Abstract
After HSP70 binds to the J domain of the substrate and co-chaperone protein, ATP is hydrolyzed to ADP, and the nucleotide exchange factors (NEFs) promote the release of ADP. Under physiological conditions, the nucleotide exchange step is the rate-limiting step, which is accelerated by NEFs. In this study, the promoter of nucleotide exchange factor ZjFes1 was cloned, and its expression in tissues and under heat stress was studied to understand the regulatory mechanism of ZjFes1 and provide the molecular basis to study heat tolerance mechanism of seagrass. It was found that the promoter has common cis-acting elements in promoter and enhancer regions CAAT-box, as well as light response elements AE-box, Box 4 and TCCC-motif, a cis-acting regulatory element essential for the anaerobic induction of ARE, hormone response elements CGTCA-motif and TGACG-motif (MeJA response element), GARE-motif (gibberellin response element), TGA-element (auxin response element), a cis-acting regulatory element related to meristem expression CAT-box, and a cis-acting element involved in defense and stress responsiveness of TC-rich repeats. Two-week-old seedlings exhibited weak GUS activities in their cotyledons. In addition, the AtFes1A promoter was constitutively active in the anthers. After exposure to 38 °C for 2 h, the root tips of two-week-old seedlings were stained a strong blue. Heat-inducible activities of GUS were also observed in the cotyledons, roots, leaves, anthers, sepals and siliques.
Subject terms: Transcriptional regulatory elements, Molecular ecology
Introduction
As is well known, molecular chaperones can help proteins fold in cells1. NEFs are critical to the functional cycle of HSP70. Well-studied NEFs include GrpE in E. coli2, Bag-13 and HspBP-14,5 in animals, and Fes1p in yeast6. The yeast Fes1 gene encodes a conserved NEF that acts on cytoplasmic Hsp70s. Mammalian HspBP1 is homologous to Fes1p. HspBP1 promotes the nucleotide dissociation of mammalian Hsc704. HspBP-1 was initially identified as a binding factor to human Hsp70 and was subsequently identified as a functional NEF of cytoplasmic Hsp70, which inhibits the CHIP ubiquitin ligase that directs Hsp70 to the 26S proteasome7. When HspBP1 bound to Hsc70, the ubiquitin ligase activity of CHIP decreased7. A protein quality control system protects cells from the accumulation of misfolded proteins by promoting selective degradation of misfolded proteins. Hsp70 combines misfolded proteins to facilitate their refolding. If the protein cannot be folded, Hsp70 interacts with ubiquitination enzymes to promote the degradation of misfolded proteins. Hsp70 NEF Fes1 is essential for the ubiquitination of cytoplasmic misfolded proteins, and Fes1 directs Hsp70 substrates to the degradation machinery8. Fes1 selectively binds proteins bound to Hsp70 to facilitate their release from Hsp708. In the absence of Fes1, misfolded proteins cannot be polyubiquitinated8. As a result, they aggregate and induce a strong heat shock response8. Cells maintain protein homeostasis by selectively identifying and degrading misfolded proteins. In Saccharomyces cerevisiae, Hsp70 NEF Fes1 is essential for the degradation of misfolded proteins using an ubiquitin–proteasome system. The cytoplasmic splicing variant of Hsp70 NEF Fes1 is essential for the degradation of misfolded proteins in yeast9. Fes1 transcripts produce two active isoforms through 3′ alternative splicing9. The C-terminus of these two isomers differ and are referred to as Fes1L and Fes1S9. Fse1L is located in the nucleus and was the first nuclear Hsp70 nucleotide exchange factor identified9. In contrast, Fes1S is located in the cytoplasm, which is a necessary condition for maintaining protein stability9. In the absence of Fes1S, the heat shock response was induced under conditions that were normally not stressful9. In addition, when the temperature increased, the cells showed severe growth defects9. Importantly, misfolded proteins cannot be degraded by the ubiquitin–proteasome system9. Genes homologous to HspBP-1 have also been found in other eukaryotes, such as Fes1p in yeast. The deletion of Fes1 moderately damaged the growth of yeast at 37 °C6. Three Fes1p homologues were identified in Arabidopsis thaliana10, and AtFes1A plays an important role in heat response10. The expression of AtFes1A was induced by high temperature, and AtFes1A prevented the degradation of Hsp7010.
