Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Mar 15.
Published in final edited form as: Neuroscience. 2020 Feb 4;430:131–140. doi: 10.1016/j.neuroscience.2020.01.034

Sustained Hypoxia Alters nTS Glutamatergic Signaling and Expression and Function of Excitatory Amino Acid Transporters

Michael P Matott 1, Eileen M Hasser 1, David D Kline 1
PMCID: PMC7560968  NIHMSID: NIHMS1556805  PMID: 32032667

Abstract

Glutamate is the major excitatory neurotransmitter in the nucleus tractus solitarii (nTS) and mediates chemoreflex function during periods of low oxygen (i.e. hypoxia). We have previously shown that nTS excitatory amino acid transporters (EAATs), specifically EAAT-2, located on glia modulate neuronal activity, cardiorespiratory and chemoreflex function under normal conditions via its tonic uptake of extracellular glutamate. Chronic sustained hypoxia (SH) elevated nTS synaptic transmission and chemoreflex function. The goal of this study was to determine the extent to which glial EAAT-2 contributes to SH-induced nTS synaptic alterations. To do so, male Sprague-Dawley rats (4–7 weeks) were exposed to either 1, 3, or 7 days of SH (10% O2, 24 hr/day) and compared to normoxic controls (21% O2, 24 hr/day, i.e., 0 days SH). After which, the nTS was harvested for patch clamp electrophysiology, quantitative real-time PCR, immunohistochemistry and immunoblots. SH induced time- and parameter-dependent increases in excitatory postsynaptic currents (EPSCs). TS-evoked EPSC amplitude increased after 1D SH which returned at 3D and 7D SH. Spontaneous EPSC frequency increased only after 3D SH, which returned to normoxic levels at 7D SH. EPSC enhancement occurred primarily by presynaptic mechanisms. Inhibition of EAAT-2 with dihydrokainate (DHK, 300μM) did not alter EPSCs following 1D SH but induced depolarizing inward currents (Ihold). After 3D SH, DHK decreased TS-EPSC amplitude yet its resulting Ihold was eliminated. EAAT-2 mRNA and protein increased after 3D and 7D SH, respectively. These data suggest that SH alters the expression and function of EAAT-2 which may have a neuroprotective effect.

Keywords: Chemoreflex, respiration, autonomic nervous system, synaptic transmission, astroglia, glutamate

INTRODUCTION

The nucleus tractus solitarii (nTS) is an important integrator of multiple afferent reflex pathways including arterial baro- and chemoreflexes (Andresen and Kunze 1994; Kline 2008). Its central pathways include reciprocal connections to numerous central nuclei that elicit coordinated physiological responses to cardiorespiratory perturbations. However, the mechanism(s) of sensory afferent processing in the nTS under physiological and pathophysiological conditions is poorly understood. Exposure to days of sustained hypoxia (SH), which occur upon altitude ascent, enhances respiratory activity; an effect widely attributed to enhanced chemoreflex response (Powell et al. 2000). However, the precise location within the chemoreflex arc, including the carotid body, its afferents or the nTS and its downstream pathways is poorly understood. Evidence suggests basal carotid body afferent activity, as well as its hypoxic sensitivity, begins to increase following 3D SH. Following 7D SH an increase in the chemoreflex central gain also develops. Within the nTS, SH enhances nTS glutamatergic synaptic transmission after 1D SH and augments glutamate (Glu) receptor expression after 7D SH (Accorsi-Mendonca et al. 2015; Accorsi-Mendonca et al. 2019; Pamenter et al. 2014; Zhang et al. 2009). Such changes have been suggested to be due, in part, to SH altering astrocyte morphology or function (Accorsi-Mendonca et al. 2015; Accorsi-Mendonca et al. 2019; Stokes et al. 2017). Yet, the mechanisms by which the astrocytes may alter nTS activity is not known.

Excitatory amino acid transporters (EAATs) located predominantly on astrocytes remove glutamate from the extracellular space, which is important for maintaining glutamate receptor and synaptic function within the operating range (Kessler 2013). EAAT-1 and EAAT-2 are the primary glutamate transporters in the nTS (Chounlamountry and Kessler 2011). We have previously demonstrated that inhibiting EAAT function modified nTS neuronal activity, increasing synaptic transmission and action potential discharge (Matott et al. 2017; Matott et al. 2016). This ultimately induced elevated chemoreflex responses; a response attributed mostly to EAAT-2 (Matott et al. 2017). The goal of this study was to examine the extent to which SH alters expression and/or function of astrocyte EAATs in the nTS and its effect on synaptic and extra-synaptic properties of nTS neurons.

EXPERIMENTAL PROCEDURES

Animals

All protocols were conducted following the National Institutes of Health Guide for the Care and Use of Laboratory Animals guidelines and approved by the University of Missouri Animal Care and Use Committee. Male Sprague-Dawley rats (Envigo, Indianapolis, IN, USA) aged 4–7 weeks were used for all experiments. Animals were housed with a 12:12h light-dark cycle with food and water available ad libitum.

Exposure to sustained hypoxia (SH)

Standard rat cages containing unrestrained animals were placed in a commercially available hypoxic system (BioSpherix, Redfield, NY) for SH exposure. SH consisted of reducing environmental oxygen to 10% O2 via infusion of nitrogen. Oxygen levels were maintained at this level via a feedback system and addition of pure oxygen or nitrogen to maintain 10% O2 levels. SH exposure was 24 hrs/day for up to 7 consecutive days (Kline et al. 2007). Ambient oxygen, carbon dioxide, temperature and humidity levels were continuously monitored. Control normoxic animals consisted of rodents not exposed to SH, and were housed in standard rat cages placed in the hypoxic chamber but only exposed to 21% O2 (i.e., normoxia or 0D SH). All electrophysiology or tissue harvesting protocols were performed the morning of the last day of hypoxic exposure or the comparable normoxic time period.

nTS brain slice preparation, recording and protocols

Isoflurane anesthetized SH (1D, n=3; 3D, n=3; 7D, n=4) and their normoxic control (n=5) rats were decapitated and the brainstem was rapidly removed and placed in ice-cold NMDG-HEPES cutting solution (in mM: 93 NMDG, 93 HCl, 2.5 KCl, 1.2 NaH2PO4, 10 MgSO4, 30 NaHCO3, 20 HEPES, 25 D-glucose, 5 L-ascorbic acid, 2 thiourea, 3 sodium pyruvate and 0.5 CaCl2, aerated with 95% O2 + 5% CO2, pH 7.4, 300–310 mOsm). Horizontal slices (μ280 ~m) containing the nTS and the visceral afferent containing tractus solitarii (TS) were generated with a vibratome (VT 1000S, Leica, Germany). Slices recovered for 15 minutes at 35°C in NMDG-HEPES solution then transferred to recording artificial cerebrospinal fluid (aCSF, in mM: 124 NaCl, 3 KCl, 1.2 NaH2PO4, 1.2 MgSO4, 25 NaHCO3, 11 D-glucose, 0.4 L-ascorbic acid, and 2 CaCl2, aerated with 95% O2 + 5% CO2, pH 7.4, 300–310 mOsm) and allowed to recover for ~30 min at 22°C.

