Abstract
Mycoplasma genitalium is a sexually transmitted bacterial pathogen that infects men and women. Antigenic variation of MgpB and MgpC, the immunodominant adherence proteins of M. genitalium, is thought to contribute to immune evasion and chronic infection. We investigated the evolution of mgpB and mgpC sequences in men with non-gonococcal urethritis persistently infected with M. genitalium, including two men with anti-M. genitalium antibodies at enrollment and two that developed antibodies during follow-up. Each of the four patients was persistently infected with a different strain type and each patient produced antibodies targeting MgpB and MgpC. Amino acid sequence evolution in the variable regions of MgpB and MgpC occurred in all four patients with changes observed in single and multiple variable regions over time. Using the available crystal structure of MgpC of the G37 type strain we found that predicted conformational B cell epitopes localize predominantly to the variable region of MgpC, amino acids that changed during patient infection lie in these epitopes, and variant amino acids are in close proximity to the conserved sialic acid binding pocket. These findings support the hypothesis that sequence variation functions to avoid specific antibodies thereby contributing to persistence in the genital tract.
Introduction
M. genitalium is increasingly recognized as a sexually transmitted pathogen in men as a frequent cause of acute and chronic non-chlamydial, non-gonococcal urethritis (NGU) [1]. In women, M. genitalium is associated with cervicitis, pelvic inflammatory disease (PID), endometritis [2–4], tubal factor infertility [5, 6], preterm birth, and spontaneous abortion [7]. Importantly, M. genitalium infection increases cervical shedding of HIV [8] as well as the risk of acquiring and transmitting HIV [9, 10]. The prevalence of M. genitalium ranges from 1.3–3.9% in population-based studies, to 20.5% in high risk settings [11, 12]. Similar to Chlamydia trachomatis [13], many infected men and women are unaware of their M. genitalium-positive status [12, 14, 15]. Treatment is complicated by inherent resistance to cell wall targeting antibiotics, and high rates of acquired azithromycin resistance (40–100% of strains in some settings) [16]. The efficacy of moxifloxacin, used to treat azithromycin-resistant infections, is declining and dual resistance is increasingly reported [17].
M. genitalium can persist for months, and potentially years, in infected individuals [10, 18, 19] despite the presence of specific antibodies in genital exudates of infected women [20] and in the sera of infected men [21]. These data suggest that M. genitalium evades the local and systemic immune response, allowing greater opportunity for transmission to others and ascension to the upper reproductive tract in women. The MgpB and MgpC adherence proteins, also known as P140/MG191 and P110/MG192, respectively, are immunodominant targets of host antibodies [5, 20–23]. MgpB and MgpC localize to the M. genitalium terminal organelle, forming a complex [24] required for adherence to host cells and inanimate surfaces, and motility [25–28]. Recently the structure of the MgpC protein was determined and a sialic acid binding pocket was identified [29].
The mgpB and mgpC genes, expressed from a single locus on the M. genitalium chromosome, consist of conserved sequences interspersed with variable regions [22, 23, 30]. MgpB and MgpC expression is affected by both antigenic and phase variation. Antigenic variants express MgpB and MgpC proteins with variant amino acids while phase variants do not express either MgpB or MgpC and are non-adherent. Antigenic variation is accomplished through segmental, reciprocal recombination between individual variable regions in mgpBC and archived variable sequences present in nine MgPars located throughout the chromosome [22, 23, 31, 32]. No MgpB or MgpC protein is expressed from the MgPars as only the variable sequences of mgpB and mgpC are present, the adjacent variable regions have different reading frames, and the variable sequences are often separated by short AT-rich regions encoding multiple stop codons. Phase variants arise in vitro by multiple mechanisms including recombination between mgpBC and the MgPars, point mutations, and deletions. [25, 33, 34]. Phase variants generated by recombination fall into at least six classes and can be reversible or irreversible depending on the number of recombination partners involved [33]. Deletion of recA results in the near-total loss of antigenic and phase variation implicating recombination as the mechanism that generates the majority of these variants [25, 33].
Antigenic and phase variation may represent immune evasion strategies allowing M. genitalium to escape binding by specific host antibodies and persist in the genital tract. In order to understand the extent of antigenic variation during infection, we assessed sequence changes in both mgpB and mgpC in four men with NGU with persistent M. genitalium infection [35]. Among these men, two were positive for anti-M. genitalium serum antibodies specific for MgpB and MgpC at enrollment and two developed MgpB/C-specific antibodies during observation. We assessed sequence variation simultaneously in all four variable regions: region B, EF, and G of mgpB, and region KLM of mgpC, and found that variation was both rapid and extensive and was localized to conformational B cell epitopes predicted for MgpC. Our results are consistent with a model in which the immune system selects for variants in multiple regions of MgpB and MgpC simultaneously during persistent infection. Finally, by mapping these sequence changes onto the published crystal structure of MgpC [29], we found that variant amino acids are located near the sialic acid binding pocket of MgpC, suggesting that antigenic variation may protect M. genitalium from adherence-inhibiting antibodies.
Materials and methods
Patient specimens
The M. genitalium isolates in this study (Table 1) were obtained from urine specimens collected between January 2007 and July 2011 in a double-blinded, randomized trial comparing the effectiveness of azithromycin and doxycycline for men with NGU at the Public Health–Seattle & King County STD Clinic in Seattle, WA [35]. In this study, M. genitalium PCR-positive patients were randomly assigned to receive azithromycin or doxycycline upon enrollment (Visit 1). Patients returning at Visit 2 with signs or symptoms of urethritis were prescribed the alternate antibiotic and M. genitalium PCR status was again determined. Patients that were M. genitalium-positive at Visit 3, after azithromycin and doxycycline treatment, were prescribed moxifloxacin. At each time point, persistent infection was determined by PCR and M. genitalium isolates were recovered in cocultures with Vero cells (see below).
Table 1. M. genitalium clinical isolates used in this study.
| Patient number | Days between Visit 1 and 3 | Treatments between Visit 1 and 3 | Isolatea | Strain typeb | GenBank Accession Numbers |
|---|---|---|---|---|---|
| 10366 | 33 | Doxycycline | MEGA 1166 | 3 | Region B: MT439353 –MT439366 |
| Region EF: MT439373 –MT439393 | |||||
| Region G: MT439409 –MT439410 | |||||
| Region KLM: MT439412 –MT439443 | |||||
| MEGA 1206 | 3 | Region B: MT439376 –MT439372 | |||
| Region EF: MT439394 –MT439408 | |||||
| Region G: MT439411 | |||||
| Region KLM: MT439444 –MT439455 | |||||
| 10378 | 48 | Doxycycline | MEGA 1199 | 2 | Region B: MT439456 |
| Azithromycin | Region EF: MT439458 –MT439459 | ||||
| Region G: MT439477 | |||||
| Region KLM: MT439479 –MT439484 | |||||
| MEGA 1261 | 2 | Region B: MT439457 | |||
| Region EF: MT439460 –MT439476 | |||||
| Region G: MT439478 | |||||
| Region KLM: MT439485 –MT439489 | |||||
| 10467 | 28 | Doxycycline | MEGA 1473 | 5 | Region B: MT439490 –MT439502 |
| Azithromycin | Region EF: MT439518 –MT439528 | ||||
| Region G: MT439540 | |||||
| Region KLM: MT439542 –MT439544 | |||||
| MEGA 1493 | 5 | Region B: MT439503 –MT439517 | |||
| Region EF: MT439529 –MT439539 | |||||
| Region G: MT439541 | |||||
| Region KLM: MT439545 –MT439553 | |||||
| 10477 | 50 | Doxycycline | MEGA 1491 | 4 | Region B: MT439554 –MT439555 |
| Azithromycin | Region EF: MT439560 –MT439571 | ||||
| Region G: MT439580 –MT439581 | |||||
| Region KLM: MT439583 –MT439591 | |||||
| MEGA 1534 | 4 | Region B: MT439556 –MT439559 | |||
| Region EF: MT439572 –MT439579 | |||||
| Region G: MT439582 | |||||
| Region KLM: MT439592 –MT439593 |
a, M. genitalium cultured from Visit 1 and Visit 3 urine specimens for each patient.
b, strain type numbering according to Jensen [37]. Strain type sequences have been deposited in GenBank (KP318822.1, KP318823.1, KP318824.1, KP318825) [27].
Among the four patients whose cultured strains were analyzed in the current study, M. genitalium infection persisted after doxycycline treatment, consistent with the known poor efficacy of this antibiotic for eradication of M. genitalium infection [36]. Three men (Patients 10378, 10467, and 10477) were also treated with azithromycin per study protocol, however, it was later determined that each of these patients had been infected with an azithromycin resistant strain (MIC ≥ 8 μg/ml, Totten et al. in preparation) at enrollment. The M. genitalium strain that infected Patient 10366 is sensitive to azithromycin, however, azithromycin treatment was initiated after collection of the Visit 3 specimens. For the present study, we analyzed M. genitalium isolates cultured from patient specimens obtained at Visit 1 and Visit 3.
Immunoblots
Antibody reactivity of patient sera to whole cell lysates of wild type M. genitalium strain G37 was determined as previously described [38] using a 1:1,000 dilution of patient serum, followed by a 1:7,500 dilution of peroxidase-conjugated goat anti-human IgG (whole molecule; Sigma-Aldrich, St. Louis, MO) secondary antibody and chemiluminescent detection (ECL, GE Healthcare, Chicago, IL).
Culture of M. genitalium from urine
M. genitalium isolates (Table 1) were recovered from processed patient urine by coculture with Vero cells [39]. Briefly, patient urine (2 ml) was centrifuged at 16,000 x g for 15 minutes, the supernatant was discarded, and the cell pellet was resuspended in 0.4 ml mycoplasma transport medium and frozen at -80°C. At the time of culture, 1 x 105 Vero cells (obtained from the American Type Culture Collection) were seeded in 25 cm2 flasks in 5 ml Eagle’s Minimal Essential Medium (EMEM; ATCC, Manassas, VA) supplemented with 10% fetal bovine serum and 100 U/ml penicillin. After overnight incubation at 37°C in 5% CO2, the culture medium was removed, adherent Vero cells were washed with PBS, and fresh EMEM containing 10% FBS, 6% yeast dialysate, 100 U/ml penicillin, 50 μg/ml polymyxin B, and 50 μg/ml colistin in a total volume of 8.5 ml was added. Flasks were inoculated with thawed, processed urine (100 μl) and incubated at 37°C in 5% CO2 for four weeks. Vero cells grew to form a confluent monolayer after two weeks and then detached from the plastic by week three. To confirm growth of M. genitalium from patient specimens, aliquots from these cocultures were collected weekly and DNA was isolated with the MasterPure DNA isolation kit (Lucigen, Middleton, WI). M. genitalium DNA was quantitated by qPCR as previously described [40] confirming growth by an increase in genomes over time.
PCR amplification and sequencing of mgpBC variable and strain typing regions
DNA isolated from M. genitalium strains cocultured with Vero cells for three weeks, corresponding to late log phase, served as template for amplification of the mgpB strain typing region (Fig 1) with primers ModPetF and 1415R (Table 2). PCR products amplified after 30 cycles with Platinum PCR SuperMix High Fidelity (Invitrogen, Carlsbad, CA) were cloned into pCR2.1-Topo (Invitrogen) and several plasmid clones were sequenced to determine the M. genitalium strain type sequence and verify that a single strain type was detected at Visit 1 and Visit 3 (Table 1). Variable regions in mgpB and mgpC were similarly PCR-amplified using the primers indicated in Fig 1 and Table 2, cloned, and sequenced from multiple plasmids. Each variable region was PCR-amplified twice, using a different primer pair for each reaction. Sequences were aligned using MultAlin (http://multalin.toulouse.inra.fr/multalin/) [41], Highlighter (https://www.hiv.lanl.gov/content/sequence/HIGHLIGHT/highlighter_top.html) [42], and ElimDupes (https://www.hiv.lanl.gov/content/sequence/elimdupesv2/elimdupes.html). Unique sequences have been deposited in GenBank (Accession numbers MT439353 –MT439593, Table 1). Sequences of the conserved regions of mgpB for these patient isolates have been published previously [27].
Fig 1. Strain typing and variable regions of mgpB and mgpC targeted for PCR amplification and sequencing.
Small arrows indicate the primers used to PCR amplify each region indicated by grey lines. Each variable region was amplified with two different primer pairs. PCR products were cloned and sequenced from individual plasmids to assess sequence changes over time in infected men. Strain types were determined by sequencing the region indicated by “ST”. Numbers indicate base pairs relative to the start codon of mgpB and mgpC.
Table 2. Primers used in this studya.
| Primer name | Primer sequence (5’-3’) | Region amplified |
|---|---|---|
| ModPetF | GTGATGTTGTTAGTGATTGTGTG | mgpB strain typing region and variable region B |
| 1415R | TGGTGGTAAACATCTTAGTAGCAT | |
| MgPa-355Fb | GAGAAATACCTTGATGGTCAGCAA | mgpB region B |
| 1976R | TAACTGTCAAGCATACAAACCAC | |
| 1826F | TCCAAGATGAAATGGGCAGT | mgpB region EF |
| 3028R | TCATTGATTACAACAAGATTACC | |
| 1653F | AGCAGGAACACTAACAATG | mgpB region EF |
| 3220R | GATCTCACAGTGATTTAGG | |
| 2863F | GGGAGGTGAATGGGTTGTAT | mgpB region G |
| 70R | CTAGTGCTAATGGTAGAAAGGG | |
| 3057F | CTTTGGGTTTCAACTTGGTG | mgpB region G |
| 4300R | TTGTTTTACTGGAGGTTTTG | |
| 106F | AATGTTACTGCTTACACCCC | mgpC region KLM |
| 1726R | TAGGGAACAGGGAGGTAACG | |
| 4149F | AAAGGCATTACAAGCAGGG | mgpC region KLM |
| 1549R | TAAACCTAACGCATCAAAC |
To measure variation during Vero coculture, one strain (MEGA 1166) was subcultured twice, for a total of ten weeks of in vitro growth, then variation in mgpB region B was assessed by PCR and sequencing as described above.
Epitope analysis
Epitopes within MgpC (amino acids 23–938) of the M. genitalium type strain G37 were predicted using DiscoTope 2.0 [45] and the published crystal structure, PDB 5MZ9 [29]. For simplicity, our analyses include only those epitopes with a score greater than -1.0, corresponding to 30% sensitivity and 85% specificity. The default threshold of -3.7 corresponds to 47% sensitivity and 70% specificity. To predict epitopes in patient variants, the KLM region of G37 MgpC was replaced with sequences specific for isolates 1491 and 1534, modeled with iTasser [46], and then analyzed using DiscoTope 2.0. PyMol was used to manipulate models of predicted protein structures and generate images. Linear epitopes were predicted using Bepipred 2.0 [47].
Ethics statement
The M. genitalium cultures and sera analyzed in this study were obtained from men enrolled in our Seattle-based treatment trial [35]. This study was approved by the University of Washington Institutional Review Board and all enrollees gave written informed consent.
Results
The goal of this study was to determine the extent of sequence variation in mgpB and mgpC over time in men with NGU who were persistently infected with M. genitalium. Previous studies of antigenic variation of M. genitalium from clinical specimens have been limited to analyzing a single variable region and/or by a low number of cloned sequences analyzed [22, 23, 32, 43], which would underestimate the diversity and complexity of MgpB and MgpC variation. An appreciation of the extent of variation occurring during infection is necessary to understand how antigenic variation contributes to persistence and immune evasion. Here we analyzed sequence variation in all four variable regions (B, EF, G, and KLM) of the mgpBC expression site in M. genitalium cultured from the urine of four men with NGU during persistent infection spanning 28 to 50 days.
Identification of suitable specimens
The M. genitalium isolates sequenced in this study were cultured from men enrolled in our study comparing the efficacy of doxycycline and azithromycin for the treatment of NGU [35]. Urine specimens were collected from men at multiple time points (up to four clinic visits) spanning 28 to 50 days, and confirmed M. genitalium-positive by PCR [48]. Strain typing [37] was used to determine that a single strain was detected at all time points. Patient sera collected at Visit 1 and Visit 3 were assayed by immunoblot to identify patients with anti-MgpB and anti-MgpC antibody reactivity. Four patients were chosen for further analysis including two (patients 10378 and 10467) with increased MgpB and MgpC reactivity between clinic visits, and two others (patients 10366 and 10477) that reacted with MgpB and MgpC at both time points (Fig 2). Immunoblot reactivity is assumed to primarily reflect the binding of patient antibodies to conserved sequences in MgpB and MgpC as variable region sequences differ between patient isolates and the G37 type strain used as antigen. The paired Visit 1 and Visit 3 M. genitalium isolates cultured from these four PCR-positive men were strain typed to confirm that the Vero-cultured isolates were identical to the strain present in patient specimens (Table 1). These isolates were then analyzed for sequence variation over time.
Fig 2. Immunoblot IgG reactivity of M. genitalium positive patient sera with whole lysates of strain G37.

Sera obtained from four PCR-positive men at first and third clinic visits (V1 and V3, respectively), were diluted 1:1,000 and reacted with M. genitalium whole cell lysates separated on a 7.5% SDS-PAGE gel. “Rb”, specific rabbit sera [40] was used to identify MgpB and MgpC protein bands (arrows). Molecular weight markers (in kDa) are shown at left. The magnitude of antibody reactivity between patients cannot be compared as different film exposure times were used.
Analysis of sequence diversity in M. genitalium infected men
To assess gene variation in M. genitalium isolates, each of the three variable regions within mgpB (regions B, EF, and G) and the single variable region within mgpC (region KLM) was PCR amplified from Visit 1 and Visit 3 cultures (Fig 1). Amplicons were cloned, and then 10 plasmids were sequenced to identify regions that varied between time points. If sequence changes were observed in a particular variable region, then an additional 25–30 plasmids were sequenced. These variable regions were then amplified with a second primer pair targeting the same region (Fig 1 and Table 2), again cloning and sequencing 35–40 plasmids. Similar sequences were obtained using both primer pairs suggesting that each reaction amplified representative sequences. For example, 18 variant sequences were identified among 78 clones of region B from Patient 10366 Visit 1. Of the 6 variant sequences found in more than two plasmid clones, all were amplified by both primer pairs, representing 83% of total sequences obtained. Using this strategy approximately 75 cloned sequences were analyzed per variable region for each time point in all four patients.
The predicted amino acid sequences for each variable region were aligned to assess sequence changes between time points. Sequence variation between time points was observed in all four patients analyzed in at least one variable region. Variable region sequences were unique to the isolates from each patient (i.e., no sequence was identical between different patients), emphasizing the diversity of M. genitalium strains circulating in a single geographic area. A comparison of the Visit 1 and Visit 3 sequences revealed the loss of specific amino acid sequences over time, consistent with immune selection against specific epitopes. Figs 3 and 4 show the results of these analyses in graphic form in which each individual cloned sequence is compared to the predominant sequence present at Visit 1. M. genitalium isolates cultured from Patient 10366 varied between time points in all four regions of mgpB and mgpC (Fig 3). A mixture of variant region B, EF, and KLM sequences, with a single region G sequence, was present at Visit 1. However, by Visit 3 novel sequences predominated in all four variable regions consistent with selection against sequences present at Visit 1. In contrast, Patient 10467 varied only in Region B, Patient 10378 varied only in region EF, and Patient 10477 varied in Regions EF and KLM (Fig 4). In general, a single variant sequence predominated at Visit 3 for all four patients analyzed, although patients differed in whether they were infected with a variety of variants (eg Patient 10366 B, EF, and KLM) or a single predominant sequence (eg Patients 10378, 10467, and 10477). Interestingly, in Patient 10378, the Visit 3 culture was a mixture of the predominant Visit 1 sequence and a novel sequence (Fig 4). This may indicate “selection in process”–i.e., that effective antibodies have recently appeared and are actively selecting against an epitope formed by the amino acids that have changed between time points.
Fig 3. Evolution of MgpB regions B, EF, and G, and MgpC region KLM sequences during infection in Patient 10366.
Amino acid alignments (Multalin [41]) were submitted to Highlighter [42] to generate the output shown. Each horizontal line represents a single cloned sequence. Amino acids that differ from the predominant Visit 1 sequence (top line) are marked with vertical colored bars with different colors corresponding to particular amino acids. Visit 1 and Visit 3 sequences are indicated by grey and yellow block shading at right, respectively. Dashed boxes indicate sequences detailed in Figs 5 and 6. Variable regions not shown for Patients 10378, 10467, and 10477 did not vary substantially between time points and therefore were not analyzed further.
Fig 4. Evolution of MgpB regions B, EF, and G, and MgpC region KLM sequences during infection in Patients 10378, 10467, and 10477.
Analysis and data presentation are described in legend for Fig 3.
Close inspection of variant sequences (Figs 5 and 6) revealed that changes occurred in clusters of amino acids consistent with the well-described mechanism of segmental recombination between mgpBC and the MgPars [22, 23]. As individual variant clusters arose independently of each other (for example, amino acids “DTSG.T” appeared independently of amino acids “KSG” in region B Patient 10366, Fig 5) we assumed that they represent independent recombination events. To estimate the number of recombination events in these patients, we visually inspected the amino acid alignments shown in Figs 3 and 4 for segmental sequence changes, similar to previously described analyses [49]. For simplicity, single amino acid changes present in only one plasmid clone were omitted as these could arise via point mutations or PCR/sequencing errors. This analysis identified 68 possible recombination events among the variants infecting Patient 10366 (8 in region B, 18 in EF, 1 in region G, and 41 in region KLM); 6 recombination events in Patient 10378 (region EF only), 16 in Patient 10467 (region B only), and 26 in Patient 10477 (11 in region EF and 15 in KLM).
Fig 5. Detailed alignment of variable segments indicated in Fig 3 for Patient 10366.
The predominant sequence present at Visit 1 is shown in black at the top of each alignment. Each unique sequence is represented on a single line, variant amino acids are marked in color, dots indicate unchanged amino acids, and dashes indicate gaps.
Fig 6. Detailed alignment of variable segments indicated in Fig 4 for Patients 10378, 10467, and 10477.
The predominant sequence present at Visit 1 is shown in black at the top of each alignment. Each unique sequence is represented on a single line, variant amino acids are marked in color, dots indicate unchanged amino acids, and dashes indicate gaps.
Stability of sequences in Vero coculture
As recovery of M. genitalium from patient specimens requires three weeks of in vitro coculture with Vero cells, we considered the possibility that the gene variation we observed occurred during in vitro culture rather during patient infection. To address this issue, we serially passaged M. genitalium from Patient 10366 at Visit 1 (MEGA 1166) for an additional seven weeks in Vero cells then compared the variants present in MgpB region B to the same unpassaged culture. As shown in Fig 7 (upper panel), we found that the number of different variants present, and the sequences of these variants, changed very little during these seven weeks of in vitro growth. Similarly, M. genitalium cultured from this patient at Visit 3 (MEGA 1206) varied little during seven weeks in vitro (Fig 7, lower panel). These results contrast with the extensive sequence evolution that occurred during 33 days of urethral infection and support our conclusion that diversification of sequences is a consequence of growth in vivo.
Fig 7. Assessment of antigenic variation during in vitro passage in Vero cell cocultures.
MgpB region B sequences were compared between Visit 1 (MEGA 1166) and Visit 3 (MEGA 1206) cultured from patient specimens after seven weeks of in vitro passage in Vero cell cocultures. Identical sequences are indicated with identical colors; 34–38 plasmids were sequenced from each culture. Results show that little variation occurred during seven weeks of in vitro growth for each culture.
MgpC variant amino acids lie within predicted conformational B cell epitopes
The recent description of the MgpC crystal structure [29] afforded the opportunity to predict the location of conformational B cell epitopes. As shown in Fig 8A, DiscoTope [45] analysis predicted numerous conformational epitopes within full-length MgpC with higher scoring epitopes concentrated in variable region KLM: 152 amino acids in full-length MgpC have a DiscoTope score greater than -1.0 (corresponding to 30% sensitivity and 85% specificity), 133 (87.5%) of which are located in KLM.
Fig 8. Prediction of conformational B cell epitopes in MgpC.
(A). G37 MgpC high-scoring B cell epitopes localize to variable region KLM. DiscoTope 2.0 with a stringent cutoff of -1 (corresponding to 30% sensitivity and 85% specificity), indicated by the horizontal dashed line, was used to predict conformational B cell epitopes using the published MgpC structure (PDB 5mzb, amino acids 25–936 [29]). Variable region KLM is indicated by the purple line, this region is expanded to show detail in panel B (dashed grey lines). (B). Variant amino acids correlate with predicted B cell epitopes within variable region KLM. Red and green lines indicate sequences obtained for Patient 10366 and 10477 isolates, respectively, amino acids that varied between time points indicated by “peaks” (arbitrary units).
The locations of predicted conformational epitopes were mapped onto the crystal structure of G37 MgpC as shown in Fig 9. Epitopes predicted within the conserved region of MgpC are marked in red, while epitopes in variable region KLM that cluster together on the MgpC surface are indicated with various colors. The amino acids implicated in sialic acid binding [29] are located within, or adjacent to, predicted epitopes (magenta in Fig 9). This analysis shows that most conformational epitopes are located on the so-called “crown” of MgpC, which consists primarily of variable region KLM, as previously noted [29], and are located on the surface of the MgpC molecule where they could be targeted by host antibodies.
Fig 9. Location of predicted conformational epitopes on the G37 MgpC protein.

The MgpC transmembrane domain (not shown) is oriented downward. Colored residues indicate epitopes that group together on the surface of MgpC; epitopes in the conserved region of KLM are indicated in red. The eight amino acids required for sialic acid binding [29] are shown in magenta, five of which lie within predicted epitopes. Figure produced using Pymol.
Variation observed during patient infection localizes to predicted epitopes
We hypothesized that if variation in MgpC region KLM represents an immune evasion mechanism then sequence changes should affect predicted epitopes. We aligned the KLM sequences obtained from two patients and identified amino acids that changed between time points (Fig 8B). In Patient 10366, 32 amino acids varied between early and late time points in region KLM, 22 (66%) of which corresponded to epitopes predicted by DiscoTope with a stringent cutoff of -1.0 (indicated as peaks in Fig 8B, red line). Similarly, 49 (67%) of the 73 amino acids that varied in Patient 10477 were located in epitopes (Fig 8B, green line).
We next determined whether sequence variation in vivo changed the amino acid sequence of an existing epitope, or if a pre-existing epitope was changed to a non-epitope. For this analysis, we replaced the G37 MgpC region KLM sequence with the patient-specific variant sequences, generated structural models with iTasser, and predicted conformational epitopes with DiscoTope. For simplicity, sequences from a single patient (Patient 10477: Visit 1 MEGA 1491 vs Visit 3 MEGA 1534) were analyzed as a single, unique sequence predominated at each time point (Fig 10). The epitopes predicted using the patient-specific models were similar to G37 in score (not shown) and location (compare Figs 10 to 9) despite 17% amino acid sequence differences. Patient-specific epitopes localized predominantly to the crown of MgpC and the amino acids that changed between time points (indicated in black in Fig 10) were embedded in these epitopes. Interestingly, the variant amino acids localized to different faces of the MgpC crown suggesting that several epitopes changed during the course of infection, possibly avoiding binding by antibodies of multiple specificities.
Fig 10. Models of MgpC for Patient 10477 Visit 1 isolate (MEGA 1491, left) and Visit 3 isolate (MEGA 1534, right).
Colored residues indicate predicted epitopes that group together on the surface of MgpC, added to improve data visualization. Amino acids that changed between time points are indicated in black on the Visit 3 model. Amino acids implicated in sialic acid binding are shown in magenta. Residues indicated in red and brown are epitopes predicted in the conserved region of MgpC.
Discussion
In this study, we assessed sequence variation in the variable regions of mgpB (regions B, EF, and G) and mgpC (region KLM) of M. genitalium cultured from longitudinal specimens (spanning 30 to 58 days) from persistently infected men. Strain typing confirmed that a single strain type was detected in each patient at all time points, and immunoblots indicated antibody reactivity to the MgpB and MgpC proteins in the sera of all four men. Evidence of extensive variation was observed in these patients in one or multiple mgpBC variable regions in vivo, with little variation during in vitro culture. The extent and diversity of variation was greater than previously appreciated by other studies of M. genitalium antigenic variation in patient specimens. Most variable amino acids in MgpC mapped to predicted conformational B cell epitopes supporting a role for antigenic variation as a mechanism to avoid the biologic effect of specific antibodies in order to persist in vivo.
Previous studies have been instrumental in establishing that the gene variation predicted from in vitro studies occurs in vivo. For example, we previously observed mgpB and mgpC gene variation in M. genitalium-infected women [22, 23] and Ma et al. [32, 43] documented variation in several M. genitalium-infected men and women. However, each of these previous studies assessed a limited number of sequences (5 to 18 cloned sequences per specimen) and only one or two variable regions in these patients. Fookes et al. [50] assessed changes in the entire mgpBC operon by whole genome sequencing of isolates obtained 79 days apart, however, as single colony cloned strains were sequenced, the full breadth of variation within the infecting population could not be assessed. Our study provides a comprehensive assessment of variation across all variable regions in both MgpB and MgpC in men who were each persistently infected with a single strain. This approach allows an appreciation of the extent and frequency of variation, necessary to understand how antigenic variation relates to immune evasion and pathogenesis. Interestingly, we found that some variable regions did not change between time points in three patients: few changes were observed in regions B, G, and KLM in Patient 10378, in regions EF, G, and KLM in Patient 10467, and in regions B and G in Patient 10477. Our model of antibody-mediated immune selection would predict that the sera of these patients would react poorly to these non-variant regions of MgpB and MgpC, a prediction we intend to test in future experiments.
We compared the number of recombination events observed at the expression site, calculated by identifying clusters of amino acid changes between time points and assuming that a unique cluster arose via a single recombination event. In this small sample set, the number of recombination events did not correlate with the length of time between specimen collection. For example, in Patient 10378 we observed 6 recombination events over 48 days of infection, whereas 68 recombination events were detected in Patient 10366 during 33 days of infection. It is tempting to speculate that the duration of antibody response is related to the number of variants observed. For example, isolates from Patients 10366 and 10477 had the most recombination events between time points analyzed (68 and 26, respectively) and both patients had anti-MgpB and MgpC antibodies at early and late time points, providing more opportunity for antibody-mediated selection. However, it is unknown when antibodies arose in Patients 10378 (48 days between visits) and 10467 (28 days). Furthermore, patient serum antibody reactivity was measured by immunoblot against whole cell lysates of M. genitalium strain G37, thereby detecting reactivity to sequences common in all MgpB and MgpC alleles, rather than unique variants present at early time points in these patients. Finally, immunoblot reactivity does not necessarily indicate biologic activity, for example, antibodies may target epitopes that are not exposed on the surface of M. genitalium. Further experiments are needed to ascertain whether these patient antibodies bind specific variants and have biologic activity.
Our results showed clearly that many more variants arise during patient infection than during in vitro culture, probably due to a combination of immune selection and higher rates of recombination in vivo. The role of selection by immune factors is supported by the presence of antibodies to MgpB and MgpC, the known immunogenicity of these proteins in humans and animals, and the prediction of many high scoring conformational B cell epitopes in the variable region of MgpC. Furthermore, the fact that a single variant predominates at a given time point suggests that immune selection drives variation (ie, by selecting against one sequence followed by proliferation of a novel variant that escapes antibody selection). In concert with immune selection, we hypothesize that the rate of recombination is upregulated in vivo. Recently, an alternative sigma factor, MG428, was identified that induces expression of RecA and other recombination enzymes thereby increasing antigenic and phase variation [51–53]. We hypothesize that specific inducing signals for the MG428 regulon, as yet unknown, will be found in the genital tract.
We analyzed the MgpC protein for predicted conformational B cell epitopes using the available crystal structure [29]. We found that most conformational epitopes are located in the variable KLM region of MgpC and that sequence variation detected in M. genitalium patient isolates alters the amino acids specifically localized to these epitopes. These data support our hypothesis that the role of gene variation is avoidance of specific antibody. Interestingly, few conformational epitopes are predicted in conserved sequences of MgpC suggesting that low immunogenicity may be an additional strategy to avoid antibody targeting of these invariant yet surface exposed regions. Further studies are needed to determine if epitopes predicted in silico are indeed targeted by host antibodies, and if the MG281 antibody binding protein of M. genitalium [54] plays a role in immune evasion.
Supporting information
Original blots showing reactivity of patient sera to M. genitalium whole cell lysates.
(TIF)
Data Availability
All relevant data are within the manuscript and its Supporting Information files.
Funding Statement
Funding provided by the National Institute of Health, NIAID grants R21 AI107402 (GEW, SLIC, PAT), U19 AI031448 (SLIC, LEM, MSL, CWG), and R01 AI072728 (LEM, PAT). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Horner PJ, Martin DH. Mycoplasma genitalium infection in men. J Infect Dis. 2017;216: S396–S405. 10.1093/infdis/jix145 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Haggerty CL, Totten PA, Astete SG, Ness RB. Mycoplasma genitalium among women with nongonococcal, nonchlamydial pelvic inflammatory disease. Infect Dis Obstet Gynecol. 2006;2006: 30184 10.1155/IDOG/2006/30184 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Haggerty CL, Totten PA, Astete SG, Lee S, Hoferka SL, Kelsey SF, et al. Failure of cefoxitin and doxycycline to eradicate endometrial Mycoplasma genitalium and the consequence for clinical cure of pelvic inflammatory disease. Sex Transm Infect. 2008;84: 338–342. 10.1136/sti.2008.030486 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Cohen CR, Manhart LE, Bukusi EA, Astete S, Brunham RC, Holmes KK, et al. Association between Mycoplasma genitalium and acute endometritis. Lancet (London, England). England; 2002. pp. 765–766. 10.1016/S0140-6736(02)07848-0 [DOI] [PubMed] [Google Scholar]
- 5.Clausen HF, Fedder J, Drasbek M, Nielsen PK, Toft B, Ingerslev HJ, et al. Serological investigation of Mycoplasma genitalium in infertile women. Hum Reprod. 2001;16: 1866–1874. 10.1093/humrep/16.9.1866 [DOI] [PubMed] [Google Scholar]
- 6.Svenstrup HF, Fedder J, Kristoffersen SE, Trolle B, Birkelund S, Christiansen G. Mycoplasma genitalium, Chlamydia trachomatis, and tubal factor infertility—a prospective study. Fertil Steril. 2008;90: 513–520. 10.1016/j.fertnstert.2006.12.056 [DOI] [PubMed] [Google Scholar]
- 7.Wiesenfeld HC, Manhart LE. Mycoplasma genitalium in women: current knowledge and research priorities for this recently emerged pathogen. J Infect Dis. 2017;216: S389–S395. 10.1093/infdis/jix198 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Manhart LE, Mostad SB, Baeten JM, Astete SG, Mandaliya K, Totten PA. High Mycoplasma genitalium organism burden is associated with shedding of HIV-1 DNA from the cervix. J Infect Dis. 2008;197: 733–736. 10.1086/526501 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mavedzenge SN, Van Der Pol B, Weiss HA, Kwok C, Mambo F, Chipato T, et al. The association between Mycoplasma genitalium and HIV-1 acquisition in African women. AIDS. 2012;26: 617–624. 10.1097/QAD.0b013e32834ff690 [DOI] [PubMed] [Google Scholar]
- 10.Vandepitte J, Weiss HA, Kyakuwa N, Nakubulwa S, Muller E, Buve A, et al. Natural history of Mycoplasma genitalium infection in a cohort of female sex workers in Kampala, Uganda. Sex Transm Dis. 2013;40: 422–427. 10.1097/OLQ.0b013e31828bfccf [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Baumann L, Cina M, Egli-Gany D, Goutaki M, Halbeisen FS, Lohrer G-R, et al. Prevalence of Mycoplasma genitalium in different population groups: systematic review and meta-analysis. Sex Transm Infect. 2018;94: 255–262. 10.1136/sextrans-2017-053384 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Sena AC, Lee JY, Schwebke J, Philip SS, Wiesenfeld HC, Rompalo AM, et al. A silent epidemic: the prevalence, incidence and persistence of Mycoplasma genitalium among young, asymptomatic high-risk women in the United States. Clin Infect Dis. 2018;67: 73–79. 10.1093/cid/ciy025 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Korenromp EL, Sudaryo MK, de Vlas SJ, Gray RH, Sewankambo NK, Serwadda D, et al. What proportion of episodes of gonorrhoea and chlamydia becomes symptomatic? Int J STD AIDS. 2002;13: 91–101. 10.1258/0956462021924712 [DOI] [PubMed] [Google Scholar]
- 14.Manhart LE, Holmes KK, Hughes JP, Houston LS, Totten PA. Mycoplasma genitalium among young adults in the United States: an emerging sexually transmitted infection. Am J Public Health. 2007;97: 1118–1125. 10.2105/AJPH.2005.074062 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Sonnenberg P, Ison CA, Clifton S, Field N, Tanton C, Soldan K, et al. Epidemiology of Mycoplasma genitalium in British men and women aged 16–44 years: evidence from the third National Survey of Sexual Attitudes and Lifestyles (Natsal-3). Int J Epidemiol. 2015;44: 1982–1994. 10.1093/ije/dyv194 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Bradshaw CS, Jensen JS, Waites KB. New horizons in Mycoplasma genitalium treatment. J Infect Dis. 2017;216: S412–S419. 10.1093/infdis/jix132 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Murray GL, Bradshaw CS, Bissessor M, Danielewski J, Garland SM, Jensen JS, et al. Increasing macrolide and fluoroquinolone resistance in Mycoplasma genitalium. Emerg Infect Dis. 2017;23: 809–812. 10.3201/eid2305.161745 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Romano SS, Jensen JS, Lowens MS, Morgan JL, Chambers LC, Robinson TS, et al. Long duration of asymptomatic Mycoplasma genitalium infection after syndromic treatment for nongonococcal urethritis. Clin Infect Dis. 2018. 10.1093/cid/ciy843 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Cohen CR, Nosek M, Meier A, Astete SG, Iverson-Cabral S, Mugo NR, et al. Mycoplasma genitalium infection and persistence in a cohort of female sex workers in Nairobi, Kenya. Sex Transm Dis. 2007;34: 274–279. 10.1097/01.olq.0000237860.61298.54 [DOI] [PubMed] [Google Scholar]
- 20.Iverson-Cabral SL, Manhart LE, Totten PA. Detection of Mycoplasma genitalium-reactive cervicovaginal antibodies among infected women. Clin Vaccine Immunol. 2011;18: 1783–1786. 10.1128/CVI.05174-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Svenstrup HF, Jensen JS, Gevaert K, Birkelund S, Christiansen G. Identification and characterization of immunogenic proteins of Mycoplasma genitalium. Clin Vaccine Immunol. 2006;13: 913–922. 10.1128/CVI.00048-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Iverson-Cabral SL, Astete SG, Cohen CR, Rocha EPC, Totten PA. Intrastrain heterogeneity of the mgpB gene in Mycoplasma genitalium is extensive in vitro and in vivo and suggests that variation is generated via recombination with repetitive chromosomal sequences. Infect Immun. 2006;74: 3715–3726. 10.1128/IAI.00239-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Iverson-Cabral SL, Astete SG, Cohen CR, Totten PA. mgpB and mgpC sequence diversity in Mycoplasma genitalium is generated by segmental reciprocal recombination with repetitive chromosomal sequences. Mol Microbiol. 2007;66: 55–73. 10.1111/j.1365-2958.2007.05898.x [DOI] [PubMed] [Google Scholar]
- 24.Scheffer MP, Gonzalez-Gonzalez L, Seybert A, Ratera M, Kunz M, Valpuesta JM, et al. Structural characterization of the NAP; the major adhesion complex of the human pathogen Mycoplasma genitalium. Mol Microbiol. 2017;105: 869–879. 10.1111/mmi.13743 [DOI] [PubMed] [Google Scholar]
- 25.Burgos R, Pich OQ, Ferrer-Navarro M, Baseman JB, Querol E, Pinol J. Mycoplasma genitalium P140 and P110 cytadhesins are reciprocally stabilized and required for cell adhesion and terminal-organelle development. J Bacteriol. 2006;188: 8627–8637. 10.1128/JB.00978-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Garcia-Morales L, Gonzalez-Gonzalez L, Querol E, Pinol J. A minimized motile machinery for Mycoplasma genitalium. Mol Microbiol. 2016;100: 125–138. 10.1111/mmi.13305 [DOI] [PubMed] [Google Scholar]
- 27.Iverson-Cabral SL, Wood GE, Totten PA. Analysis of the Mycoplasma genitalium MgpB adhesin to predict membrane topology, investigate antibody accessibility, characterize amino acid diversity, and identify functional and immunogenic epitopes. PLoS One. 2015;10: e0138244 10.1371/journal.pone.0138244 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Svenstrup HF, Nielsen PK, Drasbek M, Birkelund S, Christiansen G. Adhesion and inhibition assay of Mycoplasma genitalium and M. pneumoniae by immunofluorescence microscopy. J Med Microbiol. 2002;51: 361–373. 10.1099/0022-1317-51-5-361 [DOI] [PubMed] [Google Scholar]
- 29.Aparicio D, Torres-Puig S, Ratera M, Querol E, Piñol J, Pich OQ, et al. Mycoplasma genitalium adhesin P110 binds sialic-acid human receptors. Nat Commun. 2018;9: 1–11. 10.1038/s41467-018-06963-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Dallo SF, Baseman JB. Adhesin gene of Mycoplasma genitalium exists as multiple copies. Microb Pathog. 1991;10: 475–480. 10.1016/0882-4010(91)90113-o [DOI] [PubMed] [Google Scholar]
- 31.Ma L, Jensen JS, Myers L, Burnett J, Welch M, Jia Q, et al. Mycoplasma genitalium: an efficient strategy to generate genetic variation from a minimal genome. Mol Microbiol. 2007;66: 220–236. 10.1111/j.1365-2958.2007.05911.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ma L, Mancuso M, Williams JA, Van Der Pol B, Fortenberry JD, Jia Q, et al. Extensive variation and rapid shift of the MG192 sequence in Mycoplasma genitalium strains from patients with chronic infection. Infect Immun. 2014;82: 1326–1334. 10.1128/IAI.01526-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Burgos R, Wood GE, Iverson-Cabral SL, Totten PA. Mycoplasma genitalium nonadherent phase variants arise by multiple mechanisms and escape antibody-dependent growth inhibition. Infect Immun. 2018;86 10.1128/IAI.00866-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Lluch-Senar M, Querol E, Pinol J. Cell division in a minimal bacterium in the absence of ftsZ. Mol Microbiol. 2010;78: 278–289. 10.1111/j.1365-2958.2010.07306.x [DOI] [PubMed] [Google Scholar]
- 35.Manhart LE, Gillespie CW, Lowens MS, Khosropour CM, Colombara D V, Golden MR, et al. Standard treatment regimens for nongonococcal urethritis have similar but declining cure rates: a randomized controlled trial. Clin Infect Dis. 2013;56: 934–942. 10.1093/cid/cis1022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Manhart LE, Jensen JS, Bradshaw CS, Golden MR, Martin DH. Efficacy of antimicrobial therapy for Mycoplasma genitalium infections. Clin Infect Dis. 2015;61 Suppl 8: S802–17. 10.1093/cid/civ785 [DOI] [PubMed] [Google Scholar]
- 37.Hjorth SV, Bjornelius E, Lidbrink P, Falk L, Dohn B, Berthelsen L, et al. Sequence-based typing of Mycoplasma genitalium reveals sexual transmission. J Clin Microbiol. 2006;44: 2078–2083. 10.1128/JCM.00003-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Wood GE, Iverson-Cabral SL, Patton DL, Cummings PK, Cosgrove Sweeney YT, Totten PA. Persistence, immune response, and antigenic variation of Mycoplasma genitalium in an experimentally infected pig-tailed macaque (Macaca nemestrina). Infect Immun. 2013;81: 2938–2951. 10.1128/IAI.01322-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Hamasuna R, Osada Y, Jensen JS. Isolation of Mycoplasma genitalium from first-void urine specimens by coculture with Vero cells. J Clin Microbiol. 2007;45: 847–850. 10.1128/JCM.02056-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wood GE, Patton DL, Cummings PK, Iverson-Cabral SL, Totten PA. Experimental infection of pig-tailed macaques (Macaca nemestrina) with Mycoplasma genitalium. Infect Immun. 2017;85 10.1128/IAI.00738-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988;16: 10881–10890. 10.1093/nar/16.22.10881 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Keele BF, Giorgi EE, Salazar-Gonzalez JF, Decker JM, Pham KT, Salazar MG, et al. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc Natl Acad Sci U S A. 2008;105: 7552–7557. 10.1073/pnas.0802203105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Ma L, Jensen JS, Mancuso M, Hamasuna R, Jia Q, McGowin CL, et al. Genetic variation in the complete MgPa operon and its repetitive chromosomal elements in clinical strains of Mycoplasma genitalium. PLoS One. 2010;5: e15660 10.1371/journal.pone.0015660 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Jensen JS, Bjornelius E, Dohn B, Lidbrink P. Use of TaqMan 5’ nuclease real-time PCR for quantitative detection of Mycoplasma genitalium DNA in males with and without urethritis who were attendees at a sexually transmitted disease clinic. J Clin Microbiol. 2004;42: 683–692. 10.1128/jcm.42.2.683-692.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Kringelum JV, Lundegaard C, Lund O, Nielsen M. Reliable B cell epitope predictions: impacts of method development and improved benchmarking. PLoS Comput Biol. 2012;8: e1002829 10.1371/journal.pcbi.1002829 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Zhang Y. I-TASSER server for protein 3D structure prediction. BMC Bioinformatics. 2008;9: 40 10.1186/1471-2105-9-40 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Jespersen MC, Peters B, Nielsen M, Marcatili P. BepiPred-2.0: improving sequence-based B-cell epitope prediction using conformational epitopes. Nucleic Acids Res. 2017;45: W24–W29. 10.1093/nar/gkx346 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Dutro SM, Hebb JK, Garin CA, Hughes JP, Kenny GE, Totten PA. Development and performance of a microwell-plate-based polymerase chain reaction assay for Mycoplasma genitalium. Sex Transm Dis. 2003;30: 756–763. 10.1097/01.OLQ.0000078821.27933.88 [DOI] [PubMed] [Google Scholar]
- 49.Ma L, Jensen JS, Mancuso M, Myers L, Martin DH. Kinetics of genetic variation of the Mycoplasma genitalium MG192 gene in experimentally infected chimpanzees. Infect Immun. 2015;84: 747–753. 10.1128/IAI.01162-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Fookes MC, Hadfield J, Harris S, Parmar S, Unemo M, Jensen JS, et al. Mycoplasma genitalium: whole genome sequence analysis, recombination and population structure. BMC Genomics. 2017;18: 993 10.1186/s12864-017-4399-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Torres-Puig S, Martinez-Torro C, Granero-Moya I, Querol E, Pinol J, Pich OQ. Activation of sigma20-dependent recombination and horizontal gene transfer in Mycoplasma genitalium. DNA Res. 2018;25: 383–393. 10.1093/dnares/dsy011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Torres-Puig S, Broto A, Querol E, Pinol J, Pich OQ. A novel sigma factor reveals a unique regulon controlling cell-specific recombination in Mycoplasma genitalium. Nucleic Acids Res. 2015;43: 4923–4936. 10.1093/nar/gkv422 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Burgos R, Totten PA. MG428 is a novel positive regulator of recombination that triggers mgpB and mgpC gene variation in Mycoplasma genitalium. Mol Microbiol. 2014;94: 290–306. 10.1111/mmi.12760 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Grover RK, Zhu X, Nieusma T, Jones T, Boero I, MacLeod AS, et al. A structurally distinct human mycoplasma protein that generically blocks antigen-antibody union. Science (80-). 2014;343: 656–661. 10.1126/science.1246135 [DOI] [PMC free article] [PubMed] [Google Scholar]