Global climate change is one of the major factors that affects seagrass meadows through its effects on sea level, temperature and CO2 in the atmosphere, which can change the distribution and productivity of seagrass11. Rising sea surface temperatures impose heat stress on seagrass12,13, and the changes in sea surface temperatures directly affect the maintenance of C balance and metabolism in seagrass14. In addition, temperature is the main factor that controls the growth of seagrass by altering biochemical processes15, where high temperatures inhibit the growth of seagrass16.
Zostera japonica is a species of seagrass endemic to Asia and is primarily distributed in Japan, Korea and China. Z. japonica is the most widely distributed seagrass species in subtropical and temperate coastal areas of China. In the subtropical zone, Z. japonica often appears near mangroves or coexists with Halophila ovalis. In the temperate zone, Z. japonica often lives near Z. marina and in the intertidal zone where the water level is shallower than that in which Z. marina grows. Only Z. japonica can be found in both temperate and subtropical zones in China. Z. japonica is an intertidal seagrass, and intertidal seagrass species are more susceptible to heat stress at low tide during the summer months than subtidal seagrass species.
Fes1p has three homologous genes in Arabidopsis thaliana, which belong to the ARM (armadillo repeat) superfamily17. The fes1p homologous genes of A. thaliana are designated AtFes1A (AT3G09350), AtFes1B (AT3G53800) and AtFes1C (AT5G02150). Microarray analysis (Genevestigator, https://genevestigator.com/gv/) showed that among the three AtFes1 genes, AtFes1A was the most significantly expressed by heat induction. A knockout of AtFes1A severely impaired acquired thermotolerance in seedlings. Furthermore, AtFes1A and Hsp70 interact in vivo and in vitro. However, AtFes1A has no NEF activity in vitro. Surprisingly, an AtFes1A knockout resulted in the down-regulation of Hsp70 protein in cytoplasm and increased transcription of Hsps and Hsfs.
Although the homologous genes of hspbp-1/fes1p in A. thaliana have been identified, little is known about their homologous genes in seagrass. Promoters control gene expression, and it is important to study the promoter of nucleotide exchange factor in Z. japonica to understand regulatory mechanism of the gene. We have previously studied the nucleotide exchange factor of Z. japonica and preliminarily verified the function of ZjFes118,19, but we did not study the promoter of the gene. In this study, the upstream promoter of ZjFes1 was cloned using a genome walking method; the promoter sequence was analyzed, and the expression vector was constructed to verify the promoter activity. The promoter activity under heat stress was studied by transforming A. thaliana and subjecting the transgenic A. thaliana to heat treatment. It is helpful to understand the regulatory mode of ZjFes1 in Z. japonica, and this study provides a theoretical basis to study related nucleotide exchange factors in the future.
Results
Cloning and analysis of promoters
According to the primers designed, the 2 kb promoter was obtained by genome walking. Primers were designed at both ends of the promoter, and 2 kb bands were amplified by PCR based on the primers designed. Sequencing results showed that the amplified sequence was identical with the promoter sequence obtained by genome walking, and the sequence could be used in the next experiment. The cloned 2000 bp sequence was predicted online, and the results showed that ZjFes1 promoter not only contained common cis-acting elements in promoter and enhancer regions CAAT-box but also the light response elements AE-box, Box 4 and TCCC-motif, a cis-acting regulatory element essential for the anaerobic induction ARE, hormone response elements CGTCA-motif and TGACG-motif (MeJA response element), GARE-motif (gibberellin response element), TGA-element (auxin response element), cis-acting regulatory element related to meristem expression CAT-box, and a cis-acting element involved in defense and stress responsiveness TC-rich repeats (Fig. 1).