Slices were transferred to an Olympus BX51WI fixed stage microscope and heated recording chamber (Warner Instruments, TC-344B, Hamden, CT, USA), secured with a nylon mesh harp, and superfused with recording aCSF at 32–35°C aerated with 95% O2 + 5% CO2. Prior to recording, slices were allowed to acclimate to temperature and superfusion flow for 15–30 minutes. Patch electrodes (3–6 MΩ) were positioned via a piezoelectric micromanipulator (PCS-6000, Thor Labs) and targeted to the caudal nTS. Recording electrodes were filled with (in mM) 130 K+ gluconate, 10 NaCl, 11 EGTA, 10 HEPES, 1 MgCl2, 1 CaCl2, 2 MgATP, 0.2 NaGTP. Signals were filtered at 2 kHz and acquired at 10 kHz using a Multiclamp 700B amplifier controlled by Clampex 10 software by a Digidata 1440 interface (Molecular Devices, Sunnyvale, CA, USA).

To examine synaptic and holding currents, neurons were voltage clamped at −60 mV. TS-evoked excitatory postsynaptic currents (TS-EPSCs) were induced by placing a concentric bipolar stimulating electrode (FHC, Bowdoin, ME, USA) on the TS afferent bundle and stimulating at 0.5 and 20 Hz. Spontaneous EPSCs (sEPSCs) and holding currents (Ihold) were recorded in gap-free mode without stimulation. Paired pulse ratios were determined using the first and second TS-EPSCs of the 20 Hz stimulus train. Neurons were exposed a minimum of 5 minutes aCSF (i.e., baseline) followed by 5 min of EAAT-2 block with dihydrokainate (DHK, 300 μM). A 5–10 min wash followed. Eight nTS cell recordings were used for data analysis for each duration of hypoxia and the normoxic control. Not all variables were measurable in all recordings as indicated where n is less than eight. The concentration of DHK was based on our previous experiments demonstrating robust but not saturating effects at this concentration (Matott et al. 2017).

Immunohistochemistry

EAAT-1 and EAAT-2 immunohistochemistry was performed as previously (Kline et al. 2005; Matott et al. 2016). Normoxic rats (n=3) were anesthetized with isoflurane and transcardially perfused with heparinized 0.01 M PBS followed by 4% paraformaldehyde. The brainstem was removed, post-fixed in 4% paraformaldehyde (2 hrs) and sectioned at 30 μm on a vibratome (Leica VT1000S, Wetzlar, Germany). Tissue, processed as free-floating sections, were blocked with 10% normal donkey serum (NDS, Millipore, S30) in 0.3% Triton-PBS and incubated with primary antibodies against EAAT-1 (rabbit anti-EAAT 1; Abcam ab416, 1:250) or EAAT 2 (rabbit anti-EAAT 2; Abcam ab41621; 1:250) in 3% NDS in 0.01 M PBS overnight. As we have previously (Matott et al. 2017; Matott et al. 2016), to identify EAAT localization with astrocytes, we used the astrocyte marker S100B (mouse anti-S100B; Abcam ab41548, 1:500) which labels both somas and processes, and glial fibrillary acidic protein (GFAP, guinea pig anti-GFAP; Synaptic Systems 173004, 1:500) to label major astrocytic processes. The next day, sections were rinsed and incubated for 2 hrs in fluorescent-conjugated secondary antibodies (1:200, Jackson Immunoresearch Laboratories, West Grove, PA, USA) in 3% NDS and 0.3% Triton-PBS. nTS sections were rinsed, mounted on gelatin-coated slides, air dried, cover slipped with Prolong Gold and then sealed with nail polish. Immunolabeling was examined with a conventional epifluorescence microscope (BX51, Olympus) and acquired at 16-bit with a monochrome CCD camera (ORCA-ER, Hamamatsu). Shown images were post-processed for contrast and brightness and background subtracted (FIJI ImageJ).

Immunoblot

SH rats (1D, n=7; 3D, n=6; 7D, n=5) and their comparable normoxic time controls [n = 6, 4 & 5, or 15 total) were anesthetized, decapitated, and the nTS removed and prepared as previously (Matott and Kline 2016). nTS were homogenized in extraction buffer [150 mM NaCl, 100 mM Tris-HCl, 1% Triton X, protease inhibitor cocktail (Complete Mini, EDTA-free, Roche Diagnostics, Indianapolis, IN, USA)], centrifuged (15 min, 13,300 rpm, 4°C), and the supernatant collected. Protein concentrations were determined with the Bio-Rad Protein Assay Dye Reagent (Bio-Rad, Hercules, CA, USA) and 25 μg (EAAT-1) or 2 μg (EAAT-2) of protein was separated in a 4–20% precast Mini-PROTEAN TGX gel (Bio-Rad) and transferred to an Immun-Blot PVDF membrane (Bio-Rad). Membranes were subsequently incubated overnight at 4°C with primary antibody against EAAT-1 (1:1000, Abcam, cat Ab416), EAAT-2 (1:1000, Abcam, cat ab41621) and β-actin (0.5 μg/mL), washed, and incubated with HRP-linked secondary antibodies (1:5000–10000, 2h, 23°C, Jackson Immunoresearch Laboratories). Blots were developed with ImmunStar WesternC substrate (BioRad, Hercules, CA, USA) and imaged with ChemiDoc XRS+ Imager using Image Lab Software (Version 5.1, Bio-Rad). Intensity of bands were measured in FIJI (ImageJ), the relative amount of EAAT-1 or EAAT-2 was normalized to β-actin, and quantified.

