Abstract
TRPM7 is a cation channel-protein kinase highly expressed in T lymphocytes and other immune cells. It has been proposed to constitute a cellular entry pathway for Mg2+ and divalent metal cations such as Ca2+, Zn2+, Cd2+, Mn2+and Ni2+. TRPM7 channels are inhibited by cytosolic Mg2+, rendering them largely inactive in intact cells. Dependence of channel activity on extracellular Mg2+ is less well studied. Here, we measured native TRPM7 channel activity in Jurkat T cells maintained in external Mg2+ concentrations varying between 400 nM and 1.4 mM for 1-2 days, obtaining an IC50 value of 54 μM. Maintaining the cells in 400 nM or 8 μM [Mg2+]o resulted in almost complete activation of TRPM7 in intact cells, due to cytosolic Mg2+ depletion. 1.4 mM [Mg2+]o was sufficient to fully eliminate the basal current. Submillimolar concentrations of amiloride prevented cellular Mg2+ depletion, but not loading. We investigated whether the cytotoxicity of TRPM7 permeant metal ions Ni2+, Zn2+, Cd2+, Co2+, Mn2+, Sr2+ and Ba2+ requires TRPM7 channel activity. Mg2+ loading modestly reduced cytotoxicity of Zn2+, Co2+, Ni2+ and Mn2+ but not of Cd2+. Channel blocker NS8593 reduced Co2+ and Mn2+ but not Cd2+ or Zn2+ cytotoxicity and interfered with Mg2+ loading as evaluated by TRPM7 channel basal activity. Ba2+ and Sr2+ were neither detectably toxic, nor permeant through the plasma membrane. These results indicate that in Jurkat T cells entry of toxic divalent metal cations primarily occurs through pathways distinct from TRPM7. By contrast, we found evidence that Mg2+ entry requires TRPM7 channels.
Keywords: metal toxicity, immunotoxicity, cadmium, lanthanum, amiloride, NS8593, HAP1 cells
Introduction
TRPM7 is a dual ion channel-protein kinase, ubiquitously expressed in mammalian tissues. TRPM7 channels belong to the transient receptor potential (TRP) channel family and are inhibited by cytoplasmic Mg2+, polyamines and protons [24]. Like other TRP family members TRPM7 is a tetrameric nonselective cation channel [9,21]. Numerous studies have attempted to elucidate the functions of this protein using a variety of systems: primary cell culture, immortalized cell lines, heterologous expression and transgenic mice. TRPM7 kinase activity supports murine T-cell proliferation [3] and gut-homing of intraepithelial lymphocytes [67]. TRPM7 channels, on the other hand, are thought to mediate Mg2+ influx into cells, as well as governing blood magnesium homeostasis [76,75]. Sensitivity to physiological levels of intracellular Mg2+, however, renders the majority of channels in intact cells silent, due to tonic inhibition by Mg2+ [13]. TRPM7 kinase is functional in the absence of channel activity [58,48] and its activity is regulated by divalent metal cations, such as Mg2+, Mn2+, Zn2+ and Co2+ [73,58]. These characteristics raise interesting questions about the possible mode(s) of activation of TRPM7 channels in intact cells in the body, questions that remain open.
Traditionally, TRPM7 channel currents are recorded in whole-cell patch clamp by infusing the cell with low micromolar [Mg2+] in conjunction with metal chelators (e.g. EGTA, HEDTA) to deplete cellular Mg2+ [64,47,60,38,13,90]. During Mg2+ washout from cytosol, TRPM7 channels open sequentially over several minutes [14]. Adding higher [Mg2+] internally results in current inhibition which is reversible and mainly affects the number of conducting channels with a small reduction (~20%) of unitary conductance [14]. Of interest, TRPM7 channels over-expressed in mammalian cells show a high degree of basal activity, even before Mg2+ depletion (e.g. [60,58,90]). Like other TRPM (melastatin) subfamily channels, TRPM7 requires the plasma membrane phospholipid PI(4,5)P2 for ion channel function [72,48]. We recently demonstrated that the characteristic inhibition of TRPM7 by cytoplasmic Mg2+, spermine and protons is indirect and represents electrostatic screening of PI(4,5)P2 negative charges, preventing channel activation [90].
Despite the obvious importance of Mg2+ in lymphocyte function, the cellular uptake pathways of this cation are poorly understood [8,92]. Congenital mutations in MagT1 (magnesium transporter 1) were shown to result in an immunodeficiency in patients, and it was proposed that MagT1 is the long-sought Mg2+ transporter in lymphocytes [26,51,85,52,19,91]. More recent studies, however, have cast doubt on the idea that MagT1 is a Mg2+ transporter per se, and suggested that it is a protein involved in glycosylation [6]. TRPM7 has been the focus of studies showing that it can provide a pathway for Mg2+ entry in the gut and other tissues [45,77,59]. In human colon cell lines, on the other hand, knockdown of TRPM7 resulted in a paradoxical increase in cytoplasmic Mg2+ [54]. Additionally, in lck-Cre mice, where Trpm7 was selectively deleted, no change in body Mg2+ homeostasis was observed due to TRPM7 channel disruption [39]. Thus, the involvement of TRPM7 in Mg2+ transport requires further investigation.
TRPM7 channels have been reported to conduct Ca2+, Mg2+ and other divalent metal cations such as Zn2+, Cd2+, Mn2+, Co2+, Ba2+, Sr2+ in the inward direction when these ions are added acutely [60,33,53,17,79]. Zn2+, Co2+ and Cd2+ influx through TRPM7 was suggested to be responsible for cytotoxicity [36,50,1,57,69]. Alternative influx pathways for Cd2+, such as divalent metal transporter 1 (DMT1), have also been proposed [7]. Interestingly, many of these permeant cations can inhibit TRPM7 channels from inside in a voltage-independent manner, similar to Mg2+ [46,58]. It is therefore plausible that significant entry of divalent metal cations into the cell will result in TRPM7 channel inhibition. The consequences of divalent metal loading and feedback inhibition on basal TRPM7 channel activity have not been explored.
In the present study, we aimed to elucidate the role of TRPM7 channels as an entry pathway for Mg2+ and other divalent metal cations in Jurkat T lymphocytes, which express high levels of TRPM7 [13]. We investigated the consequences of varying the extracellular Mg2+ concentration over several days on TRPM7 channel basal activity. We determined the dependence of native TRPM7 channel currents on external [Mg2+] and found that it resembles the dose-response relationship obtained from directly changing internal Mg2+ [13]. Using cytotoxicity as an assay of entry of external divalent metal cations in the cytosol, we defined the cytotoxicity sequence of metal cations as Cd2+>Zn2+>Co2+>Ni2+>Mn2+ (or Mn2+>Ni2+ in other experiments) which differed from the known permeability sequence of TRPM7 to these ions. Thus, Cd2+ was the most toxic cation yet is only modestly permeant through TPRM7 [60,53,55]. Incubation of cells in elevated [Mg2+]o (1.4 mM) resulted in complete elimination of basal TRPM7 channel activity and modestly reduced killing by Zn2+, Co2+, Ni2+ and Mn2+ without affecting Cd2+ toxicity. Maintaining Jurkat T cells in the presence of La3+, which at high concentrations blocks TRPM7 currents at negative membrane potentials, moderately reduced Cd2+, Zn2+, Co2+ and Mn2+ cytotoxity. NS8593, which blocks TRPM7 channels in a voltage-independent manner did not reduce killing by Cd2+ and Zn2+. Interestingly, incubation with NS8593 but not La3+ prevented Mg2+ loading. We conclude that TRPM7 significantly contributes to the uptake of Mg2+ and, to a lesser degree Zn2+, Co2+, Mn2+ and Ni2+ in Jurkat T cells. In TRPM7 CRISPR knockout HAP1 cells, Co2+, Mn2+ and Ni2+ cytotoxicity was reduced compared to WT cells, whereas Cd2+ and Zn2+ cytotoxicity was unaffected. Based on our findings, we propose that divalent metal ion entry pathways must exist that preferentially transport Cd2+, Co2+ and Zn2+ and are not Mg2+-sensitive. Neither Ba2+ nor Sr2+ accumulated in Jurkat T cells and were not toxic, despite being highly permeant through TRPM7 channels. Long-term activation of TRPM7 channels under conditions when external Mg2+ is pathologically low, which occurs during hypomagnesemia, may present TRPM7 as a previously unknown player in the progression of this disease state.
Materials and methods
Cell culture
Jurkat human leukemic T lymphocytes (ATCC, Manassas, VA) were grown in 5% CO2 humidified atmosphere at 37°C in RPMI 1640 (GE Healthcare, HyClone Laboratories, Logan, UT) or Advanced RPMI 1640 (Gibco/ThermoFisher, Waltham, MA) medium supplemented with 10% or 5% heat-inactivated fetal bovine serum (FBS) (Corning, Manassas, VA), respectively, and penicillin/streptomycin (Life Technologies, Grand Island, NY). Both RPMI formulations contain 0.42 mM Ca2+ and 0.4 mM Mg2+. In experiments with elevated external Mg2+, 1 mM MgCl2 was added to the medium bringing the total Mg2+ concentration to 1.4 mM. In experiments with reduced Ca2+ (see Fig. 6), 1.4 mM MgCl2 was added to RPMI treated with chelating resin (Chelex 100 ion exchange resin, 50–100 mesh, Sigma-Aldrich, St. Louis, MO). The complete RPMI containing serum was mixed with 5% (5 grams per 100 mls) Chelex 100 sodium form, stirred for 1 hour at room temperature and filtered through a 0.22 μm polyethersulfonate (PES) vacuum filter (CELLTREAT Scientific Products, Pepperell, MA) to remove the Chelex particles and sterilization, as described previously [3]. pH of the Chelex-treated RPMI was adjusted to 7.3. To prepare low Mg2+-containing RPMI, the complete medium was first treated with Chelex to remove Ca2+ and Mg2, followed by addition of 0.42 mM CaCl2, 10 or 40 μM HEDTA and 10 μM MgCl2 as specified in figure legends. The free Mg2+ concentrations of 10 μM MgCl2/10 μM HEDTA and 10 μM MgCl2/40 μM HEDTA-containing RPMI were estimated at 8 μM and 400 nM, respectively, at 37°C (Maxchelator software https://web.stanford.edu/~cpatton/webmaxcS.htm). Chelex 100 binds Ca2+, Mg2+ and other divalent metal cations and has been used to treat FBS-supplemented RPMI, resulting in Ca2+ and Mg2+ concentrations lower than 25 μM and 40 μM, respectively [66,11,12]. One drawback of using Chelex is that it can deplete proteins and amino acids in culture media, another is its preference for heavy metals over Ca2+ and Mg2+[11].
Fig. 6. Effect of external Ca2+ on Mg2+ depletion and cell viability.
Jurkat T cells were incubated in Chelex-RPMI for 1 day without Ca2+ supplementation at 1.4 mM and 8 μM Mg2+o concentrations. a. TRPM7 current-voltage relations at break-in (black) and after maximum current development (red) for cells incubated in 1.4 mM (top) and 8 μM [Mg2+]o (bottom) in the absence of added Ca2+. b. Preactivation indices (I0 /Imax) of cells treated as in a. Asterisk represents p<0.05, two-sample Student’s test. c. Cell viability assay for cells in the absence of added Ca2+ d. Cell viability assay for cells grown in 40 μM CaCl2 supplemented Chelex-RPMI. In c and d, double asterisks (p<0.01) represent comparisons with 0 and 40 μM Ca2+, respectively.
In experiments with Zn2+, Ba2+, Ni2+, Cd2+, Co2+, Mn2+ and Sr2+ supplementation of growth medium, Zn2SO4, BaCl2, NiCl2, CdCl2, CoCl2, MnCl2, SrCl2 were added to Chelex-treated complete RPMI with or without CaCl2.
HAP1, a near haploid human cell line derived from chronic myelogenous leukemia (CML) cell line KBM-1 (Horizon Discovery, Waterbeach, Cambridge, UK) was grown at 37°C, 5% CO2 humidified atmosphere in IMDM (Gibco/ThermoFisher) supplemented with 10% FBS and penicillin/streptomycin. Cells were passaged 1–2 times a week. For HAP1 cell viability measurements, Chelex-treated complete RPMI was supplemented with 1.4 mM CaCl2 (equal to the Ca2+ concentration in IMDM) and other metal cations as specified in Fig. 7. HEK293 cells were grown in RPMI supplemented with 10% FBS and antibiotics and passaged twice weekly. Cells were transfected with GFP-tagged murine TRPM7 cDNA as described in [90].
Fig. 7. Effects of TRPM7 channel blockade and knockout on divalent metal cytotoxicity.
Jurkat T cells were grown in the presence of 0.4 mM metal ion and NS8593 (a), La3+ (b), FTY720 and FTY720-P (c). Chelex-RPMI was d. Divalent metal toxicity (0.4 mM) in WT and TRPM7 CRISPR knockout HAP1 cells. e. Western blot analysis of TRPM7 protein in anti-TRPM7 immunoprecipitates from whole cell lysate of WT and TRPM7 KO HAP1 cells. Actin was used as an internal control. Chelex-RPMI was used in a, b and Chelex-advanced RPMI in c. In d, Chelex-RPMI supplemented with 1.4 mM CaCl2 was used. Asterisks denote statistical significance for pairwise comparisons for each metal cation under two conditions.
Patch-clamp electrophysiology
Electrophysiological experiments were performed in whole-cell or perforated patch clamp recording configurations using EPC10 (HEKA, Holliston, MA) patch clamp amplifier as previously described [13,90]. Instantaneous current-voltage (I-V) relations were acquired by applying command voltage ramps spanning −100 to +85 mV every 1.5 or 2.5 sec. For whole-cell recordings of native TRPM7 Jurkat T-cell currents, the basic internal (pipette) solution contained (in mM): 112 glutamic acid, 8 NaCl, 5 CsF, 12 EGTA, 10 HEPES, pH 7.3 adjusted with CsOH. The external (bath) recording solution contained 2 mM CaCl2, 3 mM CsCl, 140 mM Na aspartate, 10 mM HEPES-Na+, pH 7.3 with added 30 μM MgCl2, unless otherwise specified Perforated-patch recordings were performed as previously described [48,90] with a pipette solution containing 55 mM CsCl, 50 mM Cs2SO4, 7 mM MgCl2, 1 mM CaCl2, pH 7.3. On the day of experiment, amphotericin B (Sigma) 60 mg/ml stock solution prepared in DMSO was diluted in the pipette solution yielding 0.24 mg/ml final concentration [90]. At the end of each experiment, brief suction was applied to achieve whole-cell configuration upon which TRPM7 currents were rapidly inhibited with 7 mM Mg2+ and 1 mM Ca2+ present in the pipette solution (see Fig. 3). Deionized water was used for preparing all recording solutions. Osmolalities were measured with a freezing point osmometer (Osmette, Norwood, MA) and adjusted with D-mannitol (Sigma). Experiments were performed at room temperature. Jurkat T cells were spun down and transferred to RPMI containing specified Mg2+ and other metal cation concentrations and grown in 37°C CO2 incubator as described above. Recordings were made the next day, the day after or on the third day (referred to in the text as 1, 2, 3 days, respectively). Cells were kept in the recording solution containing 30 μM MgCl2 for not longer than approximately 1 hour. The durations of Mg2+ depletion and loading (e.g. Fig. 2) represent the time period between placing cells in modified Mg2+ medium and the time the recordings were made, and therefore include ≤1 hour when the cells were kept at room temperature in the recording chamber in presence of 30 μM Mg2+. Electrophysiological data were analyzed with Patchmaster (HEKA) and Origin (OriginLab, Northampton, MA) software. Two-sample Student’s tests were performed using Origin to determine significant differences. In some cases t test results were confirmed with non-parametric Wilcoxon rank sum test as specified in figure legends.
Fig. 3. Perforated-patch recording of TRPM7 currents in Mg2+-depleted intact Jurkat T cells.
Jurkat T cells were grown in Chelex-RPMI supplemented with 8 μM [Mg2+] as in Fig. 1a, b for two days. a. Preactivated TRPM7 current-voltage relation obtained in perforated-patch configuration (red) and after inhibition by internal Mg2+ and Ca2+ upon break-in (black). b. Time dependence of TRPM7 current amplitude in the same cell. A representative recording of n=4 cells is shown.
Fig. 2. TRPM7 current amplitudes during Mg2+ loading and depletion. Time course of Mg2+ depletion.
Dependence of TRPM7 preactivation index (a) and maximum amplitude (b) on the duration of Mg2+ depletion (up to 60 hrs). c. Maximum TRPM7 current amplitudes in Jurkat T cells incubated in 1.4 mM and 8 μM [Mg2+] for 1 day. 3 cells prior to 1.4 Mg2+ were exposed to 8 μM Mg2+. In a–c, Chelex-RPMI was supplemented with 0.42 mM [CaCl2]. TRPM7 current amplitudes were measured at 83.77 mV (a, b) and 83.42 mV (c). d. RT-PCR of total RNA isolated from Jurkat T cells incubated in 8 μM and 0.4 mM Mg2+ in the presence of 0.42 mM CaCl2 for 1 day. Primers for TRPM7 and GAPDH were used with predicted amplicon sizes of 734 and 555 bp, respectively. In lanes marked –RT here and in Fig. 4a, reverse transcriptase was omitted from the reaction.
Cell viability measurements
The viability of Jurkat T lymphocytes and HAP1 cells grown in the presence of various metal cations was measured by trypan blue dye exclusion using Vi-CELL automated viability analyzer (Beckman Coulter, Brea, CA) [25,3]. In the majority of experiments the cells were grown at 37 °C, 5% CO2 in Chelex-treated or normal RPMI supplemented with 0.42 mM CaCl2 and 0.4 mM chloride (for Mn2+, Ni2+, Co2+, Ba2+, Cd2+, Sr2+) or sulfate salt (for Zn2+) of the metal ion. 0.4 mM Na2SO4 was tested as a control in separate experiments and did not have a noticeable effect on cell viability (data not shown). In experiments described in Fig. 6, CaCl2 was added at 40 μM or entirely omitted. In experiments with elevated Mg2+, complete RPMI (without Chelex treatment) was supplemented with 1 mM MgCl2 and various metal cations at 0.4 mM, except in Figs. 5c, d and 6 where MgCl2 was added to Chelex treated complete RPMI. Cell viability was assessed approximately 24 hours after adding the metal cation. In experiments described in Fig. 5d, cells were incubated at low and normal magnesium concentrations for 24 hours, counted and then exposed to divalent metal cations for 24 hours. Aliquots of cell culture were spun down to test cell viability after treatment with divalent metal cations. Briefly, 1 ml of cell suspension was added to a sample cup at room temperature and mixed with trypan blue by the automated cell counter. 100 cell images were acquired and analyzed by the Vi-CELL software. The software detects cells that are viable and those that are dead, based on trypan blue exclusion or accumulation in the cells. Vi-CELL data were graphed using Origin. Salts were purchased from Sigma, Acros Organics (Geel, Belgium) and Fisher. Stock solutions of NS8593 hydrochloride (Sigma), amiloride hydrochloride (Sigma), FTY720 hydrochloride (Cayman Chemical Company, Ann Arbor, MI), FTY720-phosphate (Cayman) and imipramine hydrochloride (Sigma) were prepared in DMSO and diluted to the final concentration on the day of experiment. EDTA was from Research Products International (Mt Prospect, IL), HEDTA was from Acros Organics (Geel, Belgium).
Fig. 5. Viability assay of cells grown in the presence of divalent metal cations.
Viabilities of Jurkat T cells were tested in the presence of 0.4 mM Zn2+, Cd2+, Co2+, Ni2+, Mn2+, Ba2+, Sr2+, after maintaining in normal RPMI containing 0.4 mM Mg2+ (a) or in Chelex-RPMI without Mg2+ (b). Asterisks in a and b denote comparisons to Mg2+ control (black bar) (p<0.05). c. Comparison of metal cation toxicities in cells grown in 8 μM and 1.4 mM Mg2+ added to Chelex-RPMI. In the control only Mg2+ at indicated concentrations was added. d. Cell viability measurements similar to c except with 24 hr preincubation in 8 μM or 0.4 mM Mg2+ containing Chelex-RPMI before addition of toxic metal cations for 24 hrs. 0.42 mM CaCl2 was added to Chelex-RPMI in b–d. Double asterisks in c and d denote two-sample t-test comparisons for the same metal under low and high Mg2+ conditions (p<0.01). Graphs a–d represent means of 3 independent experiments each.
Western blot analysis
Detection for the levels of endogenous TRPM7 protein was performed as previously described [3]. HAP1 cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.5, 120 mM NaCl, 0.5 mM DTT, 1.5 mM MgCl2, 0.2 mM EDTA, 1% Triton X-100 supplemented with protease inhibitors) on ice for 20 min and insoluble materials were removed by centrifugation at 20,000 g for 10 min. To concentrate the TRPM7 protein by immunoprecipitation, cell lysates were incubated with rabbit polyclonal anti-TRPM7 antibody (AB15562; Millipore, Billerica, MA) or control IgG overnight at 4°C, followed by incubation with protein A sepharose beads for 1 hour. The beads were washed three times in lysis buffer and proteins bound to the beads were eluted using Laemmli sample buffer. The eluted proteins and whole cell lysates were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked using Blocking One (Nacalai Tesque, Kyoto, Japan) and then probed with anti-TRPM7 or mouse monoclonal anti-β-actin antibodies (Medical and Biological Laboratories, Nagoya, Japan) overnight at 4°C before being washed and incubated for 1 hour with the secondary HRP-conjugated anti-rabbit IgG or anti-mouse IgG antibodies (Dako, Carpenteria, CA). Before development, the membranes were washed and incubated with Amersham ECL Prime (GE Healthcare, Piscataway, NJ) and the immunoreactive proteins were visualized using ImageQuant400 (GE Healthcare).