Figure 1.
Sequence analysis of the ZjFes1 promoter. This promoter sequence data of ZjFes1 was registered in GenBank (No. MN161576). The blue arrow indicates primers used for genome walking and amplification of the full-length promoter sequence. The cis-acting elements are highlighted in green. The initiation codon is highlighted in blue.
Construction of the plant expression vector
The promoter fragment obtained (2000 bp) was added with tail A and connected to vector pCXGUS-P/pXcmI-GUS (only GUS, no promoter) to transform E. coli. The recombinant plasmid was identified by PCR, which indicated that ZjFes1 promoter had been inserted into pCXGUS-P/pXcmI-GUS (Fig. 2).
Figure 2.
The carrier structure of recombinant plasmid of pZjFes1::GUS.
Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana and GUS staining
The recombinant expression vector pZjFes1::GUS was transformed into A. tumefaciens GV3101. A. thaliana was transformed using an A. tumefaciens-mediated floral dip method. The homozygous plants of transgenic Arabidopsis thaliana were heat-treated and 2-week-old seedlings, leaves, flowers and siliques were stained with GUS. The expression products of GUS could be detected by A. tumefaciens transfected into pZjFes1::GUS in A. thaliana, which indicated that the cloned ZjFes1 promoter could drive the expression of downstream gene GUS, i.e., the promoter fragment had driving activity. The homologous gene of ZjFes1 in A. thaliana is AtFes1A (At3g09350). AtFes1A was constitutively expressed at low levels at 23 °C and was significantly induced by high temperature10. Heat treatment was used to verify the expression of ZjFes1 promoter under heat stress. Two-week-old seedlings exhibited weak GUS activities in their cotyledons. In addition, the AtFes1A promoter was constitutively expressed in anthers. After exposure to 38 °C for 2 h, the root tips of two-week-old seedlings were strongly stained blue. Heat-inducible activities of GUS were also observed in the cotyledons, roots, leaves, anthers, sepals and siliques (Fig. 3). This is similar to the expression of AtFes1A promoter in A. thaliana10. In order to quantitatively detect the activity of Zjfes1 promoter, GUS activity assay was carried out (Fig. 3B). It can be seen from Fig. 3B that the activity of Zjfes1 promoter under heat treatment is higher than that under normal temperature, which is consistent with the result in Fig. 3A.
Figure 3.
GUS dyeing and activity analysis. (A) Illustration of the GUS activities driven by ZjFes1 promoter in different tissues of transgenic Arabidopsis. GUS activities expressed constitutively are presented on the left, and those induced by high temperature are located on the right. (B) Enzymatic assay of GUS activity in transgenic Arabidopsis seedlings, leaves, flowers and siliques under normal and high temperature.
Discussion
The release of ADP is facilitated by NEFs, and the substrate-binding domain (SBD) of Hsp70 returns to the open conformation and releases the substrate. Although there are some redundant functions and expression patterns, microarray analysis (Genevestigator, https://genevestigator.com/gv/) showed that among the three AtFes1 genes, AtFes1A was the most significantly expressed by heat induction. Recent studies have shown that AtFes1A may play a regulatory role in maintaining the stability of Hsp70 and abiotic stress tolerance10.
Gene expression in higher plants is primarily regulated by complex factors at the transcriptional level, which are coordinated by many cis-acting elements and trans-acting factors. The promoter is an important cis-acting element in transcriptional regulation and is the center of transcriptional regulation, which determines the temporal and spatial sequence of target gene expression to a certain extent. Therefore, the study of structure and function of promoter is key to understanding molecular mechanism of plant gene expression regulation. Z. japonica is an intertidal seagrass, and intertidal seagrass species are more susceptible to heat stress at low tide during the summer months compared with subtidal seagrass species.
In this study, the ZjFes1 promoter was cloned from genome of Z. japonica. A sequence analysis showed that the promoter not only contained common cis-acting elements in promoter and enhancer regions CAAT-box but also light response elements AE-box, Box 4, and TCCC-motif, a cis-acting regulatory element essential for the anaerobic induction ARE, the hormone response elements CGTCA-motif and TGACG-motif (MeJA response element), GARE-motif (gibberellin response element), TGA-element (auxin response element), a cis-acting regulatory element related to meristem expression CAT-box, and a cis-acting element involved in defense and stress responses of TC-rich repeats. The prediction of these cis-acting elements can provide a theoretical basis for the study of this gene regulation pattern. Since the GUS signals driven by the promoter of ZjFes1 as examined in the transgenic A. thaliana plants were induced by heat treatment, a typical heat-responsive element such as HSE could be contained in the promoter region. However, no such HSE element was found in the promoter region. In our previous study, to determine whether ZjFes1 expression was influenced by heat stress, we measured ZjFes1 mRNA levels 1 h after heat treatment at 40 °C and compared the measurements to plants maintained at the control temperature of 25 °C. Three independent biological replicates were conducted, and we found that the expression of ZjFes1 increased significantly (approximately 34.53-fold) at 1 h after treatment18. The result of GUS staining was consistent with that of qRT-PCR. The promoter of Zjfes1 may contain a heat-responsive element that has not yet been identified.
This study determined the activity of ZjFes1 promoter and its expression in seedlings, leaves, flowers and siliques under heat stress. The results showed that ZjFes1 might play a role in the heat tolerance of Z. japonica.
Material and methods
Plant material
Z. japonica used in this study was collected from Fangchenggang, Guangxi, China.
DNA extraction and primer design
Leaves of Z. japonica were used as materials to extract genomic DNA from young leaves that had grown well. A MiniBEST Plant Genomic DNA Extraction Kit (TaKaRa, 9768) was used to extract genomic DNA from the leaves of Z. japonica following the manufacturer’s instructions. Based on the full-length cDNA sequence of ZjFes1 obtained by RACE18, three identical and high annealing temperature specific primers (SP Primer) were designed, and four specifically designed degenerate primers, AP1, AP2, AP3 and AP4, were used for thermal asymmetric interlaced PCR (TAIL-PCR). Typically, at least one of these degenerate primers can react with specific primers by TAIL-PCR based on the difference of annealing temperature, and the flanking sequence of known sequence can be obtained by three nested PCR reactions. Because the length obtained in one experiment cannot meet the experimental requirements, we continue to acquire the flanking sequence according to the sequence information obtained in the first genome walking. Four genome walkings were conducted. Twelve SP Primers were designed. DNAMAN software was used to combine the four fragments described above into a consensus sequence by combining overlapping fragments. Specific primers were designed to amplify 2 kb sequences according to the results (Table 1), and the experimental results were verified.
Table 1.
PCR primer sequences.
| Primer name | Primer sequence (5′–3′) | Annealing temperature (°C) |
|---|---|---|
| ZjFes1-SP1-1st | AGTGGAACCAAGCCACCGATAG | 62 |
| ZjFes1-SP2-1st | AGCAAACCTTCAATTTCCTCCG | 56 |
| ZjFes1-SP3-1st | TAGTGATCTCCTTCATCCTCT | 62 |
| ZjFes1-SP1-2nd | ATTATCGCAGTTTCTGGTCACC | 58 |
| ZjFes1-SP2-2nd | CGGCAATGGTTTCTGCTATCGC | 62 |
| ZjFes1-SP3-2nd | TCCATCTCCAATTGTCTCCATG | 58 |
| ZjFes1-SP1-3rd | CACAAACAATCCAACCTCGAAC | 58 |
| ZjFes1-SP2-3rd | ACTCTGTTGAAACACCATGACC | 58 |
| ZjFes1-SP3-3rd | CGGTTCATCTTTCTTCTTCTTC | 56 |
| ZjFes1-SP1-4th | TTACCGTCAAGATCATCCACGC | 60 |
| ZjFes1-SP2-4th | CTGCTCTCATTATCATCCTATG | 56 |
| ZjFes1-SP3-4th | TTCTACCCATGTCAATAATACC | 55 |
| ZjFes1-pro-F | AGTATCATAGAGAGAACCAC | 56 |
| ZjFes1-pro-R | ATATGCACGATCTGCAAAATC | 55 |
Cloning and construction of the plant expression vector and sequence analysis of promoter
The full-length promoter sequence was amplified using high fidelity polymerase 2 × TransStart FastPfu PCR SuperMix (-dye) (TRANSGEN BIOTECH, AS221-01) using the DNA of Z. japonica as a template following the manufacturer’s instructions. The PCR products were detected using 1% gel electrophoresis. The results showed that the size of the bands was the same as that of the target fragments, and the PCR products were recovered using a MiniBEST Agarose Gel DNA Extraction Kit Ver. 4.0 (TaKaRa, 9762). The pCXGUS-P plasmid is a vector designed to detect the activity of plant promoters. The promoter activity is detected by the dyeing intensity of GUS. We used XcmI to digest the empty vector to obtain T vector. After recovery, the product was recombined with T vector, and then the recombinant vector was transformed into E. coli DH5α Competent Cells (TaKaRa, 9057) following the manufacturer’s instructions. The positive samples identified by PCR were verified by sequencing at the Guangzhou Sequencing Department of Invitrogen. The sequencing results were compared using DNAMAN software. The plasmid was extracted from the correct bacterial solution and designated pZjFes1::GUS. The sequence analysis of cis-acting elements that could possibly be found in the promoter was performed using the plant-CARE online prediction database (plant cis-acting regulatory element, https://bioinformatics.psb.ugent.be/webtools/plantcare/html/)20.
Agrobacterium-mediated genetic transformation of pZjFes1::GUS into Arabidopsis thaliana
The fusion vector pZjFes1::GUS was transformed into Agrobacterium Rhizobium strain GV3101 chemically competent cells (Biomed, BC304) using the freeze–thaw method following the manufacturer’s instructions. Transgenic plants of A. thaliana were obtained by floral dipping. Plants in nutrient soil were cultured to form a large number of immature flower clusters. The monoclone of A. tumefaciens GV3101 was selected and inoculated in liquid LB medium containing kanamycin and rifampicin (50 µg/mL). The monoclone was cultured overnight at 200 rpm and 28 °C. A volume of 2 mL bacterial solution was transferred to a 500 mL flask culture (containing 200 mL liquid LB with 50 µg/mL kanamycin and rifampicin added) and was cultured overnight at 200 rpm and 28 °C. The next day, the OD600 of Agrobacterium solution was 1.8–2.0. The solution was centrifuged at 5000 rpm for 15 min at 4 °C. The supernatant was discarded, and the precipitate of A. tumefaciens was resuspended in 1/2 volume (100 mL) osmotic medium (1/2 Murashige-Skoog, 5% sucrose, 0.5 g/L MES, 10 µg/mL 6-BA, 200 µl/L Silwet L-77, and 150 µM acetyleugenone, pH 5.7), resulting in an OD600 of approximately 1.6. The bacterial solution was adsorbed on the transformed plants using the floral dip method (5 min), wrapped with film to keep it fresh, and cultured overnight, followed by the removal of the film. The plants were cultured until the seeds were ripe, and they were harvested. A mixed disinfectant consisting of 70% ethanol and 30% bleaching water was used to soak the seeds for 3 min, suspend them continuously, and wash them three times with anhydrous ethanol. The dried seeds were evenly dispersed on the surface of solid screening medium containing hygromycin (25 µg/mL). After stratification at 4 °C for 2 days, the seeds were germinated in a light incubator and cultured for 2 weeks at 21 °C and 16 h light/8 h darkness. The development of seedlings and length of roots were used to determine whether they were transformants.
GUS dyeing and activity analysis
The expression of GUS reporter gene in Arabidopsis tissues was determined using a GUS staining kit (Solarbio, G3060) following the manufacturer’s instructions. The seedlings, leaves, flowers and siliques to be dyed were immersed in GUS dye solution and incubated overnight at 37 °C. The chlorophyll was removed with 75% ethanol until the background color disappeared completely. The results were documented by photography using a Canon 60d camera.
The material needed to determine Gus enzyme activity was frozen rapidly with liquid nitrogen, and then ground into powder by ball mill. The extraction buffer solution (50 mM NaH2PO4 (pH 7.0), 10 mM EDTA, 0.1% Triton X-100, 0.1 (w / v) sodium dodecyl sulfonate, 10 mM β-mercaptoethanol) were added to extract protein. After centrifugation at 4 °C, 12,000 r/min for 10 min, the supernatant was taken as protein extract. The protein concentration was determined by Bradford method. 4-MUG, the substrate of GUS reaction, was added and reacted at 37 °C for 30 min. Fluorescence measurement was carried out under the condition of 365 nm excitation light and 455 nm emission light. Three independent biological repeats were conducted. Finally, the GUS enzyme activity value was calculated according to the relative change of product in unit time.
Acknowledgements
This study was funded by the Natural Science Foundation of Guangxi Province (2018GXNSFBA281062), the Distinguished Employment Offered Unit of Guangxi for Conservation and Ecological Monitoring of Mangroves and Seagrasses, the National Science & Technology Basic Work Program (2015FY110600), the National Key Research and Development Program of China (2017YFC0506100) and the Research Fund Program of Guangxi Key Lab of Mangrove Conservation and Utilization (GKLMC-20A01). These funding bodies had no role in the design of the study, collection, analysis, and interpretation of data, or in the writing of the manuscript.
Author contributions
S.C. designed the study and performed the laboratory experiments. G.Q. designed the field work. S.C. and G.Q. wrote the main part of the manuscript. All the authors reviewed the manuscript and added details to it.
Data availability
All data generated or analyzed during this study are included in this published article. The promoter sequence data of ZjFes1 was registered in the GenBank (No. MN161576).
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Siting Chen, Email: c105043041@126.com.
Guanglong Qiu, Email: qalong@163.com.
References
- 1.Frydman J. Folding of newly translated proteins in vivo: the role of molecular chaperones. Annu. Rev. Biochem. 2001;70:603. doi: 10.1146/annurev.biochem.70.1.603. [DOI] [PubMed] [Google Scholar]
- 2.Liberek K, Marszalek J, Ang D, Georgopoulos C, Zylicz M. Escherichia coli DnaJ and GrpE heat shock proteins jointly stimulate ATPase activity of DnaK. Proc. Natl. Acad. Sci. USA. 1991;88:2874–2878. doi: 10.1073/pnas.88.7.2874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Gassler CS, Wiederkehr T, Brehmer D, Bukau B, Mayer MP. Bag-1M accelerates nucleotide release for human Hsc70 and Hsp70 and can act concentration-dependent as positive and negative cofactor. J. Biol. Chem. 2001;276:32538–32544. doi: 10.1074/jbc.M105328200. [DOI] [PubMed] [Google Scholar]
- 4.Kabani M, Mclellan C, Raynes DA, Guerriero V, Brodsky JL. HspBP1, a homologue of the yeast Fes1 and Sls1 proteins, is an Hsc70 nucleotide exchange factor. FEBS Lett. 2002;531:339–342. doi: 10.1016/S0014-5793(02)03570-6. [DOI] [PubMed] [Google Scholar]
- 5.Shomura Y, et al. Regulation of Hsp70 function by HspBP1: structural analysis reveals an alternate mechanism for Hsp70 nucleotide exchange. Mol. Cell. 2005;17:367–379. doi: 10.1016/j.molcel.2004.12.023. [DOI] [PubMed] [Google Scholar]
- 6.Kabani M, Beckerich JM, Brodsky JL. Nucleotide exchange factor for the yeast Hsp70 molecular chaperone Ssa1p. Mol. Cell. Biol. 2002;22:4677–4689. doi: 10.1128/MCB.22.13.4677-4689.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Alberti S, Böhse K, Arndt V, Schmitz A, Höhfeld J. The cochaperone HspBP1 inhibits the CHIP ubiquitin ligase and stimulates the maturation of the cystic fibrosis transmembrane conductance regulator. Mol. Biol. Cell. 2004;15:4003. doi: 10.1091/mbc.e04-04-0293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gowda NKC, Kandasamy G, Froehlich MS, Dohmen RJ, Andreasson C. Hsp70 nucleotide exchange factor Fes1 is essential for ubiquitin-dependent degradation of misfolded cytosolic proteins. PNAS. 2013;110:5975–5980. doi: 10.1073/pnas.1216778110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gowda NK, et al. Cytosolic splice isoform of Hsp70 nucleotide exchange factor Fes1 is required for the degradation of misfolded proteins in yeast. Mol. Biol. Cell. 2016;27:1210–1219. doi: 10.1091/mbc.E15-10-0697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Zhang JX, et al. The role of Arabidopsis AtFes1A in cytosolic Hsp70 stability and abiotic stress tolerance. Plant J. 2010;62:539–548. doi: 10.1111/j.1365-313X.2010.04173.x. [DOI] [PubMed] [Google Scholar]
- 11.Short FT, Neckles HA. The effects of global climate change on seagrasses. Aquat. Bot. 1999;63:169–196. doi: 10.1016/S0304-3770(98)00117-X. [DOI] [Google Scholar]
- 12.Stillman JH. Acclimation capacity underlies susceptibility to climate change. Science. 2003;301:65. doi: 10.1126/science.1083073. [DOI] [PubMed] [Google Scholar]
- 13.Rowan R. Coral bleaching: thermal adaptation in reef coral symbionts. Nature. 2004;430:742. doi: 10.1038/430742a. [DOI] [PubMed] [Google Scholar]
- 14.Zimmerman RC, Smith RD, Alberte RS. Thermal acclimation and whole-plant carbon balance in Zostera marina L. (eelgrass) J. Exp. Mar. Biol. Ecol. 1989;130:93–109. doi: 10.1016/0022-0981(89)90197-4. [DOI] [Google Scholar]
- 15.Lee KS, Sang RP, Kim YK. Effects of irradiance, temperature, and nutrients on growth dynamics of seagrasses: a review. J. Exp. Mar. Biol. Ecol. 2007;350:144–175. doi: 10.1016/j.jembe.2007.06.016. [DOI] [Google Scholar]
- 16.Lee KS, Sang RP, Kim JB. Production dynamics of the eelgrass, Zostera marina in two bay systems on the south coast of the Korean peninsula. Mar. Biol. 2005;147:1091–1108. doi: 10.1007/s00227-005-0011-8. [DOI] [Google Scholar]
- 17.Yashwanti M, Shin-Han S, Stone SL, Salt JN, Goring DR. A large complement of the predicted Arabidopsis ARM repeat proteins are members of the U-box E3 ubiquitin ligase family. Plant Physiol. 2004;134:59. doi: 10.1104/pp.103.029553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chen S, Qiu G. Heat-stress induced expression of stress-inducible nucleotide exchange factor Fes1 in seagrass Zostera japonica. Ecotoxicology. 2020 doi: 10.1007/s10646-020-02185-5. [DOI] [PubMed] [Google Scholar]
- 19.Chen S, Qiu G. Overexpression of seagrass nucleotide exchange factor gene zjfes1 enhances heat tolerance in transgenic Arabidopsis. Plant Signal Behav. 2020;15:1709719. doi: 10.1080/15592324.2019.1709719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Magali L, et al. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002;30:325–327. doi: 10.1093/nar/30.1.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this published article. The promoter sequence data of ZjFes1 was registered in the GenBank (No. MN161576).