Reverse transcription real-time polymerase chain reaction (RT-PCR)

SH rats (1D, n=5; 3D, n=3; 7D, n=4) and their comparable normoxic time controls (n=5, 3 & 4) were anesthetized with isoflurane, decapitated and the nTS were isolated, snap frozen and stored at - 80°C. RNA was isolated using the RNAqueous-Micro Kit, following the manufacturer’s instructions (Ambion, Life Technologies, Grand Island, NY, USA) and quantified (BioPhotometer plus, Eppendorf, Hauppauge, NY, USA). cDNA was generated from 100ng mRNA (oligo-dT primer set, SuperScript III, Invitrogen). Quantitative real-time PCR amplification of 2μL of cDNA was performed using the SYBR Premix Ex Taq kit (Takara, Mountain View, CA, USA), the SmartCycler System (Cepheid, Sunnyvale, CA, USA) and the following primers: EAAT-1 (Slc1a3, NM_019225, forward: TTCCTGGGGAGCTTCTGAT, reverse: ACTATCTAGGGCCGCCATTC, 10μM; Fisher Scientific, Pittsburgh, PA, USA), EAAT-2 (Slc1a2, NM_001035233, forward: ATCAGTCTGCTGGTGGCAGT, reverse: GCCCACTACATTGACCGAAG, 10μM; Fisher Scientific, Pittsburgh, PA, USA) and the housekeeping gene β2-microglobulin (B2m) (NM_012512.2, forward: AGCAGGTTCCTCAAACAAGG, reverse: TTCTGCCTTGGAGTCCTTTC, 10μM; Fisher Scientific). The relative amount of EAAT-1 and EAAT-2 mRNA was normalized to B2m, or EAAT-2 to EAAT-1 using the 2-ΔΔCT method (Livak and Schmittgen 2001).

Data analysis

Data were analyzed by Clampfit (Molecular Devices) and Microsoft Excel. Second-order nTS neurons were identified in Clampfit by jitter analysis, defined as the standard deviation of the TS-EPSC onset latency from stimulus (Doyle and Andresen 2001; Kline et al. 2002). Only neurons with jitter values of <250 μs, considered to be monosynaptic and directly connected to sensory TS neurons, were included in this study. A TS stimulus frequency of 0.5 Hz and 20 Hz was chosen based on the physiological range of discharge of C-type sensory and chemosensory afferents (Andresen and Kunze 1994; Vidruk et al. 2001). Reported TS-EPSC amplitudes were an average of 10–20 events. Instantaneous spontaneous EPSCs were identified in Clampfit 10 via template matching and reported as their group means.

Statistical analysis was performed with GraphPad Prism (GraphPad software, La Jolla, CA) or Excel with the Real Statistics using Excel Addin (http://www.real-statistics.com/). Data were tested by Student’s paired t-test, or one- or two-way repeated measures ANOVA where appropriate and stated in text. Fishers LSD post hoc test identified individual differences. DHK responses were also normalized and expressed relative to their individual aCSF baseline (defined as “1”). Graphical representations of the data were made with box-and-whisker plots with mean, median and quartiles indicated. Whiskers delineate minimum and maximum values for respective data sets. Results were considered significantly different at p values < 0.05.

RESULTS

SH does not alter neuronal membrane properties

We examined several neuronal properties following exposure of control normoxia (21% O2, 0 days SH) and 1, 3 and 7 days sustained hypoxia (10% O2, 24 hrs/day). We chose these durations based on previous experiments demonstrating SH induces robust cardiorespiratory increases associated with nTS alterations (Accorsi-Mendonca et al. 2015; Accorsi-Mendonca et al. 2019; Pamenter et al. 2014; Zhang et al. 2009). As shown in Table 1, compared to normoxic rats following 1, 3 and 7 D SH initial cell capacitance, holding currents, membrane potential, and input resistance were not different compared to 0D SH rats (one way ANOVA).

Table 1. Sustained hypoxia does not alter initial membrane properties.

Initial somal properties were not altered by sustained hypoxia. Capacitance (Cm), holding currents (Ihold), membrane potential (Mem. Pot), input resistance (Rin). Stimulation of the solitary tract elicited currents with comparable onset variability (i.e., jitter) and latency. One exception is that 1D SH increased latency of TS-EPSC from stimulus. n = 6 (Normoxic, i.e., 0D), 7 (1D), 8 (3D) and 8 (7D). p < 0.05 vs. Normoxia, one-way ANOVA with LSD posthoc analysis.

 
0D SH (n=6) 1D SH (n=7) 3D SH (n=8) 7 D SH (n=8)
Cm (pF) 19.3 ± 2.1 18.4 ± 2.6 20.0 ± 1.6 19.5 ± 1.3
Ihold (pA) −8.5 ± 7.3 −15.3 ± 7.5 −2.1 ± 3.9 13.8 ± 20.9
Mem. Pot (mV) −53.5 ± 4.7 −52.6 ± 4.7 −62.0 ± 3.7 −61.5 ± 4.9
Input Res (Mohm) 555.5 ± 80.4 626.2 ± 83.1 851.0 ± 146.0 608.8 ± 110.4
Jitter (μs) 144.6 ± 19.6 152.7 ± 18.2 147.1 ± 14.6 159.4 ± 29.0
Latency (ms) 3.8 ± 0.5 5.5 ± 0.5 * 4.6 ± 0.3 4.1 ± 0.2
 
Open in a new tab

P values vs. 0 D SH, 1-way ANOVA. Latency at 1D SH was greater (p= 0.0045) vs 0D SH.

SH enhances synaptic transmission in a time-dependent manner

Stimulation of the solitary tract (TS) elicited monosynaptic excitatory post-synaptic currents (TS-EPSC) in nTS neurons. Following 1D SH, TS-EPSC amplitude increased (example in Fig 1A) which subsequently returned to normoxic levels at 3 and 7 D SH (examples not shown). TS-EPSC amplitude data are quantified in Figure 1B. Synaptic onset variability (i.e., jitter) did not differ among groups, although synaptic latency was longer after 1 D SH (Table 1). Such amplitude changes could be due to elevation of presynaptic glutamate release and/or postsynaptic glutamate receptor conductance. We analyzed the inverse of the coefficient of variance (1/CV2) as one measure of pre- vs. postsynaptic changes (Kline et al. 2007). One day SH elevated 1/CV2 over normoxia, which returned to baseline levels at 3 and 7D SH (Fig 1C). SH also reduced TS-EPSC failure rate after 1 and 3D exposure, which returned to normoxic levels at 7D (Fig 1D).

Figure 1. One day SH increased TS-EPSC amplitude.

Figure 1.

Open in a new tab

A. Example of TS-EPSCs evoked following normoxia (0D SH, blue) and 1D SH (red). Note the increased amplitude after 1D SH. Cells were held at −60 mV and the TS was stimulated at arrow. B. Quantification of TS-EPSC amplitude following SH. Compared to 0D SH (n= 6 neurons), 1D SH (n=7 neurons) increased current amplitude (p = 0.023). Amplitude at 3D (n=8 neurons) and 7D (n=8 neurons) SH was comparable to normoxia. C. The inverse of coefficient of variation (1/CV2) was also increased after 1D of SH vs. normoxic-exposed nTS neurons (p = 0.0034). D. TS-EPSC failure rate decreased after 1 and 3D SH. Rate determined from 20 stimuli. E. TS-EPSC amplitude evoked at 20Hz stimulation (10 events). Note the increase in the first TS-EPSC amplitude after 1D SH, and the decrease after 7D SH (two-way RM ANOVA with Fisher LSD). Following the first event, the amplitude of currents decreased and were comparable among groups. F. Paired pulse ratio (PPR, amplitude ratio of the second-to-first TS-EPSC) demonstrates reduction at 1 and 3D SH. G. Synaptic throughput (sum of 10 events shown in panel E) was not significantly different between durations of SH (one-way ANOVA). For box-and-whisker plots, median indicated by solid line, mean by “+”, quartiles (25 and 75%) by boxes, and the range by the whiskers. For all panels except E: *, p < 0.05 vs. Normoxia (0D SH). Panel E: *, p < 0.05 1D vs. 0D SH; †, p < 0.05 3D vs. 0D SH, ‡, p < 0.05 7D vs. 0D SH.

We examined how increased and prolonged stimulation would alter TS-EPSC amplitudes or TS-EPSC depression across the stimulus train. Increasing TS stimulation frequency to 20 Hz is intended to replicate conditions of increased afferent transmission which would occur during sustained hypoxic events. Under normoxic conditions 20 Hz TS-stimulation reduced TS-EPSC within the stimulus train (i.e., use-dependent depression), as is typically observed in the nTS (Chen et al. 1999; Schild et al. 1993). One day SH elevated the amplitude only of the initial TS-EPSC. Continued stimulation resulted in TS-EPSC depression such that the amplitude was not significantly different from normoxic-exposed rats for the remaining stimulation events in the train (Fig 1E). SH duration of 7 days significantly decreased the initial TS-EPSC amplitude; subsequent events were not different between 0 and 7D SH. To further explore the potential mechanism of synaptic depression after SH, we examined the paired pulse ratio [ratio of the second-to-first TS-EPSC amplitude (Kline et al. 2007)] and total synaptic throughput - defined as the sum of all events across the stimulus train. The paired pulse ratio significantly decreased after 1 and 3 days SH, suggesting an altered presynaptic release probability compared to normoxia-exposed rats. Paired pulse ratio returned to normoxic levels after 7 days SH (Fig 1F, one-way ANOVA). Synaptic throughput was not significantly different for any time point of SH (Fig 1G). Thus, these data suggest SH primarily affects the initial TS-induced synaptic currents, with less effects on subsequent events and suggests alteration in release probability as a major contributor.

Elevation of spontaneous network events after 3D SH

We also examined spontaneous EPSCs that represent all synaptic events impinging on the recorded neuron and generally represent nTS circuit activity. After 3 days of SH there was a significant increase in frequency of spontaneous EPSCS, as demonstrated by the representative example (Fig 2A) and quantification of all recordings (Fig 2B). The sEPSC frequency returned to normoxic values after 7d of SH. There were no significant changes to sEPSC amplitude for any time point of sustained hypoxia (Fig 2A & C). These data suggest an increase in synaptic activity due to SH as indicated by the increased sEPSC frequency, but post-synaptic properties were unaffected as shown by the consistent sEPSC amplitude.

Figure 2. Three day SH enhances spontaneous EPSCs.

Figure 2.

Open in a new tab

A. Example of spontaneous currents after 0D (top, blue) and 3D (bottom, green) SH. Cells were held at −60 mV. Note the increase sEPSC frequency after 3D SH. B, C. sEPSC frequency was elevated after 3D SH (p = 0.025), but amplitude was not altered after SH (C). Number of neurons (n) = 6 (0D), 7 (1D), 8 (3D) and 8 (3D). Panels B, C: *, p < 0.05 vs. Normoxia (0D SH), One-way ANOVA with LSD.

Excitatory amino acid transporter-2 (EAAT-2) contributes to 3D SH TS-EPSC amplitude but does not alter sEPSC properties

We have previously demonstrated the presence of the glutamate transporters EAAT-1 and −2 in the nTS, primarily on astrocytes and surrounding glutamatergic terminals (Matott et al. 2017; Matott et al. 2016). EAAT-2 expression is greater than EAAT-1 in the nTS [(Chounlamountry and Kessler 2011), see Fig 6], and block of EAAT-2 with the antagonist dihydrokainate (DHK) increases ambient glutamate to enhance sEPSCs, nTS activity and chemoreflex function (Matott et al. 2017). We sought to examine the influence of EAAT-2 on the enhanced TS-EPSC amplitude or sEPSC frequency following SH. This was accomplished via application of DHK and monitoring the resulting change in synaptic currents. We reasoned that if SH decreases EAAT-2 expression or function, then this may induce the elevation of synaptic currents. By this reasoning, if EAAT-2’s influence is reduced, then EAAT-2 block with DHK would have less effect on spontaneous or evoked EPSCs and neuronal properties.

Figure 6. SH alters EAAT expression.

Figure 6.

Open in a new tab

A. Immunoreactivity (top, greyscale) of normoxic nTS demonstrating differential EAAT-1 and EAAT-2 expression. Note that EAAT-2 protein is more highly expressed in nTS compared to EAAT-1. Scale, 100 μm. AP, area postrema; CC, central canal; DmnX, dorsal motor nucleus of the vagus. Bottom, co-labeling of EAAT-1 or EAAT-2 (green, arrow) with the astrocyte markers s100B (red) and GFAP (blue). Merged image is also shown. Scale bar, 10 μm. B. Relative mRNA expression of EAAT-2 (E2) to EAAT-1 (E1) in nTS in normoxia (0D SH) and following 1, 3 and 7 SH. Note EAAT-2 is expressed more than EAAT-1 at 0, 1 and 3 D SH. After 7D SH EAAT-1 and −2 are expressed at relatively similar amounts. * p < 0.05, paired t-test. C. EAAT-1 mRNA (left) expression at 1, 3 and 7D SH relative to normoxia (N, blue line). EAAT-1 mRNA does not significantly change compared to its normoxic controls. By contrast, EAAT-2 mRNA (right) expression at 3 D SH is increased relative to normoxia (N, blue line). * p < 0.05 t-test. For RT-PCR “n” refers to the number of rats, 0 vs. 1D SH, n=5 each; 0 vs. 3D SH, n=3 each, 0 vs. 7D SH, n=4 each. D. Representative example of 0D and 7D immunoblot (IB) for EAAT-2 with bands at μ 60 kDa. Note the increase in EAAT-2 nTS expression after 7D SH. E. EAAT-1 (left) and EAAT-2 (right) protein expression at 1, 3 and 7D SH relative to its normoxic control (N, blue line). Note the 7D SH increased EAAT-1 &2 protein in nTS. For IB analysis “n” refers to the number of rats: EAAT-1; 0 vs. 1D SH, n=6 & 7; 0 vs. 3D SH, n=4 & 6, 0 vs. 7D SH, n=5 each. EAAT-2; 0 vs. 1D SH, n=6 each, 0 vs. 3D SH, n=4 & 6, 0 vs. 7D SH, n=3 & 5 each. For C&D, dashed line represents normoxic mRNA or protein within each group to which 1, 3 or 7D SH was tested. *, p < 0.05 vs. their normoxic (0D SH) controls.

Across the 0, 1 and 7 D duration of SH, block of EAAT-2 with 300 μM DHK (5 min) did not appreciably alter the amplitude of TS-EPSC evoked at 0.5 Hz. Contrary to our hypothesis, DHK decreased TS-EPSC amplitude from −93.1 ± 13.9 pA (aCSF) to −81.3 ± 12.1 pA following 3D SH (p = 0.04, paired t-test, example in Fig 3A, inset). The magnitude of TS-EPSC amplitude change in response to DHK from their aCSF baseline is shown in Figure 3A. DHK did not alter TS-EPSC 1/CV2 or failure rate (data not shown) for any duration of SH exposure. DHK did not alter the paired pulse ratio following 0, 1 or 7D SH (data not shown). DHK also did not significantly affect the paired pulse ratio at 3D SH (p = 0.08, Fig 3B). DHK did not alter synaptic throughput evoked at 20 Hz TS stimulation (Figure 3C, throughput DHK/throughput aCSF) nor the individual TS-EPSC amplitudes within the stimulus train for normoxic or SH-exposed recordings (data not shown).

Figure 3. Block of EAAT-2 inhibits TS-EPSCs after 3D SH.

Figure 3.

Open in a new tab

A. Effect of EAAT-2 block with DHK (300 μM). DHK did not appreciably alter TS-EPSC amplitude at Normoxia (0D) or after 1 and 7D SH. By contrast, DHK significantly decreased TS-EPSC amplitude from its aCSF baseline (#, p= 0.041, paired t-test). An example of the reduction in TS-EPCS amplitude by DHK is shown in the inset; solid green = aCSF, dashed grey = DHK. Average of 20 events. The magnitude of amplitude change by DHK at 3D SH did not reach significance compared to normoxia (p = 0.06, one-way ANOVA). B. Paired pulse ratio (PPR) during aCSF baseline, DHK, and its washout following 3D SH. C. Magnitude of change in synaptic throughput (as Fig 1E). DHK did not alter throughput. In panels A & C dashed line represents aCSF baseline to which events after DHK within each group was tested. # p < 0.05 DHK vs. its aCSF baseline, paired t-test.

We have previously demonstrated block of EAAT-2 increases sEPSCs in the nTS (Matott et al. 2017). Here we examined the contribution of EAAT-2 in the elevated sEPSCs that occurs following SH compared to normoxic rats. In 0D SH exposed neurons, sEPSC frequency increased following DHK by 7.0 ± 6.6% in the entire group (n=6, p=0.397), yet 4 cells significantly increased frequency 17.1 ± 2.6% (p = 0.007, paired t-test) without affecting amplitude consistent with our previous studies. Overall, following 1, 3 or 7 days SH, EAAT-2 block with DHK did not alter sEPSC frequency or amplitude (Fig 4A,B).

Figure 4. sEPSCs following SH are not altered by EAAT-2 block.

Figure 4.

Open in a new tab

A, B. The magnitude of response to EAAT-2 block with DHK (300 μM) on sEPSC frequency (A) and amplitude (B) relative to aCSF baseline. DHK did not affect sEPSC frequency or amplitude after SH. In panels A & B dashed line represents aCSF baseline to which events after DHK within each group was tested.

These data indicate that EAAT-2 block in nTS reduces TS-EPSC amplitude with 3D SH but otherwise has no effect on the properties of TS-evoked EPSCs or sEPSCs. Taken together these results suggest a reduction in function of EAAT-2 with SH.

EAAT-2 contributes to membrane holding currents (Ihold) following 3D SH

We’ve previously shown that EAAT-2 tonically limits neuronal depolarization, as evidenced by depolarization of nTS neurons following EAAT-2 blockade with DHK (Matott et al. 2017). A similar response was observed in the present study across all time-points except for 3D SH. In normoxia-exposed neurons, DHK induced depolarizing inward holding currents of 9.91 ± 2.20 picoamps (pA) (Ihold, example in Fig 5A, top row). The DHK induced current at 1D SH was 7.85 ± 2.55 pA. After 3D SH, DHK produced no significant change in inward current (2.29 ± 3.45 pA, example in Fig 5A, middle row), However, the DHK induced inward current returned to levels comparable to normoxia and 1 day SH following 7D SH (Fig 5A, bottom row). At 7D SH the DHK induced inward current was 7.75 ± 2.80 pA. The inward shift in Ihold in 0–7D SH, quantified in Fig 5B, illustrates DHK significantly depolarized nTS neurons at 0, 1 and 7D SH, but not 3D SH (aCSF vs. DHK within each group). There were no significant differences between any of the durations of SH and the normoxic control (0D vs. 3D, p = 0.06) with respect to the magnitude of the DHK-induced shift. These data suggest that the tonic function of EAAT-2 in the nTS was reduced at 3D SH but was restored by 7D SH.

Figure 5. Depolarizing currents following DHK are blunted following 3D SH.

Figure 5.

Open in a new tab

A. Representative traces of spontaneous activity showing the inward current produced in response to DHK after 0, 3 and 7D SH. Cells were voltage clamped at −60 mV. Note the downward deflection indicative of a depolarizing shift in Ihold seen after 0 and 7D SH is reduced with 3D SH. B. Group data showing the total change in holding current across SH. DHK induced depolarization after 0, 1 and 7D SH. Conversely, 3D SH did not change Ihold. p = 0.06 vs. Normoxia (0D SH), One-way ANOVA with LSD; # p < 0.05 DHK vs. aCSF baseline, paired t-test.

EAAT-2 expression is increased after SH

We also examined the nTS expression of EAAT-2, as well as EAAT-1, in relation to the observed synaptic alterations in SH and after DHK. Similar to previous reports by us and others (Chounlamountry and Kessler 2011; Matott et al. 2016), immunoreactivity for EAAT-1 and EAAT-2 was present in the nTS, although at differing abundance. EAAT-2 was more readily observed in the nTS than EAAT-1 (Fig 6A). Immunoreactivity across SH was not studied further due to the non-quantitative nature of the immunohistochemistry. RT-PCR confirmed greater expression of EAAT-2 vs. EAAT-1 in nTS in normoxia-exposed neurons and for 1 and 3D SH (Fig 6B). However, at 7D SH, mRNA expression was similar for both (Fig 6B). Examining the expression of EAAT-1 or EAAT-2 from 0D through 7D SH demonstrated a time dependent change in mRNA expression. EAAT-1 was relatively unaltered from 07D SH (Fig 6C, left). On the other hand, EAAT-2 mRNA expression significantly increased at 3D SH and subsequently returned to normoxic expression levels (Fig 6C, right). Following 7D SH EAAT-2 protein was significantly increased compared to normoxic tissue (example in Fig 6D, quantified in Fig 6E, right). A similar increase in EAAT-1 protein was observed after 7D SH (Fig 6E, left). These data indicate that EAAT-2 is generally expressed to a greater degree in the nTS than EAAT-1. Sustained hypoxia transiently increased mRNA of EAAT-2 at 3D SH but EAAT-1 mRNA expression was unaltered for any duration of SH. However, expression of both proteins increased by the end of 7D SH. This suggests that EAAT-2 protein upregulation was related to increased transcription and translation while EAAT-1 protein upregulation occurred through other mechanisms.

DISCUSSION

In the present study we show SH induces time- and EAAT-dependent changes in nTS synaptic activity. These events are likely interdependent. SH induced transient augmentation of afferent-evoked synaptic currents after 1D exposure, and spontaneous network events after 3D. Presynaptic factors appear to contribute to elevated afferent-driven events. Blockade of EAAT-2 after 3D SH attenuated TS-EPSC amplitude and eliminated the depolarizing inward current present in normoxic controls. EAAT-2 mRNA increased after 3D SH while protein was augmented after 7D. These data suggest that SH alters the expression and function of EAAT-2 which may contribute to maintenance of TS-EPSC amplitude and have a neuroprotective neuronal effect.

Our study extends and advances our understanding of the effect of SH on the synaptic processes in the nTS. SH increased TS-EPSC amplitude after 1D SH, and several lines of evidence suggest presynaptic mechanisms contributed to this increase. Specifically, the increase in afferent-induced currents was associated with an elevated 1/CV2, fewer TS-EPSC failures, reduced paired pulse ratio, and increased synaptic depression. Interestingly, TS-EPSC amplitude returned to normoxic values after 3D and remained at these levels at 7D SH. The reduction in TS-EPSC amplitude after 7D was also accompanied by a return of 1/CV2, failure rate and paired pulse ratio to normoxic control levels, again suggesting alteration in afferent release. Our results are consistent with the elevated TS-EPSC amplitude observed by others at 1D (Accorsi-Mendonca et al. 2015; Accorsi-Mendonca et al. 2019) but not those seen after 7D SH (Zhang et al. 2009). The differences observed between the latter and present study may be due to the neuronal populations examined. Although we examined similar regions of the nTS, Zhang et al. (2009) examined nTS neurons innervated by labeled chemoafferents whereas our study recorded unlabeled viscerosensory-innervated nTS neurons. Our study bridges these studies to further examine the time-related changes.

SH also increased spontaneous EPSCs. The increase in sEPSCs presently observed are in agreement with Accorsi-Mendonca et al. (2015), yet their study observed elevated sEPSC frequency at the same time as the increase in TS-EPSCs. We observed the frequency enhancement occurred after 3D SH at a time in which TS-EPSC amplitude was comparable to normoxia. The dissimilar time frame for TS-EPSC and sEPSC enhancement is reminiscent of the currents observed after chronic intermittent hypoxia where sEPSCs increased yet TS-EPSC amplitude decreased (Kline et al. 2007). The increase in sEPSC frequency after 3D SH may suggest elevation of presynaptic glutamate (Glu) release, or alternatively, uncovering of silent synapses. sEPSC amplitude did not change with 0–7 days SH suggesting postsynaptic Glu receptors were not altered. The lack of sEPSC amplitude alterations may also suggest the elevation of TS-EPSC amplitude is not due to elevated GluRs, although more direct comparisons are needed.

Several mechanisms may contribute to the changes in synaptic transmission in nTS. Hypoxia induces elevation of peripheral carotid body chemoafferent activity that terminates in the nTS (Kline 2008; Mifflin 1992). While we did not specifically target nTS neurons that receive carotid body inputs, we recorded in the area that receives the densest innervation (Austgen et al. 2012; Finley and Katz 1992; Kline et al. 2010). SH enhances rat carotid sinus nerve discharge in a time-dependent manner; baseline and hypoxic responses after 1 day of 10% O2 are similar to those exposed to normoxia (Chen et al. 2002; Flor et al. 2018) and both progressively increase following 3D SH and continue to rise (Chen et al. 2002). Such an increase in discharge will likely enhance release of glutamate from chemoafferents to induce excitation of nTS neurons and enhance respiration (McCrimmon et al. 1995; Mizusawa et al. 1994). However, the increase in TS-EPSC amplitude after 1D SH suggests the initial response is perhaps due to increases in the central gain via sensitization of central afferent synapses (Flor et al. 2018). 7D SH enhances the central gain of the sensory afferents (Dwinell and Powell 1999; Ilyinsky and Mifflin 2005) and TS-EPSCs (Zhang et al. 2009). Alternative mechanisms by which central circuit activity may be enhanced are through elevated expression or function of glutamate receptors, or persistence of synaptic Glu via reduction in astrocytic EAATs. Glu receptors were not the focus of the current study, although others have shown in nTS that 1D SH increases glutamatergic AMPA and NMDA receptor neuronal currents (Accorsi-Mendonca et al. 2019) while 7D SH increases AMPAR and NMDAR protein which contributes to enhanced ventilatory response (Pamenter et al. 2014). However, the altered 1/CV2, paired pulse ratio, and lack of change in sEPSC amplitude suggests elevated GluRs were not the primary cause of elevated TS-EPSCs after 1D nor their reduction at 7D SH in the present study. A study of hypobaric hypoxia in neonatal rats demonstrated after 7 days exposure to SH an increased percentage of nTS and dorsal motor nucleus of the vagus neurons were inhibited by hypercapnia (Nichols et al. 2009). This suggests that SH and its resultant increase in chemoafferent signaling leads to changes in central gain to chemoreflex which may serve to restore more normal respiratory patterns in the face of hypoxic conditions. Our results are consistent with this timeline and hypothesis. Additional studies will be required to parse out these time-dependent changes.

SH activates nTS astrocytes (Stokes et al. 2017; Tadmouri et al. 2014) and microglia (Lima-Silveira et al. 2019) which may contribute to the observed synaptic and associated physiological alterations (Accorsi-Mendonca et al. 2015; Accorsi-Mendonca et al. 2019; Stokes et al. 2017; Tadmouri et al. 2014). While we did not examine the role of microglia, we extend these studies to suggest that one contribution of astrocytes is through their role in EAAT-mediated Glu uptake. Astrocytic EAATs are vital to the control of synaptic glutamate concentration and thus GluR activation (Kessler 2013). EAAT-2 expression is more highly expressed in nTS than EAAT-1 (Chounlamountry and Kessler 2011), and our current data confirms this notion during normoxia and SH. Given the greater EAAT-2 expression, and our previous data demonstrating EAAT-2 modulates spontaneous EPSCs and nTS neuronal activity (Matott et al. 2017), we sought to determine if changes in SH synaptic activity is due to alterations in EAAT-2 expression and/or function. We show that EAAT-2 block with DHK did not appreciably alter TS-EPSC amplitude during normoxia and 1D SH; consistent with our previous study (Matott et al. 2017), and suggests that augmented TS-EPSC amplitude at 1D SH is not due to decreased EAAT-2 function. However, DHK block of EAAT-2 decreased TS-EPSC amplitude at 3D SH, which may indicate upregulation of EAAT-2 expression or function in restraining presynaptic inhibitory mechanisms, perhaps via metabotopic GluRs. Similar TS-EPSC reduction has been seen following block of EAAT-1 and −2 with TBOA (Matott et al. 2016). The tendency for the paired pulse ratio to decrease with DHK at 3D SH suggests a contribution of one or more presynaptic mechanisms. DHK did not alter sEPSC frequency or amplitude during any SH time period. The lack of amplitude alterations by DHK and SH may also further suggest lack of functional ionotropic receptor changes.

In addition to phasic neurotransmission, somal GluRs located in the extrasynaptic domain may contribute to neuronal activity and overall cardiorespiratory parameters. We have previously shown that astrocytic EAAT-2 restrains AMPA and NMDA receptor-mediated depolarization (Matott et al. 2017). Block of EAATs led to a postsynaptic depolarizing inward current. These effects are reduced after 3D SH but return to normoxic levels after 7D SH. This may indicate an adaptive decrease in EAAT-2 during 3D SH. The more pronounced TS-EPSC amplitude decrease after 3D, yet lack of change in Ihold during this same time period, may reflect altered protein expression or redistribution of EAAT-2 from surrounding the somas to near synaptic sites. Alternatively, GluRs may be saturated at 3D SH and not allow current to increase, however, if this were the case then reflex pathways should also be eliminated.

SH alters expression of EAAT mRNA and protein, suggesting that the observed electrophysiological changes may be due to alterations in the production and maintenance of EAAT. A study of primary astrocyte cultures showed that sustained hypoxia of one day was sufficient to reduce EAAT-2 expression and function (Dallas et al. 2007). Our functional and expression data are not consistent with this observation of EAAT changes after 1D SH, and may be due to the differential influence of in vivo and in vitro hypoxic exposure or suggest the necessity of neuronal activity. EAAT-2 mRNA increased at 3D SH followed by protein at 7D SH, consistent with increased transcription and translation within this time frame. EAAT-1 protein also increased with 7D SH without increased mRNA which may indicate EAAT-1 mRNA stabilization or perhaps elevation of mRNA at a later time point. SH may augment EAAT-1 & −2 production in response to increased sensory afferent signaling and/or spontaneous EPSCs, hypoxia itself or associated inflammation, to preserve normal synaptic function and prevent excitotoxicity. Additionally, post-translational modifications in the face of sustained hypoxia may alter functionality of existing EAAT-2, necessitating the production of additional EAAT to restore glutamate uptake capacity of synapses (Peterson and Binder 2019). One limitation is that while we observed a similar increase in EAAT-1, we did not explore its immediate function in the nTS, which will be an avenue of future studies.

In summary, we show that SH altered afferent-driven synaptic transmission and nTS network activity after one and three days of sustained hypoxia. We also demonstrated that by 7D SH synaptic transmission and nTS network activity returned to levels that did not significantly differ from normoxic controls. We showed that afferent induced synaptic transmission increased after 1D of SH and that this was independent of changes in EAAT-2 function. In fact, EAAT-2 mRNA expression was not significantly increased until 3D SH and increased expression of the protein was only observed after 7D SH. Interestingly, an EAAT-2 mediated effect was observed with afferent induced synaptic transmission with 3D SH which would suggest an enhancement of EAAT-2 function that was not evident at 1D SH. It seems reasonable to propose that sustained hypoxia produces an increased afferent response to nTS neurons that is not initially countered by increased EAAT activity, but that with longer durations of hypoxia there are gradual changes in function and expression of EAATs that allow the chemoreflex to stay within its working range and allow an effective response to hypoxia.

HIGHLIGHTS.

  • Exposure to sustained hypoxia (10% O2) up to 7 days induces time-dependent changes in glutamatergic signaling

  • Functional alterations in excitatory amino acid transporters contribute to altered glutamatergic signaling

  • EAAT expression increases over 7 days SH

ACKNOWLEDGEMENTS

We thank the late Christine Schramm for performing the IB and RT-PCR, and Heather A. Dantzler and Tessa K. Smith for their assistance of IHC, IB and RT-PCR.

Funding: NIH NHLBI HL128454 (DDK)

ABBREVIATIONS

1/CV2

inverse of the coefficient of variation

DHK

dihydrokainate

EAAT

excitatory amino acid transporter

EPSC

excitatory postsynaptic current

Glu

glutamate

nTS

nucleus tractus solitarii

SH

sustained hypoxia

TS

tractus solitarii

Footnotes

Conflict of Interest: The authors declare no competing financial interests.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  1. Accorsi-Mendonca D, Almado CE, Bonagamba LG, Castania JA, Moraes DJ, and Machado BH. Enhanced Firing in NTS Induced by Short-Term Sustained Hypoxia Is Modulated by Glia-Neuron Interaction. J Neurosci 35: 6903–6917, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Accorsi-Mendonca D, Bonagamba LG, and Machado BH. Astrocytic modulation of glutamatergic synaptic transmission is reduced in NTS of rats submitted to short-term sustained hypoxia. J Neurophysiol 2019. [DOI] [PubMed] [Google Scholar]
  3. Andresen MC, and Kunze DL. Nucleus tractus solitarius--gateway to neural circulatory control. Annu Rev Physiol 56: 93–116, 1994. [DOI] [PubMed] [Google Scholar]
  4. Austgen JR, Dantzler HA, Barger BK, and Kline DD. 5-hydroxytryptamine 2C receptors tonically augment synaptic currents in the nucleus tractus solitarii. J Neurophysiol 108: 2292–2305, 2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen CY, Horowitz JM, and Bonham AC. A presynaptic mechanism contributes to depression of autonomic signal transmission in NTS. Am J Physiol 277: H1350–H1360, 1999. [DOI] [PubMed] [Google Scholar]
  6. Chen J, He L, Dinger B, Stensaas L, and Fidone S. Role of endothelin and endothelin A-type receptor in adaptation of the carotid body to chronic hypoxia. Am J Physiol Lung Cell Mol Physiol 282: L1314–1323, 2002. [DOI] [PubMed] [Google Scholar]
  7. Chounlamountry K, and Kessler JP. The ultrastructure of perisynaptic glia in the nucleus tractus solitarii of the adult rat: Comparison between single synapses and multisynaptic arrangements. Glia 59: 655–663, 2011. [DOI] [PubMed] [Google Scholar]
  8. Dallas M, Boycott HE, Atkinson L, Miller A, Boyle JP, Pearson HA, and Peers C. Hypoxia suppresses glutamate transport in astrocytes. J Neurosci 27: 3946–3955, 2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Doyle MW, and Andresen MC. Reliability of monosynaptic sensory transmission in brain stem neurons in vitro. J Neurophysiol 85: 2213–2223, 2001. [DOI] [PubMed] [Google Scholar]
  10. Dwinell MR, and Powell FL. Chronic hypoxia enhances the phrenic nerve response to arterial chemoreceptor stimulation in anesthetized rats. J Appl Physiol (1985) 87: 817–823, 1999. [DOI] [PubMed] [Google Scholar]
  11. Finley JC, and Katz DM. The central organization of carotid body afferent projections to the brainstem of the rat. Brain Res 572: 108–116, 1992. [DOI] [PubMed] [Google Scholar]
  12. Flor KC, Silva EF, Menezes MF, Pedrino GR, Colombari E, and Zoccal DB. Short-Term Sustained Hypoxia Elevates Basal and Hypoxia-Induced Ventilation but Not the Carotid Body Chemoreceptor Activity in Rats. Front Physiol 9: 134, 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ilyinsky O, and Mifflin S. Chronic hypoxia abolishes expiratory prolongation following carotid sinus nerve stimulation in the anesthetized rat. Respir Physiol Neurobiol 146: 269–277, 2005. [DOI] [PubMed] [Google Scholar]
  14. Kessler JP. Control of cleft glutamate concentration and glutamate spill-out by perisynaptic glia: uptake and diffusion barriers. PLoS One 8: e70791, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kline DD. Plasticity in glutamatergic NTS neurotransmission. Respir Physiol Neurobiol 164: 105–111, 2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kline DD, Buniel MC, Glazebrook P, Peng YJ, Ramirez-Navarro A, Prabhakar NR, and Kunze DL. Kv1.1 deletion augments the afferent hypoxic chemosensory pathway and respiration. J Neurosci 25: 3389–3399, 2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kline DD, King TL, Austgen JR, Heesch CM, and Hasser EM. Sensory afferent and hypoxia-mediated activation of nucleus tractus solitarius neurons that project to the rostral ventrolateral medulla. Neuroscience 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kline DD, Ramirez-Navarro A, and Kunze DL. Adaptive depression in synaptic transmission in the nucleus of the solitary tract after in vivo chronic intermittent hypoxia: evidence for homeostatic plasticity. J Neurosci 27: 4663–4673, 2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kline DD, Takacs KN, Ficker E, and Kunze DL. Dopamine modulates synaptic transmission in the nucleus of the solitary tract. J Neurophysiol 88: 2736–2744, 2002. [DOI] [PubMed] [Google Scholar]
  20. Lima-Silveira L, Accorsi-Mendonca D, Bonagamba LGH, Almado CEL, da Silva MP, Nedoboy PE, Pilowsky PM, and Machado BH. Enhancement of excitatory transmission in NTS neurons projecting to ventral medulla of rats exposed to sustained hypoxia is blunted by minocycline. J Physiol 2019. [DOI] [PubMed] [Google Scholar]
  21. Livak KJ, and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408, 2001. [DOI] [PubMed] [Google Scholar]
  22. Matott MP, and Kline DD. Activation of 5-hyrdoxytryptamine 7 receptors within the rat nucleus tractus solitarii modulates synaptic properties. Brain Res 1635: 12–26, 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Matott MP, Kline DD, and Hasser EM. Glial EAAT2 regulation of extracellular nTS glutamate critically controls neuronal activity and cardiorespiratory reflexes. J Physiol 595: 6045–6063, 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Matott MP, Ruyle BC, Hasser EM, and Kline DD. Excitatory amino acid transporters tonically restrain nTS synaptic and neuronal activity to modulate cardiorespiratory function. J Neurophysiol 115: 1691–1702, 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. McCrimmon DR, Mitchell GS, and Dekin MS. Glutamate, GABA and Serotonin in Ventilatory Control In: Lung Biology in Health and Disease Regulation of Breathing, edited by Dempsey JA, and Pack A. New York: Marcel Dekker, 1995, p. 151–218. [Google Scholar]
  26. Mifflin SW. Arterial chemoreceptor input to nucleus tractus solitarius. Am J Physiol 263: R368–R375, 1992. [DOI] [PubMed] [Google Scholar]
  27. Mizusawa A, Ogawa H, Kikuchi Y, Hida W, Kurosawa H, Okabe S, Takishima T, and Shirato K. In vivo release of glutamate in nucleus tractus solitarii of the rat during hypoxia. J Physiol 478 ( Pt 1): 55–66, 1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nichols NL, Wilkinson KA, Powell FL, Dean JB, and Putnam RW. Chronic hypoxia suppresses the CO2 response of solitary complex (SC) neurons from rats. Respir Physiol Neurobiol 168: 272–280, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Pamenter ME, Carr JA, Go A, Fu Z, Reid SG, and Powell FL. Glutamate receptors in the nucleus tractus solitarius contribute to ventilatory acclimatization to hypoxia in rat. J Physiol 592: 1839–1856, 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Peterson AR, and Binder DK. Post-translational Regulation of GLT-1 in Neurological Diseases and Its Potential as an Effective Therapeutic Target. Front Mol Neurosci 12: 164, 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Powell FL, Huey KA, and Dwinell MR. Central nervous system mechanisms of ventilatory acclimatization to hypoxia. Respir Physiol 121: 223–236, 2000. [DOI] [PubMed] [Google Scholar]
  32. Schild JH, Khushalani S, Clark JW, Andresen MC, Kunze DL, and Yang M. An ionic current model for neurons in the rat medial nucleus tractus solitarii receiving sensory afferent input. J Physiol 469: 341–363, 1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Stokes JA, Arbogast TE, Moya EA, Fu Z, and Powell FL. Minocycline blocks glial cell activation and ventilatory acclimatization to hypoxia. J Neurophysiol 117: 1625–1635, 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tadmouri A, Champagnat J, and Morin-Surun MP. Activation of microglia and astrocytes in the nucleus tractus solitarius during ventilatory acclimatization to 10% hypoxia in unanesthetized mice. J Neurosci Res 92: 627–633, 2014. [DOI] [PubMed] [Google Scholar]
  35. Vidruk EH, Olson EB Jr., Ling L, and Mitchell GS. Responses of single-unit carotid body chemoreceptors in adult rats. J Physiol 531: 165–170, 2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zhang W, Carreno FR, Cunningham JT, and Mifflin SW. Chronic sustained hypoxia enhances both evoked EPSCs and norepinephrine inhibition of glutamatergic afferent inputs in the nucleus of the solitary tract. J Neurosci 29: 3093–3102, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES