Pre-treatment twice with liposomal clodronate protects against acetaminophen hepatotoxicity through a pre-conditioning effect

Abstract

Background and Aim:

Acetaminophen (APAP) overdose is a major cause of acute liver injury, but the role of macrophages in propagation of the hepatotoxicity is controversial. Early research revealed that macrophage inhibitors protect against APAP injury. However, later work demonstrated that macrophage ablation by acute pre-treatment with liposomal clodronate (LC) exacerbates the toxicity. To our surprise, during other studies, we observed that pre-treatment twice with LC seemed to protect against APAP hepatotoxicity, in contrast to acute pre-treatment. The aim of this study was to confirm that observation and to explore the mechanisms.

Methods:

We treated mice with empty liposomes (LE) or LC twice per week for 1 week before APAP overdose and collected blood and liver tissue at 0, 2, and 6 h post-APAP. We then measured liver injury (serum ALT activity, histology), APAP bioactivation (total glutathione, APAP-protein adducts), oxidative stress (oxidized glutathione [GSSG]), glutamate cysteine-ligase subunit c (Gclc) mRNA, and nuclear factor erythroid 2-related factor (Nrf2) immunofluorescence. We also confirmed ablation of macrophages by F4/80 immunohistochemistry.

Results:

Pre-treatment twice with LC dramatically reduced F4/80 staining, protected against liver injury, and reduced oxidative stress at 6 h post-APAP, without affecting APAP bioactivation. Importantly, Gclc mRNA was higher in the LC group at 0 h and total glutathione was higher at 2 h, indicating accelerated glutathione re-synthesis after APAP overdose due to greater basal glutamate-cysteine ligase. Oxidative stress was lower in the LC groups at both time points. Finally, total Nrf2 immunofluorescence was higher in the LC group.

Conclusions:

We conclude that multiple pre-treatments with LC protect against APAP by accelerating glutathione re-synthesis through glutamate-cysteine ligase. Investigators using two or possibly more LC pre-treatments to deplete macrophages, including peritoneal macrophages, should be aware of this possible confounder.

Introduction

Acetaminophen (APAP) is one of the most used over-the-counter medications in the United States.¹ However, APAP overdose is the major cause of drug-induced liver injury, acute liver failure (ALF) and related deaths.² After APAP overdose, the initial injury is followed by liver regeneration and repair, and the ability of the liver to recover ultimately determines patient outcomes.³ Currently, there is only one treatment for APAP overdose, N-acetyl-cysteine (NAC). But NAC loses efficacy after 10 h and many patients seek medical attention later, when NAC is no longer effective and the only option is supportive care or a liver transplant.^4–6

The mechanisms of APAP-induced hepatocyte injury have been thoroughly studied, though some important questions remain. Briefly, therapeutic doses of APAP are primarily glucuronidated and sulfated in hepatocytes, with a small percentage metabolized by cytochrome P450 enzymes, predominately Cyp2e1, leading to formation of the reactive metabolite N-acetyl-p-benzoquinone imine (NAPQI). NAPQI is then detoxified by glutathione. After APAP overdose, however, accumulation of NAPQI leads to the depletion of glutathione and binding to cellular proteins to form protein adducts within hepatocytes.^7–10 Protein adduct formation primarily affects mitochondrial proteins and results in mitochondrial oxidative stress, impairment of mitochondrial respiration, loss of mitochondrial membrane potential, and activation of cell death signaling pathways.^11–24

The significance of non-parenchymal cells in APAP-induced liver injury is less clear. In particular, the role of macrophages is controversial. Early studies revealed that inhibitors of macrophage activation decrease APAP hepatotoxicity.^25–26 However, it was later demonstrated that ablation of Kupffer cells (KCs) by acute pre-treatment with liposome-entrapped clodronate (LC) either worsened or had no effect on the liver injury and knockout of the enzyme in KCs responsible for ROS production also had no effect.^27–31 These data indicate that KCs are either not involved in APAP-induced liver injury or are protective.

During another study, we incidentally observed that pre-treatment twice with LC reduced liver injury after APAP overdose in mice. We were surprised by that result, considering the prior data demonstrating that acute pre-treatment worsens injury or has no effect. In this study, we sought to confirm the protection with repeated administration and to explore the mechanism. We conclude that the multiple LC pre-treatment regimen had a pre-conditioning effect, resulting in increased re-synthesis of liver glutathione after APAP overdose due to a stress response and therefore greater protection against oxidative stress.

Materials and Methods

Animals

Male C57BL/6J mice between the ages of 8 and 12 weeks were purchased from Jackson Laboratory (Bar Harbor, ME, USA). Mice were kept in a temperature-controlled 12 h light/dark cycle room with free access to food and water. For most experiments, mice (n = 5–6 per group) were pre-treated i.p. with 180 uL of 17 mM liposomal clodronate (LC) or empty liposome control (LE) (Clodrosome, Brentwood, TN, USA) twice per week (once on Tuesday, once on Friday) for 1 week before APAP (Sigma, St. Louis, MO, USA) treatment (the following Tuesday). Mice were then fasted overnight prior to i.p. injection of 250 mg/kg APAP at 0 h. Blood and liver tissue were collected at 0, 2 and 6 h. In another experiment, mice (n = 5 per group) were given a single dose of 180 μL of 17 mM LC or LE i.v. (tail vein) approximately 24 h before APAP overdose. Blood and liver tissue were collected at 6 h post-APAP. All study protocols were approved by the Institutional Animal Care and Use Committee of the University of Arkansas for Medical Sciences.

Clinical chemistry and biochemical analyses

Alanine aminotransferase (ALT) was measured in serum using a kit from Point Scientific, Inc. (Canton, MI, USA), according to the manufacturer’s instructions. Total glutathione (GSH + GSSG) and oxidized glutathione (GSSG) were measured using a modified Tietze assay, as previously described.³³ Some liver tissue pieces were fixed in 10% phosphate-buffered formalin for histology, while others were flash-frozen in liquid nitrogen and stored at −80°C for later biochemical analysis.

APAP-protein adducts

APAP-protein adducts were measured by high pressure liquid chromatography (HPLC) with electrochemical detection, as previously described.^10,34

Immunoblotting

Immunoblotting of liver homogenates was performed according to a protocol previously reported.³⁵ Primary monoclonal antibodies were purchased from Cell Signaling Technology (Danvers, MA): p-JNK (Cat. No. 4668) and JNK (Cat. No. 9252). Secondary antibodies were purchased from LiCor Biosciences (Lincoln, NE): IRDye 680 goat anti-mouse IgG (Cat. No. 926–68070) and IRDye 800CW goat anti-rabbit IgG (Cat. No. 926–32211). Primary and secondary antibodies were used at 1:1,000 and 1:10,000 dilutions, respectively.

Immunohistochemistry and immunofluorescence

For nuclear factor erythroid 2-related factor (Nrf2) immunofluorescence, formalin-fixed tissues were embedded in paraffin wax and 5 μm sections were mounted on glass slides. The tissues were then deparaffinized in xylene and rehydrated in 100% ethanol for 10 min followed by 95% ethanol for an additional 10 min. Antigen unmasking was performed by boiling tissues in 10 mM sodium citrate buffer, pH 6.0, for 10 min. Quenching of endogenous peroxidase activity in liver tissues was performed by placing slides in 3% hydrogen peroxide for 10 min. Tissues were then permeabilized and blocked using Image-it Fix-Perm kit from Life Technologies (Eugene, OR), according to the manufacturer’s instructions. Primary antibody against Nrf2 was purchased from Cell Signaling Technology (Danvers, MA) and used at 1:400 dilution in antibody dilution buffer (1x phosphate buffer solution (PBS), 1% bovine serum albumin, 0.3% Triton X-100). Secondary antibody, anti-rat Alexa Fluor 488 from Cell Signaling Technology (Danvers, MA), was used at 1:2,000 dilution in antibody dilution buffer. Slide mounting and visualization of nuclei with DAPI was performed using Vectashield Hardset from Vector Laboratories (Burlinggame, CA). Images were collected using a ZOE Fluorescent Cell Imager (Bio-Rad, Hercules, CA). The images were collected the same day using the same settings for light intensity, exposure, and gain to enable comparison between groups. For F4/80 IHC, primary F4/80 antibody from Cell Signaling Technology (Danvers, MA) was used at 1:250 dilution. Goat anti-mouse secondary antibody was added at 1:400 dilution in TBS-T.

qPCR

Tissues were processed and analyzed according to a protocol previously reported.³⁵ Real-time qPCR was performed for glutamate-cysteine ligase subunit c (Gclc) with forward primer ATCTGCAAAGGCGGCAAC and reverse primer ACTCCTCTGCAGCTGGCTC. Gclc was normalized to Gapdh with forward primer AGGTCGGTGTGAACGGATTTG and reverse primer TGTAGACCATGTAGTTGAGGTC. All primers were acquired from Integrated DNA Technologies (Coralville, IA).

Statistics

Normally distributed data were analyzed using Student’s t-test for comparison of two groups or one-way ANOVA with post-hoc Student-Neuman-Keul’s for comparison of three or more groups. Data that were not normally distributed were analyzed using a nonparametric Mann-Whitney U test for comparison of two groups, or one-way ANOVA on ranks with post-hoc Dunn’s test to compare three or more. Data are expressed as mean ± SEM. Means were considered significantly different when p<0.05. Statistical analysis was performed using GraphPad Prism 8 (GraphPad Software, San Diego, CA).

Results

Multiple LC pre-treatment protects against APAP-induced liver injury

Based on our preliminary data, we hypothesized that multiple pre-treatments with LC would decrease liver injury after APAP overdose. To confirm that, we treated mice i.p. with either LE or LC twice per week for 1 week prior to treatment with APAP at 0 h. We then measured liver injury by serum ALT activity and histology at 6 h after APAP overdose. We observed a significant decrease in serum ALT values in the mice pre-treated with LC compared to LE (Fig. 1A), even when the highest ALT value was removed from the LE group as a possible outlier. These data were confirmed by histology, which revealed reduced areas of necrosis (Fig. 1B,C). Finally, the effect of LC on liver macrophages was verified by F4/80 staining, which demonstrated depletion of macrophages in the tissue (Fig. 1B,C). We also counted the F4/80⁺ cells in the LE and LC groups at 0 h. F4/80⁺ cells per high-power (400x) field were 99±14 and 20±6 for LE vs. LC, respectively (mean±SE, p = 0.006).

Figure 1. Pre-treatment twice with liposomal clodronate reduces acetaminophen hepatotoxicity.

We treated mice with empty liposomes (LE) or liposomal clodronate (LC) twice per week for 1 week then administered 250 mg/kg acetaminophen (APAP). We collected blood and liver tissue at 6 h post-APAP. (A) Serum ALT activity. (B) H&E-stained liver sections (left) and F4/80 immunohistochemistry (right) (100x magnification). Dark brown staining indicates F4/80⁺ cells. Data expressed as mean±SE for n = 5 per group. *p<0.05 vs. LE.

Acute LC treatment does not protect against APAP-induced liver injury

Our observation that administration of LC twice protects against APAP hepatotoxicity was unexpected. Previous studies using both the i.v. and i.p. routes of administration demonstrated that a single, acute pre-treatment with LC at 24–72 h before APAP either exacerbates APAP-induced liver injury after overdose or has no effect.^27–31 To confirm the lack of protection with acute LC in our laboratory, we treated mice i.v. with either LE or LC followed by APAP the next day. We chose the i.v. route because most research groups using acute LC pre-treatment have used that route, but it should be noted that i.p. pre-treatment yields similar results.³¹ Consistent with earlier observations, acute LC pre-treatment did not protect against APAP hepatotoxicity (Fig. 2A), and no differences in area of necrosis were observed in liver tissues between the two groups (Fig. 2B,C). The serum ALT values in both groups were lower than expected based on the experiments presented in figure 1, and that may have confounded our results in some way. We do not know the reason for the different range of ALT values, but it may due to protective effects of the liposomes themselves. It has been demonstrated that i.v. administration of empty liposomes protects in some models of APAP hepatotoxicity.³⁶ In any case, F4/80 staining was again used to verify depletion of liver macrophages. F4/80⁺ cells were clearly reduced in the LC-treated group (Fig. 1C) (F4/80⁺ cells per high power field: 72±10 vs. 4±2 for LE vs. LC, respectively; mean±SE, p = 0.02).

Figure 2. Single, acute pre-treatment with liposomal clodronate does not affect acetaminophen hepatotoxicity.

We treated mice with empty liposomes (LE) or liposomal clodronate (LC) 24 h before administration of 250 mg/kg acetaminophen (APAP). We collected blood and liver tissue at 6 h post-APAP. (A) Serum ALT activity. (B) H&E-stained liver sections (left) and F4/80 immunohistochemistry (right) (100x magnification). Dark brown staining indicates F4/80⁺ cells. Data expressed as mean±SE for n = 5 per group. *p<0.05 vs. LE.

Multiple LC pre-treatment does not affect APAP bioactivation

As described in the introduction, for APAP hepatotoxicity to occur the drug must be converted to a reactive metabolite.³⁷ The metabolite then depletes hepatic glutathione stores and binds to proteins, leading to oxidative stress and the other downstream effects of APAP overdose. Therefore, any treatment that interferes with or prevents reactive metabolite formation will affect hepatotoxicity. To determine if the multiple LC pre-treatments altered APAP bioactivation or oxidative stress, we measured total (GSH+GSSG) and oxidized (GSSG) glutathione and APAP-protein adducts in the liver at 6 h post-APAP. LC pre-treatment twice did not affect total glutathione or APAP-adduct accumulation compared to LE (Fig. 3A,B). Importantly, however, it did significantly reduce glutathione oxidation (Fig. 3C). These data indicate that the two LC treatments may reduce oxidative stress in the liver following APAP treatment.

Figure 3. Pre-treatment twice with liposomal clodronate does not affect acetaminophen bioactivation but does reduce oxidative stress.

We treated mice with empty liposomes (LE) or liposomal clodronate (LC) twice per week for 1 week then administered 250 mg/kg acetaminophen (APAP). We collected liver tissue at 6 h post-APAP. (A) Total liver glutathione (GSH+GSSG). (B) APAP-protein adducts in the liver. (C) Oxidized glutathione (%GSSG) in the liver. Data expressed as mean±SE for n = 5 per group. *p<0.05 vs. LE.

Multiple LC pre-treatment reduces oxidative stress by enhancing glutathione re-synthesis

Since GSSG was decreased at 6 h, we wondered whether the two LC pre-treatments alone induced glutathione synthesis and if that primed the liver to respond to APAP toxicity. To test that, we pre-treated mice with i.p. LE or LC twice a week for 1 week then euthanized mice at 0 h and 2 h post-APAP. We measured total glutathione, GSSG, and mRNA for Gclc, which is the rate-limiting enzyme in glutathione synthesis. There was no change in total liver glutathione at 0 h (Fig. 4A), but consistent with our hypothesis we did observe a significant increase at 2 h (Fig. 4E). In addition, both 0 h (Fig. 4B) and 2 h (Fig. 4F) GSSG concentrations were significantly decreased, as well as %GSSG at 2 h (Fig. 4G). Though %GSSG was not significantly different at 0 h (Fig. 4C), that is not surprising because no excess reactive oxygen species should be formed at that time. Finally, Gclc mRNA was significantly increased at the 0 h baseline (Fig. 4D), though that difference disappeared by 6 h due to Gclc induction by APAP (Fig. 4H). These data indicate that the two LC pre-treatments alone can induce glutathione re-synthesis early after APAP overdose through glutamate-cysteine ligase, priming the liver to respond to oxidative stress.

Figure 4. Pre-treatment twice with liposomal clodronate accelerates glutathione re-synthesis after acetaminophen overdose.

We treated mice with empty liposomes (LE) or liposomal clodronate (LC) twice per week for 1 week then administered 250 mg/kg acetaminophen (APAP). We collected blood and liver tissue at 0 and 2 h post-APAP. (A,E) Total liver glutathione (GSH+GSSG) at 0 and 2 h, respectively. (B,F) Oxidized glutathione (GSSG) concentration in the liver at 0 and 2 h, respectively. (C,D) Percent of glutathione in oxidized form (%GSSG) at 0 and 2 h, respectively. (D,H) Gclc mRNA in the liver at 0 and 2 h, respectively. Data expressed as mean±SE. N = 5 per group at 0 h and 6 per group at 2 h. *p<0.05 vs. LE.

Multiple LC pre-treatment alone does not cause liver injury

To determine if the pre-conditioning caused by the LC pre-treatment regimen could be due to liver injury caused by LC alone, we measured serum ALT activity and liver necrosis in the 0 h LE and LC pre-treated mice. No differences in ALT or liver histology were observed, demonstrating that there was no overt liver injury due to LC (Fig. 5A,B). To verify macrophage depletion, we again performed IHC for F4/80 staining (Fig. 5B). As expected, F4/80 staining was dramatically reduced. Finally, to explore the mechanism for the upregulation of Glcl mRNA, we performed immunofluorescence staining for Nrf2 because Gclc is a well-known target of Nrf2. Although we did not observe proportionally greater nuclear translocation of Nrf2, there was an increase in total Nrf2 fluorescence intensity (in both nuclei and cytoplasm) in the LC-treated mice compared to the LE-treated animals (mean fluorescence intensity [fold over LE] for LE and LC, respectively: 1±0.11 vs. 1.35±0.06; p = 0.052). Overall, these data indicate that the two LC treatments promote expression of Nrf2, which is likely responsible for the increased Gclc expression and enhanced re-synthesis of glutathione after APAP overdose.

Figure 5. Pre-treatment twice with liposomal clodronate does not cause liver injury but may induce accumulation of Nrf2.

We treated mice with empty liposomes (LE) or liposomal clodronate (LC) twice per week for 1 week then administered 250 mg/kg acetaminophen (APAP). We collected blood and liver tissue at 0 h post-APAP. (A) Serum ALT activity. (B) Representative images for H&E-stained liver sections (top row), F4/80 immunohistochemistry (middle row; brown), and immunofluorescence staining for Nrf2 (green) and DAPI (blue) (bottom row). Bright field images are 100x magnification. Data expressed as mean±SE for n = 5 per group. *p<0.05 vs. LE.

Discussion

APAP-induced liver injury begins with the formation of a reactive metabolite that binds to proteins, especially in mitochondria.^{7,8,11,13,10,14,38} Protein binding leads to increased ROS production, which then activates the c-Jun N-terminal kinases (JNK) 1/2.^21,39 Activated JNK1/2 translocates to mitochondria where they ultimately inactivate Src, leading to reduced mitochondrial respiration and thereby greater ROS production.²⁴ This creates a feed forward mechanism in which ROS activates JNK and JNK increases ROS, leading to greater JNK activation and therefore more ROS. Eventually, the oxidative stress leads to mitochondrial permeability transition pore (MPTP) opening, loss of mitochondrial membrane potential, and swelling and rupture of the mitochondrial membranes.^19,20 Mitochondrial rupture releases several proteins, including endonuclease G (EndoG) and apoptosis inducing factor (AIF).⁴⁰ EndoG and AIF then translocate to the nucleus and cause nuclear DNA degradation.⁴⁰ The result is oncotic necrosis of the damaged hepatocytes.⁴¹ Hepatocyte death causes release of damage-associated molecular patterns (DAMPs) into the extracellular space, where they initiate a sterile inflammatory response. The DAMPs act on toll-like receptors to activate KCs which can then produce ROS and secrete cytokines and chemokines that recruit monocyte-derived macrophages.^42,43

The role of macrophages in APAP hepatotoxicity is highly controversial. In 1986, Laskin and coworkers reported accumulation of activated macrophages in the liver in rats after APAP overdose and determined that pro-inflammatory factors released by APAP-treated hepatocytes can activate both KCs and monocytes.^44,45 Nearly a decade later, they reported that the modulators of macrophage function, GdCl₃ and dextran sulfate, reduce APAP-induced liver injury in rats and those data were later reproduced in mice using GcCl₃.^25,26 Together, those data strongly indicated that macrophages, including KCs, worsen APAP toxicity. However, the same group also reported that the macrophage activator lipopolysaccharide (LPS) protected against APAP.²⁵ In addition, multiple later studies using acute LC pre-treatment revealed that depletion of macrophages in the liver, as opposed to inhibition, either exacerbates APAP toxicity or has no effect on the injury, indicating that macrophages may be either beneficial or irrelevant.^27–31 Indeed, some studies have demonstrated that macrophage depletion delays injury resolution and repair after acute liver injury. Consistent with that, Wang and Kubes recently reported that peritoneal macrophages enter the liver after carbon tetrachloride (CCl₄) hepatotoxicity and that the novel approach of two i.p. LC pre-treatments to deplete both peritoneal macrophages and other macrophages leads to greater mortality.⁴⁶ During an unrelated study in which we used the approach of Wang and Kubes to deplete all macrophages in mice, we incidentally observed that early APAP-induced liver injury seemed to be reduced. That was surprising, given the results from previous studies demonstrating that LC pre-treatment worsens APAP hepatotoxicity. In the present study, we confirmed our earlier results and determined that the likely mechanism of protection is a pre-conditioning effect that leads to greater expression of Gclc at baseline and therefore accelerated re-synthesis of hepatic glutathione after APAP overdose.

Similar pre-conditioning effects have been observed in several other studies. Williams et al. found that Fas-receptor deficient mice are resistant to APAP-induced liver injury due to increased Gclc induction after APAP overdose.⁴⁷ As in our study, the greater Gclc expression led to faster glutathione re-synthesis and lower oxidative stress. Around the same time, Ni et al. reported that liver-specific Atg5 KO mice have chronic liver injury at baseline, resulting in persistent Nrf2 activation and therefore greater glutathione synthesis.⁴⁸ Interestingly, pre-treatment with APAP itself can protect against APAP overdose. It has been observed that daily treatment with progressively larger doses of APAP is protective due to increased basal glutathione, reduced cytochrome P450 activity, and greater cell proliferation.⁴⁹ Together with our results, these data demonstrate that pre-conditioning effects, and particularly changes in glutathione levels or APAP bioactivation, should be considered whenever a pre-treatment regimen is used with the APAP model of acute liver injury.

The mechanism by which repeated administration of LC increases Gclc expression likely involves Nrf2 activation. Gclc is the catalytic subunit of glutamate-cysteine ligase, which is the rate-limiting enzyme in glutathione synthesis. The Gclc gene is also a major target of Nrf2 in the liver and other organs, and Nrf2 is well known to be protective in APAP toxicity.^50–52 It has been demonstrated that APAP overdose activates Nrf2 in mice, and that Nrf2 KO leads to worse injury and poorer survival after APAP overdose.^53–56 Normally, Nrf2 is sequestered and targeted for degradation by Kelch-like ECH-associated protein 1 (Keap1), but modification of critical cysteine residues by NAPQI and ROS inhibit Keap1 and facilitate Nrf2 accumulation and activity.^53,57–59 Using immunofluorescence staining, we observed greater total Nrf2 fluorescence after two LC pre-treatments, consistent with Nrf2 accumulation. These data indicate that the increased Gclc and glutathione in the liver is due to increased Nrf2. However, additional confirmation of the role of Nrf2 is needed using Nrf2 inhibitors or Nrf2 KO mice. Additionally, the exact mechanism by which LC causes Nrf2 remains to be elucidated. Although clodronate is toxic and could in theory stress hepatocytes and therefore activate Nrf2, it is unlikely to be due to a direct effect of that drug on the parenchymal cells. Clodronate liposomes are ingested and digested by macrophages. Lysosomal phospholipases in the macrophages disrupt the phospholipid bilayers and release the clodronate.⁶⁰ However, because clodronate alone does not cross membranes and has a short half-life, it is thought to be non-toxic to other cells in the same tissue.⁶¹ We propose that ongoing macrophage killing by multiple LC injections leads to release of DAMPs or other stress signals from those cells which then signal to hepatocytes to induce a stress response. However, more experiments are needed to test that hypothesis.

It should be noted that we used different routes of administration for LC in our single-dose and two-dose experiments. We chose the i.p. route for the repeated dosing experiments to increase the probability of successful injections with each mouse so we could reduce variation in the data and reduce our animal use. We chose the i.v. route for the acute, single-dose pre-treatment to make that experiment more consistent with most prior studies using acute LC treatment. While it is possible that the difference in effect of the one and two dose LC pre-treatment regimens that we observed is due in part to the different routes of administration, that seems highly unlikely. Other groups have used the i.p. route for acute LC pre-treatment before APAP overdose and have obtained nearly identical results to those reported after acute i.v. pre-treatment.³¹

In conclusion, our data demonstrate that multiple pre-treatments with LC protect against early APAP-induced liver injury in mice by increasing re-synthesis of glutathione after overdose. These data reinforce the idea that it is important to consider pre-conditioning effects when using pre-treatment regimens to explore mechanisms or test possible therapeutics in the APAP overdose model of acute liver injury. In addition, investigators interested in using the novel approach of Wang and Kubes to deplete peritoneal macrophages and prevent their effects in the liver should be aware of this potential confounder.⁴⁶ Future research could explore the mechanism of pre-conditioning in greater detail, specifically the role of Nrf2, using Nrf2 inhibitors or KO mice.

Abbreviations

APAP

Acetaminophen

Gclc

glutamate-cysteine ligase subunit c

GSSG

oxidized glutathione

KC

Kupffer cells

LE

empty liposomes

LC

liposomal clodronate

NAC

N-acetyl-cysteine

NAPQI

N-acetyl-p-benzoquinone imine

Nrf2

nuclear factor erythroid 2-related factor