RT-PCR
RT-PCR was performed on RNA isolated from Jurkat T cells essentially as previously described [13,3]. RNA was isolated from cells grown for 24 hours in Chelex-treated RPMI with10 μM MgCl2/10 μM HEDTA or 0.4 mM MgCl2, using Tri Reagent RT (Molecular Research Center, Cincinnati, OH) according to manufacturer’s instructions. OneStep RT-PCR Kit (Qiagen, Hilden, Germany) was used with primer sets specific for TRPM7, SLC41A1, SLC41A2 and GAPDH (Integrated DNA Technologies, Coralville, IA). Primer sequences were: hTRPM7 Fwd 5”-CTGAAGAGGAATGATTATACGCC-3”/Rev 5”-GCCTAACCCTGATTCATAAA-3” [13], hSLC41A1 Fwd 5”-GTGATTGAGTCTCGGGCCAA/Rev GTTCCAGGTAGAGTCCCCCA, hSLC41A2 Fwd 5”-CTTGCCATATTGGCTTGGAT/Rev CAACCTTTGGGTTCATCAGG [74]. 25 cycle amplification was performed for TRPM7 and SLC41A1, A2 and 35 cycles for GAPDH. Amplicons were separated by agarose gel electrophoresis run together with GenerRuler1kb Plus DNA ladder (Thermo Scientific).
Results
Effects of Mg2+ depletion and loading on TRPM7 channel activity
Based on RT-PCR results, Jurkat T lymphocytes express high levels of TRPM7 but not TRPM6, a closely related channel-kinase [13]. This presents an advantage for studying Mg2+ regulation and TRPM7 in this cell line since TRPM6 has also been implicated in Mg2+ transport in other cell types and can combine with TRPM7 to form heterotetramers [83,18,15,5,54]. Given that most TRPM7 channels are normally inhibited in Jurkat T cells, presumably due to inhibition by cytoplasmic Mg2+ [13], we investigated if prolonged removal of external Mg2+ would activate TRPM7 channels by depletion of Mg2+ from the cell. Growing Jurkat T cells in 8 μM Mg2+-containing medium, in the presence of normal 0.42 mM Ca2+ for 1–2 days resulted in an almost full activation of TRPM7 channels estimated as preactivation index I0/Imax (Fig. 1a, b). We chose this parameter because it accurately quantifies the number of open channels in an intact cell at break-in (I0) compared to the total number of channels present in the plasma membrane (Imax) (see also Fig. 2 below). Imax for each cell was estimated after cell dialysis with Mg2+-free internal solution for 5–6 minutes (Fig. 1a, c). Elevating external Mg2+ to 1.4 mM in the growth medium for 1–2 days resulted in full inhibition of basal channel activity (Fig. 1b, d).
Fig. 1. TRPM7 channel activity in Jurkat T cells grown under varying [Mg2+]o.
a, b. TRPM7 current-voltage relations obtained at break-in (I0) and after dialysis with Mg2+-free internal solution (Imax). Cells were grown in Chelex-RPMI supplemented with 8 μM Mg2+ for 1 day (a) or 1.4 mM Mg2+ for 2 days (b). c, d. Time dependence of TRPM7 current amplitude in the same cells as a and b, respectively. e. Scatter plot of TRPM7 current preactivation index (I0/Imax) obtained from cells grown for 1–3 days at the indicated external Mg2+ concentrations. Each symbol represents current magnitude measured at 83.42 mV from one cell. Data points for 400 μM Mg2+ represent cells grown in normal RPMI. f. Dose response relationship obtained from data shown in e. Each symbol represents a mean±SEM. Numbers of cells for each Mg2+ concentration are in parentheses. The data were fitted with the Hill equation with IC50 of 54 μM and n= 0.9.
We next measured TRPM7 preactivation at low and intermediate [Mg2+]o (Fig. 1e). In agreement with our previous study [13], basal channel activity was minimal in most cells at 400 μM [Mg2+]o present in normal RPMI (Fig. 1e). We constructed a dose-response curve for external Mg2+, which yielded IC50 of 54 μM (Fig. 1f). This value is close to that determined in whole-cell recordings where pipette [Mg2+] was systematically varied [13].
We investigated in detail the dependence of TRPM7 current preactivation on the duration of exposure to 8 μM Mg2+ (i.e. depletion step). Cells grown in normal RPMI were transferred to 8 mM Mg2+-containing Chelex-RPMI for various time periods up to 60 hours and TRPM7 current amplitudes were compared (Fig. 2). We found that the preactivation index rose steeply in the majority of cells after incubating for ~12 hours and remained high for at least up to 55 hours (Fig. 2a). The maximum TRPM7 current rose gradually during that time period, however this rise was substantially slower than that for preactivation index (Fig. 2b). We compared the maximum TRPM7 current amplitudes in cells grown in 8 μM Mg2+ vs. elevated 1.4 mM Mg2+ for one day. On average, there was a modest increase of maximum current amplitude in cells grown in low Mg2+ (Fig. 2c). We investigated further if increase maximum current was due to increased expression of TRPM7 in low Mg2+. RT-PCR experiments using TRPM7 specific primers were performed on RNA isolated from cells grown in 8 μM and 0.4 mM Mg2+ for 1 day. However, there was a slight decrease, rather than an increase of TRPM7 expression in low Mg2+ (Fig. 2d).
Unlike whole cell, the perforated-patch configuration prevents changes in concentrations of divalent cations such as Mg2+ and Ca2+ inside the cell. In Mg2+-depleted cells we recorded TRPM7 currents in this configuration. Fig. 3a shows TRPM7 current-voltage relation obtained in a cell grown in 8 μM Mg2+ for two days. As expected, TRPM7 amplitude did not change during the entire recording, reflecting the fact that the majority of TRPM7 channels are active in an intact cell under these growth conditions (Fig. 3b). At the end of experiment, whole-cell configuration was obtained causing the current to be inhibited fully by influx of 7 mM Mg2+ and 1 mM Ca2+ present in the internal solution (Fig. 3a, b).
Experiments presented in Figs. 1 and 2 and Suppl. Fig. 1 demonstrate that removal of external Mg2+ and resulting cellular depletion of this cation is sufficient to activate TRPM7 currents. Conversely, loading of cells in presence of moderately elevated Mg2+ (1.4 mM) is sufficient to inhibit the great majority of channels. We previously showed that TRPM7 channels can be inhibited by cytoplasmic polyamines and protons in addition to Mg2+ [48,90]. The observation that in perforated-patch recordings TRPM7 currents were maximally activated under low Mg2+ conditions (Fig. 3), similar to whole-cell (Fig. 1a) suggest that the primary inhibitory cation in Jurkat T cells is Mg2+, whereas polyamines, such as spermine, and protons may play a minor role. Thus, TRPM7 channels can be used to estimate cellular Mg2+ levels in intact cells determined by extracellular [Mg2+]. TRPM7 channels under low Mg2+o conditions can still be inhibited by spermine added to the internal solution (Suppl. Fig. 1a) [48,40].
Mg2+ efflux but not influx is sensitive to amiloride
It has been reported in other cell types that Mg2+ efflux is governed by the Na+-Mg2+ exchanger, thought to be encoded by SLC41A1, which is sensitive to submillimolar amiloride and imipramine [80,68,44,35]. Expression of SLC41A1 and SLC41A2, a closely related putative Mg2+ transporter, has been reported in Jurkat T cells [84,91]. Using RT-PCR, we compared SLC41A1 and A2 expression in Jurkat cells grown under low (8 μM) and normal (0.4 mM) Mg2+. SLC41A1 mRNA levels were reduced in low Mg2+, whereas SLC41A2 was unchanged (Fig. 4a). In order to determine if amiloride inhibits Mg2+ efflux, the cells were first grown in 1.4 mM [Mg2+], followed by a switch to 8 μM Mg2+ in the presence or absence of amiloride (Fig. 4b–d). Afterwards, preactivation index for each condition was derived from patch clamp recordings of TRPM7 currents. Depletion of Mg2+ in the presence of 300 μM amiloride was essentially prevented (Fig. 4b–d) after 1 – 2 days of incubation in low external Mg2+. Imipramine, a tricyclic antidepressant drug that also inhibits Na+-Mg2+ exchanger was toxic to Jurkat T cells at 20 and 200 μM in a concentration-dependent manner, precluding further experiments (Suppl. Fig. 1c). Imipramine has been reported to cause apoptosis in human lymphocytes [41].
Fig. 4. Sensitivity of Mg2+ efflux and influx to amiloride.
a. Expression of SLC41A1 and SLC41A2 in Jurkat T cells. RT-PCR with primers specific for SLC41A1 and A2 was performed with RNA isolated from cells maintained in 8 μM and 0.4 mM Mg2+ for 1 day. Predicted amplicon sizes were 694 and 374 bp for SLC41A1 and A2, respectively. b–d. Jurkat T cells were first grown in 1.4 mM Mg2+ then transferred to 8 μM Mg2+ containing RPMI for 1 (a, c) or 2 days (d) before performing whole-cell recordings. a. Top: superimposed time courses of TRPM7 current development in cells incubated in the presence (red) and absence (black) of amiloride for 1 day. c, d. Scatter plots of preactivation indices obtained from cells grown in control and 300 μM amiloride-containing media for 1 day or 2 days e. After growing in 8 μM Mg2+ for 1 day, cells were transferred to 1.4 mM Mg2+ in the presence and absence of 300 μM amiloride. Asterisks indicate significant differences by Student’s t test, p<0.01.
Next, we tested whether Mg2+ influx may also be amiloride-sensitive, reasoning that in high Mg2+ this exchanger may reverse direction and serve as a Mg2+ influx pathway, as reported for red blood cells [31]. The cells were grown in 8 μM Mg2+ for 1 day to deplete cellular Mg2+, followed by a switch to 1.4 mM Mg2+ with or without amiloride for 1 day. We found no effect of 300 μM amiloride on Mg2+ loading as assessed by TRPM7 current pre-activation index (Fig. 4e). In agreement with a previous report, up to 300 μM amiloride did not block TRPM7 currents (data not shown)[38]. We conclude from these experiments that in Jurkat T cells Mg2+ efflux is likely occurring through Na+-Mg2+ exchanger SLC41A1, whereas Mg2+ influx occurs through an unrelated, amiloride-insensitive influx pathway. These experiments also confirmed that the observed current preactivation in cells grown in low Mg2+ represents cytoplasmic Mg2+ depletion, rather than a direct effect of external Mg2+ removal.
Divalent metal cation cytotoxicity under conditions when TRPM7 channels are active or inactive
TRPM7 channels have been reported to conduct divalent metal cations such as Ni2+, Zn2+, Ba2+, Sr2+, Mg2+, Ca2+, Mn2+, Co2+ and Cd2+ (e.g.[60,53,36,55,16,69,2]). In most cases, divalent cation permeability has been measured during acute application and/or in cells overexpressing TRPM7 heterologously using 10 mM or higher concentrations. The metal ion permeability sequence determined from patch clamp measurements was: Zn2+>Ni2+ >> Ba2+ > Co2+ > Mg2+ ≥ Mn2+ ≥Sr2+≥ Cd2+ ≥ Ca2+ with no permeation of La3+ and Gd3+[60]. Uptake of the majority of these metal cations is known to be toxic to cells, including lymphocytes [29,10,36,57,1,89]. Our finding that removal or supplementation of extracellular Mg2+ can effectively switch on and off TRPM7 channel currents in intact cells (Figs. 1, 3), led us to investigate whether influx of permeant divalent cations through TRPM7 under these conditions can be quantitated by cytotoxicity using the trypan blue exclusion assay. We reasoned that if TRPM7 is indeed a major Mg2+ entry pathway in Jurkat T cells, then the cytotoxicity by divalent cations would follow the permeability sequence determined for TRPM7. On the other hand, inhibiting TRPM7 channels by Mg2+-loading or pharmacological blockade would be expected to rescue cells from cytotoxicity by eliminating the uptake pathway. To address this question we grew Jurkat T cells in the presence of 0.42 mM Ca2+ and 0.4 mM of divalent metal cation for 1 day. Afterwards, we quantitated cell viability by trypan blue dye exclusion [25]. In cells grown in normal RPMI ([Mg2+] =0.4 mM) (Fig. 5a) and in the absence of external Mg2+ (Fig. 5b), with TRPM7 channels activated, we found the cytotoxicity sequence to be Cd2+>Zn2+>Co2+>Ni2+>Mn2+>>Ba2+>Sr2+=Mg2+ (Fig. 5a). In the normal medium there was some reduction in cell killing by Mn2+, Ni2+, Co2+ and Zn2+ but not Cd2+ (Fig. 5a). Nether Ba2+ nor Sr2+ were noticeably cytotoxic (Fig. 5a, b). We then compared metal cytotoxicity in low (8 μM) and high (1.4 mM) [Mg2+] medium (Fig. 5c). Even in cells grown in elevated Mg2+, cytotoxicity caused by Mn2+, Ni2+, Co2+, Zn2+ and Cd2+ persisted under conditions in which TRPM7 channels are expected to be inactive due to inhibition by Mg2+ (Figs. 1, 2). In order to mimic the conditions in our electrophysiological experiments (Figs. 1–3) we incubated Jurkat T cells in 8 μM and 0.4 mM Mg2+ for 24 hours before adding divalent metal cations for another 24 hours. As shown in Fig. 5d, results were essentially similar to Fig. 5a, b except for a ~10% reduced viability in cells treated with 8 μM Mg2+ for 48 hours. These experiments show that cytotoxicity by Mn2+, Ni2+, Co2+ and Zn2+ uptake is modestly reduced when TRPM7 channels are closed but Cd2+ cytotoxicity is unaffected.
Effects of external Ca2+ on Mg2+ depletion and divalent metal cytotoxicity
TRPM7 channel I-V relation is strongly dependent on extracellular divalent cation concentrations. Upon removal of all external Ca2+ and Mg2+, the I-V relation is transformed from outwardly rectifying (see Fig. 1a, b and 3a) to semi-linear [47,42]. This is thought to represent removal of Ca2+ and Mg2+ tonic pore blockade. It is likely that in the presence of Ca2+ (0.42 mM in our experiments) Ca2+ competes with Mg2+ and other permeant divalent cations for the conduction pathway and may thus hamper their entry [42,53,62]. In order to investigate whether reduced external Ca2+ modifies divalent metal cation entry, we first investigated if Mg2+ depletion and loading can proceed in the absence of Ca2+. We incubated Jurkat T cells in Chelex-RPMI with 8 μM Mg2+ and 1.4 mM Mg2+ without added Ca2+. Incubation in low Mg2+ resulted in highly preactivated TRPM7 currents, whereas incubation in elevated Mg2+ resulted in virtually no preactivation (Fig. 6a, b). These results were essentially the same as what we observed in the presence of 0.42 mM [Ca2+] (Fig. 1), and demonstrate that Mg2+ depletion and loading do not require external Ca2+. We then repeated metal cytotoxicity experiments similar to Fig. 4 in the absence of added Ca2+ but found that cell viability in divalent-free RPMI dropped to around 30%, making interpretation of cytotoxicity measurements challenging (Fig. 6c). Cell viability reached almost 100% when 0.42 mM [Ca2+] was added (Fig. 6c). Interestingly, 0.4 mM MgCl2 alone without Ca2+ was also sufficient to completely rescue the cells (Fig. 6c). We then measured metal cytotoxicity in 40 μM [Ca2+] (roughly 10-fold lower than normal RPMI) and found significantly improved cell survival, reaching ~60% (Fig. 5d). 40 μM [Ca2+] is sufficient to block most of the inward monovalent TRPM7 current [42,62]. The cytotoxicity profile of Cd2+, Zn2+, Ni2+ and Co2+ however, remained essentially the same as in the absence of Ca2+ (Fig. 6c), suggesting that TRPM7 pore occupancy by Ca2+ and competition with other divalent cations does not significantly influence entry of these metals. The only exception was Mn2+, which was somewhat less cytotoxic in 40 μM Ca2+ compared to no Ca2+ (35.2 vs. 26.3% survival; Fig. 6d). Additionally, we found that similar to Ca2+, Mg2+ and Sr2+ alone also increased cell survival (Fig. 6d). In control experiments we compared cell viability in the presence of 10 and 100 μM HEDTA finding no significant difference, and concluding that contamination by divalent metals is negligible after Chelex treatment (Suppl. Fig. 1b). By contrast, addition of 100 μM EDTA modestly decreased cell viability compared to 100 μM HEDTA, which could be due to toxic effects of EDTA to cells irrespective of its chelating efficiency.
Effects of TRPM7 blockers and knockout on divalent metal cytotoxicity
In patch-clamp experiments, we tested NS8593 blockade, which was voltage-independent and 20 μM was sufficient to eliminate TRPM7 currents entirely without affecting the CRAC current in agreement with previous reports (Suppl. Fig. 1e–h) [16,23]. By contrast, we found that 400 μM La3+ blocks the inward component of TRPM7 currents reversibly, while leaving the outward component intact (Suppl. Fig. 1d). NS8593 was originally identified as a small conductance Ca2+-activated K+ channel (SK) inhibitor [78]. SK2 channels are highly expressed in Jurkat T cells, and 20 μM NS8593 would be sufficient to block SK channels completely (IC50 for SK channels is 60 nM) [78,37,20]. Therefore, we used 1 μM NS8593 as a negative control to eliminate the contribution of SK channels (Fig. 7a). To test the involvement of TRPM7 channels in entry of metal cations we maintained Jurkat T cells in the presence of either 20 μM NS8593 (Fig. 7a) or 400 μM La(NO3)3 (Fig. 7b), concentrations sufficient for significant reduction of TRPM7 channel activity. We found, however, that cytotoxicity by divalent metal cations persisted even under these conditions (Fig. 7a, b). We also tested the effect of TRPM7 channel blocker FTY720 (fingolimod) and its inactive analog FTY720 phosphate [65,79] and, as expected, found that 3 μM FTY720 reversibly inhibited TRPM7 currents whereas FTY720 phosphate at 10 μM had no effect (Suppl. Fig. 1i, j). We tested these compounds in cytotoxicity assays but found that FTY720 was itself somewhat toxic to Jurkat T cells, unlike FTY720 phosphate (Fig. 7c). From these series of experiments we conclude that divalent metal cations (Zn2+, Cd2+, Mn2+, Co2+) can enter and accumulate in Jurkat T cells, but largely not through TRPM7 channels. Notably, Cd2+, which is only sparingly permeant through TRPM7 was the most cytotoxic cation. Conversely, Ba2+ and Sr2+, cations highly permeant through TRPM7, did not cause noticeable cell damage (see below). Martineau et al [57] evaluated Cd2+ cytotoxicity under Mg2+ depletion in MC3T3-E1 osteoblast cell line and found that it stimulated Cd2+ entry. The authors argued that this reflected increased TRPM7 channel activity. We did not detect any effect of Mg2+ loading or NS8593 on Cd2+ cytotoxicity, which suggests that Cd2+ entry pathway in this cell type, primarily occurs through a pathway unrelated to TRPM7. La3+ reduced Cd2+ and Zn2+ cytotoxicity (Fig. 7b), however, this may simply suggest that Cd2+ and Zn2+ entry pathways are sensitive to 400 μM La3+, since La3+ may block other ion transport pathways (e.g. [88]).
In view of the fact that TRPM7 channel blockers are relatively non-specific, we also examined if TRPM7 serves as a divalent metal cation entry using HAP1 wildtype and TRPM7 CRISPR knockout lines [22,15,17]. Co2+, Ni2+ and Mn2+ cytotoxicity was reduced in TRPM7 knockout cells compared to WT, however, Cd2+ and Zn2+ cytotoxicities were unaffected (Fig. 7d). Western blot analysis confirmed a significant reduction of TRPM7 protein in HAP1 KO cells compared to WT (Fig. 7e). These observations suggest that similar to Jurkat, Cd2+ and Zn2+ entry pathways are distinct from TRPM7 in HAP1 cells. By contrast, Co2+, Ni2+ and Mn2+ entry, in part, involves TRPM7.
Cellular uptake of non-toxic metal cations evaluated by inhibition of TRPM7 channels
TRPM7 channels are inhibited not only by internal Mg2+ but also by other divalent and trivalent metal cations such as Zn2+, Ba2+, Mn2+ and La3+ [46,48]. We took advantage of this property to evaluate whether the metal cations that are non-toxic when applied externally (Fig. 4) also cannot enter the cell cytosol. We measured TRPM7 preactivation index in cells incubated in 8 μM Mg2+ or 1.4 mM Ba2+ and found no significant difference, which suggested that Ba2+ did not accumulate in these cells (Fig. 8a). Internal 1.4 mM Ba2+ readily inhibited TRPM7 currents in cells incubated in the absence (Fig. 8b) and presence (Fig. 8 c) of 1.4 mM external Ba2+. Similarly, in cells incubated in 1.4 mM Sr2+, preactivation index was the same as in Mg2+-depleted cells (Fig. 7d). Unlike with 1.4 mM Mg2+, incubation in 1.4 mM Sr2+ did not reduce the preactivation index (Fig. 8e). These experiments demonstrate that the non-toxic metal cations Ba2+ and Sr2+, despite being highly permeant through TRPM7 channels [60], do not accumulate in Jurkat T cells. Ba2+ and Sr2+ applied internally through the patch pipette resulted in cell death after several minutes of recording (unpublished observations).
Fig. 8. Ba2+and Sr2+uptake evaluated by inhibition of TRPM7 channels.
Jurkat T cells were treated as shown for each panel in the scheme and x axis labels. a. TRPM7 preactivation indices for cells grown in 8 μM [Mg2+] and 1.4 mM [Ba2+] without Mg2+. The difference was not significant (p=0.39 from Student’s t test and p=0.25 from Wilcoxon rank sum test). b. Inhibition of TRPM7 current by internal Ba2+ in a cell grown in 1.4 mM [Ba2+]. c. Inhibition of TRPM7 current by internal Ba2+ in a cell grown in 8 μM Mg2+ and no Ba2+. d. TRPM7 preactivation indices in cells grown in 8 μM [Mg2+] and 1.4 mM [Sr2+] without Mg2+. The difference was not significant (p=0.25 from Student’s t test, p=0.37 from Wilcoxon rank sum). e. Comparison of preactivation indices in cells grown in 1.4 mM [Mg2+] vs. 1.4 mM [Sr2+], *p<0.0001 from Student’s t test, p=0.0159 from Wilcoxon rank sum test. In a–e internal solutions contained no Mg2+.
Blockade of TRPM7 and Mg2+ loading
In order to test if the blockade of TRPM7 channels will reduce Mg2+ entry, the cells were grown in the presence of La3+ and NS8593 to prevent TRPM7 channel activity. Initially the cells were grown for 1 day in 8 μM Mg2+ (Mg2+ depletion step) after which the medium was switched to 1.4 mM Mg2+ (Mg2+ loading) (Fig. 9a). We reasoned that if Mg2+ loading occurs through TRPM7 channels, then cells treated with La3+ and NS8593 would have large preactivated currents, whereas untreated cells will be fully loaded with Mg2+ and show no preactivation. La3+ blocks TRPM7 currents primarily at negative membrane potentials (Suppl. Fig. 1d) whereas NS8593 block is voltage-independent (Suppl. Fig. 1e, f). Fig. 8b shows TRPM7 I-V relations obtained during Mg2+ depletion and loading in the presence of NS8593 and La3+. We found that in the presence of 20 μM NS8593 Mg2+ loading was largely prevented (Fig. 9b, c). However, neither 3 nor 400 μM La3+ had an effect on Mg2+ loading (Fig. 9b, d). These results suggest that TRPM7 participates in Mg2+ loading, however, this question requires further investigation in view of lack of La3+ effect (see Discussion). Our results also suggest that blockade of SK2 channels with 1 μM NS8593 (Fig. 9c) or CRAC channels with 3 μM La3+ (Fig. 9d) have no effect on Mg2+ loading.
Fig. 9. Effect of TRPM7 blockers on Mg2+ loading.
Experiments similar to Fig. 4 were performed in the presence of La3+ and NS8593. a. Experimental paradigm used to measure Mg2+ loading. b. TRPM7 current-voltage relations obtained (break-in (t=0) and Imax) in cells incubated in 8 μM, followed by 1.4 mM Mg2+ in the presence of NS8593 or La3+. c. TRPM7 preactivation indices in cells grown in 1.4 mM [Mg2+] with NS8593. d. TRPM7 preactivation index in cells grown in 1.4 mM [Mg2+] with La3+. In c and d 1 μM NS8593 and 3 μM La3+ were used as negative controls since at these concentrations TRPM7 channels are not affected.
Discussion
TRPM7 and the closely related TRPM6 have been reported to participate in both cellular and body homeostasis of Mg2+ as well as other divalent cations like Zn2+ [92]. TRPM7 channels are highly expressed in primary T lymphocytes and lymphocytic cell lines (e.g. [13,79]. We were interested in TRPM7 channel function in intact cells and its role as a divalent metal entry pathway.
The goals of the present study were: 1) to characterize the behavior of TRPM7 channels in Jurkat T cells during growth in the presence of low and high extracellular Mg2+ concentrations 2) to evaluate whether entry of divalent metal cations Mg2+, Zn2+, Cd2+, Co2+, Mn2+, Ni2+, Ba2+, Sr2+ occurs via TRPM7 channels. We used two experimental approaches: patch-clamp recording of endogenous TRPM7 channel activity and cell viability measurements. Additionally, we evaluated metal ion cytotoxicity in HAP1 wildtype and TRPM7 CRISPR knockout cells.
We measured endogenous TRPM7 channel activity in Jurkat T cells grown under varying Mg2+ concentrations and found that the dose-response relationship had an IC50 of 54 μM and Hill coefficient of 0.9. TRPM7 channel activity was quantified by determining the preactivation index (I0/Imax) for each cell, which reflects the fraction of channels open in an intact cell at a given Mg2+ concentration. The external Mg2+ dependence was close to what we previously observed by directly changing [Mg2+] on the cytoplasmic side [13,14]. Thus, intracellular [Mg2+] appeared to be similar to extracellular [Mg2+], since we saw only modestly increased Mg2+ in the cytoplasm due to the negative resting membrane potential. At negative membrane potentials of −55 to −70 mV in Jurkat T cells (CTL and JAK, unpublished observations), increased Mg2+ entry would be expected to shift the dose-response curve leftwards, but this was not observed.
External Mg2+ concentration dependence of TRPM7 channel activity (Fig. 1) closely resembled the dependence of splenic T-cell proliferation on Mg2+ [3] obtained under similar conditions. This suggests that Mg2+ dependence of proliferation may be mediated by a process not too far removed from increased cytoplasmic Mg2+. Possibly, cytoplasmic Mg2+ elevations result in increased screening of PI(4,5)P2 phospholipid negative charges [48,90]. We have reported that Mg2+ dependence of TRPM7 reflects electrostatic screening of this membrane phospholipid [48,90].
The target of Mg2+o during T-cell proliferation is not currently known and it is possible that gradual reduction of TRPM7 current in the cell due to increasing cytoplasmic Mg2+ mediates increased proliferation. The mechanism might be the same as adding Mg2+ and other inhibitory cations internally, namely, PIP2 screening by Mg2+ entering from outside. Another possibility would be a more hyperpolarized membrane potential in T cells with inhibited TRPM7 channels. This would potentiate Ca2+ influx through Orai1 channels. It is well known that Ca2+ is a second messenger required for efficient T-cell proliferation. Several studies have demonstrated that extracellular Mg2+ deficiency can result in reductions in cellular ATP [61,87]. Given that 80–90% of cellular Mg2+ is bound to ATP [71], this would be expected to have profound effects on various enzymes, including TRPM7 kinase. Interestingly, prolonged growth in low Mg2+ increased the maximum current amplitude, which represents the total number of TRPM7 channels in the cell (Fig. 2b,c). This was not accompanied by increased TRPM7 mRNA expression (Fig. 2d). Previously, TRPM7 mRNA expression was reported not to depend on Mg2+ [30]. We also found that viability of Jurkat T cells is supported equally by Ca2+ and Mg2+ (Fig. 6c). The mechanisms of external Mg2+ effect on native T-cell proliferation and survival and channel expression will be addressed in our future studies.
In effect, growing cells in low micromolar [Mg2+] for 1–2 days results in pre-activated TRPM7 current, whereas growing them in elevated Mg2+ (1.4 mM) completely eliminates the current in intact cells (Fig. 1). This raises questions about the interpretation of results obtained under high Mg2+ growth conditions (~10 mM), which would be expected to eliminate TRPM7 currents. Importantly, the majority of divalent metal cation cytotoxicity studies were done in normal culture medium, which would render TRPM7 channels in intact cells largely inactive (see Fig. 1e, f). Our approach was to test the metal cations in low Mg2+ to maximize TRPM7 channel activity (Fig. 5).
Growing Jurkat T cells in Chelex-RPMI containing 400 nM or 8 μM free Mg2+ was sufficient to almost fully activate TRPM7 by depletion of cytoplasmic Mg2+ (Fig. 1). Mg2+ depletion and loading did not depend on external Ca2+ (Figs. 1 and 6). The time course of Mg2+ depletion was slow, reaching a maximum at ~12 hours (Fig. 2). This is significantly slower than the 10–20 minutes required for full depletion in HEK293 cells overexpressing SLC41A1 [44]. The slower depletion rate in Jurkat cells may be due to lower expression levels of endogenous SLC41A1 under our experimental conditions (Fig. 4a). Increased SLC41A1 expression in response to low Mg2+ treatment has been reported [28,56], however, we found a reduction in its mRNA levels in low Mg2+-grown cells (Fig. 4a). We found no change in SLC41A2 expression in response to Mg2+ changes in agreement with [28]. In addition to Mg2+, both SLC41A1 and A2 were reported to transport other divalent metal cations and may have a role in their cellular entry [28,27].
We tested other divalent metals in Chelex-RPMI containing 0.4 mM of metal cation. The goal here was to examine the potency of the metal ions in killing cells. We assumed that only those ions that enter the cells would effectively kill. The sequence of killing potency (Figs. 5, 7) did not match the divalent cation permeability sequence of TRPM7 reported by several studies. Specifically, Cd2+ was the most potent in cell toxicity assays (Figs. 5–7) yet it conducts through TRPM7 rather poorly [60]. Conversely, Ba2+ and Sr2+, which are highly permeant through TRPM7 did not reduce cell viability (Figs. 5, 6). Ni2+ and Co2+, highly permeant through TRPM7, had only moderate killing effect. Mg2+ loading, which would be expected to eliminate TRPM7 current, TRPM7 blockers (La3+, NS8593, FTY720) [86,16,65] and TRPM7 knockout did not rescue cells from killing by Cd2+ (Figs. 5, 7). Moreover, divalent metal toxicity persisted essentially unchanged in no Ca2+ and 40 μM Ca2+, even though Ca2+ would be expected to compete with other divalent cations in the TRPM7 conduction pathway [53] (Fig. 6). In summary, these findings point to the existence of metal entry pathways that are distinct from TRPM7. Our findings are in agreement with [32] who reported that Zn2+, Ni2+ and Cd2+ are toxic to Jurkat T cells.
In C. elegans cells, Ni2+ influx occurs through TRPM channels GON-2 and GTL-1. Toxicity by this ion was greatly reduced under Mg2+ loading conditions ([Mg2+]o = 40 mM) or in animals with inactivating mutations in GON-2 and GTL-1[81]. Interestingly, the authors proposed that even though TRPM7 ortholog GON-2 conducts Mg2+ and other cations better than GTL-1, the feedback Mg2+ inhibition of the former makes it a significant cation entry pathway during acute, rather than continuous perturbations of ionic homeostasis. The relevance of this idea to our study may be that cellular divalent metal ion homeostasis, which we have examined here, is probably set not only by TRPM7 but also by other pathways that are not inhibited by Mg2+i.
One question arising from these findings is: if TPRM7 channels are fully active why do they not provide a more substantial metal cation entry pathway in Jurkat T cells? Even if we assume that Cd2+ enters the cell through a different pathway which conducts this ion better than TRPM7, this cannot explain why Ba2+ and Sr2+ do not enter the cell even at 1.4 mM. It should be noted in this context, that previous studies describing metal cation entry through overexpressed and native TRPM7 employed higher concentrations (10 −100 mM). It is therefore possible that at 0.4 mM or 1.4 mM these cations do not permeate sufficiently to enter the cell in significant quantities. Nevertheless, 0.4 mM Mg2+ (present in normal RPMI) does enter the cell, as evidenced by significantly inhibited TRPM7 currents (Fig. 1). One possibility is that highly permeant divalent ions, while entering initially, quickly inhibit TRPM7 channels from inside and this feedback inhibition limits their further entry. Point mutants of TRPM7 with reduced Mg2+ sensitivity may shed light on this possibility [34,90]. Certainly, various metal cations may enter Jurkat T cells through unrelated pathways. Jurkat T cells do not express TRPM6, making TRPM7 the only Mg2+-inhibited channel. Ion channels present in Jurkat T cells have been extensively studied over the past forty years and the only well documented inward currents are TRPM7 and CRAC. In our experiments using 3 and 400 μM La3+, CRAC currents would be expected to be blocked already at 3 μM [70,4], ruling out this channel as a possible pathway of divalent cation entry (Fig. 7b). Additionally, CRAC currents are not normally active in intact cells, requiring prior Ca2+ store depletion [63,49].
Based on our experiments, several features of the putative divalent metal entry pathway in Jurkat T cells are becoming evident: it is not sensitive to amiloride, La2+ and NS8593 and likely insensitive to external Mg2+ or Ca2+. Further investigations will be required to identify the main divalent cation influx pathway in Jurkat cells.
In regards to the role of TRPM7 as a Mg2+ entry pathways in Jurkat T cells, we found that NS8593, for the most part prevented Mg2+ loading at a concentration sufficient to block TRPM7 (Fig. 9). Surprisingly, La3+, which only blocks the inward component of TRPM7 current (Suppl. Fig. 1d) was ineffective (Fig. 9). It is thought that the inward current detected in patch clamp experiments reflects divalent cation entry through TRPM7 and TRPM6 [60,82,43]. Our results suggest that both inward and outward currents through TRPM7 channels are required for cellular Mg2+ loading. A less likely explanation is that NS8593 at 20 μM can inhibit unrelated (and unknown) Mg2+ entry pathways. Interestingly, some cells could be loaded with Mg2+ even in the presence of NS8593, which indicates that an alternative Mg2+ influx pathway is functional in these cells (Fig. 9c). Future experiments will address the nature of differences between La3+ and NS8593 effects on Mg2+ loading.
Supplementary Material
Suppl Fig. 1. Sensitivity of TRPM7 channels to blockers and inhibitors. Effects of metal chelators and imipramine on Jurkat cell viability. a. Inhibition of preactivated TRPM7 current by internal 900 μM spermine in a Jurkat T cell incubated in 8 μM Mg2+ for 1 day. b. Effects of varying concentrations of HEDTA and EDTA on cell viability. Cells were incubated for 24 hrs in Chelex-treated RPMI supplemented with the indicated concentrations of HEDTA and EDTA or 0.4 mM Mg2+/0.42 mM Ca2+ (control). Statistical significance was determined from Student’s two sample t tests. c. Viability assays performed on Jurkat T cells grown for 24 hrs in the presence of 20 or 200 μM imipramine in normal RPMI. Asterisks show statistically significant difference from control cells grown without imipramine (black bar) (p<0.05, Student’s t test). d. Blockade by La3+ was tested on murine TRPM7 heterologously expressed in HEK293 cells. TRPM7 current-voltage relations were obtained before application (black), in the presence (red) and after washout (blue) of 400 μM LaCl3. −120 to 85 mV voltage ramps were applied to magnify the inward component of current through TRPM7 channels. In the inset, the voltage range has been truncated at +25 mV. e–h. Time courses of current development in Jurkat T cells grown in normal RPMI. Recordings were made in the absence of external Mg2+. The current amplitudes were collected at +83.47 mV (e, f) and −100 mV (g, h). e and g show a recording from an untreated cell and f and h a recording in the presence of 20 μM NS8593 in the bath, which prevented the development of TRPM7 current (f). The CRAC current, measured at −100 mV, was not affected (g, h). i, j. Effects of acutely applied 3 μM FTY720 and 10 μM FTY720 phosphate and washout (indicated by horizontal bars) on TRPM7 outward current magnitude. Recordings in a, d, i, j were obtained in the presence of external 30 μM Mg2+.
Acknowledgements
We thank Courtney Sulentic for the use of Vi-CELL analyzer, Dan Halm for useful discussions, Kalina Szteyn for assistance with buffer preparation and Mike Bottomley (Statistical Consulting Center, WSU) for help with statistical analysis. This work was funded by 1R01AI114804 from the National Institute of Allergy and Infectious Diseases (to J.A.K.).
Abbreviations
- TRPM7
transient receptor potential melastatin 7
- [Mg2+]o
external magnesium concentration
- [Mg2+]i
internal magnesium concentration
- CRAC
calcium release-activated calcium
- SLC41A1
2 solute carrier family 41, members 1, 2
Footnotes
Publisher's Disclaimer: This Author Accepted Manuscript is a PDF file of a an unedited peer-reviewed manuscript that has been accepted for publication but has not been copyedited or corrected. The official version of record that is published in the journal is kept up to date and so may therefore differ from this version.
References
- 1.Abiria SA, Krapivinsky G, Sah R, Santa-Cruz AG, Chaudhuri D, Zhang J, Adstamongkonkul P, DeCaen PG, Clapham DE (2017) TRPM7 senses oxidative stress to release Zn2+ from unique intracellular vesicles. Proc Natl Acad Sci U S A 114:E6079–E6088. doi: 10.1073/pnas.1707380114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ardestani G, Mehregan A, Fleig A, Horgen FD, Carvacho I, Fissore RA (2020) Divalent cation influx and calcium homeostasis in germinal vesicle mouse oocytes. Cell Calcium 87:102181. doi: 10.1016/j.ceca.2020.102181 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Beesetty P, Wieczerzak KB, Gibson JN, Kaitsuka T, Luu CT, Matsushita M, Kozak JA (2018) Inactivation of TRPM7 kinase in mice results in enlarged spleens, reduced T-cell proliferation and diminished store-operated calcium entry. Sci Rep 8:3023. doi: 10.1038/s41598-018-21004-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bird GS, Putney JW (2017) Pharmacology of store-operated calcium entry channels In: Kozak JA, Putney JW (eds) Calcium entry channels in non-excitable cells. Methods in Signal Transduction. CRC Press, Taylor & Francis, Boca Raton, pp 311–324 [Google Scholar]
- 5.Blanchard MG, Kittikulsuth W, Nair AV, de Baaij JH, Latta F, Genzen JR, Kohan DE, Bindels RJ, Hoenderop JG (2016) Regulation of Mg2+ reabsorption and Transient Receptor Potential Melastatin Type 6 activity by cAMP signaling. J Am Soc Nephrol 27:804–813. doi: 10.1681/ASN.2014121228 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Blommaert E, Peanne R, Cherepanova NA, Rymen D, Staels F, Jaeken J, Race V, Keldermans L, Souche E, Corveleyn A, Sparkes R, Bhattacharya K, Devalck C, Schrijvers R, Foulquier F, Gilmore R, Matthijs G (2019) Mutations in MAGT1 lead to a glycosylation disorder with a variable phenotype. Proc Natl Acad Sci U S A 116:9865–9870. doi: 10.1073/pnas.1817815116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bork U, Lee WK, Kuchler A, Dittmar T, Thevenod F (2010) Cadmium-induced DNA damage triggers G(2)/M arrest via chk1/2 and cdc2 in p53-deficient kidney proximal tubule cells. Am J Physiol Renal Physiol 298:F255–265. doi: 10.1152/ajprenal.00273.2009 [DOI] [PubMed] [Google Scholar]
- 8.Brandao K, Deason-Towne F, Perraud AL, Schmitz C (2013) The role of Mg2+ in immune cells. Immunol Res 55:261–269. doi: 10.1007/s12026-012-8371-x [DOI] [PubMed] [Google Scholar]
- 9.Cabezas-Bratesco D, Brauchi S, Gonzalez-Teuber V, Steinberg X, Valencia I, Colenso C (2015) The different roles of the channel-kinases TRPM6 and TRPM7. Curr Med Chem 22:2943–2953 [DOI] [PubMed] [Google Scholar]
- 10.Caicedo M, Jacobs JJ, Reddy A, Hallab NJ (2008) Analysis of metal ion-induced DNA damage, apoptosis, and necrosis in human (Jurkat) T-cells demonstrates Ni2+ and V3+ are more toxic than other metals: Al3+, Be2+, Co2+, Cr3+, Cu2+, Fe3+, Mo5+, Nb5+, Zr2+. J Biomed Mater Res A 86:905–913. doi: 10.1002/jbm.a.31789 [DOI] [PubMed] [Google Scholar]
- 11.Carpentieri U, Myers J, Daeschner CW 3rd, Haggard ME (1987) Observations on the use of a cation exchange resin for the preparation of metal-depleted media for lymphocyte culture. J Biochem Biophys Methods 14:93–100. doi: 10.1016/0165-022x(87)90044-3 [DOI] [PubMed] [Google Scholar]
- 12.Carpentieri U, Myers J, Daeschner CW 3rd, Haggard ME (1988) Effects of iron, copper, zinc, calcium, and magnesium on human lymphocytes in culture. Biol Trace Elem Res 16:165–176. doi: 10.1007/BF02797101 [DOI] [PubMed] [Google Scholar]
- 13.Chokshi R, Matsushita M, Kozak JA (2012) Detailed examination of Mg2+ and pH sensitivity of human TRPM7 channels. Am J Physiol Cell Physiol 302:C1004–1011. doi: 10.1152/ajpcell.00422.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chokshi R, Matsushita M, Kozak JA (2012) Sensitivity of TRPM7 channels to Mg2+ characterized in cell-free patches of Jurkat T lymphocytes. Am J Physiol Cell Physiol 302:C1642–1651. doi: 10.1152/ajpcell.00037.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Chubanov V, Ferioli S, Wisnowsky A, Simmons DG, Leitzinger C, Einer C, Jonas W, Shymkiv Y, Bartsch H, Braun A, Akdogan B, Mittermeier L, Sytik L, Torben F, Jurinovic V, van der Vorst EP, Weber C, Yildirim OA, Sotlar K, Schurmann A, Zierler S, Zischka H, Ryazanov AG, Gudermann T (2016) Epithelial magnesium transport by TRPM6 is essential for prenatal development and adult survival. Elife 5. doi: 10.7554/eLife.20914 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chubanov V, Mederos y Schnitzler M, Meissner M, Schafer S, Abstiens K, Hofmann T, Gudermann T (2012) Natural and synthetic modulators of SK (K(ca)2) potassium channels inhibit magnesium-dependent activity of the kinase-coupled cation channel TRPM7. Br J Pharmacol 166:1357–1376. doi: 10.1111/j.1476-5381.2012.01855.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Chubanov V, Mittermeier L, Gudermann T (2018) Role of kinase-coupled TRP channels in mineral homeostasis. Pharmacol Ther 184:159–176. doi: 10.1016/j.pharmthera.2017.11.003 [DOI] [PubMed] [Google Scholar]
- 18.Chubanov V, Waldegger S, Mederos y Schnitzler M, Vitzthum H, Sassen MC, Seyberth HW, Konrad M, Gudermann T (2004) Disruption of TRPM6/TRPM7 complex formation by a mutation in the TRPM6 gene causes hypomagnesemia with secondary hypocalcemia. Proc Natl Acad Sci U S A 101:2894–2899 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Deason-Towne F, Perraud AL, Schmitz C (2011) The Mg2+ transporter MagT1 partially rescues cell growth and Mg2+ uptake in cells lacking the channel-kinase TRPM7. FEBS Lett 585:2275–2278. doi: 10.1016/j.febslet.2011.05.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Desai R, Peretz A, Idelson H, Lazarovici P, Attali B (2000) Ca2+-activated K+ channels in human leukemic Jurkat T cells. Molecular cloning, biochemical and functional characterization. J Biol Chem 275:39954–39963. doi: 10.1074/jbc.M001562200 [DOI] [PubMed] [Google Scholar]
- 21.Duan J, Li Z, Li J, Hulse RE, Santa-Cruz A, Valinsky WC, Abiria SA, Krapivinsky G, Zhang J, Clapham DE (2018) Structure of the mammalian TRPM7, a magnesium channel required during embryonic development. Proc Natl Acad Sci U S A 115:E8201–E8210. doi: 10.1073/pnas.1810719115 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Essletzbichler P, Konopka T, Santoro F, Chen D, Gapp BV, Kralovics R, Brummelkamp TR, Nijman SM, Burckstummer T (2014) Megabase-scale deletion using CRISPR/Cas9 to generate a fully haploid human cell line. Genome Res 24:2059–2065. doi: 10.1101/gr.177220.114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Faouzi M, Kilch T, Horgen FD, Fleig A, Penner R (2017) The TRPM7 channel kinase regulates store-operated calcium entry. J Physiol 595:3165–3180. doi: 10.1113/JP274006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Fleig A, Chubanov V (2014) Trpm7. Handb Exp Pharmacol 222:521–546. doi: 10.1007/978-3-642-54215-2_21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gibson JN, Beesetty P, Sulentic C, Kozak JA (2016) Rapid quantification of mitogen-induced blastogenesis in T lymphocytes for identifying immunomodulatory drugs. J Vis Exp. doi: 10.3791/55212 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Gotru SK, Chen W, Kraft P, Becker IC, Wolf K, Stritt S, Zierler S, Hermanns HM, Rao D, Perraud AL, Schmitz C, Zahedi RP, Noy PJ, Tomlinson MG, Dandekar T, Matsushita M, Chubanov V, Gudermann T, Stoll G, Nieswandt B, Braun A (2018) TRPM7 kinase controls calcium responses in arterial thrombosis and stroke in mice. Arterioscler Thromb Vasc Biol 38:344–352. doi: 10.1161/ATVBAHA.117.310391 [DOI] [PubMed] [Google Scholar]
- 27.Goytain A, Quamme GA (2005) Functional characterization of human SLC41A1, a Mg2+ transporter with similarity to prokaryotic MgtE Mg2+ transporters. Physiol Genomics 21:337–342. doi: 10.1152/physiolgenomics.00261.2004 [DOI] [PubMed] [Google Scholar]
- 28.Goytain A, Quamme GA (2005) Functional characterization of the mouse [corrected] solute carrier, SLC41A2. Biochem Biophys Res Commun 330:701–705. doi: 10.1016/j.bbrc.2005.03.037 [DOI] [PubMed] [Google Scholar]
- 29.Granchi D, Ciapetti G, Savarino L, Cavedagna D, Donati ME, Pizzoferrato A (1996) Assessment of metal extract toxicity on human lymphocytes cultured in vitro. J Biomed Mater Res 31:183–191. doi: [DOI] [PubMed] [Google Scholar]
- 30.Groenestege WM, Hoenderop JG, van den Heuvel L, Knoers N, Bindels RJ (2006) The epithelial Mg2+ channel transient receptor potential melastatin 6 is regulated by dietary Mg2+ content and estrogens. J Am Soc Nephrol 17:1035–1043. doi: 10.1681/ASN.2005070700 [DOI] [PubMed] [Google Scholar]
- 31.Gunther T, Vormann J (1995) Reversibility of Na+/Mg2+ antiport in rat erythrocytes. Biochim Biophys Acta 1234:105–110 [DOI] [PubMed] [Google Scholar]
- 32.Haase H, Hebel S, Engelhardt G, Rink L (2015) The biochemical effects of extracellular Zn(2+) and other metal ions are severely affected by their speciation in cell culture media. Metallomics 7:102–111. doi: 10.1039/c4mt00206g [DOI] [PubMed] [Google Scholar]
- 33.Hanano T, Hara Y, Shi J, Morita H, Umebayashi C, Mori E, Sumimoto H, Ito Y, Mori Y, Inoue R (2004) Involvement of TRPM7 in cell growth as a spontaneously activated Ca2+ entry pathway in human retinoblastoma cells. J Pharmacol Sci 95:403–419 [DOI] [PubMed] [Google Scholar]
- 34.Hofmann T, Schafer S, Linseisen M, Sytik L, Gudermann T, Chubanov V (2014) Activation of TRPM7 channels by small molecules under physiological conditions. Pflugers Arch. doi: 10.1007/s00424-014-1488-0 [DOI] [PubMed] [Google Scholar]
- 35.Hurd TW, Otto EA, Mishima E, Gee HY, Inoue H, Inazu M, Yamada H, Halbritter J, Seki G, Konishi M, Zhou W, Yamane T, Murakami S, Caridi G, Ghiggeri G, Abe T, Hildebrandt F (2013) Mutation of the Mg2+ transporter SLC41A1 results in a nephronophthisis-like phenotype. J Am Soc Nephrol 24:967–977. doi: 10.1681/ASN.2012101034 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Inoue K, Branigan D, Xiong ZG (2010) Zinc-induced neurotoxicity mediated by transient receptor potential melastatin 7 channels. J Biol Chem 285:7430–7439 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Jager H, Adelman JP, Grissmer S (2000) SK2 encodes the apamin-sensitive Ca(2+)-activated K(+) channels in the human leukemic T cell line, Jurkat. FEBS Lett 469:196–202 [DOI] [PubMed] [Google Scholar]
- 38.Jiang J, Li M, Yue L (2005) Potentiation of TRPM7 inward currents by protons. J Gen Physiol 126:137–150 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Jin J, Desai BN, Navarro B, Donovan A, Andrews NC, Clapham DE (2008) Deletion of Trpm7 disrupts embryonic development and thymopoiesis without altering Mg2+ homeostasis. Science 322:756–760 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Kaitsuka T, Katagiri C, Beesetty P, Nakamura K, Hourani S, Tomizawa K, Kozak JA, Matsushita M (2014) Inactivation of TRPM7 kinase activity does not impair its channel function in mice. Sci Rep 4:5718. doi: 10.1038/srep05718 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Karlsson H, Gu Y, DePierre J, Nassberger L (1998) Induction of apoptosis in proliferating lymphocytes by tricyclic antidepressants. Apoptosis 3:255–260. doi: 10.1023/a:1009609224936 [DOI] [PubMed] [Google Scholar]
- 42.Kerschbaum HH, Kozak JA, Cahalan MD (2003) Polyvalent cations as permeant probes of MIC and TRPM7 pores. Biophys J 84:2293–2305. doi: 10.1016/S0006-3495(03)75035-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Kolisek M, Launay P, Beck A, Sponder G, Serafini N, Brenkus M, Froschauer EM, Martens H, Fleig A, Schweigel M (2008) SLC41A1 is a novel mammalian Mg2+ carrier. J Biol Chem 283:16235–16247. doi: 10.1074/jbc.M707276200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Kolisek M, Nestler A, Vormann J, Schweigel-Rontgen M (2012) Human gene SLC41A1 encodes for the Na+/Mg(2)+ exchanger. Am J Physiol Cell Physiol 302:C318–326. doi: 10.1152/ajpcell.00289.2011 [DOI] [PubMed] [Google Scholar]
- 45.Komiya Y, Runnels LW (2015) TRPM channels and magnesium in early embryonic development. Int J Dev Biol 59:281–288. doi: 10.1387/ijdb.150196lr [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Kozak JA, Cahalan MD (2003) MIC channels are inhibited by internal divalent cations but not ATP. Biophys J 84:922–927. doi: 10.1016/S0006-3495(03)74909-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Kozak JA, Kerschbaum HH, Cahalan MD (2002) Distinct properties of CRAC and MIC channels in RBL cells. J Gen Physiol 120:221–235 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Kozak JA, Matsushita M, Nairn AC, Cahalan MD (2005) Charge screening by internal pH and polyvalent cations as a mechanism for activation, inhibition, and rundown of TRPM7/MIC channels. J Gen Physiol 126:499–514 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Kozak JA, Rychkov G (2017) Electrophysiological methods for recording CRAC and TRPV5/6 channels In: Kozak JA, Putney JW (eds) Calcium entry channels in non-excitable cells. Methods in Signal Transduction edn. CRC Press, Taylor & Francis, Boca Raton, pp 1–24 [Google Scholar]
- 50.Leng T, Lin S, Xiong Z, Lin J (2017) Lidocaine suppresses glioma cell proliferation by inhibiting TRPM7 channels. Int J Physiol Pathophysiol Pharmacol 9:8–15 [PMC free article] [PubMed] [Google Scholar]
- 51.Li FY, Chaigne-Delalande B, Su H, Uzel G, Matthews H, Lenardo MJ (2014) XMEN disease: a new primary immunodeficiency affecting Mg2+ regulation of immunity against Epstein-Barr virus. Blood 123:2148–2152. doi: 10.1182/blood-2013-11-538686 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Li FY, Lenardo MJ, Chaigne-Delalande B (2011) Loss of MAGT1 abrogates the Mg2+ flux required for T cell signaling and leads to a novel human primary immunodeficiency. Magnes Res 24:S109–114. doi: 10.1684/mrh.2011.0286 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Li M, Du J, Jiang J, Ratzan W, Su LT, Runnels LW, Yue L (2007) Molecular determinants of Mg2+ and Ca2+ permeability and pH sensitivity in TRPM6 and TRPM7. J Biol Chem 282:25817–25830 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Luongo F, Pietropaolo G, Gautier M, Dhennin-Duthille I, Ouadid-Ahidouch H, Wolf FI, Trapani V (2018) TRPM6 is essential for magnesium uptake and epithelial cell function in the colon. Nutrients 10. doi: 10.3390/nu10060784 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Macianskiene R, Martisiene I, Zablockaite D, Gendviliene V (2012) Characterization of Mg(2)(+)-regulated TRPM7-like current in human atrial myocytes. J Biomed Sci 19:75. doi: 10.1186/1423-0127-19-75 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Mandt T, Song Y, Scharenberg AM, Sahni J (2011) SLC41A1 Mg(2+) transport is regulated via Mg(2+)-dependent endosomal recycling through its N-terminal cytoplasmic domain. Biochem J 439:129–139. doi: 10.1042/BJ20110807 [DOI] [PubMed] [Google Scholar]
- 57.Martineau C, Abed E, Medina G, Jomphe LA, Mantha M, Jumarie C, Moreau R (2010) Involvement of transient receptor potential melastatin-related 7 (TRPM7) channels in cadmium uptake and cytotoxicity in MC3T3-E1 osteoblasts. Toxicol Lett 199:357–363. doi: 10.1016/j.toxlet.2010.09.019 [DOI] [PubMed] [Google Scholar]
- 58.Matsushita M, Kozak JA, Shimizu Y, McLachlin DT, Yamaguchi H, Wei FY, Tomizawa K, Matsui H, Chait BT, Cahalan MD, Nairn AC (2005) Channel function is dissociated from the intrinsic kinase activity and autophosphorylation of TRPM7/ChaK1. J Biol Chem 280:20793–20803 [DOI] [PubMed] [Google Scholar]
- 59.Mittermeier L, Demirkhanyan L, Stadlbauer B, Breit A, Recordati C, Hilgendorff A, Matsushita M, Braun A, Simmons DG, Zakharian E, Gudermann T, Chubanov V (2019) TRPM7 is the central gatekeeper of intestinal mineral absorption essential for postnatal survival. Proc Natl Acad Sci U S A. doi: 10.1073/pnas.1810633116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Monteilh-Zoller MK, Hermosura MC, Nadler MJ, Scharenberg AM, Penner R, Fleig A (2003) TRPM7 provides an ion channel mechanism for cellular entry of trace metal ions. J Gen Physiol 121:49–60 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Nagai N, Fukuhata T, Ito Y (2007) Effect of magnesium deficiency on intracellular ATP levels in human lens epithelial cells. Biol Pharm Bull 30:6–10. doi: 10.1248/bpb.30.6 [DOI] [PubMed] [Google Scholar]
- 62.Numata T, Okada Y (2008) Molecular determinants of sensitivity and conductivity of human TRPM7 to Mg2+ and Ca2+. Channels (Austin) 2:283–286 [DOI] [PubMed] [Google Scholar]
- 63.Parekh AB, Penner R (1997) Store depletion and calcium influx. Physiol Rev 77:901–930 [DOI] [PubMed] [Google Scholar]
- 64.Prakriya M, Lewis RS (2002) Separation and characterization of currents through store-operated CRAC channels and Mg(2+)-inhibited cation (MIC) channels. J Gen Physiol 119:487–507 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Qin X, Yue Z, Sun B, Yang W, Xie J, Ni E, Feng Y, Mahmood R, Zhang Y, Yue L (2013) Sphingosine and FTY720 are potent inhibitors of the transient receptor potential melastatin 7 (TRPM7) channels. Br J Pharmacol 168:1294–1312. doi: 10.1111/bph.12012 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Raymond FA, Weinshilboum RM (1975) Microassay of human erythrocyte catechol-O-methyltransferase: removal of inhibitory calcium ion with chelating resin. Clin Chim Acta 58:185–194. doi: 10.1016/s0009-8981(75)80012-x [DOI] [PubMed] [Google Scholar]
- 67.Romagnani A, Vettore V, Rezzonico-Jost T, Hampe S, Rottoli E, Nadolni W, Perotti M, Meier MA, Hermanns C, Geiger S, Wennemuth G, Recordati C, Matsushita M, Muehlich S, Proietti M, Chubanov V, Gudermann T, Grassi F, Zierler S (2017) TRPM7 kinase activity is essential for T cell colonization and alloreactivity in the gut. Nat Commun 8:1917. doi: 10.1038/s41467-017-01960-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Romani AM (2011) Cellular magnesium homeostasis. Arch Biochem Biophys 512:1–23 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Rommelt C, Munsch T, Drynda A, Lessmann V, Lohmann CH, Bertrand J (2018) Periprosthetic hypoxia as consequence of TRPM7 mediated cobalt influx in osteoblasts. J Biomed Mater Res B Appl Biomater. doi: 10.1002/jbm.b.34273 [DOI] [PubMed] [Google Scholar]
- 70.Ross PE, Cahalan MD (1995) Ca2+ influx pathways mediated by swelling or stores depletion in mouse thymocytes. J Gen Physiol 106:415–444. doi: 10.1085/jgp.106.3.415 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Rude RK (1998) Magnesium deficiency: a cause of heterogeneous disease in humans. J Bone Miner Res 13:749–758. doi: 10.1359/jbmr.1998.13.4.749 [DOI] [PubMed] [Google Scholar]
- 72.Runnels LW, Yue L, Clapham DE (2002) The TRPM7 channel is inactivated by PIP(2) hydrolysis. Nat Cell Biol 4:329–336 [DOI] [PubMed] [Google Scholar]
- 73.Ryazanova LV, Dorovkov MV, Ansari A, Ryazanov AG (2004) Characterization of the protein kinase activity of TRPM7/ChaK1, a protein kinase fused to the Transient Receptor Potential ion channel. J Biol Chem 279:3708–3716 [DOI] [PubMed] [Google Scholar]
- 74.Sahni J, Nelson B, Scharenberg AM (2007) SLC41A2 encodes a plasma-membrane Mg2+ transporter. Biochem J 401:505–513. doi: 10.1042/BJ20060673 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Schlingmann KP, Waldegger S, Konrad M, Chubanov V, Gudermann T (2007) TRPM6 and TRPM7--Gatekeepers of human magnesium metabolism. Biochim Biophys Acta 1772:813–821. doi: 10.1016/j.bbadis.2007.03.009 [DOI] [PubMed] [Google Scholar]
- 76.Schmitz C, Perraud AL, Johnson CO, Inabe K, Smith MK, Penner R, Kurosaki T, Fleig A, Scharenberg AM (2003) Regulation of vertebrate cellular Mg2+ homeostasis by TRPM7. Cell 114:191–200 [DOI] [PubMed] [Google Scholar]
- 77.Stritt S, Nurden P, Favier R, Favier M, Ferioli S, Gotru SK, van Eeuwijk JM, Schulze H, Nurden AT, Lambert MP, Turro E, Burger-Stritt S, Matsushita M, Mittermeier L, Ballerini P, Zierler S, Laffan MA, Chubanov V, Gudermann T, Nieswandt B, Braun A (2016) Defects in TRPM7 channel function deregulate thrombopoiesis through altered cellular Mg(2+) homeostasis and cytoskeletal architecture. Nat Commun 7:11097. doi: 10.1038/ncomms11097 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Strobaek D, Hougaard C, Johansen TH, Sorensen US, Nielsen EO, Nielsen KS, Taylor RD, Pedarzani P, Christophersen P (2006) Inhibitory gating modulation of small conductance Ca2+-activated K+ channels by the synthetic compound (R)-N-(benzimidazol-2-yl)-1,2,3,4-tetrahydro-1-naphtylamine (NS8593) reduces afterhyperpolarizing current in hippocampal CA1 neurons. Mol Pharmacol 70:1771–1782. doi: 10.1124/mol.106.027110 [DOI] [PubMed] [Google Scholar]
- 79.Takahashi K, Umebayashi C, Numata T, Honda A, Ichikawa J, Hu Y, Yamaura K, Inoue R (2018) TRPM7-mediated spontaneous Ca(2+) entry regulates the proliferation and differentiation of human leukemia cell line K562. Physiol Rep 6:e13796. doi: 10.14814/phy2.13796 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Tashiro M, Tursun P, Konishi M (2005) Intracellular and extracellular concentrations of Na+ modulate Mg2+ transport in rat ventricular myocytes. Biophys J 89:3235–3247 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Teramoto T, Lambie EJ, Iwasaki K (2005) Differential regulation of TRPM channels governs electrolyte homeostasis in the C. elegans intestine. Cell Metab 1:343–354 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Topala CN, Groenestege WT, Thebault S, van den Berg D, Nilius B, Hoenderop JG, Bindels RJ (2007) Molecular determinants of permeation through the cation channel TRPM6. Cell Calcium 41:513–523 [DOI] [PubMed] [Google Scholar]
- 83.Voets T, Nilius B, Hoefs S, van der Kemp AW, Droogmans G, Bindels RJ, Hoenderop JG (2004) TRPM6 forms the Mg2+ influx channel involved in intestinal and renal Mg2+ absorption. J Biol Chem 279:19–25 [DOI] [PubMed] [Google Scholar]
- 84.Wabakken T, Rian E, Kveine M, Aasheim HC (2003) The human solute carrier SLC41A1 belongs to a novel eukaryotic subfamily with homology to prokaryotic MgtE Mg2+ transporters. Biochem Biophys Res Commun 306:718–724. doi: 10.1016/s0006291x(03)01030-1 [DOI] [PubMed] [Google Scholar]
- 85.Wolf FI, Trapani V (2011) MagT1: a highly specific magnesium channel with important roles beyond cellular magnesium homeostasis. Magnes Res 24:S86–91. doi: 10.1684/mrh.2011.0288 [DOI] [PubMed] [Google Scholar]
- 86.Wykes RC, Lee M, Duffy SM, Yang W, Seward EP, Bradding P (2007) Functional transient receptor potential melastatin 7 channels are critical for human mast cell survival. J Immunol 179:4045–4052. doi: 10.4049/jimmunol.179.6.4045 [DOI] [PubMed] [Google Scholar]
- 87.Yamanaka R, Tabata S, Shindo Y, Hotta K, Suzuki K, Soga T, Oka K (2016) Mitochondrial Mg(2+) homeostasis decides cellular energy metabolism and vulnerability to stress. Sci Rep 6:30027. doi: 10.1038/srep30027 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Yarotskyy V, Elmslie KS (2009) omega-conotoxin GVIA alters gating charge movement of N-type (CaV2.2) calcium channels. J Neurophysiol 101:332–340. doi: 10.1152/jn.91064.2008 [DOI] [PubMed] [Google Scholar]
- 89.Zarei MH, Hosseini Shirazi SF, Aghvami M, Salimi A, Pourahmad J (2018) Analysis of cytotoxic effects of nickel on human blood lymphocytes. Toxicol Mech Methods 28:79–86. doi: 10.1080/15376516.2017.1364314 [DOI] [PubMed] [Google Scholar]
- 90.Zhelay T, Wieczerzak KB, Beesetty P, Alter GM, Matsushita M, Kozak JA (2018) Depletion of plasma membrane-associated phosphoinositides mimics inhibition of TRPM7 channels by cytosolic Mg(2+), spermine, and pH. J Biol Chem 293:18151–18167. doi: 10.1074/jbc.RA118.004066 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Zhou H, Clapham DE (2009) Mammalian MagT1 and TUSC3 are required for cellular magnesium uptake and vertebrate embryonic development. Proc Natl Acad Sci U S A 106:15750–15755. doi: 10.1073/pnas.0908332106 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Zou ZG, Rios FJ, Montezano AC, Touyz RM (2019) TRPM7, magnesium, and signaling. Int J Mol Sci 20. doi: 10.3390/ijms20081877 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Suppl Fig. 1. Sensitivity of TRPM7 channels to blockers and inhibitors. Effects of metal chelators and imipramine on Jurkat cell viability. a. Inhibition of preactivated TRPM7 current by internal 900 μM spermine in a Jurkat T cell incubated in 8 μM Mg2+ for 1 day. b. Effects of varying concentrations of HEDTA and EDTA on cell viability. Cells were incubated for 24 hrs in Chelex-treated RPMI supplemented with the indicated concentrations of HEDTA and EDTA or 0.4 mM Mg2+/0.42 mM Ca2+ (control). Statistical significance was determined from Student’s two sample t tests. c. Viability assays performed on Jurkat T cells grown for 24 hrs in the presence of 20 or 200 μM imipramine in normal RPMI. Asterisks show statistically significant difference from control cells grown without imipramine (black bar) (p<0.05, Student’s t test). d. Blockade by La3+ was tested on murine TRPM7 heterologously expressed in HEK293 cells. TRPM7 current-voltage relations were obtained before application (black), in the presence (red) and after washout (blue) of 400 μM LaCl3. −120 to 85 mV voltage ramps were applied to magnify the inward component of current through TRPM7 channels. In the inset, the voltage range has been truncated at +25 mV. e–h. Time courses of current development in Jurkat T cells grown in normal RPMI. Recordings were made in the absence of external Mg2+. The current amplitudes were collected at +83.47 mV (e, f) and −100 mV (g, h). e and g show a recording from an untreated cell and f and h a recording in the presence of 20 μM NS8593 in the bath, which prevented the development of TRPM7 current (f). The CRAC current, measured at −100 mV, was not affected (g, h). i, j. Effects of acutely applied 3 μM FTY720 and 10 μM FTY720 phosphate and washout (indicated by horizontal bars) on TRPM7 outward current magnitude. Recordings in a, d, i, j were obtained in the presence of external 30 μM Mg2+.









