cells (Figure 7G–J). These data suggest that NCLX KO cells compensate for their decreased respiratory reserve capacity (Figure 4J–M, and Figure 4—figure supplement 2J–M) by enhancing glycolytic pathways to meet their energy demands.

Considering these findings, the glycolytic inhibitor 2-deoxy-D-glucose (2-DG) was used to test if CRC cells that lack NCLX expression are more vulnerable to glycolysis inhibition. While 2-DG caused a significant reduction in proliferation of both DLD1 control and NCLX KO cells (Figure 7—figure supplement 1I), it did not affect the proliferation of NCLX KO clones of HCT116 (Figure 7K). However, the enhanced migration of NCLX KO clones was abrogated when glycolysis was inhibited using 2-DG (Figure 7L–M; Figure 7—figure supplement 1J), suggesting that increased glycolysis is supporting migration of NCLX KO clones and that targeting this metabolic adaptation may be an avenue to block metastatic progression of CRC cells with low NCLX expression.

Discussion

In addition to the critical role mitochondria play in cellular bioenergetics, lipid metabolism, and cell death, recent attention has focused on their direct and indirect contributions to mediating crucial signal transduction pathways that control the shift in cellular metabolic activity and changes in gene transcription (Tennant et al., 2009; Tennant et al., 2010). Mitochondria are generators and active participants in Ca2+ and ROS signaling (Hempel and Trebak, 2017; Vyas et al., 2016). Growing evidence has shown a critical role of mtCa2+ homeostasis in mitochondrial function and cell survival (Celsi et al., 2009; Santulli et al., 2015) and reported a strong correlation between altered mitochondrial function and disease including cancer progression (Porporato et al., 2018). Mitochondria are major mediators of the shift in metabolic activity of cancer cells. This metabolic shift is a mechanism of adaptation to stressors within the tumor microenvironment that is required for cancer cell survival (Vyas et al., 2016). Nevertheless, the mechanisms of mtCa2+ in driving mitochondrial signaling and metabolic shifts have largely remained unknown.

Previous studies on the mitochondrial Ca2+ uniporter (MCU) complex indicated that the level of mtCa2+ is an important determinant in the progression of different cancer types (Marchi et al., 2019a; Marchi et al., 2013; Marchi et al., 2019b; Tosatto et al., 2016). The downregulation of MCU and subsequent reduction of mtCa2+ uptake correlated with resistance to apoptosis of colorectal cancer cell lines (Marchi et al., 2013). Conversely, in triple-negative breast cancer cell lines, the downregulation of MCU caused a reduction in mtROS, HIF1α levels, cell migration, invasion and inhibited metastasis to the lung in xenograft experiments (Tosatto et al., 2016), suggesting that although mtCa2+ overload is pro-apoptotic, it is likely beneficial for invasion and metastasis of cancer cell clones that have evaded apoptosis. Similarly, our TCGA data analysis of colorectal cancer patients showed that SLC8B1 mRNA levels are significantly reduced in both early and late-stage tumors with a more pronounced reduction in late-stage tumors, suggesting that mtCa2+ overload through reduced NCLX function has a critical role in CRC progression. Nevertheless, we cannot rule out possible contributions of cytosolic Ca2+ to the phenotype of NCLX KO cells. Furthermore, future studies investigating the role of MCU in CRC progression are required to support the notion that mtCa2+per se is the critical driver of CRC progression.

It is well established that mtCa2+ overload is detrimental to mitochondrial function and is a precursor of death in normal cells through the opening of the mitochondrial permeability transition pore, cytochrome C release from mitochondria and subsequent activation of the caspase family of pro-apoptotic proteases (Giorgi et al., 2012; Pinton et al., 2008). However, the exact mechanisms by which cancer cells adapt and survive under these conditions are not fully understood. Our data show that downregulation or complete loss of NCLX in CRC cells causes mtCa2+ overload, an increase in mtROS production and mitochondria depolarization. Our transmission electron microscopy data show that loss of NCLX in CRC cells causes altered mitochondria shape and morphology with disrupted cristae and inner mitochondrial membrane structures. We also show that this coincides with increased LC3BII- and p62-dependent autophagosome formation and decreased cell-cycle-related gene expression. This phenotype is consistent with the reduced proliferation of NCLX KO and NCLX KD CRC cells, and the reduced tumor burden and tumor size in NCLX KO mice subjected to the colitis-associated CRC model. Similarly, our xenograft model yielded smaller primary tumors when HCT116 NCLX KO cells were injected in SCID mice by comparison to xenografts of control HCT116 cells. Thus, the reduction in NCLX expression likely limits proliferation and primary tumor growth. Yet, it is also apparent that clones of cancer cells survive this loss of NCLX and coopt the downregulation of NCLX to undergo metabolic reprogramming and gene expression changes that support tumor migration, invasion and metastasis, by initiating a mitochondrial Ca2+/ROS signaling axis to drive HIF1α activation. Increased p62 is a marker for autophagosome formation but upon autophagy the levels of p62 decrease (Liu et al., 2016). Interestingly, our NCLX KO cells have maintained an increase in p62 levels, suggesting possible accumulation of autophagosomes. Future studies are required to determine whether increased autophagosome formation is accompanied by increased mitophagy or whether accumulation of autophagosomes in NCLX KO cells causes cytotoxicity and apoptosis (Button et al., 2017). We have shown that cleaved caspase three staining was increased in HCT116 NCLX KO cells, suggesting enhanced apoptosis in NCLX KO cells. However, additional experiments including more direct approaches are required to determine the effect of NCLX deletion on apoptosis of CRC cells. Herein, we have considered studying the effects of NCLX overexpression on metastasis of CRC to complement out NCLX knockout and knockdown studies. However, these studies are not feasible because overexpressed NCLX localizes not only to mitochondria but also to other organelles, making the interpretation of results from these experiments tenuous.

While it is generally thought that mtCa2+ induces mtROS production through increased activation of TCA cycle proteins and consequential increases in ETC function, it is also evident that defective electron transport chain function results in mtROS production (Starkov, 2008). Our data clearly demonstrate that increased mtROS production is accompanied by mitochondrial structural perturbations, decreased OXPHOS, and mitochondrial membrane depolarization. These phenotypes of mitochondrial dysfunction are commonly associated with apoptosis initiation. However, NCLX knockout resulted in the selection of clones that initiate pro-survival and pro-metastatic adaptations. Mitochondrial depolarization and mtROS production are known initiators of mitophagy (Ashrafi and Schwarz, 2013; Fan et al., 2019; Frank et al., 2012; Schofield and Schafer, 2020; Twig and Shirihai, 2011). Moreover, HIF1α, which is regulated in a mtCa2+/mtROS-dependent manner in response to NCLX loss in CRC, also contributes to mitophagy, by upregulating the pro-mitophagy proteins BNIP3 and NIX (Bellot et al., 2009; Chourasia et al., 2015; Zhang et al., 2008; Zhang and Ney, 2009).

The gene expression signatures and phenotypes observed in response to NCLX downregulation largely mirror those of the mesenchymal CRC subtype labeled as CMS4. Shared pathways include the increase in EMT, TGF- β, matrix remodeling, stemness, and decreases in Myc and cell-cycle progression (Guinney et al., 2015). No single mutation is solely associated with one of the CMS or CRIS subtypes, and at present, the underlying drivers of colorectal cancer molecular subtypes still remain to be fully elucidated (Guinney et al., 2015). However, it is interesting to note that ~ 50% of CMS4 tumors display TP53 mutations and generally lack mutations in BRAF, and that loss of NCLX is statistically linked to TP53 mutant tumors and wild type BRAF CRC tumors. We used two different CRC cell lines HCT116 and DLD1; both of these cell lines are derived from male CRC patients carrying a mutation in KRAS and PIK3CA. TCGA data analysis showed no difference in NCLX expression between CRC patients bearing the wildtype KRAS and PIK3CA and their respective mutations. Interestingly, we also saw lower basal NCLX expression in DLD1 cells that have mutated TP53 (S241F), compared to HCT116 cells, which are wildtype for TP53. Whether increased mtCa2+ and subsequent mtROS signaling is one of the underlying drivers of CMS4 tumors remains to be determined.

A metabolic shift towards aerobic glycolysis is a hallmark of cancer progression (Burns and Manda, 2017; Liberti and Locasale, 2016). Our data demonstrated that the loss of NCLX leads to reduced oxygen consumption, increased glycolysis, and increased transcription of major glycolytic enzymes. This increased transcription of glycolytic enzymes is commonly controlled by HIF1α, which is upregulated in response to increased mtROS resulting from loss of NCLX and subsequent increase in mtCa2+. Furthermore, we show that inhibiting glycolysis of NCLX KO CRC cells partially normalizes the increased migration of these cells, consistent with previous findings that showed a critical role of glycolysis in cancer metastasis (Bu et al., 2018; Gillies et al., 2008; Han et al., 2013). Although the increase in HIF1α protein levels was shown to be critical for the migration and metastasis of cancer cells (Lehmann et al., 2017; Masoud and Li, 2015; Semenza, 2003; Wigerup et al., 2016), the mechanisms by which mtCa2+ regulates HIF1α protein levels are not clear. Here, we provide evidence that reduced NCLX function, causing reduced mtCa2+ extrusion and resulting in mtCa2+ overload, enhances HIF1α levels through an increase in mtROS. Our xenograft model shows that despite the reduced tumor burden and tumor size in SCID mice injected with HCT116 NCLX KO cells compared to SCID mice injected with control HCT116 cells, the survival of the former mice was significantly reduced compared to the latter. This result can be explained by the enhanced metastasis to the liver and colon in SCID mice injected with HCT116 NCLX KO cells. Indeed, we were able to show that the increased invasive properties of NCLX KO CRC cells were associated with increased MMP1, MMP2, and MMP9 activities, which are known to be regulated by HIF1α (Ben-Yosef et al., 2002; Choudhry and Harris, 2018; Muñoz-Nájar et al., 2006; Shin et al., 2015; Tsai et al., 2016). We showed that NCLX KO CRC cells are chemoresistant to treatment by 5-FU, with both proliferation and migration of NCLX KO CRC cells not significantly altered by 5-FU treatment. It is reasonable to suspect that the decrease in proliferation contributes to the chemoresistance phenotype of cells lacking NCLX. In previous work, we demonstrated that decreased mtCa2+ extrusion in HEK293 cells leads to a decrease in cytosolic Ca2+ and reduced store-operated Ca2+ entry (SOCE) mediated by ORAI1 channels (Ben-Kasus Nissim et al., 2017). Similarly, we see a decrease in cytosolic Ca2+ and SOCE when NCLX is knocked out in CRC cell lines. A consequence of reducing SOCE and cytosolic Ca2+ is decreased activation of the Ca2+ sensitive transcription factor NFAT (Trebak and Kinet, 2019). NFAT is a known stimulator of MYC activation (Buchholz et al., 2006; Mognol et al., 2012; Singh et al., 2010), suggesting that reduced NFAT signaling as a consequence of NCLX downregulation might be contributing to the decrease in MYC pathway activation, cell-cycle progression, and proliferation.

The EMT phenotype and decreases in proliferation are hallmarks of cancer stem cells and the presence of cancer stem cells within tumors is one of the major causes of chemotherapy resistance (Izumiya et al., 2012; Munro et al., 2018; Ohata et al., 2019; Zhao, 2016). Studies have shown that CSCs are enriched on treatment with 5-FU through different molecular mechanisms (Abdullah and Chow, 2013; Lu et al., 2015; Touil et al., 2014). Recent work showed that increased chemoresistance of breast cancer was mediated by HIF1α-mediated glutathione biosynthesis and glutathione-mediated enrichment with cancer stem cells (Lu et al., 2015). Chemotherapy in breast cancer induces HIF1α-dependent glutathione biosynthesis by enhancing the expression of the cystine transporter xCT (SLC7A11) and the regulatory subunit of glutamate-cysteine ligase (GCLM) (Lu et al., 2015). The glutathione thus generated inhibits the MEK/ERK pathway through copper chelation resulting in enhanced expression of the stem cell markers NANOG, Oct4 and Sox2. We observed enhanced expression of SLC7A11 and GCLM in NCLX KO clones from both HCT116 and DLD1 cells. In addition to contributing to stem cell regulation, an increase in enzymes responsible for glutathione synthesis potentially provides additional survival advantages to NCLX knockout cells, by enhancing the ROS scavenging ability of CRC cells and preventing any lethal build-up of ROS as a consequence of mtCa2+ elevation. Throughout this study, HIF1α emerged as major regulator of metastasis, chemoresistance and stemness in NCLX KO CRC cells. HIF1α might represent a novel marker or target of anti-CRC drugs. One could speculate that the concomitant inhibition of HIF1α and chemotherapy might be more effective against CRC cancer.

In summary, we have identified a novel mitochondrial Ca2+/ROS signaling axis in colorectal cancer that is initiated in response to decreased NCLX expression, as commonly observed in CRC patient tumors. In one hand, reduced mtCa2+ extrusion causes mitochondrial depolarization, mitochondrial dysfunction, reduced cell-cycle-related gene expression, increased autophagosome formation, and reduced proliferation, leading to smaller tumors both in the colitis-associated CRC model and the xenograft CRC model. On the other hand, mtCa2+ overload induced by NCLX loss enhances mtROS, which in turn enhances CRC metastasis through HIF1α-dependent increases in glycolysis, chemoresistance and pro-metastatic gene expression signatures. This contributes to increased metastatic burden and enhanced lethality of SCID mice injected with NCLX KO CRC cells (summarized in Figure 7N). These changes are reminiscent of the highly metastatic mesenchymal CMS4 CRC subtype, and our work suggests that restoring mtCa2+ homeostasis in CRC tumors might be beneficial in limiting or preventing CRC progression and metastasis.

Materials and methods

Reagents and resources

See article appendix for key resources table.

Human tissue

The Pennsylvania State University College of Medicine institutional review board approved this study (IRB Protocol number HY98-057EP-A). Prior to surgery, patients are consented to have resected tissues collected and banked into the Penn State Hershey Colorectal Disease Biobank. As outlined in the consent form and IRB Protocol, de-identified tissues are made available to study on a per-request basis after such requests are considered by an internal review panel and deemed to be collaborative in nature. The CRD biobank has been in operation since 1998 and substantial efforts are in place to protect patient information including storage of data behind firewalls and limited access to electronic medical records. Methods regarding tissue procurement, mRNA isolation and processing were previously described (Schieffer et al., 2017).

Mice

A breeding pair of global NCLX KO and wildtype C57BL/6 mice were obtained from the Jackson laboratory. NOD/SCID (NOD.CB17-Prkdcscid/J) were also obtained from the Jackson laboratory. All mice were maintained in 12:12 hr light-dark cycle (22°C to 25°C) in a pathogen-free barrier facility at The Pennsylvania State University animal facility. The mice were sacrificed (age at the time of sacrifice is mentioned in the figure legends) at the end of the experiment, and organs were collected for histopathology, protein, and mRNA analysis. All experiments with mice were approved and conducted in accordance with The Pennsylvania State Institutional Animal Care and Research Advisory Committee.

Cell culture and drug treatment

To investigate the role of NCLX in human CRC cells, we chose two widely used CRC cell lines HCT116 and DLD1 derived from the colon of male CRC patients with colorectal carcinoma and colorectal adenocarcinoma, respectively (Ahmed et al., 2013). HCT116 and HT29 cells were cultured in McCoy’s 5A media supplemented with 10% FBS and 1X antibiotic-antimycotic agents. DLD1 cells were cultured in RPMI-1640 media supplemented with 10% FBS and 1X antibiotic-antimycotic agents. All cells were kept at 37°C in a 5% CO2 incubator. The cells were transfected with siRNA or plasmids using the Lipofectamine 2000 reagent, according to manufacturer protocol (Invitrogen). In experiments with 2-DG and 5-FU, cells were cultured in complete growth media McCoy’s or RPMI media with 10% FBS and 1X antibiotic-antimycotic agents and treated with different concentrations of 2-DG or 5-FU for the specified time. Our cell lines were purchased from ATCC immediately before use and the identities of the cell lines were further confirmed by RNA sequencing. Further, we routinely perform mycoplasma tests on all our cell lines, including the cell lines used herein. These mycoplasma tests were negative.

Plasmids, siRNAs, shRNAs, CRISPR/Cas9, and lentiviral infection

The cells were seeded at 80–90% confluency at the time of transfection. The plasmids or siRNAs and Lipofectamine 2000 were diluted in Opti-MEM and mixed. The mixture was incubated for 5–10 min at room temperature and then added to the cells cultured in media with 10% serum without antibiotic-antimycotic agents. The medium of transfected cells was changed to normal media with 10% FBS and 1X antibiotic-antimycotic agents after 4–6 hr. The expression of plasmid and siRNA was confirmed after 24 hr and 72 hr of transfection, respectively. To generate stable NCLX knockdown cells, shScramble, shNCLX #2, and shNCLX #3 cloned in pLKO. The lentiviral construct was packaged into HEK293FT using the ViraPower kit (Invitrogen) and Lipofectamine 2000 (Thermofisher Scientific). HCT116 cells were infected with respective lentivirus for 72 hr and selected with puromycin (1.5 μg/ml) for 72 hr. The knockdown of mRNA was confirmed through RT-qPCR. Stable knockdown cells were used within two weeks, then discarded. We generated several clones of NCLX knockout (NCLX KO) in both HCT116 and DLD1 cells using the CRISPR/Cas9 system. To alleviate potential off-target effects of the CRISPR/Cas9 system, we generated several independent clones obtained with three independent guide RNAs (gRNAs; see methods) (Figure 3—figure supplement 1A–H). Genome sequencing and PCR on genomic DNA confirmed NCLX KO. For the case of HCT116 cells, which we generated first, NCLX KO #33 was generated using a guide RNA (g2) which resulted in a single cut at nucleotide 150 in exon one causing a frameshift mutation and introduction of a stop codon at predicted position 181-183 bp and 184-186 bp in the NCLX open reading frame (Figure 3—figure supplement 1A). NCLX KO #37 and #59 were generated using two guide RNAs (g1 and g2), which resulted in a double-strand cut and introduction of a stop codon in the NCLX open reading frame (Figure 3—figure supplement 1B,C; method table). For the NCLX KO clones of DLD1 generated later, we employed an advanced strategy with each knockout condition using simultaneously two guide RNAs flanking a region starting from exon three to the end of the SLC8B1 gene (Figure 3—figure supplement 1E) to completely excise most of NCLX open reading frame. PCR on genomic DNA (Figure 3—figure supplement 1G) confirmed NCLX knockout in DLD1 clones. We used RT-qPCR to document the absence of mRNA in NCLX KO clones of HCT116 (Figure 3—figure supplement 1D) and DLD1 cells (Figure 3—figure supplement 1H). The positions of the primers used for qPCR are shown in Figure 3—figure supplement 1A and Figure 3—figure supplement 1E for HCT116 and DLD1 cells, respectively, and labeled as ‘qNCLX’.

Transcriptome sequencing (RNA-seq) and analysis

The mRNA was isolated (minimum 3 µg) using the RNeasy Mini Kit. A fragmentation buffer (Ambion) was used to short fragment the mRNA. These short-fragmented mRNA were used as a template to synthesize double-stranded cDNA. The cDNA was end-repaired and ligated to Illumina adapters. Further, to generate the library, these cDNAs were size selected (~250 bp) on an agarose gel, and PCR amplified. To sequence the cDNA, the prepared cDNA library was fed to the Illumina HiSeq 2500 sequencing platform (Berry Genomics). The expression level of each transcript of a gene was quantified using read counts with HTseq. After removing gene identifiers with zero read counts in each sample, the biomaRt R package (Durinck et al., 2009) was used to convert Ensemble gene identifiers to gene symbols using the January 2019 archive (http://jan2019.archive.ensembl.org). Identifiers corresponding to multiple gene symbols were removed. The edgeR R package (McCarthy et al., 2012; Robinson et al., 2010) was used to identify lowly expressed genes based on thresholds defined using counts per million reads mapped. This yielded expression data for a total of 10,179 genes.

Exploratory analyses were performed after utilizing the variance stabilizing transformation (VST) function in the DESeq2 R package (Love et al., 2014) to apply VST to the read count data. The results strongly suggested the presence of a batch effect. After applying the voom transformation (Law et al., 2014) to the read counts, the limma R package (Ritchie et al., 2015) was used to identify differentially expressed genes based on a q-value threshold of 0.05. The limma design matrix included batch information as a factor.

Gene set enrichment analysis (GSEA)

The gene set enrichment analysis (GSEA) software (Subramanian et al., 2005) was used to perform pathway analyses based on the limma output. Briefly, genes in the limma output were ordered according to the t test statistic. Then a GSEA pre-ranked analysis was performed using the Hallmark Gene Sets in the Molecular Signatures Database (http://software.broadinstitute.org/gsea/msigdb/index.jsp).

TCGA analysis

RNA-sequencing (RNA-seq)-based gene expression data for both tumor and normal samples, as well as clinical data for the combined TCGA COADREAD cohort were downloaded from the Broad Institute’s Firehose GDAC (https://gdac.broadinstitute.org/). Gene expression was quantified as log2(normalized RSEM + 1). Somatic gene mutation data was obtained from Ellrott et al., 2018 after restricting to samples in the RNA-seq cohort. Wilcoxon rank-sum tests and Kruskal-Wallis tests were used to compare expression values of SLC8B1 across groups defined by the clinical and mutation data.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Human colorectal cancer tissues utilized for mRNA extraction were obtained from the Penn State Hershey medical center with IRB approval. Briefly, mRNA were isolated from either tissues or cells. The cells were washed with cold PBS, and RNA was isolated using the RNeasy Mini Kit. The quality and quantity of RNA were analyzed using NanoDrop2000 (Thermo Scientific, Wilmington, DE, USA). High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA) was used to make cDNA. The cDNA was further used for quantitative real-time PCR using the SYBR select master mix (Thermo Scientific) according to the manufacturer protocol. The reactions were run in technical duplicates using the Quant Studio three system (Applied Biosystems). The expression levels of genes were normalized to at least two housekeeping genes, GAPDH or Tubulin or NONO (specified in the figure legends) using the 2-ΔCt method.

Western blot

The cells were cultured with 80–90% confluency and were washed with chilled PBS and lysed in 100 µl RIPA buffer (Sigma) containing Halt protease and phosphatase inhibitor. 30–50 µg of the protein was loaded on a 4–12% gel (NuPAGE Bis-Tris precast gels, Life Technologies) and transferred to a polyvinylidene difluoride membrane. The membrane was incubated in Odyssey blocking buffer for 1 hr at room temperature for blocking and was incubated overnight at 4°C in primary antibody diluted in Odyssey blocking buffer. The primary antibodies were used are mentioned in the key resource table, and their dilutions are as follows: anti-HIF1α (1:500), all other antibodies were used at 1:1000 dilution. The next day, the membrane was washed with 0.1% TBS-T for 5 min (three times) at room temperature, followed by incubation in IRDye for 2 hr at room temperature. The IRDyes used are mentioned in the key resource table, and they were diluted in Odyssey blocking buffer (IRDye 680RD Goat anti-Mouse at 1:10,000 dilution and IRDye 800CW Donkey anti-Rabbit at 1:5000). The membrane was washed with 0.1% TBS-T for 5 min (three times) at room temperature. Then the blot was imaged in Odyssey CLx Imaging System (LI-COR, NE, USA). Densiometric analysis of the bands on the membrane was performed using ImageJ software.

Immunofluorescence microscopy

The cells were cultured in six well plates on glass coverslip at 60–70% confluency. The next day, the cells were washed with cold PBS and fixed with chilled 100% Methanol for 30 min. The cells were washed with chilled PBS (3X for 5 min). The cells were incubated in an anti-cleaved caspase-3 antibody (1:250). Secondary Alexa Fluor 594 (1:5000) was used to stain the cells.

For live-cell imaging and mitochondrial staining, the cells were stained with MitoTracker Green FM (50 nM in complete media for 30 min at 37°C), TMRM (100 nM in complete media for 30 min at 37°C) or MitoSOX Red (2.5 µM in HBSS for 30 min at 37°C) and Hoechst (1 µM in HBSS for 5 min). The images were acquired using the Leica SP8 confocal microscope. The fluorescence intensity was quantified using LAS X (Leica Microsystems) software.

Mitochondrial Ca2+ measurements

To measure mitochondrial Ca2+ using Rhod-2 AM (543 nm/580–650 nm) dye, the cells were cultured at 50–60% confluency. The cells were washed with media without FBS and antibiotic-antimycotic agents. Then the cells were incubated in media containing 1 µM Rhod-2 AM (without FBS and antibiotic-antimycotic agents) at 37°C for 30 min. The cells were washed with media and were loaded with MitoTracker Green FM (50 nM in media for 30 min at 37°C) for photobleaching and focus corrections. After loading with MitoTracker Green, cells were washed and kept in HBSS (HEPES-buffered saline solution (140 mM NaCl, 1.13 mM MgCl2, 4.7 mM KCl, 2 mM CaCl2, 10 mM D-glucose, and 10 mM HEPES, adjusted to pH 7.4 with NaOH)) containing 5 mM CaCl2 for imaging. The cells were stimulated with 300 µM ATP in HBSS containing 5 mM CaCl2. The time-lapse images were acquired using the Leica TCS SP8 confocal microscope equipped with a 63X oil objective. The images were acquired every 5 s intervals for 10–15 min. The fluorescence intensity was quantified using LAS X (Leica Microsystems) software.

Intracellular Ca2+ measurements

Intracellular Ca2+ imaging was performed described previously (Emrich et al., 2019; Zhang et al., 2019). Briefly, the cells were cultured on glass coverslips with 50–60% confluency. Next day the cells were washed with fresh media, and the glass coverslip with cells were mounted on a Teflon chamber. Further, the cells were incubated at 37°C for 45 min in culture media containing 4 μM Fura-2/acetoxymethyl ester (Molecular Probes, Eugene, OR, USA). Then the cells were washed and kept in HEPES-buffered saline solution (140 mM NaCl, 1.13 mM MgCl2, 4.7 mM KCl, 2 mM CaCl2, 10 mM D-glucose, and 10 mM HEPES, adjusted to pH 7.4 with NaOH) for at least 10 min before Ca2+ measurements were made. Time-lapse imaging was performed, and the change in fluorescence of Fura-2 was recorded and analyzed with a digital fluorescence imaging system (InCyt Im2; Intracellular Imaging Inc, Cincinnati, OH, USA). An ROI was drawn around each cell, and 340/380 ratio of each cell was calculated.

Transmission electron microscopy (TEM)

The HCT116, DLD1, NCLX KO HCT116, and NCLX KO DLD1 cells were cultured at 80–90% confluency and fixed with 1% glutaraldehyde in 0.1 M sodium phosphate buffer, pH 7.3. After fixation, the cells were washed with 100 mM Tris (pH 7.2) and 160 mM sucrose for 30 min. The cells were washed again twice with phosphate buffer (150 mM NaCl, 5 mM KCl, 10 mM Na3PO4, pH 7.3) for 30 min, followed by treatment with 1% OsO4 in 140 mM Na3PO4 (pH 7.3) for 1 hr. The cells were washed twice with water and stained with saturated uranyl acetate for 1 hr, dehydrated in ethanol, and embedded in Epon (Electron Microscopy Sciences, Hatfield, PA). Roughly 60 nm sections were cut and stained with uranyl acetate and lead nitrate. Further, the stained grids were analyzed using a Philips CM-12 electron microscope (FEI; Eindhoven, The Netherlands) and photographed with a Gatan Erlangshen ES1000W digital camera (Model 785, 4 k 3 2.7 k; Gatan, Pleasanton, CA). Morphometric analysis of mitochondrial was analyzed by double-blinded independent observers in at least 10 different micrographs per condition. The mitochondria without intact inner mitochondrial membrane and cristae were classified as damaged, and their number was counted in each cell and divided by the total number of mitochondria in that cell to calculate % damaged mitochondria. The mitochondrial area was measured by manually tracing the outer mitochondrial membrane and using the measure function of NIH ImageJ software. Cristae per mitochondria were calculated by counting the number of intact cristae in each mitochondrion.

Mitochondrial membrane potential and mitochondrial ROS measurements

Cells were cultured in 6-well plates at 50–60% confluency. The next day, 1 × 106 cells were harvested and loaded with Tetramethyl rhodamine (TMRM) dye. The cells were stained with 100 nM TMRM dye in complete growth media and kept at 37°C in 5% CO2 for 20–30 min. CCCP (50 µM) was used as a positive control. To measure mitochondrial ROS, 1 × 106 cells were stained with MitoSOX (2.5 µM in HBSS at 37°C for 30 min). Antimycin (50 µM) was used as a positive control. The intensity of staining was measured on an LSRII flow cytometer using FACSDiva software (BD Biosciences) and analyzed with FlowJo software (Tree Star).

Cell proliferation assays

The cells were harvested, and 3000–5000 cells were plated in each well of 96 well plates. The cells were kept at 37°C in 5% CO2 for 4 hr to allow the cells to adhere to the plate. The CyQUANT-NF dye was diluted in HBSS buffer, and 100 µl of the mixture was added in each well. The plate was kept at 37°C in 5% CO2 for 1 hr. The fluorescence intensity (~485 nm/~530 nm) was measured using FlexStation 3 Multimode Plate Reader (VWR). To analyze the effect of 2-DG and 5-FU on proliferation, different doses of the drugs were added in the culture media and cells were grown for the indicated amount of time. The fluorescence intensity of the dye was recorded after the drug treatment. The normalized intensity was calculated using the following formula:

  • Normalized intensity = (It-Ib)/(I0-Ib)

  • It = intensity at the given time

  • Ib = background intensity

  • I0 = intensity at time zero

Zymography

Briefly, the cells were harvested and cultured in 6-well plates. Once the culture becomes 80–90% confluent, 20 µl of the media was taken and mixed with Tris-Glycine-SDS sample buffer and loaded in a Novex Zymogram gel and Tris-glycine SDS running buffer was used to run the gel. After electrophoresis, the gel was kept in Novex Zymogram renaturing buffer for 30 min and transferred to Novex Zymogram Developing buffer and kept at 37°C overnight. The next day the gel was stained with SimplyBlue Safe Stain and imaged using FluorChem M imager. The images were analyzed using ImageJ.

In vitro migration and invasion assays

Migration was measured using two different methods a transwell migration assay and wound healing assay. For the transwell migration assay using FluoroBlok, the cells were serum-starved for 24 hr, and 1,000 cells were plated on the chamber in 200 µl media without FBS. The cells were stimulated to migrate towards preconditioned media with 10% FBS. After 8 hr of migration, the upper part of the membrane was cleaned, and the lower part was stained with DAPI, and the intensity of DAPI was measured using FlexStation 3 Multimode Plate Reader (VWR).

For the wound healing (gap closure) assay, cells were serum-starved for 24 hr to synchronize the cell cycle. Then 50,000 cells were plated in ibidi-silicone insert with a defined cell-free gap. After 24 hr, the inserts were lifted, and the gap between two migrating fronts was measured at 0 hr, 12 hr, and 24 hr using Zeiss inverted fluorescence microscope equipped with 5X air objective. The area between the two migrating fronts was measured using ImageJ (NIH, Bethesda). To analyze the effect of 2-DG and 5-FU on migration, a specific dose of the drugs was added in the culture media at the time of removal of the silicon insert, and cells were grown for the indicated amounts of time. Fresh media with the drug was added every 12 hr. The following formula was used to calculate % gap closure:

  • % Gap closure = (A0-At/A0)/100

  • A0 = area of gap measured immediately after lifting the insert

  • At = area of gap measured after the indicated time of migration

Cell invasion was measured using the BioCoat Tumor Invasion Plate with 8 µm pore size inserts, which were coated with growth factor-reduced Matrigel. The cells were serum-starved for 24 hr, and a total of 5,000 cells were plated on the chamber in 200 µl media without FBS. The cells were stimulated to invade towards preconditioned media with 10% FBS. After 24 hr invasion, the upper part of the membrane was cleaned, and the lower part was stained with DAPI, and the intensity of DAPI was measured using FlexStation 3 Multimode Plate Reader (VWR). The percentage of invasion was calculated using the following formula-

%invasion=(Fluorescenceofinvadingcells−Fluorescenceofblankchamber)/(Fluorescenceofmigratingcells−Fluorescenceofblankchamber)X100

ECAR and oxygen consumption rate (OCR)

The ECAR, OCR, and % metabolite dependency was measured using the Seahorse XFp Extracellular Flux Analyzer (Seahorse Bioscience). All experiments were performed according to the manufacturer’s protocol. Seahorse XFp Glycolysis Stress Test Kit, Seahorse XFp Cell Mito Stress Test Kit, and Seahorse XFp Mito Fuel Flex Test Kit (Agilent Technologies) were used to measure ECAR, OCR, and % dependency respectively. Briefly, cells were harvested, and 30,000 cells were plated per well and cultured in a Seahorse XFp cell culture microplate with complete growth media for 10–12 hr. The next day the cells were washed with Seahorse XF DMEM media (pH 7.4). The plate with cultured cells was placed in the Seahorse XFp Extracellular Flux Analyzer, and baseline measurements were recorded. For ECAR measurements, oligomycin, and 2-DG were sequentially injected into each well at the indicated time points. Similarly, for OCR measurements, oligomycin, FCCP (p-trifluoromethoxy carbonyl cyanide phenylhydrazone), and antimycin A (Rote/AA) were sequentially injected. For % dependency measurements, UK5099, BPTES, and Etomoxir were sequentially injected. The results obtained for ECAR, OCR, and Mito Fuel Flex Test were normalized to cell number. Data were analyzed using Seahorse XFp Wave software. The results for OCR are reported in pmols/minute, ECAR in mpH/minute, and Mito Fuel Flex Test in % dependency.

Glucose and lactate measurements

To measure glucose and lactate in media, 100,000 cells were plated in each well of 6-well plates with 2 ml of complete growth media. After 24 hr, 400 µl of the media were taken from each well of the 6-well plates and divided into four wells in a 96-well plate (quadruplicate for each NCLX KO clone and respective control). Then the plate was kept in YSI 7100 multichannel biochemistry analyzer (YSI Life Sciences) to measure glucose and lactate levels in the media. Fresh media was used to measure the basal level of glucose and lactate. After measurements were completed, cells were harvested, and the protein content was measured using the BCA assay. This experiment was performed at least three times independently. The following formulas were used to calculate glucose consumption and lactate generation:

  • Glucose consumption = (Glucose in fresh media - Glucose in the media with cells)/protein content

  • Lactate generation = (Lactate in the media with cells - Lactate in fresh media)/protein content

Mouse xenograft experiments

Mice were anesthetized using isoflurane, and after proper sterile preparation of the abdomen, a small (4–8 mm) incision was made by sharp sterile blade over the left upper quadrant of the abdomen. The peritoneal cavity was carefully exposed, and the spleen was located. Further, the spleen was carefully exteriorized on the sterile field around the incision area, and 500,000 cells suspended in 50 µl McCoy’s (10 or 20% FBS) were then injected into the spleen via a 1 ml insulin syringe. A small bleb was observed while injecting the cells in the spleen, confirming that the cells were successfully injected. The spleen was carefully placed back into the peritoneal cavity. Both the peritoneal cavity and skin were closed with sterile absorbable suture. The mice injected with luciferin (100 µg/ml) and imaged in the IVIS system every week till the time of sacrifice.

Colitis-associated colon cancer model and histology

6–8 week-old mice were given a single azoxymethane (AOM) injection via IP. One week after AOM injection, the mice were given three cycles of dextran sodium sulfate (DSS), which was supplemented in drinking water (1.5 % m/v, MW 36–50 kDa, MP Biochemicals) ad libitum for five days. The DSS cycles were intermixed with two weeks of normal autoclaved drinking water. Mice were sacrificed, and the colons were collected ten weeks after the last DSS cycle. The collected colons were flushed with PBS to clear feces and photographed. Before dissection, tumors were scored according to their number and size. PBS-rinsed colons were either snap-frozen for further analysis or fixed in 10% neutral buffered formalin and sectioned for histological analysis.

Quantification and statistical analysis

Data are represented as mean ± SEM and analyzed using Origin pro 2019b (Origin lab). In the box plot, the box represents the 25th to 75th interquartile range, midline in the box represents the median, and the solid square box represents mean data points. To test single variables between two groups, paired t-test or Kruskal-Wallis ANOVA was performed (specified in each figure legend). One-way ANOVA followed by post-hoc Tukey’s test was used for comparison between multiple conditions and the control group. The p-value<0.05 was considered to be significant and is presented as *p<0.05, **p<0.01, or ***p<0.001.

Acknowledgements

The authors acknowledge Dr. Han Chen from The Pennsylvania State University College of Medicine EM facility for assistance with TEM imaging. Our study was supported by the National Heart, Lung, and Blood Institute (R01-HL123364, R01-HL097111, and R35-HL150778 to MT), National Institute on Aging (R21-AG050072 to MT), and American Heart Association Postdoctoral Fellowship (9POST34380606) to TP GSY and WAK are supported by the Peter and Marshia Carlino Fund for IBD research. We also acknowledge, Flow Cytometry and Cell Sorting, Imaging, Informatics and Data Analysis Core facility (The Pennsylvania State University, College of Medicine).

Appendix 1

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Homo sapiens) SLC8B1/NCLX GenBank Gene ID: 80024
Gene Mus musculus Slc8b1/NCLX GenBank Gene ID: 170756
Genetic reagent Mus musculus NOD.CB17-Prkdcscid/J Jackson Laboratory Stock No: 010636, RRID:IMSR_JAX:010636 Male
Cell line (Homo-sapiens) HCT116 (colon, epithelial) ATCC ATCC# CCL-247 Male
Cell line (Homo-sapiens) HT29 (colon, epithelial) ATCC ATCC# HTB-38 Female
Cell line (Homo-sapiens) DLD1 (colon, epithelial) ATCC ATCC# CCL-221 Male
Cell line (Homo-sapiens) HCT116 NCLX KO (colon, epithelial) This paper NCLX Knockout clones of HCT116 cells were generated by the Trebak lab using CRISPR/Cas9 and are available upon request
Cell line (Homo-sapiens) DLD1 NCLX KO (colon, epithelial) This paper NCLX Knockout clones of DLD1 cells were generated in the Trebak lab using CRISPR/Cas9 and are available upon request
Cell line (Homo-sapiens) HCT116 shNCLX (colon, epithelial) This paper HCT116 cells with stable shRNA-mediated knockdown of NCLX (shNCLX) were generated by the Trebak Lab using shRNA sequences (listed below in this table) cloned in the lentiviral vector pLKO. These plasmids are available upon request
Cell line (Homo-sapiens) DLD1 shNCLX (colon, epithelial) This paper DLD1 cells with stable shRNA-mediated knockdown of NCLX (shNCLX) were generated by the Trebak Lab using shRNA sequences (listed below in this table) cloned in the lentiviral vector pLKO. These plasmids are available upon request
Antibody anti-Hif1α (Rabbit polyclonal) Cell Signaling Technology Cat# 14179s,
RRID:AB_2622225
WB (1:500)
Antibody anti- ALDOA (Rabbit polyclonal) Cell Signaling Technology Cat# 8060S,
RRID:AB_2797635
WB (1:1000)
Antibody anti- HK2 (Rabbit polyclonal) Cell Signaling Technology Cat# 2867S, RRID:AB_2232946 WB (1:1000)
Antibody anti- LDHA (Rabbit polyclonal) Cell Signaling Technology Cat# 2012S,
RRID:AB_2137173
WB (1:1000)
Antibody anti- MMP1 (Rabbit polyclonal) Abcam Cat# ab38929, RRID:AB_776395 WB (1:1000)
Antibody anti- MMP2 (Mouse monoclonal) Santa Cruz Biotechnology Cat# sc-13594, RRID:AB_627956 WB (1:500)
Antibody anti- MMP9 (Rabbit polyclonal) Abcam Cat# ab73734, RRID:AB_1860201 WB (1:1000)
Antibody anti- LC3B (Rabbit polyclonal) Abcam Cat# ab51520, RRID:AB_881429 WB (1:1000)
Antibody anti- OXPHOS (Mouse monoclonal) Abcam Cat# ab110413, RRID:AB_2629281 WB (1:5000)
Antibody anti- GAPDH (Mouse monoclonal) Millipore Sigma Cat# MAB374, RRID:AB_2107445 WB (1:10000)
Antibody anti- HSC70 (Mouse monoclonal) Santa Cruz Biotechnology Cat# sc-24, RRID:AB_627760 WB (1:5000)
Antibody anti- p62 (Rabbit polyclonal) Abcam Cat# ab109012, RRID:AB_2810880 WB (1:1000)
Antibody anti- cleaved caspase-3 (Rabbit polyclonal) Cell Signaling Technology Cat# 9661S, RRID:AB_2341188 WB (1:1000)
IF (1:500)
Antibody anti- pAMPK (Rabbit polyclonal) Cell Signaling Technology Cat# 2535S, RRID:AB_331250 WB (1:1000)
Antibody anti- AMPK (Rabbit polyclonal) Cell Signaling Technology Cat# 5831S, RRID:AB_10622186 WB (1:1000)
Antibody anti- pS6K (Rabbit polyclonal) Cell Signaling Technology Cat# 9234S, RRID:AB_2269803 WB (1:1000)
Antibody anti- S6K (Rabbit polyclonal) Cell Signaling Technology Cat# 2708S, RRID:AB_390722 WB (1:1000)
Sequence-based reagent SLC7A11_F This paper RT-PCR primers AGGGTCACCTTCCAGAAATC
Sequence-based reagent SLC7A11_R This paper RT-PCR primers GAAGATAAATCAGCCCAGCA
Sequence-based reagent GCLM _F This paper RT-PCR primers CATTTACAGCCTTACTGGGAGG
Sequence-based reagent GCLM _R This paper RT-PCR primers ATGCAGTCAAATCTGGTGGCA
Sequence-based reagent FOXO3_F This paper RT-PCR primers CGGACAAACGGCTCACTCT
Sequence-based reagent FOXO3_R This paper RT-PCR primers GGACCCGCATGAATCGACTAT
Sequence-based reagent NANOG _F This paper RT-PCR primers TTTGTGGGCCTGAAGAAAACT
Sequence-based reagent NANOG _R This paper RT-PCR primers AGGGCTGTCCTGAATAAGCAG
Sequence-based reagent OCT4_F This paper RT-PCR primers TTCAGCCAAACGACCATCTG
Sequence-based reagent OCT4_R This paper RT-PCR primers CACGAGGGTTTCTGCTTTGC
Sequence-based reagent SOX2_F This paper RT-PCR primers GCCGAGTGGAAACTTTTGTCG
Sequence-based reagent SOX2_R This paper RT-PCR primers GGCAGCGTGTACTTATCCTTCT
Sequence-based reagent GLUT1_F This paper RT-PCR primers TATCGTCAACACGGCCTTCACT
Sequence-based reagent GLUT1_R This paper RT-PCR primers AACAGCTCCTCGGGTGTCTTAT
Sequence-based reagent HK2_F This paper RT-PCR primers GCCATCCTGCAACACTTAGGG
Sequence-based reagent HK2_R This paper RT-PCR primers GTGAGGATGTAGCTTGTAGAGGGT
Sequence-based reagent GPI_F This paper RT-PCR primers TGTGTTCACCAAGCTCACAC
Sequence-based reagent GPI_R This paper RT-PCR primers GTAGAAGCGTCGTGAGAGGT
Sequence-based reagent ALDOA_F This paper RT-PCR primers AGGCCATGCTTGCACTCAG
Sequence-based reagent ALDOA_R This paper RT-PCR primers AGGGCCCAGGGCTTCAG
Sequence-based reagent ENO1_F This paper RT-PCR primers GACTTGGCTGGCAACTCTG
Sequence-based reagent ENO1_R This paper RT-PCR primers GGTCATCGGGAGACTTGAAG
Sequence-based reagent LDHA_F This paper RT-PCR primers GGTTGGTGCTGTTGGCATGG
Sequence-based reagent LDHA_R This paper RT-PCR primers TGCCCCAGCCGTGATAATGA
Sequence-based reagent MMP1_F This paper RT-PCR primers ATGCTGAAACCCTGAAGGTG
Sequence-based reagent MMP1_R This paper RT-PCR primers GAGCATCCCCTCCAATACCT
Sequence-based reagent MMP2_F This paper RT-PCR primers ACCAGCTGGCCTAGTGATGATG
Sequence-based reagent MMP2_R This paper RT-PCR primers GGCTTCCGCATGGTCTCGATG
Sequence-based reagent MMP9_F This paper RT-PCR primers ACGCACGACGTCTTCCAGTA
Sequence-based reagent MMP9_R This paper RT-PCR primers CCACCTGGTTCAACTCACTCC
Sequence-based reagent qNCLX_1_F This paper RT-PCR primers GCGTGCTGGTTACCACAGT
Sequence-based reagent qNCLX_1_R This paper RT-PCR primers CCACGGAAGAGCATGAGGAA
Sequence-based reagent qNCLX_2_F This paper RT-PCR primers CCGGCAGAAGGCTGAATCTG
Sequence-based reagent qNCLX_2_R This paper RT-PCR primers ACCTTGCGGCAGTCTACCAC
Sequence-based reagent GAPDH_F This paper RT-PCR primers CCCTTCATTGACCTCAACTACA
Sequence-based reagent GAPDH_R This paper RT-PCR primers ATGACAAGCTTCCCGTTCTC
Sequence-based reagent NONO_F This paper RT-PCR primers TCCGAGGAGATACCAGTCGG
Sequence-based reagent NONO_R This paper RT-PCR primers CCTGGGCCTCTCAACTTCGAT
Sequence-based reagent Tubulin_F This paper RT-PCR primers AGTCCAAGCTGGAGTTCTCTAT
Sequence-based reagent Tubulin_R This paper RT-PCR primers CAATCAGAGTGCTCCAGGGT
Sequence-based reagent G6PD_F This paper RT-PCR primers CGAGGCCGTCACCAAGAAC
Sequence-based reagent G6PD_R This paper RT-PCR primers GTAGTGGTCGATGCGGTAGA
Sequence-based reagent PGD_F This paper RT-PCR primers ATGGCCCAAGCTGACATCG
Sequence-based reagent PGD_R This paper RT-PCR primers AAAGCCGTGGTCATTCATGTT
Sequence-based reagent TKT_F This paper RT-PCR primers TCCACACCATGCGCTACAAG
Sequence-based reagent TKT_R This paper RT-PCR primers CAAGTCGGAGCTGATCTTCCT
Sequence-based reagent g1 This paper Guide RNA sequences (Figure 2A and Figure 3—figure supplement 1A) GCGCAGATTCAGCCTTCTGC
Sequence-based reagent g2 This paper Guide RNA sequences (Figure 3—figure supplement 1B and C) GGGATACTCACGTCTACCAC
Sequence-based reagent g3 This paper Guide RNA sequences (Figure 3—figure supplement 1E) GTAGACGTGAGTATCCCGGT
Sequence-based reagent g4 This paper Guide RNA sequences (Figure 3—figure supplement 1E) ACCCACACCAGCAGTCCGTC
Sequence-based reagent shRNA (shNCLX#2) This paper Figure 3—figure supplement 1I GCCTTCTTGCTGTCATGCAAT
Sequence-based reagent shRNA (shNCLX#3) This paper Figure 3—figure supplement 1I GCTCCTCTTCTACCTGAACTT
Sequence-based reagent siRNA (siNCLX) This paper Figure 4—figure supplement 1M AACGGCCCCUCAACUGUCUT
Sequence-based reagent NCLX_1 This paper PCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F) GCCAGCATTTGTGTCCATTT
Sequence-based reagent NCLX_2 This paper PCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F) AATTCGTCTCGGCCACTTAC
Sequence-based reagent NCLX_3 This paper PCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F) ACTTAGCACATCGCCACC TG
Sequence-based reagent NCLX_4 This paper PCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F) CTGATCTGCACGCTGAAT GG
Sequence-based reagent NCLX_5 This paper PCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F) GAGGTACACAGCAGTTCT CCC
Sequence-based reagent NCLX_6 This paper PCR primers for screening genomic DNA of NCLX KO clones (Figure 3—figure supplement 1F) CAGCTGGTGCCCTCAAACAC
Sequence-based reagent PX75 NCLX test F This paper PCR primers for screening genomic DNA of NCLX KO HCT116 cells GTTGTTGAGACAGAGTCTTGC TTC
Sequence-based reagent PX76 NCLX test R This paper PCR primers for screening genomic DNA of NCLX KO HCT116 cells TCCAGCGAGACTGTGCAGAA
Sequence-based reagent px77 This paper PCR primers for genotyping NCLX -/- mice TACAGTCTGGCTCGTTCC CT
Sequence-based reagent px78 This paper PCR primers for genotyping NCLX -/- mice CGGTCCCAGACGCCG T
Sequence-based reagent px79 This paper PCR primers for genotyping NCLX -/- mice CGCTGGGGTCCATCT TTG AT
Sequence-based reagent px80 This paper PCR primers for genotyping NCLX -/- mice TGGGTCTCCGGTCCCAGT A
Commercial assay or kit cDNA Reverse Transcription Kit Applied biosystems Cat# 4368814
Commercial assay or kit Seahorse XFp Mito Fuel Flex Test Kit Agilent Technologies Cat# 103270-100
Commercial assay or kit Seahorse XFp Glycolysis Stress Test Kit Agilent Technologies Cat# 103017-100
Commercial assay or kit Seahorse XFp Cell Mito Stress Test Kit Agilent Technologies Cat# 103010-100
Commercial assay or kit BCA assay kit Thermo Fisher Scientific Cat# A53225
Commercial assay or kit TMRE Thermo Fisher Scientific Cat# T669
Commercial assay or kit CyQUANT Thermo Fisher Scientific Cat# C35006
Chemical compound, drug Antibiotic and Antimycotic Thermo Fisher Scientific Cat# 15240062
Chemical compound, drug McCoy’s 5A Corning Cat# 10-050CV
Chemical compound, drug RPMI-1640 Corning Cat# 10-040CV
Chemical compound, drug Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668019
Chemical compound, drug TrypLE Thermo Fisher Scientific Cat# 12605028
Chemical compound, drug CoCl2 Sigma-Aldrich Cat# 15862
Chemical compound, drug 2-deoxy-D-glucose (2-DG) Sigma-Aldrich Cat# D8375
Chemical compound, drug 5- Fluorouracil Sigma-Aldrich Cat# F6627
Chemical compound, drug Glucose Sigma-Aldrich Cat# D9434
Chemical compound, drug Puromycin MP Biomedical Cat# 02100552
Chemical compound, drug RIPA buffer Sigma Cat# R0278
Chemical compound, drug ATP Sigma Cat# A9187
Chemical compound, drug Dextrose Fisher Scientific Cat# D14
Chemical compound, drug Tris Base Fisher Scientific Cat# BP152-5
Chemical compound, drug NaCl Fisher Scientific Cat# S671
Chemical compound, drug MOPS SDS running buffer Thermo Fisher Scientific Cat# NP0001
Chemical compound, drug Tris-Glycine transfer buffer Bio-rad Cat#161-0734
Chemical compound, drug KCl Fisher Scientific Cat# P217
Chemical compound, drug MgCl2 Fisher Scientific Cat# M33
Chemical compound, drug CaCl2 Fisher Scientific Cat# C614
Chemical compound, drug HEPES Fisher Scientific Cat# BP310
Chemical compound, drug LDS sample buffer Thermo Fisher Scientific Cat# NP0007
Chemical compound, drug NuPAGE Bis-Tris precast gels Thermo Fisher Scientific Cat# NP0321
Chemical compound, drug Polyvinylidene difluoride membrane Li-Core Biosciences Cat# 88518
Chemical compound, drug Odyssey Blocking Buffer (TBS) Li-Core Biosciences Cat# 937-50003
Chemical compound, drug Dextran sulfate sodium MP Biomedical Cat# 0216011080
Chemical compound, drug Azoxymethane Sigma Cat# A5486
Chemical compound, drug DNase I Thermo Fisher Scientific Cat# 18068-015
Chemical compound, drug TRIzol Thermo Fisher Scientific Cat# 15596018
Chemical compound, drug Seahorse XF DMEM Medium pH 7.4 Agilent Technologies Cat# 103575-100
Chemical compound, drug Seahorse XF 100 mM pyruvate solution Agilent Technologies Cat# 103578-100
Chemical compound, drug Seahorse XF 200 mM glutamine solution Agilent Technologies Cat# 103579-100
Chemical compound, drug Seahorse XF 1.0 M glucose solution Agilent Technologies Cat# 103577-100
Chemical compound, drug Zymogram Developing Buffer (10X) Thermo Fisher Scientific Cat# LC2671
Chemical compound, drug Zymogram Renaturing Buffer (10X) Thermo Fisher Scientific Cat# LC2670
Chemical compound, drug Tris-Glycine SDS Running Buffer (10X) Thermo Fisher Scientific Cat# LC2675
Chemical compound, drug Tween 20 Fisher Scientific Cat# BP337
Software, algorithm Image J https://imagej.net/ RRID:SCR_003070
Other DAPI Sigma-Aldrich Cat# D9542 1µg/ml
Other Hoechst Thermo Fisher Scientific Cat# H3570 1µg/ml
Other IRDye 800CW Goat anti-Mouse Li-Core Biosciences Cat# 925-32210 1:10000
Other IRDye 800CW Donkey anti-Rabbit Li-Core Biosciences Cat# 925-32213 1:5000
Other MitoSox Red Thermo Fisher Scientific Cat# M36008
Other Mito TEMPO Thermo Fisher Scientific Cat# SML0737
Other Mito Tracker Green FM Thermo Fisher Scientific Cat# M7514
Other Mito Tracker Deep red FM Cell Signaling Technology Cat# 8778S
Other Fura-2 AM Thermo Fisher Scientific Cat# F1221
Other FluoroBlok Corning Cat# 351152
Other BioCoat Tumor Invasion Plate Corning Cat# 80774380
Other SYBER select master mix Thermo Fisher Scientific Cat# 4472920
Other Novex 10% Zymogram Plus (Gelatin) Protein Gels, 1.0 mm, 10-well Thermo Fisher Scientific Cat# ZY00100
Other SimplyBlue Safe Stain Thermo Fisher Scientific Cat# LC6060

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Mohamed Trebak, Email: mtrebak@psu.edu.

Mark T Nelson, University of Vermont, United States.

Richard W Aldrich, The University of Texas at Austin, United States.

Funding Information

This paper was supported by the following grants:

  • National Heart, Lung, and Blood Institute R35-HL150778 to Mohamed Trebak.

  • American Heart Association 9POST34380606 to Trayambak Pathak.

  • National Heart, Lung, and Blood Institute F30 HL147489 to Martin T Johnson.

  • National Heart, Lung, and Blood Institute R01-HL123364 to Mohamed Trebak.

  • National Heart, Lung, and Blood Institute R01-HL097111 to Mohamed Trebak.

  • National Institute on Aging R21-AG050072 to Mohamed Trebak.

  • Peter and Marshia Carlino Fund to Gregory S Yochum, Walter A Koltun.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing.

Conceptualization, Investigation.

Resources, Software, Formal analysis.

Investigation.

Investigation.

Investigation.

Investigation.

Investigation.

Investigation.

Resources, Writing - review and editing.

Resources, Writing - review and editing.

Resources.

Resources.

Conceptualization, Resources, Supervision, Methodology, Writing - original draft, Writing - review and editing.

Conceptualization, Supervision, Funding acquisition, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Ethics

Human subjects: The Pennsylvania State University College of Medicine institutional review board approved this study. Approval under IRB Protocol number HY98-057EP-A. Prior to surgery, patients are consented to have resected tissues collected and banked into the Penn State Hershey Colorectal Disease Biobank. As outlined in the consent form and IRB protocol.

Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) protocol # 47350/Trebak, which was approved by the IACUC at the Penn State University college of medicine. Every effort was made to minimize animal suffering.

Additional files

Supplementary file 1. Genomic sequencing of NCLX KO clones of HCT116 and DLD1 cells.

This file shows the genome sequencing of NCLX KO clones #33, #37, and #59 of HCT116 and #06, #24, and #32 of DLD1 cells. For genomic sequencing, PCR was performed to amplify specific parts of the NCLX gene using primers listed in the key resources table. The primers used for cloning genomic DNA from HCT116 cells were PX75 NCLX test F and PX76 NCLX test R. The primers used for cloning genomic DNA from DLD1 cells were NCLX_4 and NCLX_5. PCR products were cloned using StrataClone Blunt PCR Cloning Kit and sent to Genewiz for sanger sequencing. The genome sequencing data for the HCT116 NCLX KO clones confirm the introduction of STOP codons in coding sequences of HCT116 NCLX KO #33 at predicted positions 181-183 bp and 184-186 bp, in HCT116 NCLX KO #37 at 16-18 bp and 46-48 bp, and in HCT116 NCLX KO #59 at 31-33 bp, and 52-54 bp. Furthermore, the genomic sequencing of NCLX KO clones of DLD1 cells showed that the middle ~32 kb portion of the NCLX gene was deleted in all clones. Therefore, providing decisive evidence that these cells are indeed NCLX KO.

elife-59686-supp1.docx (27KB, docx)
Source data 1. Source data RNAseq_HCT116_HCT116 NCLX KO.
elife-59686-data1.xlsx (1,003.4KB, xlsx)
Transparent reporting form

Data availability

No large data sets have been generated from the current study. All data generated or analysed during this study are included in the manuscript and supporting files. Source data files for all figures and figure supplements have been provided in Source data 1.

References

  1. Abdullah LN, Chow EK. Mechanisms of chemoresistance in Cancer stem cells. Clinical and Translational Medicine. 2013;2:3. doi: 10.1186/2001-1326-2-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ahmed D, Eide PW, Eilertsen IA, Danielsen SA, Eknæs M, Hektoen M, Lind GE, Lothe RA. Epigenetic and genetic features of 24 Colon cancer cell lines. Oncogenesis. 2013;2:e71. doi: 10.1038/oncsis.2013.35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ashrafi G, Schwarz TL. The pathways of mitophagy for quality control and clearance of mitochondria. Cell Death & Differentiation. 2013;20:31–42. doi: 10.1038/cdd.2012.81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Baughman JM, Perocchi F, Girgis HS, Plovanich M, Belcher-Timme CA, Sancak Y, Bao XR, Strittmatter L, Goldberger O, Bogorad RL, Koteliansky V, Mootha VK. Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter. Nature. 2011;476:341–345. doi: 10.1038/nature10234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bell EL, Klimova TA, Eisenbart J, Schumacker PT, Chandel NS. Mitochondrial reactive oxygen species trigger hypoxia-inducible factor-dependent extension of the replicative life span during hypoxia. Molecular and Cellular Biology. 2007;27:5737–5745. doi: 10.1128/MCB.02265-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bellot G, Garcia-Medina R, Gounon P, Chiche J, Roux D, Pouysségur J, Mazure NM. Hypoxia-induced autophagy is mediated through hypoxia-inducible factor induction of BNIP3 and BNIP3L via their BH3 domains. Molecular and Cellular Biology. 2009;29:2570–2581. doi: 10.1128/MCB.00166-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ben-Kasus Nissim T, Zhang X, Elazar A, Roy S, Stolwijk JA, Zhou Y, Sekler I. Mitochondria control store-operated ca(2+) entry through na(+) and redox signals. The EMBO Journal. 2017;36:797–815. doi: 10.15252/embj.201592481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ben-Yosef Y, Lahat N, Shapiro S, Bitterman H, Miller A. Regulation of endothelial matrix metalloproteinase-2 by hypoxia/reoxygenation. Circulation Research. 2002;90:784–791. doi: 10.1161/01.RES.0000015588.70132.DC. [DOI] [PubMed] [Google Scholar]
  9. Bernardi P, Di Lisa F. The mitochondrial permeability transition pore: molecular nature and role as a target in cardioprotection. Journal of Molecular and Cellular Cardiology. 2015;78:100–106. doi: 10.1016/j.yjmcc.2014.09.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bertero E, Maack C. Calcium Signaling and Reactive Oxygen Species in Mitochondria. Circulation Research. 2018;122:1460–1478. doi: 10.1161/CIRCRESAHA.118.310082. [DOI] [PubMed] [Google Scholar]
  11. Blank A, Roberts DE, Dawson H, Zlobec I, Lugli A. Tumor heterogeneity in primary colorectal cancer and corresponding metastases. Does the apple fall far from the tree? Frontiers in Medicine. 2018;5:234. doi: 10.3389/fmed.2018.00234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Booth DM, Enyedi B, Geiszt M, Várnai P, Hajnóczky G. Redox nanodomains are induced by and control calcium signaling at the ER-Mitochondrial interface. Molecular Cell. 2016;63:240–248. doi: 10.1016/j.molcel.2016.05.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Brookes PS, Yoon Y, Robotham JL, Anders MW, Sheu SS. Calcium, ATP, and ROS: a mitochondrial love-hate triangle. American Journal of Physiology-Cell Physiology. 2004;287:C817–C833. doi: 10.1152/ajpcell.00139.2004. [DOI] [PubMed] [Google Scholar]
  14. Bu P, Chen KY, Xiang K, Johnson C, Crown SB, Rakhilin N, Ai Y, Wang L, Xi R, Astapova I, Han Y, Li J, Barth BB, Lu M, Gao Z, Mines R, Zhang L, Herman M, Hsu D, Zhang GF, Shen X. Aldolase B-Mediated fructose metabolism drives metabolic reprogramming of Colon cancer liver metastasis. Cell Metabolism. 2018;27:1249–1262. doi: 10.1016/j.cmet.2018.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Buchholz M, Schatz A, Wagner M, Michl P, Linhart T, Adler G, Gress TM, Ellenrieder V. Overexpression of c-myc in pancreatic Cancer caused by ectopic activation of NFATc1 and the Ca2+/calcineurin signaling pathway. The EMBO Journal. 2006;25:3714–3724. doi: 10.1038/sj.emboj.7601246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Burns J, Manda G. Metabolic pathways of the warburg effect in health and disease: perspectives of choice, chain or chance. International Journal of Molecular Sciences. 2017;18:2755. doi: 10.3390/ijms18122755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Button RW, Roberts SL, Willis TL, Hanemann CO, Luo S. Accumulation of autophagosomes confers cytotoxicity. Journal of Biological Chemistry. 2017;292:13599–13614. doi: 10.1074/jbc.M117.782276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Buvinic S, Almarza G, Bustamante M, Casas M, López J, Riquelme M, Sáez JC, Huidobro-Toro JP, Jaimovich E. ATP released by electrical stimuli elicits calcium transients and gene expression in skeletal muscle. Journal of Biological Chemistry. 2009;284:34490–34505. doi: 10.1074/jbc.M109.057315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Celsi F, Pizzo P, Brini M, Leo S, Fotino C, Pinton P, Rizzuto R. Mitochondria, calcium and cell death: a deadly triad in neurodegeneration. Biochimica Et Biophysica Acta (BBA) - Bioenergetics. 2009;1787:335–344. doi: 10.1016/j.bbabio.2009.02.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Chandrashekar DS, Bashel B, Balasubramanya SAH, Creighton CJ, Ponce-Rodriguez I, Chakravarthi B, Varambally S. UALCAN: a portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia. 2017;19:649–658. doi: 10.1016/j.neo.2017.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Choudhry H, Harris AL. Advances in Hypoxia-Inducible factor biology. Cell Metabolism. 2018;27:281–298. doi: 10.1016/j.cmet.2017.10.005. [DOI] [PubMed] [Google Scholar]
  22. Chourasia AH, Tracy K, Frankenberger C, Boland ML, Sharifi MN, Drake LE, Sachleben JR, Asara JM, Locasale JW, Karczmar GS, Macleod KF. Mitophagy defects arising from BNip3 loss promote mammary tumor progression to metastasis. EMBO Reports. 2015;16:1145–1163. doi: 10.15252/embr.201540759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Dan Dunn J, Alvarez LA, Zhang X, Soldati T. Reactive oxygen species and mitochondria: a nexus of cellular homeostasis. Redox Biology. 2015;6:472–485. doi: 10.1016/j.redox.2015.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Danese A, Patergnani S, Bonora M, Wieckowski MR, Previati M, Giorgi C, Pinton P. Calcium regulates cell death in Cancer: roles of the mitochondria and mitochondria-associated membranes (MAMs) Biochimica Et Biophysica Acta (BBA) - Bioenergetics. 2017;1858:615–627. doi: 10.1016/j.bbabio.2017.01.003. [DOI] [PubMed] [Google Scholar]
  25. De Stefani D, Raffaello A, Teardo E, Szabò I, Rizzuto R. A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter. Nature. 2011;476:336–340. doi: 10.1038/nature10230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. De Stefani D, Rizzuto R, Pozzan T. Enjoy the Trip: Calcium in Mitochondria Back and Forth. Annual Review of Biochemistry. 2016;85:161–192. doi: 10.1146/annurev-biochem-060614-034216. [DOI] [PubMed] [Google Scholar]
  27. Dodd KM, Yang J, Shen MH, Sampson JR, Tee AR. mTORC1 drives HIF-1α and VEGF-A signalling via multiple mechanisms involving 4E-BP1, S6K1 and STAT3. Oncogene. 2015;34:2239–2250. doi: 10.1038/onc.2014.164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Dunne PD, Alderdice M, O'Reilly PG, Roddy AC, McCorry AMB, Richman S, Maughan T, McDade SS, Johnston PG, Longley DB, Kay E, McArt DG, Lawler M. Cancer-cell intrinsic gene expression signatures overcome intratumoural heterogeneity Bias in colorectal Cancer patient classification. Nature Communications. 2017;8:15657. doi: 10.1038/ncomms15657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Durinck S, Spellman PT, Birney E, Huber W. Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRt. Nature Protocols. 2009;4:1184–1191. doi: 10.1038/nprot.2009.97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ellrott K, Bailey MH, Saksena G, Covington KR, Kandoth C, Stewart C, Hess J, Ma S, Chiotti KE, McLellan M, Sofia HJ, Hutter C, Getz G, Wheeler D, Ding L, MC3 Working Group, Cancer Genome Atlas Research Network Scalable open science approach for mutation calling of tumor exomes using multiple genomic pipelines. Cell Systems. 2018;6:271–281. doi: 10.1016/j.cels.2018.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Emrich SM, Yoast RE, Xin P, Zhang X, Pathak T, Nwokonko R, Gueguinou MF, Subedi KP, Zhou Y, Ambudkar IS, Hempel N, Machaca K, Gill DL, Trebak M. Cross-talk between N-terminal and C-terminal domains in stromal interaction molecule 2 (STIM2) determines enhanced STIM2 sensitivity. Journal of Biological Chemistry. 2019;294:6318–6332. doi: 10.1074/jbc.RA118.006801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Fan P, Xie X-H, Chen C-H, Peng X, Zhang P, Yang C, Wang Y-T. Molecular Regulation Mechanisms and Interactions Between Reactive Oxygen Species and Mitophagy. DNA and Cell Biology. 2019;38:10–22. doi: 10.1089/dna.2018.4348. [DOI] [PubMed] [Google Scholar]
  33. Frank M, Duvezin-Caubet S, Koob S, Occhipinti A, Jagasia R, Petcherski A, Ruonala MO, Priault M, Salin B, Reichert AS. Mitophagy is triggered by mild oxidative stress in a mitochondrial fission dependent manner. Biochimica Et Biophysica Acta (BBA) - Molecular Cell Research. 2012;1823:2297–2310. doi: 10.1016/j.bbamcr.2012.08.007. [DOI] [PubMed] [Google Scholar]
  34. Gillies RJ, Robey I, Gatenby RA. Causes and consequences of increased glucose metabolism of cancers. Journal of Nuclear Medicine. 2008;49:24S–42. doi: 10.2967/jnumed.107.047258. [DOI] [PubMed] [Google Scholar]
  35. Giorgi C, Baldassari F, Bononi A, Bonora M, De Marchi E, Marchi S, Missiroli S, Patergnani S, Rimessi A, Suski JM, Wieckowski MR, Pinton P. Mitochondrial ca(2+) and apoptosis. Cell Calcium. 2012;52:36–43. doi: 10.1016/j.ceca.2012.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Gonzalez FA, Rozengurt E, Heppel LA. Extracellular ATP induces the release of calcium from intracellular stores without the activation of protein kinase C in Swiss 3T6 mouse fibroblasts. PNAS. 1989;86:4530–4534. doi: 10.1073/pnas.86.12.4530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Guinney J, Dienstmann R, Wang X, de Reyniès A, Schlicker A, Soneson C, Marisa L, Roepman P, Nyamundanda G, Angelino P, Bot BM, Morris JS, Simon IM, Gerster S, Fessler E, De Sousa E Melo F, Missiaglia E, Ramay H, Barras D, Homicsko K, Maru D, Manyam GC, Broom B, Boige V, Perez-Villamil B, Laderas T, Salazar R, Gray JW, Hanahan D, Tabernero J, Bernards R, Friend SH, Laurent-Puig P, Medema JP, Sadanandam A, Wessels L, Delorenzi M, Kopetz S, Vermeulen L, Tejpar S. The consensus molecular subtypes of colorectal cancer. Nature Medicine. 2015;21:1350–1356. doi: 10.1038/nm.3967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Halestrap AP. What is the mitochondrial permeability transition pore? Journal of Molecular and Cellular Cardiology. 2009;46:821–831. doi: 10.1016/j.yjmcc.2009.02.021. [DOI] [PubMed] [Google Scholar]
  39. Hamanaka RB, Chandel NS. Mitochondrial reactive oxygen species regulate cellular signaling and dictate biological outcomes. Trends in Biochemical Sciences. 2010;35:505–513. doi: 10.1016/j.tibs.2010.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Han T, Kang D, Ji D, Wang X, Zhan W, Fu M, Xin HB, Wang JB. How does Cancer cell metabolism affect tumor migration and invasion? Cell Adhesion & Migration. 2013;7:395–403. doi: 10.4161/cam.26345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Hansford RG. Physiological role of mitochondrial Ca2+ transport. Journal of Bioenergetics and Biomembranes. 1994;26:495–508. doi: 10.1007/BF00762734. [DOI] [PubMed] [Google Scholar]
  42. Heijstek MW, Kranenburg O, Borel Rinkes IH. Mouse models of colorectal Cancer and liver metastases. Digestive Surgery. 2005;22:16–25. doi: 10.1159/000085342. [DOI] [PubMed] [Google Scholar]
  43. Hempel N, Trebak M. Crosstalk between calcium and reactive oxygen species signaling in Cancer. Cell Calcium. 2017;63:70–96. doi: 10.1016/j.ceca.2017.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Hudson CC, Liu M, Chiang GG, Otterness DM, Loomis DC, Kaper F, Giaccia AJ, Abraham RT. Regulation of hypoxia-inducible factor 1alpha expression and function by the mammalian target of rapamycin. Molecular and Cellular Biology. 2002;22:7004–7014. doi: 10.1128/MCB.22.20.7004-7014.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Isella C, Brundu F, Bellomo SE, Galimi F, Zanella E, Porporato R, Petti C, Fiori A, Orzan F, Senetta R, Boccaccio C, Ficarra E, Marchionni L, Trusolino L, Medico E, Bertotti A. Selective analysis of cancer-cell intrinsic transcriptional traits defines novel clinically relevant subtypes of colorectal Cancer. Nature Communications. 2017;8:15107. doi: 10.1038/ncomms15107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Izumiya M, Kabashima A, Higuchi H, Igarashi T, Sakai G, Iizuka H, Nakamura S, Adachi M, Hamamoto Y, Funakoshi S, Takaishi H, Hibi T. Chemoresistance is associated with Cancer stem Cell-like properties and Epithelial-to-Mesenchymal transition in pancreatic Cancer cells. Anticancer Research. 2012;32:3847–3853. [PubMed] [Google Scholar]
  47. Jin SM, Lazarou M, Wang C, Kane LA, Narendra DP, Youle RJ. Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL. The Journal of Cell Biology. 2010;191:933–942. doi: 10.1083/jcb.201008084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Kerkhofs M, Bittremieux M, Morciano G, Giorgi C, Pinton P, Parys JB, Bultynck G. Emerging molecular mechanisms in chemotherapy: Ca2+ signaling at the mitochondria-associated endoplasmic reticulum membranes. Cell Death & Disease. 2018;9:334. doi: 10.1038/s41419-017-0179-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Koval OM, Nguyen EK, Santhana V, Fidler TP, Sebag SC, Rasmussen TP, Mittauer DJ, Strack S, Goswami PC, Abel ED, Grumbach IM. Loss of MCU prevents mitochondrial fusion in G1-S phase and blocks cell cycle progression and proliferation. Science Signaling. 2019;12:eaav1439. doi: 10.1126/scisignal.aav1439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Law CW, Chen Y, Shi W, Smyth GK. Voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biology. 2014;15:R29. doi: 10.1186/gb-2014-15-2-r29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Lehmann S, Te Boekhorst V, Odenthal J, Bianchi R, van Helvert S, Ikenberg K, Ilina O, Stoma S, Xandry J, Jiang L, Grenman R, Rudin M, Friedl P. Hypoxia induces a HIF-1-Dependent transition from Collective-to-Amoeboid dissemination in epithelial Cancer cells. Current Biology. 2017;27:392–400. doi: 10.1016/j.cub.2016.11.057. [DOI] [PubMed] [Google Scholar]
  52. Liberti MV, Locasale JW. The warburg effect: how does it benefit Cancer cells? Trends in Biochemical Sciences. 2016;41:211–218. doi: 10.1016/j.tibs.2015.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Liu WJ, Ye L, Huang WF, Guo LJ, Xu ZG, Wu HL, Yang C, Liu HF. p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. Cellular & Molecular Biology Letters. 2016;21:29. doi: 10.1186/s11658-016-0031-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Lu H, Samanta D, Xiang L, Zhang H, Hu H, Chen I, Bullen JW, Semenza GL. Chemotherapy triggers HIF-1-dependent glutathione synthesis and copper chelation that induces the breast Cancer stem cell phenotype. PNAS. 2015;112:E4600–E4609. doi: 10.1073/pnas.1513433112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Luongo TS, Lambert JP, Gross P, Nwokedi M, Lombardi AA, Shanmughapriya S, Carpenter AC, Kolmetzky D, Gao E, van Berlo JH, Tsai EJ, Molkentin JD, Chen X, Madesh M, Houser SR, Elrod JW. The mitochondrial na+/Ca2+ exchanger is essential for Ca2+ homeostasis and viability. Nature. 2017;545:93–97. doi: 10.1038/nature22082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Marchi S, Lupini L, Patergnani S, Rimessi A, Missiroli S, Bonora M, Bononi A, Corrà F, Giorgi C, De Marchi E, Poletti F, Gafà R, Lanza G, Negrini M, Rizzuto R, Pinton P. Downregulation of the mitochondrial calcium uniporter by cancer-related miR-25. Current Biology. 2013;23:58–63. doi: 10.1016/j.cub.2012.11.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Marchi S, Corricelli M, Branchini A, Vitto VAM, Missiroli S, Morciano G, Perrone M, Ferrarese M, Giorgi C, Pinotti M, Galluzzi L, Kroemer G, Pinton P. Akt-mediated phosphorylation of MICU1 regulates mitochondrial Ca2+ levels and tumor growth. The EMBO Journal. 2019a;38:e99435. doi: 10.15252/embj.201899435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Marchi S, Vitto VAM, Danese A, Wieckowski MR, Giorgi C, Pinton P. Mitochondrial calcium uniporter complex modulation in cancerogenesis. Cell Cycle. 2019b;18:1068–1083. doi: 10.1080/15384101.2019.1612698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Masoud GN, Li W. HIF-1α pathway: role, regulation and intervention for Cancer therapy. Acta Pharmaceutica Sinica B. 2015;5:378–389. doi: 10.1016/j.apsb.2015.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. McCarthy DJ, Chen Y, Smyth GK. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Research. 2012;40:4288–4297. doi: 10.1093/nar/gks042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. McCormack JG, Halestrap AP, Denton RM. Role of calcium ions in regulation of mammalian intramitochondrial metabolism. Physiological Reviews. 1990;70:391–425. doi: 10.1152/physrev.1990.70.2.391. [DOI] [PubMed] [Google Scholar]
  63. Mognol GP, de Araujo-Souza PS, Robbs BK, Teixeira LK, Viola JP. Transcriptional regulation of the c-Myc promoter by NFAT1 involves negative and positive NFAT-responsive elements. Cell Cycle. 2012;11:1014–1028. doi: 10.4161/cc.11.5.19518. [DOI] [PubMed] [Google Scholar]
  64. Montero M, Alonso MT, Carnicero E, Cuchillo-Ibáñez I, Albillos A, García AG, García-Sancho J, Alvarez J. Chromaffin-cell stimulation triggers fast millimolar mitochondrial Ca2+ transients that modulate secretion. Nature Cell Biology. 2000;2:57–61. doi: 10.1038/35000001. [DOI] [PubMed] [Google Scholar]
  65. Muñoz-Nájar UM, Neurath KM, Vumbaca F, Claffey KP. Hypoxia stimulates breast carcinoma cell invasion through MT1-MMP and MMP-2 activation. Oncogene. 2006;25:2379–2392. doi: 10.1038/sj.onc.1209273. [DOI] [PubMed] [Google Scholar]
  66. Munro MJ, Wickremesekera SK, Peng L, Tan ST, Itinteang T. Cancer stem cells in colorectal Cancer: a review. Journal of Clinical Pathology. 2018;71:110–116. doi: 10.1136/jclinpath-2017-204739. [DOI] [PubMed] [Google Scholar]
  67. Ohata H, Shiokawa D, Obata Y, Sato A, Sakai H, Fukami M, Hara W, Taniguchi H, Ono M, Nakagama H, Okamoto K. NOX1-Dependent mTORC1 activation via S100A9 oxidation in Cancer Stem-like cells leads to Colon cancer progression. Cell Reports. 2019;28:1282–1295. doi: 10.1016/j.celrep.2019.06.085. [DOI] [PubMed] [Google Scholar]
  68. Palty R, Silverman WF, Hershfinkel M, Caporale T, Sensi SL, Parnis J, Nolte C, Fishman D, Shoshan-Barmatz V, Herrmann S, Khananshvili D, Sekler I. NCLX is an essential component of mitochondrial Na+/Ca2+ exchange. PNAS. 2010;107:436–441. doi: 10.1073/pnas.0908099107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Pan Y, Mansfield KD, Bertozzi CC, Rudenko V, Chan DA, Giaccia AJ, Simon MC. Multiple factors affecting cellular redox status and energy metabolism modulate hypoxia-inducible factor prolyl hydroxylase activity in vivo and in vitro. Molecular and Cellular Biology. 2007;27:912–925. doi: 10.1128/MCB.01223-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Pathak T, Trebak M. Mitochondrial Ca2+ signaling. Pharmacology & Therapeutics. 2018;192:112–123. doi: 10.1016/j.pharmthera.2018.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Paupe V, Prudent J. New insights into the role of mitochondrial calcium homeostasis in cell migration. Biochemical and Biophysical Research Communications. 2018;500:75–86. doi: 10.1016/j.bbrc.2017.05.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Pinton P, Giorgi C, Siviero R, Zecchini E, Rizzuto R. Calcium and apoptosis: ER-mitochondria Ca2+ transfer in the control of apoptosis. Oncogene. 2008;27:6407–6418. doi: 10.1038/onc.2008.308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Polyak K, Weinberg RA. Transitions between epithelial and mesenchymal states: acquisition of malignant and stem cell traits. Nature Reviews Cancer. 2009;9:265–273. doi: 10.1038/nrc2620. [DOI] [PubMed] [Google Scholar]
  74. Porporato PE, Filigheddu N, Pedro JMB, Kroemer G, Galluzzi L. Mitochondrial metabolism and cancer. Cell Research. 2018;28:265–280. doi: 10.1038/cr.2017.155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Ren T, Zhang H, Wang J, Zhu J, Jin M, Wu Y, Guo X, Ji L, Huang Q, Zhang H, Yang H, Xing J. MCU-dependent mitochondrial Ca2+ inhibits NAD+/SIRT3/SOD2 pathway to promote ROS production and metastasis of HCC cells. Oncogene. 2017;36:5897–5909. doi: 10.1038/onc.2017.167. [DOI] [PubMed] [Google Scholar]
  76. Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and cancer stem cells. Nature. 2001;414:105–111. doi: 10.1038/35102167. [DOI] [PubMed] [Google Scholar]
  77. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Research. 2015;43:e47. doi: 10.1093/nar/gkv007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139–140. doi: 10.1093/bioinformatics/btp616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Santulli G, Xie W, Reiken SR, Marks AR. Mitochondrial calcium overload is a key determinant in heart failure. PNAS. 2015;112:11389–11394. doi: 10.1073/pnas.1513047112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Schieffer KM, Choi CS, Emrich S, Harris L, Deiling S, Karamchandani DM, Salzberg A, Kawasawa YI, Yochum GS, Koltun WA. RNA-seq implicates deregulation of the immune system in the pathogenesis of diverticulitis. American Journal of Physiology-Gastrointestinal and Liver Physiology. 2017;313:G277–G284. doi: 10.1152/ajpgi.00136.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Schofield JH, Schafer ZT. Mitochondrial reactive oxygen species and mitophagy: a complex and nuanced relationship. Antioxidants & Redox Signaling. 2020;1:8058. doi: 10.1089/ars.2020.8058. [DOI] [PubMed] [Google Scholar]
  82. Semenza GL. Targeting HIF-1 for cancer therapy. Nature Reviews Cancer. 2003;3:721–732. doi: 10.1038/nrc1187. [DOI] [PubMed] [Google Scholar]
  83. Shin DH, Dier U, Melendez JA, Hempel N. Regulation of MMP-1 expression in response to hypoxia is dependent on the intracellular redox status of metastatic bladder cancer cells. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 2015;1852:2593–2602. doi: 10.1016/j.bbadis.2015.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2020. CA: A Cancer Journal for Clinicians. 2020;70:7–30. doi: 10.3322/caac.21590. [DOI] [PubMed] [Google Scholar]
  85. Singh G, Singh SK, König A, Reutlinger K, Nye MD, Adhikary T, Eilers M, Gress TM, Fernandez-Zapico ME, Ellenrieder V. Sequential activation of NFAT and c-Myc transcription factors mediates the TGF-beta switch from a suppressor to a promoter of Cancer cell proliferation. Journal of Biological Chemistry. 2010;285:27241–27250. doi: 10.1074/jbc.M110.100438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Starkov AA. The role of mitochondria in reactive oxygen species metabolism and signaling. Annals of the New York Academy of Sciences. 2008;1147:37–52. doi: 10.1196/annals.1427.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. PNAS. 2005;102:15545–15550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Tandon P, Gallo CA, Khatri S, Barger JF, Yepiskoposyan H, Plas DR. Requirement for ribosomal protein S6 kinase 1 to mediate glycolysis and apoptosis resistance induced by Pten deficiency. PNAS. 2011;108:2361–2365. doi: 10.1073/pnas.1013629108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Tennant DA, Duran RV, Boulahbel H, Gottlieb E. Metabolic transformation in cancer. Carcinogenesis. 2009;30:1269–1280. doi: 10.1093/carcin/bgp070. [DOI] [PubMed] [Google Scholar]
  90. Tennant DA, Durán RV, Gottlieb E. Targeting metabolic transformation for cancer therapy. Nature Reviews Cancer. 2010;10:267–277. doi: 10.1038/nrc2817. [DOI] [PubMed] [Google Scholar]
  91. Tosatto A, Sommaggio R, Kummerow C, Bentham RB, Blacker TS, Berecz T, Duchen MR, Rosato A, Bogeski I, Szabadkai G, Rizzuto R, Mammucari C. The mitochondrial calcium uniporter regulates breast Cancer progression via HIF-1α. EMBO Molecular Medicine. 2016;8:569–585. doi: 10.15252/emmm.201606255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Touil Y, Igoudjil W, Corvaisier M, Dessein AF, Vandomme J, Monté D, Stechly L, Skrypek N, Langlois C, Grard G, Millet G, Leteurtre E, Dumont P, Truant S, Pruvot FR, Hebbar M, Fan F, Ellis LM, Formstecher P, Van Seuningen I, Gespach C, Polakowska R, Huet G. Colon cancer cells escape 5fu chemotherapy-induced cell death by entering stemness and quiescence associated with the c-Yes/YAP Axis. Clinical Cancer Research. 2014;20:837–846. doi: 10.1158/1078-0432.CCR-13-1854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Trebak M, Kinet J-P. Calcium signalling in T cells. Nature Reviews Immunology. 2019;19:154–169. doi: 10.1038/s41577-018-0110-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  94. Tsai S-H, Huang P-H, Hsu Y-J, Peng Y-J, Lee C-H, Wang J-C, Chen J-W, Lin S-J. Inhibition of hypoxia inducible factor-1α attenuates abdominal aortic aneurysm progression through the down-regulation of matrix metalloproteinases. Scientific Reports. 2016;6:28612. doi: 10.1038/srep28612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Twig G, Shirihai OS. The interplay between mitochondrial dynamics and mitophagy. Antioxidants & Redox Signaling. 2011;14:1939–1951. doi: 10.1089/ars.2010.3779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  96. Vultur A, Gibhardt CS, Stanisz H, Bogeski I. The role of the mitochondrial calcium uniporter (MCU) complex in Cancer. Pflügers Archiv - European Journal of Physiology. 2018;470:1149–1163. doi: 10.1007/s00424-018-2162-8. [DOI] [PubMed] [Google Scholar]
  97. Vyas S, Zaganjor E, Haigis MC. Mitochondria and Cancer. Cell. 2016;166:555–566. doi: 10.1016/j.cell.2016.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  98. Wigerup C, Påhlman S, Bexell D. Therapeutic targeting of hypoxia and hypoxia-inducible factors in Cancer. Pharmacology & Therapeutics. 2016;164:152–169. doi: 10.1016/j.pharmthera.2016.04.009. [DOI] [PubMed] [Google Scholar]
  99. Wu H, Carvalho P, Voeltz GK. Here, there, and everywhere: the importance of ER membrane contact sites. Science. 2018;361:eaan5835. doi: 10.1126/science.aan5835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  100. Youle RJ, Narendra DP. Mechanisms of mitophagy. Nature Reviews Molecular Cell Biology. 2011;12:9–14. doi: 10.1038/nrm3028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  101. Zhang H, Bosch-Marce M, Shimoda LA, Tan YS, Baek JH, Wesley JB, Gonzalez FJ, Semenza GL. Mitochondrial autophagy is an HIF-1-dependent adaptive metabolic response to hypoxia. Journal of Biological Chemistry. 2008;283:10892–10903. doi: 10.1074/jbc.M800102200. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  102. Zhang X, Pathak T, Yoast R, Emrich S, Xin P, Nwokonko RM, Johnson M, Wu S, Delierneux C, Gueguinou M, Hempel N, Putney JW, Gill DL, Trebak M. A calcium/cAMP signaling loop at the ORAI1 mouth drives channel inactivation to shape NFAT induction. Nature Communications. 2019;10:1971. doi: 10.1038/s41467-019-09593-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  103. Zhang J, Ney PA. Role of BNIP3 and NIX in cell death, autophagy, and mitophagy. Cell Death & Differentiation. 2009;16:939–946. doi: 10.1038/cdd.2009.16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  104. Zhao J. Cancer stem cells and chemoresistance: The smartest survives the raid. Pharmacology & Therapeutics. 2016;160:145–158. doi: 10.1016/j.pharmthera.2016.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Mark T Nelson1
Reviewed by: Mark T Nelson2

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

The authors tell a convincing story about the functional consequences of Na/Ca/Li exchanger (NCLX) downregulation in colorectal cancer cells (CRC), showing that, although loss of NCLX suppresses cancer cell proliferation, it also enhances cell migratory behavior. Thus, the NCLX downregulation in CRC exerts a net detrimental effect owing to an associated increase in metastatic potential. Overall, these findings significantly advance our understanding of the contribution of mitochondrial Ca2+ dynamics to CRC progression and suggest NCLX as a potential therapeutic target

Decision letter after peer review:

Thank you for submitting your article "Dichotomous role of the mitochondrial Na+/Ca2+/Li+ exchanger NCLX in colorectal cancer growth and metastasis" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Mark T Nelson as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by a Reviewing Editor and Richard Aldrich as the Senior Editor.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand, or to explicitly state that the relevant conclusions require additional supporting data.

Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in eLife, either of which would be linked to the original paper.

Summary:

In their manuscript, Pathak/Gueguinou et al. investigate the role of the mitochondrial Na+/Ca2+ exchanger, NCLX, in colorectal cancer (CRC) cell proliferation and invasion. The primary experimental models used to address these questions include colon cancer cell lines (HCT226, DLD1) in which NCLX was constitutively knocked out (CRISPR/Cas9) or transiently knocked down (siRNA), as well as NCLX-/- mice in which NCLX was knocked out globally using the CRISPR/Cas9 system. The authors found that NCLX expression is downregulated in colorectal tumors from CRC patients, exhibiting a greater decrease in advanced-stage patients, and showed that NLCX knockout in mice resulted in fewer, smaller tumors in a DSS-induced colonic tumor model. NLCX knockout/knockdown in vitro caused mitochondrial Ca2+ (mtCa2+) overload owing to abrogated NLCX-mediated mtCa2+ efflux in the context of largely unchanged MCU-mediated Ca2+ influx into mitochondria and, as a consequence, led to overproduction of reactive oxygen species (ROS). It also disrupted mitochondrial membranes and cristae, induced expression of mitophagy markers, caused mitochondrial membrane depolarization, and negatively affected respiratory reserve. Notably, they found that NLCX knockout/knockdown suppressed proliferation of CRC cells, but enhanced CRC cell migration; it also increased chemoresistance and expression of genes involved in epithelial-to-mesenchymal transition and hypoxia (i.e., hypoxia-inducible factor 1α [HIF1α]), as well as stem cell-related genes. The authors conclude that loss of NCLX expression and accompanying mitochondrial Ca2+ overload drives the metastatic behavior of CRC cells through ROS-dependent activation of HIF1α and altered expression of HIF1α target genes.

Essential revisions:

Overall

Using a broad range of experimental approaches, the authors tell a convincing story about the functional consequences of NCLX downregulation in CRC, showing that, although loss of NCLX suppresses cancer cell proliferation, it also enhances cell migratory behavior. Thus, the NCLX downregulation in CRC exerts a net detrimental effect owing to an associated increase in metastatic potential. The experimental models (wild-type and NCLX-KO/KD CRC cells, wild-type and NCLX-/- mouse DSS-induced colonic tumor models, patient-derived CRC tumors) are complementary and generally appropriate, and the conclusions follow logically from the results. Overall, these findings significantly advance our understanding of the contribution of mitochondrial Ca2+ dynamics to CRC progression and suggest NCLX as a potential therapeutic target.

General comments

A unified approach should be applied to the presentation of results from the various HT116 and DLD1 NCLX-KO clones. In some cases, results from all NCLX-KO clones are shown in figure panels, but in others, results from only a subset (or even just one) clone are presented. Results from all clones should be shown throughout or results from a representative clone (or clones) of each cell type should be consistently shown. Choosing to show results from one clone but not others in some experimental settings leaves the impression of cherry picking.

Awkward phrasing and grammatical errors are frequent enough to significantly impact readability and occasionally obscure meaning. Recommend additional editing efforts.

1) Only circumstantial evidence supports the claim that NCLX expression controls tumor progression via matrix calcium. It has to be shown that MCU deletion prevents the effect of NCLX in colorectal tumor cells in at least in one of the paradigms. The Authors propose that the effect of NCLX targeting on the tumor growth and metastasis formation is mediated through mitochondrial matrix [Ca2+]. However, an alternative possibility is that NCLX per se has a function in the tumors. Studying the MCU-deficient cells would help to discriminate between these distinct possibilities. Losing the tumor growth/metastasis effects of NCLX targeting in MCU-deficient cells would directly support the Authors' proposal, and the opposite result would be conclusive evidence that NCLX is relevant for the tumors independent of matrix calcium signaling.

After discussion, the reviewers felt that conclusion should be rephrased to leave open the possibility that the NCLX effect is not mediated through matrix [Ca2+].

2) Although the results of Figure 2 are very interesting, the reasons that an intrasplenic injection was chosen are not explained. In this model, metastasis to the colon was measured and not the other way around. Some discussion of why this injection site was chosen and of the limitations of this system would be helpful to better appreciate this experiment.

3) In Figure 3—figure supplement 1L, there appears to be a several-fold increase in cleaved caspase 3 positive cells. For some reason, this is reported as a slight increase in apoptosis and then discounted. I don't quite understand the reasons for this conclusion. The average number of cells exhibiting cleaved caspase 3 increases from less than 10% to around 30%. Why can't this be responsible for the decrease in total cell number over time? Particularly when you consider the growth curves were not logarithmic, which could be explained by apoptosis?

4) Also, in Figure 3, there is a statement that differences in MMP activity are greater than differences in MMP expression. This statement can be easily tested statistically; please do so or remove the statement.

5) The basis for the statement that mitophagy is increased in NCLX-KO cells is unclear to me based on the data shown in Figure 4 and Figure 4—figure supplement 2. Evidence is provided that mitochondria are damaged and exhibit less cristae. It is shown that there is more LC3BII, which could indicate the presence of more autophagic vesicles, however, there is also increased P62 expression in Figure 4; P62 is degraded during autophagy. There is also no loss of total mitochondria as shown in Figure 4D. As such, while these data definitely show mitochondrial damage, I do not understand the reasons for attributing it to increased mitophagy.

6) In the Discussion section, there is a statement that reduced expression of cell cycle-related genes in NCLX-KO cells is consistent with decreased proliferation. Does this refer to decreased expression of genes associated with the G2/M checkpoint? If so, the data shown isn't entirely sufficient to make this claim; are the genes that are downregulated within the G2/M checkpoint category all genes that promote proliferation?

7) Figure 3—figure supplement 1L: Was the increase in cleaved caspase-3 detected in all three HT116 clones, or was only clone #33 tested?

8) In the absence of more direct approaches for assessing apoptosis, the suggestion that apoptosis is generally increased in NCLX-KO CRC cells based on an increase in cleaved caspase-3 (as implied by the text) is an overinterpretation.

9) "Collectively, these results show that the loss of NCLX in CRC cells causes an increase in migration and invasion of CRC cells through increased MMP1, 2, and 9 protein levels and activity." This conclusion should be toned down. No experiments capable of establishing a causal relationship between MMP increases and migration/invasion (MMP KO, MMP inhibitors, etc.) were done. At best, these expression and zymography data are suggestive of the involvement of MMPs.

10) Figure 3: Despite the fact that MMP1 showed the strongest increase in protein expression among the three MMPs tested (Figure 3L,M), zymography results are only shown for MMP2 and MMP9. Why?

11) Loss of NCLX in CRC cells inhibits mtCa2+ extrusion, causes mitochondrial perturbations, and enhances mitophagy and mitochondrial ROS.

12) "While basal and ATP-dependent OCR were slightly decreased…"

No. In the main figure (Figure 4K), basal OCR was significantly decreased whereas ATP-dependent OCR was not. "Slightly decreased" is a vague phrase that cannot be used to simultaneously describe both significant and non-significant differences (any "difference" that does not reach statistical significance should be described as a trend or tendency).

13) Although the different DLD1 clones yielded OCR results that were generally consistent with each other (Figure 4—figure supplement 2), exhibiting significant decreases in basal, spare, ATP-dependent and max OCR, they differed from those of clone #33 HCT116 NCLX-KO cells with respect to ATP-dependent OCR (Figure 4K). Curiously, although results for all HCT116 NCLX-KO clones were presented in Figure 4A,D,E,F,G,H and I, data for HCT116 NCLX-KO clones #37 and #59 were not shown in Figure 4K, making it difficult to gauge the significance of this discrepancy. These additional data should be shown.

14) "non-significant reduction" is an oxymoron: if it isn't significant, it isn't a reduction. Modifying this phrase with "mild" just further confuses the issue.

15) In the seahorse experiments, every parameter seems to be lower in the NCLX-KO (basal, oligomyicin, uncoupled and even after Rotenone/Antimycin), this raises the concern that such a reduction could be caused simply by a lower total number of cells at the moment of the experiment (due to attachment, growth, cell death, etc) or lower number of mitochondria. While the latter is trickier to assess, the former can be done by washing the wells in the seahorse plates with PBS to remove dead/detached cells and then doing protein extraction from the wells with RIPA buffer (and use that to normalize the values rather than the amount of cells plated, which could vary between the groups due to cell attachment, death and growth during the short time they stay in culture in the plates).

16) Why is colorectal cancer chosen to study the effect of NCLX expression? Did the authors have some prior knowledge or some supporting data of the involvement of NCLX in colorectal cancer specifically?

Do the risk factors of colorectal cancer like smoking, alcohol consumption or genetic predisposition have any effect on NCLX expression levels? From the data set available to the authors or the patient samples available (if the patient background history is available), can something be concluded in this respect?

17) NCLX loss (1) inhibits proliferation and primary tumor growth, while (2) enhancing metastasis, and drug resistance, suggesting that a loss of NCLX contributes to CRC metastatic progression. How is the expression of NCLX different (if any) in the metastatic part of the tumor (i.e. at the secondary site of the tumor)?

18) Do all samples obtained from patients with colorectal cancer or the information available in the database have NCLX dowregulation? If no, then what percentage of the available dataset has this NCLX downregulation?

eLife. 2020 Sep 11;9:e59686. doi: 10.7554/eLife.59686.sa2

Author response


Essential revisions:

Overall

Using a broad range of experimental approaches, the authors tell a convincing story about the functional consequences of NCLX downregulation in CRC, showing that, although loss of NCLX suppresses cancer cell proliferation, it also enhances cell migratory behavior. Thus, the NCLX downregulation in CRC exerts a net detrimental effect owing to an associated increase in metastatic potential. The experimental models (wild-type and NCLX-KO/KD CRC cells, wild-type and NCLX-/- mouse DSS-induced colonic tumor models, patient-derived CRC tumors) are complementary and generally appropriate, and the conclusions follow logically from the results. Overall, these findings significantly advance our understanding of the contribution of mitochondrial Ca2+ dynamics to CRC progression and suggest NCLX as a potential therapeutic target.

General comments

A unified approach should be applied to the presentation of results from the various HT116 and DLD1 NCLX-KO clones. In some cases, results from all NCLX-KO clones are shown in figure panels, but in others, results from only a subset (or even just one) clone are presented. Results from all clones should be shown throughout or results from a representative clone (or clones) of each cell type should be consistently shown. Choosing to show results from one clone but not others in some experimental settings leaves the impression of cherry picking.

To address this concern, we have performed additional studies for the missing HCT116 and DLD1 clones. Now we show results from all 6 clones (3 clones of each HCT116 and DLD1 cells). These are now shown in Figure 3—figure supplement 1L; Figure 4L; Figure 4M; Figure 4—figure supplement 2F and Figure 5—figure supplement 2G.

Awkward phrasing and grammatical errors are frequent enough to significantly impact readability and occasionally obscure meaning. Recommend additional editing efforts.

Thank you. We have taken every effort to correct typos and grammatical errors in the manuscript.

1) Only circumstantial evidence supports the claim that NCLX expression controls tumor progression via matrix calcium. It has to be shown that MCU deletion prevents the effect of NCLX in colorectal tumor cells in at least in one of the paradigms. The Authors propose that the effect of NCLX targeting on the tumor growth and metastasis formation is mediated through mitochondrial matrix [Ca2+]. However, an alternative possibility is that NCLX per se has a function in the tumors. Studying the MCU-deficient cells would help to discriminate between these distinct possibilities. Losing the tumor growth/metastasis effects of NCLX targeting in MCU-deficient cells would directly support the Authors' proposal, and the opposite result would be conclusive evidence that NCLX is relevant for the tumors independent of matrix calcium signaling.

We have extensively studied the role of MCU in colorectal cancer progression and found that MCU deficient cells present the opposite phenotype (i.e. reduced metastasis) as compared to NCLX deficient CRC cells. These extensive data on MCU, which validate the role of mtCa2+ in CRC, are substantial and warrant their own manuscript. We are in the process of finalizing a manuscript on the role of MCU in colorectal cancer progression.

After discussion, the reviewers felt that conclusion should be rephrased to leave open the possibility that the NCLX effect is not mediated through matrix [Ca2+].

A statement has been added in the Discussion section stating that the role of MCU has to be tested in CRC progression to establish that mtCa2+ is required CRC growth.

2) Although the results of Figure 2 are very interesting, the reasons that an intrasplenic injection was chosen are not explained. In this model, metastasis to the colon was measured and not the other way around. Some discussion of why this injection site was chosen and of the limitations of this system would be helpful to better appreciate this experiment.

The main aim of the xenograft model is to understand the role of NCLX in regulating metastatic property of colorectal cancer in vivo. No xenograft model is 100% perfect. Intrasplenic injection is a well-established method to study metastasis to the liver for example. The advantage of this model is that we can monitor metastasis to both colon and liver. The only known limitation of this model is that the overall efficiency of liver metastasis and colonization is low (Heijstek, Kranenburg and Borel Rinkes, 2005). There is a model that tests metastasis from the colon to distant sites but this model is not within the expertise of our laboratory. A couple of sentences have been added to the Results section on page 6 to explain why we used this model.

3) In Figure 3—figure supplement 1L, there appears to be a several-fold increase in cleaved caspase 3 positive cells. For some reason, this is reported as a slight increase in apoptosis and then discounted. I don't quite understand the reasons for this conclusion. The average number of cells exhibiting cleaved caspase 3 increases from less than 10% to around 30%. Why can't this be responsible for the decrease in total cell number over time? Particularly when you consider the growth curves were not logarithmic, which could be explained by apoptosis?

We completely agree that the cleaved caspase 3 staining in NCLX KO cell was increased significantly and this is a clear indication of apoptosis that might contribute to the reduced tumor size. We have added the cleaved caspase 3 staining quantification from the other two clones #37 and #59 of HCT116 NCLX KO cells. These clones also show a significant increase in cleaved caspase3 staining. However, we were not able to confirm this result by western or Annexin V staining, because we discovered from our metabolomics screen that the lipid profile, including phosphatidylserine levels were altered in NCLX KO cells. Therefore, we think that apoptosis has a role in reduced tumor phenotype of NCLX KO cells, but it might not be the only player in this particular case.

4) Also, in Figure 3, there is a statement that differences in MMP activity are greater than differences in MMP expression. This statement can be easily tested statistically; please do so or remove the statement.

The statement has been removed.

5) The basis for the statement that mitophagy is increased in NCLX-KO cells is unclear to me based on the data shown in Figure 4 and Figure 4—figure supplement 2. Evidence is provided that mitochondria are damaged and exhibit less cristae. It is shown that there is more LC3BII, which could indicate the presence of more autophagic vesicles, however, there is also increased P62 expression in Figure 4; P62 is degraded during autophagy. There is also no loss of total mitochondria as shown in Figure 4D. As such, while these data definitely show mitochondrial damage, I do not understand the reasons for attributing it to increased mitophagy.

We agree that the increased LC3BII and p62 levels clearly indicate that the there is an increase of autophagosome formation, and this does not mean that there is increased mitophagy in NCLX KO cells. Electron micrograph images shows that NCLX KO cells have significantly more autophagosomes than control HCT116 cells. While the number of mitophagosomes was increased in NCLX KO clones, this increase was not statistically significant compared to control HCT116 cells. Therefore, we have modified the interpretation of Figure 4 and added statements in the Discussion section, indicating that more experiments are required to determine the fate of damaged mitochondria of NCLX KO cells.

6) In the Discussion section, there is a statement that reduced expression of cell cycle-related genes in NCLX-KO cells is consistent with decreased proliferation. Does this refer to decreased expression of genes associated with the G2/M checkpoint? If so, the data shown isn't entirely sufficient to make this claim; are the genes that are downregulated within the G2/M checkpoint category all genes that promote proliferation?

Yes, the genes shown in the heatmap in Figure 5—figure supplement 1D positively regulate cell proliferation or regulates transition from G2/M. Reduction in any of those genes will lead to reduced proliferation or cell cycle arrest. However, we acknowledge that the RNAseq data must be validated by qRT-PCR or western to confirm the downregulation of these genes.

7) Figure 3—figure supplement 1L: Was the increase in cleaved caspase-3 detected in all three HT116 clones, or was only clone #33 tested?

In the first version of the manuscript, only one clone was tested. However, we now have stained the clone #37 and #59 for cleaved caspase-3 and added the data in Figure 3—figure supplement 1L.

8) In the absence of more direct approaches for assessing apoptosis, the suggestion that apoptosis is generally increased in NCLX-KO CRC cells based on an increase in cleaved caspase-3 (as implied by the text) is an overinterpretation.

Yes, we agree with the reviewer’s suggestion and have adjusted our conclusion. We have added statements in the Discussion section, stating that more direct approaches are required to confirm that the deletion of NCLX causes apoptosis in CRC cells.

9) "Collectively, these results show that the loss of NCLX in CRC cells causes an increase in migration and invasion of CRC cells through increased MMP1, 2, and 9 protein levels and activity." This conclusion should be toned down. No experiments capable of establishing a causal relationship between MMP increases and migration/invasion (MMP KO, MMP inhibitors, etc.) were done. At best, these expression and zymography data are suggestive of the involvement of MMPs.

We have toned down the conclusion and changed the word “show that” to “suggest that” in subsection “Loss of NCLX inhibits proliferation but enhances migration and invasion of CRC cells” in results related to Figure 3.

10) Figure 3: Despite the fact that MMP1 showed the strongest increase in protein expression among the three MMPs tested (Figure 3L,M), zymography results are only shown for MMP2 and MMP9. Why?

Both MMP2 and MMP9 degrade gelatin and their activity can be tested by using publicly available gelatin zymograms. MMP1 does not act on gelatin, but on collagen. Therefore, collagen zymograms are required to test the activity of MMP1. The collagen zymograms are not available for purchase and making theses collagen zymograms is beyond the expertise of our lab.

11) Loss of NCLX in CRC cells inhibits mtCa2+ extrusion, causes mitochondrial perturbations, and enhances mitophagy and mitochondrial ROS.

We agree with this comment. We have removed the term mitophagy from the sentence.

12) "While basal and ATP-dependent OCR were slightly decreased…"

No. In the main figure (Figure 4K), basal OCR was significantly decreased whereas ATP-dependent OCR was not. "Slightly decreased" is a vague phrase that cannot be used to simultaneously describe both significant and non-significant differences (any "difference" that does not reach statistical significance should be described as a trend or tendency).

We have changed the statement in the Results section.

13) Although the different DLD1 clones yielded OCR results that were generally consistent with each other (Figure 4—figure supplement 2), exhibiting significant decreases in basal, spare, ATP-dependent and max OCR, they differed from those of clone #33 HCT116 NCLX-KO cells with respect to ATP-dependent OCR (Figure 4K). Curiously, although results for all HCT116 NCLX-KO clones were presented in Figure 4A,D,E,F,G,H and I, data for HCT116 NCLX-KO clones #37 and #59 were not shown in Figure 4K, making it difficult to gauge the significance of this discrepancy. These additional data should be shown.

We have added data on HCT116 NCLX KO #37 and #59 in Figure 4. Similar to HCT116 NCLX KO #33, the ATP-dependent OCR remains unaltered in HCT116 NCLX KO #37 and #59.

14) "non-significant reduction" is an oxymoron: if it isn't significant, it isn't a reduction. Modifying this phrase with "mild" just further confuses the issue.

We have changed the sentence from non-significant reduction in proliferation to “it did not affect the proliferation” in subsection “NCLX deficiency causes stem cell-like phenotype and chemoresistance of CRC cells”.

15) In the seahorse experiments, every parameter seems to be lower in the NCLX-KO (basal, oligomyicin, uncoupled and even after Rotenone/Antimycin), this raises the concern that such a reduction could be caused simply by a lower total number of cells at the moment of the experiment (due to attachment, growth, cell death, etc) or lower number of mitochondria. While the latter is trickier to assess, the former can be done by washing the wells in the seahorse plates with PBS to remove dead/detached cells and then doing protein extraction from the wells with RIPA buffer (and use that to normalize the values rather than the amount of cells plated, which could vary between the groups due to cell attachment, death and growth during the short time they stay in culture in the plates).

We agree with the reviewer’s comment. We have added new seahorse experiments from HCT116 NCLX KO #37 and #59 clones in Figure 4L,M. In this experiment we have normalized the OCR values with the protein amount. After normalization, we observe a significant reduction in spare respiratory capacity and maximal respiration in HCT116 NCLX KO #37and #59 clones. However, basal respiration appears to be similar to that of HCT116 control.

16) Why is colorectal cancer chosen to study the effect of NCLX expression? Did the authors have some prior knowledge or some supporting data of the involvement of NCLX in colorectal cancer specifically?

Do the risk factors of colorectal cancer like smoking, alcohol consumption or genetic predisposition have any effect on NCLX expression levels? From the data set available to the authors or the patient samples available (if the patient background history is available), can something be concluded in this respect?

When we analyzed the TCGA data of colorectal cancer patient to determine the differential expression of calcium handling proteins, we observed a significant reduction of NCLX mRNA levels in the patient samples as compared to adjacent normal tissue. Unfortunately, we did not observe a correlation between smoking, alcohol consumption, genetic predisposition and NCLX mRNA levels in colorectal cancer patient samples.

17) NCLX loss (1) inhibits proliferation and primary tumor growth, while (2) enhancing metastasis, and drug resistance, suggesting that a loss of NCLX contributes to CRC metastatic progression. How is the expression of NCLX different (if any) in the metastatic part of the tumor (i.e. at the secondary site of the tumor)?

We have analyzed the NCLX mRNA levels in primary tumors from patients both at early and late stages of CRC. We could not analyze NCLX mRNA levels in the secondary site of tumors because tissues from secondary tumors of CRC patients are not readily available.

18) Do all samples obtained from patients with colorectal cancer or the information available in the database have NCLX dowregulation? If no, then what percentage of the available dataset has this NCLX downregulation?

Yes, in the case of patient samples, 100% of tumor tissues analyzed had a significant reduction in NCLX mRNA level compared to their respective adjacent normal tissue. The data are represented in Figure 1B and 1G.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Source data Figure 1.
    Figure 2—source data 1. Source data Figure 2.
    Figure 3—source data 1. Source data Figure 3.
    Figure 3—figure supplement 1—source data 1. Source data Figure 3—figure supplement 1.
    Figure 4—source data 1. Source data Figure 4.
    elife-59686-fig4-data1.xlsx (329.2KB, xlsx)
    Figure 4—figure supplement 1—source data 1. Source Data Figure 4—figure supplement 1.
    Figure 4—figure supplement 1—source data 2. Source Data Figure 4—figure supplement 2.
    Figure 5—source data 1. Source data Figure 5.
    Figure 5—figure supplement 1—source data 1. Source Data Figure 5—figure supplement 1.
    Figure 6—source data 1. Source data Figure 6.
    Figure 6—figure supplement 1—source data 1. Source Data Figure 6—figure supplement 1.
    Figure 7—source data 1. Source data Figure 7.
    Figure 7—figure supplement 1—source data 1. Source Data Figure 7—figure supplement 1.
    Supplementary file 1. Genomic sequencing of NCLX KO clones of HCT116 and DLD1 cells.

    This file shows the genome sequencing of NCLX KO clones #33, #37, and #59 of HCT116 and #06, #24, and #32 of DLD1 cells. For genomic sequencing, PCR was performed to amplify specific parts of the NCLX gene using primers listed in the key resources table. The primers used for cloning genomic DNA from HCT116 cells were PX75 NCLX test F and PX76 NCLX test R. The primers used for cloning genomic DNA from DLD1 cells were NCLX_4 and NCLX_5. PCR products were cloned using StrataClone Blunt PCR Cloning Kit and sent to Genewiz for sanger sequencing. The genome sequencing data for the HCT116 NCLX KO clones confirm the introduction of STOP codons in coding sequences of HCT116 NCLX KO #33 at predicted positions 181-183 bp and 184-186 bp, in HCT116 NCLX KO #37 at 16-18 bp and 46-48 bp, and in HCT116 NCLX KO #59 at 31-33 bp, and 52-54 bp. Furthermore, the genomic sequencing of NCLX KO clones of DLD1 cells showed that the middle ~32 kb portion of the NCLX gene was deleted in all clones. Therefore, providing decisive evidence that these cells are indeed NCLX KO.

    elife-59686-supp1.docx (27KB, docx)
    Source data 1. Source data RNAseq_HCT116_HCT116 NCLX KO.
    elife-59686-data1.xlsx (1,003.4KB, xlsx)
    Transparent reporting form

    Data Availability Statement

    No large data sets have been generated from the current study. All data generated or analysed during this study are included in the manuscript and supporting files. Source data files for all figures and figure supplements have been provided in Source data 1.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES