Association of interleukin-18 gene polymorphisms with Takayasu arteritis in a Chinese Han population

Abstract

Background:

Interleukin-18 (IL18) gene polymorphisms are related to many inflammatory and autoimmune diseases. However, a correlation analysis between IL18 −607C/A and −137G/C gene polymorphisms and Takayasu arteritis (TA) is lacking.

Methods:

This study enrolled 200 patients with TA as the case group and 334 region-, age-, and sex-matched healthy subjects as the control group. We genotyped alleles and genotypes at positions −607 and −137 of the IL18 gene and analyzed the distribution frequencies. Mann-Whitney U test, t test, Chi-squared test and Hardy-Weinberg equilibrium were performed.

Results:

After adjusting for risk factors, the adjusted odds ratios and 95% confidence intervals at position −607C/A were 0.533, 0.391 to 0.880 (P = 0.010); 0.266, 0.586 to 1.002 (P = 0.051); and 0.122, 0.552 to 1.420 (P = 0.613) under the dominant, additive, and recessive models, respectively. For the −137G/C polymorphism, the adjusted odds ratios and 95% confidence intervals were 1.571, 1.068 to 2.311 (P = 0.022); 1.467, 1.086 to 1.980 (P = 0.012); and 1.815, 0.901 to 3.656 (P = 0.095) under the dominant, additive, and recessive models, respectively. Moreover, regardless of the model used, we found no statistical difference in distribution frequency between the active and quiescent states of TA for the −607C/A (P = 0.355, 0.631, and 0.705, respectively) and −137G/C polymorphisms (P = 0.205, 0.385, and 0.208, respectively).

Conclusions:

The IL18 −607C/A gene polymorphism may decrease the risk of TA, and thus is a protective factor, whereas −137G/C may increase the risk of TA, and thus is a risk factor. However, neither polymorphism was related to activity (active vs. quiescent) of TA.

Introduction

Takayasu arteritis (TA) is a chronic, non-specific granulomatous vasculitis affecting the aorta and its main branches, the coronary and pulmonary arteries. TA is heterogeneous in terms of ethnic population, regional, age, and sex distribution. Multiple factors may be involved in the pathogenesis of TA, including autoimmunity, inflammation, genetic, and environmental factors. Several studies have shown that the human leukocyte antigen gene is closely related to the occurrence and development of TA.^[1–5] These studies indicate the relevance of genetic abnormalities in TA pathogenesis, disease progression, response to treatment, and prognosis.

Interleukin-18 (IL18) is an important inflammatory cytokine with multiple biologic functions in regulating inflammatory and immune responses. IL18 can induce monocytes, macrophages, and natural killer cells to produce interferon-γ, which enhances the activity of natural killer cells, results in immune disorders, and thus is involved in the pathogenesis of many diseases.^[6–8] The human IL18 gene is located on 11q22.2-22.3 and has six exons. Numerous studies have shown that IL18 gene polymorphisms are related to many inflammatory and autoimmune diseases, such as chronic hepatitis B, asthma, coronary heart disease, rheumatoid arthritis, systemic lupus erythematosus, Crohn disease, multiple sclerosis, and graft-vs.-host disease.^[9–17]

Studies have demonstrated that single-nucleotide polymorphisms (SNPs) −607C/A and −137G/C in the upstream promoter region of the IL18 gene significantly affect transcription of IL18, and thus change its expression levels and plasma concentrations.^[18,19] Significantly increased plasma IL18 concentrations are observed in TA, especially in the active stage of the disease.^[20]

However, to date, studies of the relationship between IL18 and TA have only evaluated plasma levels. No studies have described correlations between −607C/A and −137G/C SNPs and TA. It is convenient to enroll patients with TA because of the relatively high incidence of TA in the Chinese Han population. We hypothesized that the −607C/A and −137G/C gene polymorphisms may be associated with TA, and describing these correlations may further provide genetic evidence for the pathogenesis of TA.

Methods

Ethical approval

Informed consent was signed by all the enrolled subjects before the study. The study protocol was approved by the local hospital ethical committee.

Study population

The study subjects were enrolled consecutively and comprised two groups: 200 patients with TA as case group and 334 region-, age-, and sex-matched healthy controls, which were admitted to Fuwai Hospital, between May 2006 and September 2011. All the subjects enrolled in this study had normal hepatic and renal function. Those subjects who had history of autoimmune, collagen, and cardiovascular disease, Marfan syndrome, diabetes mellitus, cancer, and had current inflammatory symptoms were excluded.

Diagnostic criteria for Takayasu arteritis

The commonly used diagnostic criteria of TA in adults, which was proposed by the American College of Rheumatology in 1990, were listed as follows: age of onset ≤40 years; limb claudication; decreased branchial artery pulse; the difference in bilateral limb systolic blood pressure >10 mmHg; subclavian or abdominal aortic murmur; abnormal arteriography indicating narrowing or occlusion of the entire aorta and its main branches.^[21]

Criteria for Takayasu arteritis activity

The natural course of TA consists of active and quiescent phases. The criteria in evaluating disease activity are the National Institute Health (NIH) criteria including: (1) systemic features such as fever or musculoskeletal problems (no other cause identified); (2) elevated erythrocyte sedimentation rate; (3) features of vascular ischemia or inflammation, such as claudication, diminished or absent pulse, bruits, vascular pain (carotidynia), asymmetric blood pressure in either upper or lower limbs (or both); and (4) typical angiographic features. Patients who demonstrate new onset or worsening of at least two of the five features listed above are considered as active phase.^[22,23]

Genotyping

DNA from patients and controls was obtained from peripheral blood using standard methods. For the determination of IL18 alleles, Taqman probe produced by American ABI Company was performed. The Taqman probe sequences for –607C/A and –137G/C were 5′-ACGGATACCATCATTAGAATTTTAT[G/T]TAATAATTTTTACACTTTCTGCAAC and TGTAATATCACTATTTTCATGAAAT[C/G]TTTTCTTCCGTAAAAGTTGGGGCTC-3′, respectively. The probes were labeled with fluorescent dyes VIC and FAM. Polymerase chain reaction was performed in a total volume of 7.50 μL consisting of 3.75 μL 2 × Universal polymerase chain reaction Master Mix, 0.19 μL 20×Probe/Primer mix, 1 μL DNA, and 2.50 μL double distilled H₂O. The cycling parameters included denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 92°C for 15 s, and annealing and extension at 60°C for 1 min.

Statistical analysis

Data were presented as numbers, percentages, or mean ± standard deviation. Continuous variables were compared by means of t test and analysis of variance for normally distributed data, non-parametric Mann-Whitney U test for abnormally distributed data. Categorical variables were compared by Chi-squared test or Fisher exact test. Correlations were assessed using Spearman rank correlation.

Hardy-Weinberg equilibrium (HWE) was performed to test whether the samples get genetic equilibrium. The frequencies of genotypes and alleles of IL18 gene at positions of –607 and –137 were compared using Chi-squared test or Fisher exact test. Odds ratio (OR) and 95% confidence interval (CI) were calculated by logistic regression. A P value <0.05 was considered statistically significant. Data analysis was performed using a commercially available statistical software package (SPSS II for windows, version 18.0, Chicago, IL, USA).

Results

Clinical baseline data in patients with Takayasu arteritis and healthy controls

Other than history of hypertension, which was higher in the case group (P < 0.001), no other significant differences were found between the two groups [Table 1].

Table 1.

Clinical baseline data in patients with Takayasu arteritis and healthy controls.

Allele and genotype frequencies in IL18 −607 C/A between cases and controls

The C and A alleles and the CC, CA, and AA genotypes at position −607 were identified in cases and controls [Table 2]. The genotype frequency conformed to HWE. Risk factors assessed in this study included age, sex, history of hypertension, smoking, total cholesterol, triglycerides, high-density lipoprotein cholesterol, and low-density lipoprotein cholesterol. Before adjusting for risk factors, the crude ORs and 95% CIs at position −607C/A were 0.532, 0.406–0.851 (P = 0.005); 0.320, 0.568–0.928 (P = 0.011); and 0.294, 0.481–1.154 (P = 0.188) under the dominant, additive, and recessive models, respectively. After adjusting for risk factors, the adjusted ORs and 95% CIs at −607C/A were 0.533, 0.391–0.880 (P = 0.010); 0.266, 0.586–1.002 (P = 0.051); and 0.122, 0.552–1.420 (P = 0.613), under the dominant, additive, and recessive models, respectively [Table 3].

Table 2.

Distribution frequency of interleukin-18 –607C/A and –137G/C alleles and genotypes in 200 patients with Takayasu arteritis and 334 healthy controls, n (%).

Table 3.

Relationships between IL18 –607 C/A and Takayasu arteritis under different genetic models.

Allele and genotype frequencies in IL18 −137G/C between cases and controls

The alleles at IL18 position −137 were G and C, and the genotypes were GG, GC, and CC [Table 2]. The genotype frequency conformed to HWE. Before adjusting for risk factors, the crude ORs and 95% CIs for SNP −137G/C were 1.658, 1.164–2.361 (P = 0.005); 1.554, 1.185–2.039 (P = 0.001); and 2.141, 1.150–3.986 (P = 0.016), under the dominant, additive, and recessive models, respectively. After adjusting for risk factors, the adjusted ORs and 95% CIs at −137G/C were 1.571, 1.068–2.311 (P = 0.022); 1.467, 1.086–1.980 (P = 0.012); and 1.815, 0.901–3.656 (P = 0.095), under the dominant, additive, and recessive models, respectively [Table 4].

Table 4.

Relationships between IL18 –137G/C and Takayasu arteritis under different genetic models.

Genotype frequency in IL18 −607C/A between active and quiescent stages

The genotype frequency in IL18 −607C/A showed no significant difference between patients with active and quiescent stages of TA (χ² = 0.855, P = 0.652) [Table 5]. Moreover, the differences were not statistically significant under the dominant (χ² = 0.855, P = 0.355), additive (χ² = 0.920, P = 0.631), or recessive models (χ² = 0.144, P = 0.705) [Table 6].

Table 5.

Comparison of IL18 –607C/A and –137G/C genotype distribution frequency between active and quiescent phases in Takayasu arteritis.

Table 6.

Comparison of IL18 –607C/A and –137G/C genotype distribution frequency between active and quiescent phases in TA under different genetic models.

Genotype frequency in IL18 −137G/C between active and quiescent stages

The genotype frequency in IL18 −137G/C showed no significant difference between patients with active and quiescent stages of TA (χ² = 1.907, P = 0.385) [Table 5]. Moreover, the differences were not statistically significant under dominant (χ² = 1.604, P = 0.205), additive (χ² = 1.907, P = 0.385), or recessive models (χ² = 1.583, P = 0.208) [Table 6].

Discussion

In this study, we found that SNPs in the upstream promoter region of the IL18 gene, −607C/A and −137G/C, were associated with TA in a Chinese Han population. After adjusting for risk factors (including age, sex, history of hypertension, smoking, total cholesterol, triglyceride, high-density lipoprotein cholesterol , and low-density lipoprotein cholesterol), we demonstrated that, under the dominant and additive models, the −607C/A polymorphism may decrease the risk of TA, and thus is a protective factor. In contrast, the −137G/C polymorphism may increase the risk of TA, and thus is a risk factor. At the −607 position, the risk of occurrence of TA was decreased by about 47% in individuals carrying the A allele compared with carriers of the C allele. At the −137 position, the risk of occurrence of TA was increased by about 57% in individuals carrying the C allele compared with carriers of the G allele. However, the −607C/A and −137G/C SNPs in IL18 were not associated with activity of TA (active or quiescent stage).

IL18 is mainly generated by monocyte-macrophage cells and can induce proliferation of T helper 1 cells. It not only stimulates production of interferon-γ, but also induces tumor necrosis factor-α and IL-2 synthesis, which may enhance Fas and its ligand-mediated cytotoxicity effect. Therefore, IL18 is an important pro-inflammatory cytokine with multiple biologic functions involved in antitumor, anti-inflammatory, and autoimmune mechanisms.^[6–8]

The IL18 −607C/A and −137G/C polymorphisms significantly affect expression levels and plasma concentrations of IL18.^[18,19] Patients with the active state of TA show increased levels of IL18 compared with patients with the quiescent state.^[20] However, on the genetic level, our data did not indicate show correlations of IL18 −607C/A and −137G/C polymorphisms and activity of TA under the dominant, additive, or recessive models.

Recent studies have demonstrated that SNPs in the IL18 gene promoter region at positions −607 and −137 are involved in many inflammatory and autoimmune diseases.^[9–17] Carriers of the A allele at position −607 have a 28% increased risk of chronic hepatitis B. Moreover, the risk of chronic hepatitis B is increased about 53% in individuals with the AA genotype at position −607.^[9] Ma et al^[24] reported that presence of the AC or CC genotype at position −607C/A could increase the risk of asthma by 28%. In addition, the −607C/A and −137G/C SNPs are associated with susceptibility to ulcerative colitis.^[25]

Furthermore, the −607C/A and −137G/C SNPs in the IL18 gene promoter region are associated with a protective effect in many diseases. Presence of the C allele at the −137 locus significantly reduced the risk of insulin resistance in Chinese patients with polycystic ovary syndrome^[26]; and presence of the G allele may significantly increase the risk of insulin resistance in patients with acquired human immunodeficiency syndrome.^[27] In the kidney transplant allograft rejection process, the C allele at the −137 locus has a protective effect and might reduce the occurrence of rejection.^[28] However, some reports have shown no association between IL18 −607C/A and −137G/C SNPs and inflammatory or autoimmune diseases. The −607C/A SNP has no relationship with tuberculosis, type 1 diabetes, rheumatoid arthritis, systemic lupus erythematosus, Crohn disease, ulcerative colitis, or asthma.^[29–31] Moreover, −607C/A and −137G/C SNPs are not related to gout in the male Chinese Han population.^[32]

Regarding the association between −607C/A and −137G/C SNPs and non-specific vasculitis, Palomino-Morales et al^[33] reported that the −137G/C SNP was not associated with the incidence of giant cell arteritis, whereas the A allele at the −607C/A locus significantly increased the risk of giant cell arteritis (OR, 1.32; 95% CI, 1.04–1.69; P = 0.02), and thus was a susceptibility gene. Lee et al^[34] found that IL18 −607C/A and −137G/C SNPs were susceptibility genes for Behcet disease in a Korean population. However, Jang et al^[35] reported no such correlation in a Korean population.

Our results showed that under the dominant model, the risk of TA was decreased by about 47% in individuals carrying the A allele at the −607C/A SNP (P = 0.005). After adjusting for risk factors, the risk of TA was decreased by about 47% (P = 0.010). Under the additive model, the risk of TA decreased by about 68% in carriers of the A allele (P = 0.011). After adjusting for risk factors, the risk of TA decreased by about 73% (P = 0.051).

For the −137G/C SNP, under the dominant model, the risk of TA was increased by about 66% in individuals carrying the C allele (P = 0.005). After adjusting for risk factors, the risk of TA was increased by about 57% (P = 0.022). Under the additive model, the risk of TA increased by about 55% in carriers of the C allele (P = 0.001). After adjusting for risk factors, the risk of TA increased by about 47% (P = 0.012). These findings confirmed that IL18 −607C/A may decrease the risk of TA, and thus is a protective factor, whereas the −137G/C SNP may increase the risk of TA, and thus is a risk factor.

Although we confirmed the importance of the IL18 −607C/A and −137G/C SNPs in TA, there are some limitations to this study, as follows. First, the correlations might be caused by synergistic interactions with other SNPs in the same gene or in other candidate genes. Moreover, the study subjects may not fully represent the Chinese Han population, and population stratification can cause false-positive results. These results need to be verified in other countries and populations, with a larger sample size and additional prospective cohort studies. Finally, the potential functional mechanism of the IL18 gene needs to be further elucidated.

The IL18 −607C/A gene polymorphism may decrease the risk of TA, and thus is a protective factor, whereas −137G/C may increase the risk of TA, and thus is a risk factor. However, neither polymorphism was related to activity (active vs. quiescent) of TA.

Funding

This work was supported by grants from the National Key Research and Development Program of China (No.2016YFC1301002 and No. 2020YFC2004803), and National Natural Science Foundation of China Grant (No.81900449).

Conflicts of interest

None.