Abstract
PCNA sliding clamp binds factors through which histone deposition, chromatin remodeling, and DNA repair are coupled to DNA replication. PCNA also directly binds Eco1/Ctf7 acetyltransferase, which in turn activates cohesins and establishes cohesion between nascent sister chromatids. While increased recruitment thus explains the mechanism through which elevated levels of chromatin-bound PCNA rescue eco1 mutant cell growth, the mechanism through which PCNA instead worsens cohesin mutant cell growth remains unknown. Possibilities include that elevated levels of long-lived chromatin-bound PCNA reduce either cohesin deposition onto DNA or cohesin acetylation. Instead, our results reveal that PCNA increases the levels of both chromatin-bound cohesin and cohesin acetylation. Beyond sister chromatid cohesion, PCNA also plays a critical role in genomic stability such that high levels of chromatin-bound PCNA elevate genotoxic sensitivities and recombination rates. At a relatively modest increase of chromatin-bound PCNA, however, fork stability and progression appear normal in wildtype cells. Our results reveal that even a moderate increase of PCNA indeed sensitizes cohesin mutant cells to DNA damaging agents and in a process that involves the DNA damage response kinase Mec1(ATR), but not Tel1(ATM). These and other findings suggest that PCNA mis-regulation results in genome instabilities that normally are resolved by cohesin. Elevating levels of chromatin-bound PCNA may thus help target cohesinopathic cells linked that are linked to cancer.
Introduction
During S phase, the cellular genome duplicates and each sister chromatid becomes tethered together to ensure proper inheritance of the genome during mitosis. Sister chromatid tethering is maintained by cohesin, a complex comprised of Smc1, Smc3, and Mcd1/Scc1/RAD21 along with auxiliary subunits Pds5, Scc3/Irr1, Rad61/WAPL and, in vertebrate cells, Sororin [1–7]. Cohesin deposition onto DNA requires the cohesin loader, comprised of Scc2 and Scc4, which functions through a large part of the cell cycle but is essential during S phase for cohesins to participate in sister chromatin tethering [8, 9]. Deposition onto chromatin, however, is not sufficient for cohesion. Eco1/Ctf7 (herein Eco1) is an acetyltransferase that converts chromatin-bound cohesins, through acetylation of Smc3 cohesin subunit, to a tethering competent state [3, 10–13]. Early studies coupled this process of cohesion establishment to the DNA replication factor PCNA [10]. PCNA directly binds and recruits Eco1 to the DNA replication fork [14–16], suggesting that establishment is coordinated with numerous processes (histone deposition, chromatin remodeling, DNA repair and translesion synthesis) directed by PCNA and regulated through PCNA post-translational modifications [17–20]. Elevated recruitment to the DNA replication fork thus provides a plausible explanation for PCNA-dependent suppression of eco1 mutant cell growth defects [10, 15]. In support of this model, genetic fusing of ECO1 and POL30 (PCNA) restores cohesion defects otherwise present in eco1 PIP box mutants [21]. The repertoire of DNA replication factors (Chl1, Ctf4, Ctf18, MCM2-7, for example) implicated in cohesion establishment regulation has grown substantially [15, 22–36], highlighting the fundamental and highly conserved nature through which cohesion establishment is obligatorily coordinated with DNA replication.
Further complicating the relationship between PCNA, Eco1 and cohesins are the additional roles played beyond sister chromatid tethering [1, 5, 10, 21, 37–48]. For instance, cohesin functions in both DNA replication restart during S phase and high fidelity DNA repair after S phase [49–51]. Cohesin is recruited to stalled DNA replication forks during S phase, as well as to rDNA and telomeric regions that experience prescribed pauses during replication [52–54]. Cohesin is similarly recruited to sites of DNA damage to promote high fidelity repair by ensuring proximity to the undamaged sister template [50, 55, 56]. Intriguingly, once recruited to stalled replication forks and sites of DNA damage, cohesin must ultimately dissociate from DNA to promote replication fork restart [57]. Thus, cohesin and PCNA appear to play highly coordinated roles in DNA metabolism.
PCNA impact on cohesin complexes, however, is quite complex. Deletion of the PCNA-dissociation factor ELG1 (elg1Δ), or simply overexpression of PCNA (PCNAOE), result in long-lived retention and increased levels of chromatin-bound PCNA which in turn rescues eco1 and pds5 mutant cell cohesion defects and viability [10, 15, 32–34, 58–63]. Conversely, elg1Δ and PCNAOE each exacerbate the growth defects exhibited by cohesin (mcd1, smc1 and smc3) mutant cells [15, 32, 33, 35]. The mechanism through which elevated levels of chromatin-bound PCNA antagonize cohesin mutant cell growth remains unknown, highlighting a critical deficit in current descriptions of cohesin regulation. In this current study, we confirm the adverse impact that PCNAOE exerts on cohesin mutant strains, even while having no overt adverse effect in wildtype cells. We then test multiple mechanisms through which the long-lived retention, and increased levels, of chromatin-bound PCNA exacerbates cohesin mutant cells: models that include competition for DNA access, changes in cohesin acetylation states, and increased sensitivity to genotoxic agents.
Materials and methods
Yeast strains and bacterial plasmids
All reagents, yeast strains, and bacterial plasmids are listed in S1–S3 Tables, respectively. All yeast strains used in this study were performed in a W303 background strain unless otherwise noted (S2 Table). V5 tagged Smc3 strains were created using EU3430-9A, generously given by Drs. Vincent Guacci and Douglas Koshland. Primers used to amplify the SMC3:V5:HIS region, primers are (forward primer) 5’-TTAACGCGGTTGATTTCTACTTTCCAAAAGGTTTCTGAAAA-3’ and (reverse primer) 5’-TAGCTCTGATTCTGACTCTAACTCCAGTTCGGACTCCGTATCGGATTCCAGTTCAGATTC-3’. The resulting PCR product was transformed into a wildtype W303 background strain (YCZ044) to produce YCZ249. YCZ249 was mated with YCZ262 and a genetic cross was used to obtain YCZ280. YCZ280 was mated with YBS2012 to obtain YCZ407, YCZ408, YCZ425, and YCZ428 (see S2 Table). A CEN vector plasmid or 2μ POL30 plasmid were transformed into YCZ147 and YCZ144 to obtain the resulting yeast strains: YCZ477, YCZ465, YCZ474, and YCZ225. YCZ559, YCZ561, YCZ563, and YCZ565 were created by transforming either a CEN vector plasmid or 2μ POL30 plasmid into K5824 and K6013, respectively, generously given by Dr. Vincent Guacci. A CEN vector plasmid or 2μ POL30 plasmid were transformed into YMM433 and YMM435 to obtain the resulting yeast strains (YCZ530, YCZ532, YCZ534, YCZ536). A CEN vector plasmid or 2μ POL30 plasmid were transformed into YDM884 and DLY285 to obtain the resulting yeast strains (YCZ567 through YCZ578). A pGADT7 vector plasmid or a 2μ ADH AD:HA:POL30 plasmid was transformed into yeast strains K699, K5824, and K6013 to generate resulting yeast strains (YCZ662 through YCZ673). 2μ POL30 plasmid was transformed into yeast strains K5824 and K6013 to generate resulting yeast strains (YCZ559, YCZ561, YCZ563, YCZ565). Primers (forward primer) 5’- AGAGAAGGTTTTCCAATGAAAAGGCACGTGTCTTTATCTGATATATTGACAGGAAATAAGCGGATCCCCGGGTTAATTAA-3’and (reverse primer) 5’- ATTTCCCCGCACTACCATGCTATATTTATTATACATACGTGTTCCTGTAACGATGCACGCGAATTCGAGCTCGTTTAAAC-3’ were used to generate strains harboring ELG1::KAN as previously described [64]. The resulting PCR product was transformed into K5824 to obtain the yeast strains YCZ706 and YCZ707. YCZ143 was mated to K6013 to obtain YCZ702 and a genetic cross was used to obtain YCZ728 and YCZ729. CZ421 was mated to CZ778, generously given by Dr. Gregory Lang, to obtain CZ799 and a genetic cross was used to determine the genetic interaction between msh3Δ, elg1Δ, and mcd1-1 alleles. Strains and plasmids are available upon request.
Dilution plating
Cells were grown at 23° overnight in either YPD or selection media, normalized by OD600, and then plated in 10-fold serial dilutions at the indicated temperatures on YPD medium or selective medium. Cells grown on YPD medium or selective medium supplemented with methyl methanesulfonate (Sigma) or hydroxyurea (Sigma) were treated in a similar manner.
Smc3 chromatin binding assay
Log phase yeast strains were grown to 0.6 OD600 and synchronized in G1 by exposing cells to fresh media supplemented with alpha factor at the permissive temperature of 23°C for three hours. The resulting G1 synchronized cells were washed, cultures split in half and maintained for three hours at 34°C or 37°C for 3 hours. Nocodazole arrested cells were harvested to assess Smc3 chromatin binding levels, based on modifications of previously described protocols [65]. Cell cultures were normalized to OD600 between 0.3–0.6, pelleted and washed with 1.2 M Sorbitol. Cells were resuspended in CB1 buffer (50 mM Sodium citrate, 1.2 M Sorbitol, 40 mM EDTA, pH 7.4) and spheroblasted. Spheroblasted cells were washed, resuspended in 1.2 M Sorbitol, and frozen in liquid nitrogen. Cells were thawed on ice and supplemented with Lysis buffer (500 mM Lithium Acetate, 20 mM MgSO4, 200 mM HEPES, pH 7.9), protease inhibitor cocktail (AEBSF, 1,10-Phenanthroline, Pepstatin A, E-64) (Sigma), and TritonX-100. Lysates were centrifuged at 12,000g for 15 minutes and soluble and containing chromatin bound fractions collected and denatured using 2X Laemelli buffer. Whole cell extracts, supernatant, and pellet were resolved by SDS-PAGE and analyzed by Western blot using anti-V5 (1:40,000) (Invitrogen) with goat anti-mouse HRP (1:40,000) (Bio-Rad), anti-PGK (1:20,000) (Novex) with goat anti-mouse HRP (1:40,000) (Bio-Rad), or anit-H2B (1:80,000) (Abcam) with goat anti-rabbit HRP (1:40,000) (Bio-Rad) and ECL prime (GE Healthcare) for visualization.
Smc3 acetylation assay
Log phase yeast strains were grown to 0.6 OD600 and synchronized in G1 by exposing cells to fresh media supplemented with alpha factor at the permissive temperature of 23°C for three hours. The resulting G1 synchronized cells were washed, cultures split in half and maintained for three hours at 34°C or 37°C. Nocodazole arrested cells were harvested to assess Smc3 acetylation, with additional modifications as previously described [65]. Cell cultures were normalized to an OD600 between 0.3–0.6. Cells were washed in sterile water, then resuspended in sterile water prior to freezing at -80°C. Frozen pellets were extracted by the addition of IPH50 buffer (50mM Tris pH 7.8, 150mM NaCl, 5mM EDTA, 0.5% IGEPAL 630 (Sigma), 10mM Sodium Butyrate, 1mM DTT) and glass beads prior to bead beating (BioSpec). Cell lysates were supplemented with IPH50 buffer and protease inhibitor cocktail (AEBSF, 1,10-Phenanthroline, Pepstatin A, E-64) (Sigma), centrifuged at 15,000rpm for 20 minutes, and the pellet washed with sterile water before centrifugation at 15,000rpm for 10 minutes. The resulting chromatin fraction was supplemented with SBIIA buffer (0.5M Tris pH 9.4, 6% Sodium Dodecyl Sulfate before a 10-minute incubation at 50°C. SBII buffer (50% glycerol supplemented with bromophenol blue) and 1M DTT buffer was added to the cell lysates followed by a 5-minute incubation at 65°C. Whole cell protein samples were resolved by SDS-PAGE electrophoresis and analyzed by Western blot using anti-V5 (1:40,000) (Invitrogen) with goat anti-mouse HRP (1:40,000), anti-PGK (1:20,000) (Novex) with goat anti-mouse HRP (1:40,000) (Bio-Rad) or by anti-Smc3 K112/K113 Acetylation (1:1,000, gift from Dr. Katsuhiko Shirahige) in combination with goat anti-mouse HRP (1:10,000) (Bio-Rad) and ECL prime (GE Healthcare) for visualization.
PCNA chromatin binding assay
Log phase yeast strains were normalized to OD600 between 0.3–0.6, pelleted and washed with 1.2 M Sorbitol. Cells were resuspended in CB1 buffer (50 mM Sodium citrate, 1.2 M Sorbitol, 40 mM EDTA, pH 7.4) and spheroblasted. Spheroblasted cells were washed, resuspended in 1.2 M Sorbitol, and frozen in liquid nitrogen. Cells were thawed on ice and supplemented with Lysis buffer (500 mM Lithium Acetate, 20 mM MgSO4, 200 mM HEPES, pH 7.9), protease inhibitor cocktail (AEBSF, 1,10-Phenanthroline, Pepstatin A, E-64) (Sigma), and TritonX-100. Lysates were centrifuged at 12,000g for 15 minutes and soluble and containing chromatin bound fractions collected and denatured using 2X Laemelli buffer. Whole cell extracts, supernatant, and pellet were resolved by SDS-PAGE and analyzed by Western blot using anti-PCNA (1:1,000) (Abcam) with rabbit anti-mouse HRP (1:40,000) (Bio-Rad), anti-PGK (1:20,000) (Novex) with goat anti-mouse HRP (1:40,000) (Bio-Rad), or anit-H2B (1:80,000) (Abcam) with goat anti-rabbit HRP (1:40,000) (Bio-Rad) and ECL prime (GE Healthcare) for visualization.
Rad53 phosphorylation assay
Log phase yeast strains were grown to 0.6 OD600 and synchronized in G1 by exposing cells to fresh media supplemented with alpha factor at the permissive temperature of 23°C for three hours. The resulting G1 synchronized cells were washed, and half of the wildtype cell culture was exposed to 0.05% MMS to induce Rad53 phosphorylation. Cultures were then maintained for three hours at 37°C. Nocodazole arrested cells were harvested to assess Rad53 phosphorylation, with additional modifications as previously described [65]. Cell cultures were normalized to an OD600 between 0.3–0.6. Cells were washed in sterile water, then resuspended in sterile water prior to freezing at -80°C. Frozen pellets were extracted by the addition of Trichloroacetic acid (TCA) and glass beads prior to bead beating (BioSpec). Cell lysates were supplemented with TCA, centrifuged at 15,000rpm for 20 minutes, and the pellet washed with sterile water before centrifugation at 15,000rpm for 10 minutes. The resulting chromatin fraction was supplemented with SBIIA buffer (0.5M Tris pH 9.4, 6% Sodium Dodecyl Sulfate before a 10-minute incubation at 50°C. SBII buffer (50% glycerol supplemented with bromophenol blue) and 1M DTT buffer was added to the cell lysates followed by a 5-minute incubation at 65°C. Whole cell protein samples were resolved by SDS-PAGE electrophoresis and analyzed by Western blot using anti-Rad53 (1:5,000) (Invitrogen) with goat anti-mouse HRP (1:30,000) or by anti-PGK (1:20,000) (Novex) with goat anti-mouse HRP (1:40,000) (Bio-Rad) and ECL prime (GE Healthcare) for visualization.
Results
Elevated levels of chromatin-bound PCNA (via elg1Δ) promote cohesin binding to DNA in mcd1 mutant cells
PCNAOE (POL30 expressed from a 2μ vector) and elg1Δ, both of which result in persistent and increased levels of chromatin-bound PCNA, adversely affect all core cohesin mutant strains tested to date [15, 32, 33, 35, 61, 63]. For instance, mcd1-1 mutant cells are inviable at the restrictive temperature of 37°C, due to both high cohesion and condensation defects [1, 2], but lose viability at 34°C in response to either PCNAOE or elg1Δ [32, 33]. Given that cohesin deposition onto chromatin and cycles of PCNA binding/release are normally coordinated [10, 21, 36], it became important to test whether elevated levels of chromatin-bound PCNA reduce cohesin deposition onto DNA—either through direct competition, reduction of factors that promote cohesin deposition (Scc2,4, RSC or Chl1), or increase in factors (Rad61/WAPL) that dissociate cohesin from chromatin [7, 8, 23, 30, 31, 63, 66–70]. We first independently verified the antagonistic effect that elg1Δ imparts on cells harboring mcd1-1 mutations and indeed found severely exacerbated growth defects (Fig 1A). Next, we validated the efficiency of the Triton X-100-based fractionation procedure [3, 45]. We obtained clear separation of soluble components (using the cytoplasmic factor Phosphoglycerokinase—PGK) from those of chromatin-bound components (Histone 2B) (65). Finally, we optimized Western blot procedures to obtain a linear range of band intensities from which to quantify levels of fractionated chromatin-bound proteins (Fig 1B). To test whether elevated levels of chromatin-bound PCNA reduce cohesin binding to DNA, wildtype, elg1Δ and mcd1-1 single mutant cells, and mcd1-1 elg1Δ double mutant cells, all of which express Smc3-3V5 as the sole source of Smc3 protein, were synchronized in G1 and released at either 34°C (the non-permissive temperature for mcd1-1 elg1Δ double mutant cells) or 37°C (the non-permissive temperature for mcd1-1 single mutant cells) in fresh medium containing nocodazole. Cell cycle synchronizations were monitored by flow cytometry (Fig 1C). The resulting pre-anaphase cells were lysed and fractionated prior to assessing for changes in chromatin-bound Smc3, a core component of the cohesin complex [2, 71]. As expected, wildtype and elg1Δ single mutant cells display similar levels of chromatin bound Smc3, compared to H2B (Fig 1D and 1E). The results further reveal that mcd1-1 single mutant cells display similar levels of chromatin-bound Smc3 compared to wildtype cells, even at the non-permissive temperature of 37° (Fig 1D and 1E). Thus, Mcd1 inactivation, which results in cell inviability, cohesion and condensation defects [1, 2], does so in the absence of cohesin dissociation from DNA (Fig 1D and 1E). Surprisingly, mcd1-1 elg1Δ double mutant cells display increased levels of chromatin bound cohesin at both non-permissive temperatures of 34° and 37°, compared to that of either wildtype, elg1Δ or mcd1-1 single mutant cells (Fig 1D and 1E). These results that chromatin-bound levels of Smc3 are not reduced in mcd1-1 elg1Δ double mutant cells, but instead are increased, reveal that excess chromatin-bound PCNA does not adversely impact cohesin loading onto DNA and negates both direct competition models and recruitment of cohesin releasing factors. The mechanism through which PCNA promotes cohesin deposition onto DNA remains an important issue in chromatin regulation.
Fig 1. Excess chromatin-bound PCNA (via elg1Δ) increases cohesin chromatin levels in mcd1 mutant cells.
[A] 10-fold serial dilution of indicated yeast strains plated on rich medium plates and incubated at 23°C, 34°C, and 37°C for 2 days. [B] Titration and chromatin fractionation of wildtype cells arrested in nocodazole. 1X sample concentration for Smc3, H2B, and PGK indicates samples are within the linear range of detection. [C] DNA content of cells synchronized in G1 with alpha factor, and then shifted to 34°C or 37°C and arrested in pre-anaphase with nocodazole (NZ). [D] Chromatin bound fraction of cells arrested in pre-anaphase. Smc3 and H2B indicate levels of chromatin-bound proteins in the chromatin fraction. [E] Quantification of chromatin bound Smc3 levels, compared to H2B, in the indicated strains. Smc3 enrichment on DNA is based on the ratio of Smc3 to Histone 2B levels and obtained from 3 independent experiments. Error bars represent standard deviation.
Elevated levels of chromatin-bound PCNA (via elg1Δ) promote Smc3 acetylation in mcd1 mutant cells
If excess levels of chromatin-bound PCNA (via elg1Δ) do not reduce cohesin deposition, PCNA may instead negatively impact acetylation of impaired cohesin to produce the observed cell growth defects. To test this possibility, wildtype, elg1Δ and mcd1-1 single mutant cells, and mcd1-1 elg1Δ double mutant cells, all of which express Smc3-3V5 as the sole source of Smc3 function, were synchronized in G1 and released at 34°C or 37°C into fresh medium supplemented with nocodazole (Fig 2A). Protein samples were then assessed for Smc3 acetylation. Wildtype cells and elg1Δ single mutant cells contained similar levels of Smc3 acetylation at both temperatures. In contrast, mcd1-1 single mutant cells exhibited a dramatic decrease in Smc3 acetylation at both temperatures (Fig 2B), despite the retention of both mcd1-1 and Smc3 proteins on DNA (Fig 1E). This provides the first evidence that Mcd1 is critical for Eco1-dependent Smc3 acetylation and thus defines a new role for Mcd1 in promoting cohesion establishment. Importantly, mcd1-1 elg1Δ double mutant cells contained increased levels of Smc3 acetylation compared to mcd1-1 single mutant cells, regardless of a temperature shift to either 34°C or 37°C (Fig 2B, S1 Fig), consistent with prior evidence that elevated levels of PCNA promote both eco1 mutant cell viability and Eco1-dependent acetylation of Smc3 [10, 15]. In combination, these results reveal that elevated levels of chromatin-bound PCNA, via elg1Δ, do not negatively impact either binding or acetylation of cohesin. That elevated levels of chromatin-bound PCNA promotes both the acetylation and deposition of mutant cohesin therefore suggests that the adverse effect of PCNA occurs through some other mechanism.
Fig 2. Excess chromatin bound PCNA (via elg1Δ) promotes Smc3 acetylation in mcd1-1 mutant cells.
[A] DNA content of log phase cells synchronized in G1, then shifted to 34°C or 37°C and arrested in pre-anaphase. [B] Elevated levels of chromatin-bound PCNA promotes Smc3 acetylation in mcd1-1 mutant cells. Smc3 was detected by a V5 specific antibody, and acetylated Smc3 was detected by a K112/K113 acetylation antibody. PGK was used as a loading control.
Elevated levels of chromatin-bound PCNA (via 2μ POL30) increases mcd1 mutant cell sensitivity to DNA damage agents
Given the exclusion of models in which elevated levels of chromatin-bound PCNA (via elg1Δ) reduce either cohesin binding to DNA or acetylation, we next hypothesized that PCNA-dependent growth defects of cohesin mutants might involve genomic instability. For instance, it is now well documented that very high levels of PCNA, obtained by GAL-based overexpression, renders wildtype cells hypersensitive to genotoxic agents and promotes elevated levels of sister chromatid recombination [63], phenotypes similarly exhibited by elg1Δ cells [60, 63, 72–74]. In contrast, studies involving relatively moderate increased levels of PCNA, via 2μ plasmids, have thus far failed to produce overt growth defects in wildtype cells [10, 15, 58, 63, 75]. We utilized this same 2μ plasmid strategy to ascertain whether a modest increase of chromatin-bound PCNA produces increased sensitivity to genotoxic agents in the context of cohesin mutant cells. Serial dilutions of wildtype and mcd1-1 mutant cells harboring either CEN vector alone or 2μ vector containing POL30 (PCNA) were plated on selective media supplemented with increasing concentrations of MMS, and maintained at the permissive temperature of 23°C. Wildtype cells, with or without the 2μ POL30 plasmid, exhibited similar dose-dependent growth defects, but remained viable even at elevated levels of MMS (Fig 3A). mcd1-1 single mutant cells that harbored the vector alone exhibited growth rates nearly identical to those of wildtype cells across the entire dose range of MMS. In contrast, mcd1-1 mutant cells that harbored the 2μ POL30 plasmid (PCNAOE) produced significant growth defects that coincided with increased MMS levels (Fig 3A). In combination, this result suggests that even moderate PCNAOE adversely impacts genomic integrity, but an effect which is detected here only in cohesin mutant cells sensitized by MMS.
Fig 3. Elevated PCNA levels (via PCNAOE) causes DNA damage sensitivity in mcd1-1 mutant cells.
[A] 10-fold serial dilution of indicated yeast strains plated on selective medium plates containing no MMS, 0.01% MMS, 0.03% MMS, 0.04% MMS, 0.06% MMS, or 0.1% MMS, and incubated at 23°C for 3 days. [B] 10-fold serial dilution of indicated yeast strains plated on selective medium plates containing no HU, 10mM HU, 30mM HU, 60mM HU, 90mM HU, 120mM HU, 180mM HU, or 240mM HU, and incubated at 23°C for 3 days.
We next tested whether this moderate PCNAOE is sufficient to sensitize mcd1-1 mutant cells to replication fork destabilizing agents. Hydroxyurea (HU) inhibits RNR function, resulting in depletion of dNTPs and destabilized DNA replication forks [76]. Serial dilutions of wildtype and mcd1-1 mutant cells, harboring either CEN vector alone or with 2μ POL30, were exposed to various concentrations of HU and maintained at the permissive temperature of 23°C. Wildtype cells, with or without elevated PCNA levels, were largely refractile to HU except at the most extreme concentration of HU, at which PCNA produced a minor growth defect (Fig 3B). Interestingly, mcd1-1 mutant cells that harbor the vector alone exhibited growth comparable to that of wildtype cells at all concentrations of HU. mcd1-1 mutant cells that harbor 2μ POL30 plasmid, however, exhibited significant growth defects even at relatively moderate levels of HU (Fig 3B). To assess the effect of elevated levels of chromatin-bound PCNA, in the absence of increased cytosolic levels of PCNA, we also tested the combined effects of elg1Δ and DNA damaging agents on wildtype and mcd1-1 mutant cells. Similar to results obtained from PCNAOE, the deletion of EGL1 from mcd1-1 cells produced extreme sensitivities to both MMS and HU (S2 Fig). These results are consistent with prior studies that cohesin plays a critical role in stalled replication fork restart as well as DNA damage repair [77–80].
Elevated levels of chromatin-bound PCNA (via 2μ POL30) activate the Mec1/ATR DNA damage response pathway and impact cell cycle progression
The adverse effect of 2μ POL30 and elg1Δ on mcd1-1 mutant cells is consistent with the model that even very moderate levels of PCNA is detrimental to genome maintenance. Mec1 (ATR) and Tel1 (ATM) kinases form parallel DNA damage response pathways [81–84]. To determine which, if either, pathway responds to PCNAOE, tel1Δ1 and mec1-1 mutant cells were transformed with a CEN vector alone or 2μ vector with POL30 and grown on plates maintained at a range of temperatures. Surprisingly, neither tel1Δ1 nor mec1-1 mutant cells exhibited any adverse growth rates in response to PCNAOE, regardless of the temperature (Fig 4A). We next assessed if either tel1Δ1 or mec1-1 mutant cells, sensitized by low doses of MMS, might reveal adverse effects of PCNAOE. tel1Δ1 mutant cells that harbor the 2μ POL30 plasmid exhibited growth nearly identical to that of wildtype cells, despite the presence of MMS. Conversely, mec1-1 mutant cells that harbor the 2μ POL30 plasmid exhibited significant growth defects in the presence of MMS (Fig 4B).
Fig 4. Elevated levels of PCNA sensitizes mec1-1 mutant cells to MMS.
[A] Elevated levels of PCNA does not impact tel1Δ1 and mec1-1 mutant cells under high temperature stress. 10-fold serial dilution of indicated yeast strains plated on selective medium plates and incubated at 23°C, 34°C, and 37°C for 2 days. [B] Elevated levels of PCNA specifically sensitizes mec1-1 mutant cells when exposed to DNA damage. 10-fold serial dilution of indicated yeast strains plated on selective medium plates containing no MMS or 0.01% MMS and incubated at 23°C for 2 days. [C] Rad53 checkpoint is not activated in mcd1-1 elg1Δ double mutant cells. DNA content are shown for cells in log phase, synchronized in G1 with alpha factor, and released and shifted to 37°C and arrested in pre-anaphase. Wildtype cells exposed to 0.05% MMS was used as a positive control for Rad53 activation. Rad53 was detected using a Rad53 specific antibody, and PGK was used as a loading control.
Phosphorylation of the DNA damage checkpoint kinase Rad53 occurs in a Mec1-dependent manner [85]. Rad53 is not phosphorylated in cells depleted of Elg1 under normal conditions, even though this checkpoint pathway is competent to respond to genotoxic agents [21, 61, 73]. These studies suggest that mcd1-1 elg1Δ double mutant cells would similarly not exhibit elevated Rad53 phosphorylation, despite the exacerbated growth defect at the restrictive temperature. To test this prediction, wildtype, both mcd1-1 and elg1Δ single mutants, and mcd1-1 elg1Δ double mutant cells were synchronized in G1, washed, and released in nocodazole at 37°C. As a positive control, wildtype cell cultures were split in two, with one population exposed to 0.05% MMS, prior to assessing for Rad53 phosphorylation in all strains. As expected, Rad53 exhibited a clear upward shift in wildtype cells exposed to 0.05% MMS, compared to Rad53 obtained from untreated wildtype and elg1Δ single mutant cells, consistent with prior results [61]. Interestingly, neither mcd1-1 single mutant nor mcd1-1 elg1Δ double mutant cells exhibited a shift in Rad53 migration (Fig 4C). These results suggest that increased levels of chromatin-bound PCNA generates genomic instabilities that can activate a Mec1/ATR (but not Tel1/ATM) DNA damage repair pathway but in the absence of Rad53 phosphorylation.
PCNAOE sensitizes mcd1-1 mutant cells to MMS and HU and also activates the Mec1/ATR intra-S phase checkpoint, suggesting that elevated PCNA levels may adversely impact replication fork progression. Consistent with this hypothesis, mutation of either ESCO2 (human homolog of yeast ECO1) or cohesin subunits result in slowed fork progression in mammalian cells [86–89], although a velocity reduction appears absent in analogous yeast mutant strains [2, 3, 10, 77, 80, 90–92]. It thus became important to test whether elevated levels of chromatin-bound PCNA produces replication stress severe enough to delay S phase progression in mcd1-1 mutant cells. Log phase wildtype, both elg1Δ and mcd1-1 single mutant cells, and mcd1-1 elg1Δ double mutant cells were synchronized in G1, washed, and released into fresh medium supplemented with nocodazole and maintained at the either 32° (restrictive temperature for mcd1-1 elg1Δ double mutant cells) or 37°C (restrictive temperature for mcd1-1 single mutant cells). Aliquots were harvested at 15 minute intervals and cell cycle progression monitored by flow cytometry (S3 Fig). Because cells harboring ELG1 deletion do not fully synchronize in G1 with alpha factor [32], we analyzed the time point at which at least half of a G1 arrested population progressed to an S-phase state. At 32°C, wildtype and elg1Δ mutant cells both reached a half-way point (relatively equal 1N and 2N peaks) between the 30–45 minute time points, while arresting in pre-anaphase in about 75 minutes. mcd1-1 mutant cells progressed to a mid-way state at the tail end of the time range (45 minutes) required by wildtype and elg1Δ mutant cells, and achieved a final preanaphase state in coordination with wildtype and elg1Δ mutant cells. At 37°C, which is non-permissive for both mcd1-1 and mcd1-1 elg1Δ mutant cells, mcd1-1 cells are clearly delayed by almost two time points in progressing to a half-way state (75 minutes), compared to wildtype and elg1Δ mutant cells (45–60 minutes) and delayed by a full time point in achieving a preanaphase arrest (90 minutes in mcd1-1 cells compared to 75 minutes in both wildtype and elg1Δ cells. Interestingly, mcd1-1 elg1Δ double mutant cells instead both exit G1 and achieve a mid-way state (15 minutes) faster than all other strains at both 32°C and 37°C, but then remain in this mid-way state for an extended period of time of 30 minutes (15–45 minutes) at 37°C, relative to other strains (S3 Fig). These results suggest that elevated levels of chromatin-bound PCNA, in combination with cohesin mutation, adversely impacts replication fork progression.
The differential impacts of PCNAOE on various cohesin mutant cells
High levels of PCNA (GAL-dependent POL30 overexpression) results in phenotypes that overlap with those obtained by elg1Δ, although elg1Δ phenotypes are far more robust [63, 73, 74, 93]. It thus became important to ascertain the effect of elg1Δ on cohesin mutants to that of a moderate increase (2μ-based) in PCNA levels. Our results document that, not only mcd1-1 cells, but also smc1-259 and smc3-42 mutant cells exhibit growth defects in response to elg1Δ (Fig 5A), consistent with prior studies [33, 35]. We next tested whether wildtype PCNA (via 2μ plasmid) would similarly exacerbate cohesin mutant cell growth. The results reveal that PCNAOE severely exacerbates the temperature sensitivity of mcd1-1 mutant cells (Fig 5B), consistent with a previous study [15]. Surprisingly, PCNAOE exhibited no adverse effect on either smc1-259 or smc3-42 mutant cell growth (Fig 5B). We repeated our analysis on different cohesin alleles. The results show that PCNAOE similarly failed to adversely impact the growth of smc1-2 and smc3-5 mutant cells. At first blush, these results appear in stark contrast to those reported by Zhang and colleagues for both smc1-259 and smc3-42 mutant cell [15]. Our results, however, are predicated on PCNA expressed from the endogenous promoter in which elevated expression is driven solely by the multi-copy 2μ plasmid [10]. In contrast, the Zhang study expressed PCNA using the constitutive and high-expressing ADH promotor in the context of the high copy 2μ plasmid (pGADT7), suggesting that the two results may differ due to PCNA expression levels. To test this hypothesis, we cloned POL30 into pGADT7. The resulting PCNA construct, however, produced a dominant-negative phenotype such that all strains tested, including wildtype cells, exhibited severe growth defects (Fig 5C). We confirmed that both overexpressed PCNA from the multi-copy 2μ plasmid and high copy 2μ plasmid (pGADT7) resulted in elevated levels of chromatin-bound PCNA (Fig 5D–5F and S4 Fig). Therefore, it is possible that this dominant-negative effect is due to elevated levels of epitope-tagged PCNA as occurs for pGADT7 tagging which is absent in our 2μ strategy. Prior studies, for instance, document that endogenous expression of either N- and C-terminus tagged PCNA can result in wildtype cell increased MMS sensitivity [62, 75]. Regardless, our results reveal that mcd1-1, in contrast to numerous other cohesin subunit alleles (which exhibit similar conditional growth defects—Fig 5), are hypersensitive to even a moderate increase in wildtype PCNA.
Fig 5. Elevated levels of chromatin-bound PCNA differentially impacts cohesin alleles.
[A] ELG1 deletion exacerbates smc1-259 and smc3-42 mutant cells. 10-fold serial dilution of indicated yeast strains plated on rich medium plates and incubated at 23°C, 34°C, and 37°C for 2 days. * indicates a mutated smc1-259 elg1Δ strain that displays a resistant to temperature sensitivity [B] PCNAOE from a 2μ plasmid specifically impacts mcd1-1 mutant cells. 10-fold serial dilution of indicated yeast strains plated on selective medium plates and incubated at 23°C, 34°C, and 37°C for 2 days. [C] Overexpressed PCNA harboring a GAL4 AD and HA N-terminal tag exacerbates cell growth in wildtype cells, smc1-259, and smc3-42 mutant cells. Images of POL30 in pGADT7 in WT, smc3-42, and smc1-259 mutant cells. 10-fold serial dilution of indicated yeast strains plated on selective medium plates and incubated at 23°C, 34°C, and 37°C for 2 days. [D] Log phase wildtype cells that harbor 2μ POL30 plasmid produce elevated levels of chromatin-bound PCNA, compared to wildtype cells that harbor a vector plasmid and elg1Δ single mutant cells. PGK and H2B were used as a loading control and control for chromatin fractionation, respectively. [E] Five times the chromatin fraction of Fig 5D was loaded to visualize chromatin-bound PCNA in wildtype cells. [F] Overexpressed PCNA via a high copy 2μ plasmid in log phase wildtype cells results in elevated levels of chromatin-bound PCNA compared to log phase wildtype cells harboring a vector plasmid. PCNA was detected by a PCNA specific antibody. PGK and H2B was used as a loading control and control for chromatin fractionation.
Discussion
Since the first evidence that cohesion establishment is intimately coupled to DNA replication [10], a wealth of studies document the dependency of Eco1 recruitment by DNA replication fork factors and, furthermore, that replication fork factors regulate sister chromatid tethering reactions [14, 15, 23–25, 29, 32, 33, 35, 36, 94–98]. Of particular interest are RFC complexes that regulate the loading (RFC1RFC, Ctf18RFC) and unloading (Elg1RFC) of PCNA onto DNA [61, 99–101]. Either PCNA overexpression or ELG1 deletion, both of which result in prolonged and elevated retention of PCNA onto DNA, rescue eco1 mutant cell growth [10, 15, 32, 33]. Intriguingly, however, elevated levels of chromatin-bound PCNA instead exacerbates the growth defects of the cohesin subunits [15, 33], a surprising phenotype given that the cohesin subunit Smc3 is the target of Eco1 acetylation [12, 13, 102]. ELG1 deletion is mutagenic and thus may have adverse impacts beyond PCNA unloading while moderate increases in PCNA appear fully tolerated by wildtype cells [58, 60, 63, 73, 75, 103]. Here, we confirm that ELG1 deletion exacerbates the growth defects present in mcd1 mutant cells and extend those findings to show that moderate overexpression of wildtype PCNA similarly exerts an adverse growth effect on mcd1 mutant cell growth. The link between PCNA and cohesin function is complex, however, in that similar expression of PCNA had no impact on a number of other cohesin subunit alleles (smc3-5, smc3-42, smc1-295 and smc1-2). These findings raise the possibility that cohesin loading onto sister chromatids, which occurs behind DNA polymerase and PCNA [10, 21, 36], may be oriented such that Mcd1 is most proximal to, and thus most impacted by, DNA replication fork components. Interestingly, deletion of ELG1 (PCNA-unloader), and independent deletion of CTF18 (PCNA-loader), both exacerbate cohesin mutant cell growth [10, 102]. While our current study was under review, recent findings revealed that dual deletion of ELG1 and CTF18 returns to near-normal both chromatin-bound PCNA and cohesion levels, with additional evidence for strand-specific RFC roles in PCNA deposition [21]. Thus, cohesin function is negatively impacted by altering both PCNA dynamics, in either direction, and residency. Additional studies are required to elucidate the multiple mechanisms through which DNA replication fork components, especially involving PCNA, impact cohesin functions.
A second major finding from this study are surprising impacts of elevated levels of chromatin-bound wildtype PCNA on cohesin regulation. Elevated levels of chromatin-bound PCNA that persist well after S phase could antagonize any number of post-replicative activities such as histone deposition, chromatin remodeling, or Okazaki maturation [104, 105]. Given the adverse impact of elevated levels of chromatin-bound PCNA on mcd1-1 mutant cells, PCNA might conceivably reduce Scc2,Scc4 recruitment and/or subsequent deposition of cohesins onto DNA [8, 23, 66, 106, 107]. An alternate model is that elevated levels of PCNA sequester Eco1 into soluble PCNA pools, precluding sufficient cohesin acetylation. We provide evidence that negate both of these models. Our finding reveals that mutant mcd1 impedes Smc3 acetylation, a new observation that suggests that Mcd1 supports Eco1-dependent acetylation in a manner yet unknown. Furthermore, our study supports prior findings that elevated chromatin-binding of PCNA improves Smc3 acetylation [10, 15, 21]. More importantly, the finding that increased PCNA promotes cohesin binding onto DNA suggests that factors that promote cohesin deposition (Scc2,4, Chl1, or RSC), or promote cohesin dissociation (Rad61), are themselves sensitive to PCNA levels or modifications [8, 23, 24, 59, 98]. In support of this model are reports that PCNA physically interacts with Chl1, which promotes the recruitment to DNA of both Scc2,4 and cohesin [14, 23, 66, 107]. Intriguingly, increased Smc3 acetylation and cohesin deposition, induced by elg1Δ, fails to rescue mcd1-1 mutant cell growth defects, suggesting that PCNA impacts cohesin functions beyond sister chromatid tethering pathways—as described below.
A third major finding from the current study involves identifying potential mechanisms through which PCNA renders mcd1-1 mutant cells inviable. It is well known that elg1Δ results in long-lived and elevated levels of chromatin-bound PCNA which is highly mutagenic to wildtype cells [73, 74, 93]. High levels of PCNA, achieved by GAL-overexpression or coupling ADH-overexpression to 2μ-based high copy number, similarly produce genomic instabilities [15, 63]. A much more moderate expression system (2μ high copy) has thus far shown no adverse effect in wildtype cells [10, 58]. Our findings document that PCNAOE is sufficient to produce growth defects in mcd1-1 mutant cells, and that this effect is greatly exacerbated by challenging mutant cells with MMS or HU. This intersection between PCNA and cohesin is consistent with prior studies that document that 1) highly elevated levels of PCNA result in genomic instability [63], 2) cohesin are both recruited to stalled replication forks and promote fork restart [77–79, 89], and 3) DNA replication fork protection complexes and cohesin pathways are intimately linked [24, 63, 77, 80, 108]. During the final stages of this study, independent analyses revealed that elevated levels of chromatin-bound PCNA results in hyper-recruitment of mismatch repair factors [109]. Cells that exhibit elevated levels of mismatch repair intermediates normally activate cohesin recruitment pathways to promote efficient DNA repair through homologous recombination [110, 111]. Cells utilize Msh2-Msh3-dependent mismatch repair (MMR) to correct mismatches (including short insertions and deletions) that accumulate during DNA replication [109, 112–114], which increase upon high levels of PCNA expression [109]. However, numerous mcd1-1 msh3Δ elg1Δ triple mutant cells were obtained from crossing msh3Δ single mutant cells to mcd1-1 elg1Δ double mutant cells (S4 Table). Thus, the moderate increase of PCNA used here does not appear to generate long-lived genomic instabilities sufficient to require mismatch repair factor Msh3. Despite this, our findings document that the adverse effect of PCNAOE does result in a Mec1(ATR)-dependent response, versus a Tel1(ATM)-dependent response, but in the absence of Rad53 phosphorylation. The integration of Mec1 sensor in PCNA and cohesin genome instability contrasts those in which double deletion of MEC1 and TEL1 were required to reduce Scc1 recruitment to forks under conditions of replication stress [77]. In combination, these findings highlight the complex nature through which Mec1 (and possibly Tel1) respond to replication stressors (such as PCNAOE), which are revealed only under conditions of cohesin mutation and/or genotoxic agents.
A confluence of findings document that 1) cohesins are deposited during S phase onto nascent sister chromatids [8, 10, 65, 115–120], 2) cohesins are critical for replication fork restart and repair [77–79, 88], 3) Eco1-dependent cohesion establishment is intimately coupled to PCNA and the DNA replication fork [10, 15, 16, 25–27, 121–123], and 4) PCNAOE and elg1Δ both adversely impact cohesin mutant cell growth. Clearly, PCNAOE (at even very moderate levels) and elg1Δ adversely impact cohesin mutant cell growth, an effect exacerbated by genotoxic agents. We thus posit a model that may explain why elevated levels of PCNA reduce mcd1-1 mutant cell growth (Fig 6). In wildtype cells, PCNA is removed from chromatin by Elg1 and proper cohesin deposition and acetylation occur to establish sister chromatid cohesion. Elevated levels of chromatin-bound PCNA result in minor genomic instabilities that likely impact replication fork progression, but at a level insufficient for Mec1 to promote Rad53 phosphorylation. Cohesin mutant cells are unable to counter the adverse effects of PCNA—which eventually leads to cell death.
Fig 6. Cohesins are necessary to resolve genomic instabilities caused by elevated levels of PCNA.
[A] In wildtype cells, a functional Elg1 removes PCNA from behind the replication fork. If DNA damage occurs, the damage is resolved in a Mec1-dependent manner. Proper DNA repair and protection from genomic instability results in cell viability. [B]. In mcd1-1 elg1Δ double mutant cells, loss of Elg1 results in the retention of chromatin-bound PCNA. The combination of misregulated PCNA and a mutant cohesin (which exhibits reduced acetylation) may result in unrepaired DNA and unresolved genomic stability, leading to cell death.
Supporting information
Second biological iteration of Fig 2. Smc3 was detected by a V5 specific antibody, and acetylated Smc3 was detected by a K112/K113 acetylation antibody. PGK was used as a loading control.
(PDF)
[A] 10-fold serial dilution of indicated yeast strains plated on selective medium plates containing no MMS, 0.03% MMS, 0.06% MMS, or 0.1% MMS, and incubated at 23°C for 3 days. [B] 10-fold serial dilution of indicated yeast strains plated on selective medium plates containing no HU, 60mM HU, 120mM HU, or 240mM HU, and incubated at 23°C for 3 days.
(PDF)
DNA content of log phase cells synchronized in G1. Temperature was then shifted to either 32°C or 37°C and cells released into media supplemented with nocodazole. Samples were collected every 15 minutes.
(PDF)
[A] Second biological replicate of Fig 5D. Wildtype cells harboring a 2μ POL30 plasmid results in elevated levels of chromatin-bound PCNA compared to wildtype cells harboring a vector plasmid and elg1Δ single mutant cells. PCNA was detected by a PCNA specific antibody. PGK and H2B was used as a loading control and control for chromatin fractionation. [B] Five times the chromatin fraction was loaded to visualize chromatin-bound PCNA in wildtype cells. [C] Second biological replicate of Fig 5F. Overexpressed PCNA via a high copy 2μ plasmid results in elevated levels of chromatin-bound PCNA compared to wildtype cells harboring a vector plasmid. PCNA was detected by a PCNA specific antibody. PGK and H2B was used as a loading control and control for chromatin fractionation.
(PDF)
(DOCX)
(DOCX)
(DOCX)
Dissection of mcd1-1 elg1Δ Smc3:3V5 mated with msh3Δ. mcd1-1 elg1Δ msh3Δ triple mutant strains are obtained at the expected frequency.
(DOCX)
Acknowledgments
We thank the R.V.S. laboratory members (Michael Mfarej, Annie Sanchez, Nicole Kirven, and Shaya Ameri) for helpful comments during the progression of this study. We also thank Dr. Vincent Guacci, Dr. Douglas Koshland, Dr. Gregory Lang, and Dr. Katsuhiko Shirahige for generously sharing yeast strains and reagents. Any opinions, findings, and conclusions or recommendations expressed in this study are those of the authors and does not necessarily reflect the views of the National Institutes of Health. No competing interests are declared.
Data Availability
All original images (gels, blots, etc.), and underlying data and findings are available at FigShare under the following DOI: 10.6084/m9.figshare.12908282.
Funding Statement
This study was funded through an award from the National Institutes of Health [R15GM110631] to R.V.S. and a Nemes Fellowship Research Award to CMZ. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Guacci V, Koshland D, Strunnikov A. A direct link between sister chromatid cohesion and chromosome condensation revealed through the analysis of MCD1 in S. cerevisiae. Cell. 1997;91: 47–57. 10.1016/s0092-8674(01)80008-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Michaelis C, Ciosk R, Nasmyth K. Cohesins: Chromosomal proteins that prevent premature separation of sister chromatids. Cell. 1997;91: 35–45. 10.1016/s0092-8674(01)80007-6 [DOI] [PubMed] [Google Scholar]
- 3.Tóth A, Ciosk R, Uhlmann F, Galova M, Schleiffer A, Nasmyth K. Yeast cohesin complex requires a conserved protein, Eco1p(Ctf7), to establish cohesion between sister chromatids during DNA replication. Genes Dev. 1999;13: 320–333. 10.1101/gad.13.3.320 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Panizza S, Tanaka T, Hochwagen A, Eisenhaber F, Nasmyth K. Pds5 cooperates with cohesin in maintaining sister chromatid cohesion. Curr Biol. 2000;10: 1557–1564. 10.1016/s0960-9822(00)00854-x [DOI] [PubMed] [Google Scholar]
- 5.Hartman T, Stead K, Koshland D, Guacci V. Pds5p Is an Essential Chromosomal Protein Required for both Sister Chromatid Cohesion and Condensation in Saccharomyces cerevisiae. J Cell Biol. 2000;151: 613–626. 10.1083/jcb.151.3.613 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Rankin S, Ayad NG, Kirschner MW. Sororin, a substrate of the anaphase- promoting complex, is required for sister chromatid cohesion in vertebrates. Mol Cell. 2005;18: 185–200. 10.1016/j.molcel.2005.03.017 [DOI] [PubMed] [Google Scholar]
- 7.Kueng S, Hegemann B, Peters BH, Lipp JJ, Schleiffer A, Mechtler K, et al. Wapl Controls the Dynamic Association of Cohesin with Chromatin. Cell. 2006;127: 955–967. 10.1016/j.cell.2006.09.040 [DOI] [PubMed] [Google Scholar]
- 8.Ciosk R, Shirayama M, Shevchenko A, Tanaka T, Toth A, Shevchenko A, et al. Cohesin’s binding to chromosomes depends on a separate complex consisting of Scc2 and Scc4 proteins. Mol Cell. 2000;5: 243–254. 10.1016/s1097-2765(00)80420-7 [DOI] [PubMed] [Google Scholar]
- 9.Watrin E, Schleiffer A, Tanaka K, Eisenhaber F, Nasmyth K, Peters JM. Human Scc4 Is Required for Cohesin Binding to Chromatin, Sister-Chromatid Cohesion, and Mitotic Progression. Curr Biol. 2006;16: 863–874. 10.1016/j.cub.2006.03.049 [DOI] [PubMed] [Google Scholar]
- 10.Skibbens R V, Corson LB, Koshland D, Hieter P. Ctf7p is essential for sister chromatid cohesion and links mitotic chromosome structure to the DNA replication machinery. Genes Dev. 1999;13: 307–319. 10.1101/gad.13.3.307 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ivanov D, Schleiffer A, Eisenhaber F, Mechtler K, Haering CH, Nasmyth K. Eco1 is a novel acetyltransferase that can acetylate proteins involved in cohesion. Curr Biol. 2002;12: 323–328. 10.1016/s0960-9822(02)00681-4 [DOI] [PubMed] [Google Scholar]
- 12.Rolef Ben-shahar T, Heeger S, Lehane C, East P, Flynn H, Skehel M, et al. Eco1-Dependent Cohesin Sister Chromatid Cohesion. Science (80-). 2008;321: 563–566. 10.1126/science.1157774 [DOI] [PubMed] [Google Scholar]
- 13.Unal E, Heidinger-Pauli JM, Kim W, Guacci V, Onn I, Gygi SP, et al. A Molecular Determinant for the Establishment of Sister Chromatid Cohesion. Science (80-). 2008;321: 566 10.1126/science.1172133 [DOI] [PubMed] [Google Scholar]
- 14.Moldovan GL, Pfander B, Jentsch S. PCNA Controls Establishment of Sister Chromatid Cohesion during S Phase. Mol Cell. 2006;23: 723–732. 10.1016/j.molcel.2006.07.007 [DOI] [PubMed] [Google Scholar]
- 15.Zhang J, Shi D, Li X, Ding L, Tang J, Liu C, et al. Rtt101‐Mms1‐Mms22 coordinates replication‐coupled sister chromatid cohesion and nucleosome assembly. EMBO Rep. 2017;18: 1294–1305. 10.15252/embr.201643807 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Bender D, Da Silva EML, Chen J, Poss A, Gawey L, Rulon Z, et al. Multivalent interaction of ESCO2 with the replication machinery is required for cohesion. Proc Natl Acad Sci. 2020;117: 1081–1089. 10.1073/pnas.1911936117 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ohashi E, Tsurimoto T. Functions of Multiple Clamp and Clamp-Loader Complexes in Eukaryotic DNA Replication. Adv Exp Med Biol. 2017;1042: 135–162. 10.1007/978-981-10-6955-0_7 [DOI] [PubMed] [Google Scholar]
- 18.Choe KN, Moldovan GL. Forging Ahead through Darkness: PCNA, Still the Principal Conductor at the Replication Fork. Mol Cell. 2017;65: 380–392. 10.1016/j.molcel.2016.12.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Leung W, Baxley RM, Moldovan G, Bielinsky A. Mechanisms of DNA Damage Tolerance: Post-Translational Regulation of PCNA. Genes (Basel). 2019;10 10.3390/genes10010010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Slade D. Maneuvers on PCNA Rings during DNA Replication and Repair. Genes (Basel). 2018;9 10.3390/genes9080416 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Liu HW, Bouchoux C, Panarotto M, Kakui Y, Patel H, Uhlmann F. Division of Labor between PCNA Loaders in DNA Replication and Sister Chromatid Cohesion Establishment. Mol Cell. 2020;78 10.1016/j.molcel.2020.03.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Hanna JS, Kroll ES, Lundblad V, Spencer FA. Saccharomyces cerevisiae CTF18 and CTF4 Are Required for Sister Chromatid Cohesion. Mol Cell Biol. 2001;21: 3144–3158. 10.1128/MCB.21.9.3144-3158.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Rudra S, Skibbens R V. Chl1 DNA Helicase Regulates Scc2 Deposition Specifically during DNA-Replication in Saccharomyces cerevisiae. PLoS One. 2013;8 10.1371/journal.pone.0075435 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Samora CP, Saksouk J, Goswami P, Wade BO, Singleton MR, Bates PA, et al. Ctf4 Links DNA Replication with Sister Chromatid Cohesion Establishment by Recruiting the Chl1 Helicase to the Replisome. Mol Cell. 2016;63: 371–384. 10.1016/j.molcel.2016.05.036 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zhang W, Yeung CHL, Wu L, Yuen KWY. E3 ubiquitin ligase Bre1 couples sister chromatid cohesion establishment to DNA replication in Saccharomyces cerevisiae. Elife. 2017;6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ivanov MP, Ladurner R, Poser I, Beveridge R, Rampler E, Hudecz O, et al. The replicative helicase MCM recruits cohesin acetyltransferase ESCO2 to mediate centromeric sister chromatid cohesion. EMBO J. 2018; e97150 10.15252/embj.201797150 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sun H, Zhang J, Xin S, Jiang M, Zhang J, Li Z, et al. Cul4-Ddb1 ubiquitin ligases facilitate DNA replication-coupled sister chromatid cohesion through regulation of cohesin acetyltransferase Esco2. PLoS Genet. 2019;15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Faramarz A, Balk JA, van Schie JJM, Oostra AB, Ghandour CA, Rooimans MA, et al. Non-redundant roles in sister chromatid cohesion of the DNA helicase DDX11 and the SMC3 acetyl transferases ESCO1 and ESCO2. PLoS One. 2020;15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Mayer ML, Gygi SP, Aebersold R, Hieter P. An Alternative RFC Complex Required for Sister Chromatid Cohesion in S. cerevisiae. Mol Cell. 2001;7: 959–970. 10.1016/s1097-2765(01)00254-4 [DOI] [PubMed] [Google Scholar]
- 30.Mayer ML, Pot I, Chang M, Xu H, Aneliunas V, Kwok T, et al. Identification of Protein Complexes Required for Efficient Sister Chromatid Cohesion. Mol Biol Cell. 2004;15: 3751–3737. 10.1091/mbc.e03-12-0900 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Skibbens R V. Chl1p, a DNA Helicase-Like Protein in Budding Yeast, Functions in Sister-Chromatid Cohesion. Genetics. 2004;166: 33–42. 10.1534/genetics.166.1.33 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Maradeo ME, Skibbens R V. The Elg1-RFC Clamp-Loading Complex Performs a Role in Sister Chromatid Cohesion. PLoS One. 2009;4 10.1371/journal.pone.0004707 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Parnas O, Zipin-Roitman A, Mazor Y, Liefshitz B, Ben-Aroya S, Kupiec M. The Elg1 clamp loader plays a role in sister chromatid cohesion. PLoS One. 2009;4 10.1371/journal.pone.0005497 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Maradeo ME, Skibbens R V. Replication factor C complexes play unique pro- and anti-establishment roles in sister chromatid cohesion. PLoS One. 2010;5 10.1371/journal.pone.0015381 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Maradeo ME, Garg A, Skibbens R V. Rfc5p regulates alternate RFC complex functions in sister chromatid pairing reactions in budding yeast. Cell Cycle. 2010;9: 4370–4378. 10.4161/cc.9.21.13634 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Rudra S, Skibbens R V. Sister chromatid cohesion establishment occurs in concert with lagging strand synthesis. Cell Cycle. 2012;11: 2114–2121. 10.4161/cc.20547 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Banerji R, Skibbens R V., Iovine MK. Cohesin mediates Esco2-dependent transcriptional regulation in a zebrafish regenerating fin model of Roberts Syndrome. Biol Open. 2017;6: 1802–1813. 10.1242/bio.026013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Gassler J, Brandão HB, Imakaev M, Flyamer IM, Ladstätter S, Bickmore WA, et al. A mechanism of cohesin-dependent loop extrusion organizes zygotic genome architecture. EMBO J. 2017;36: 3600–3618. 10.15252/embj.201798083 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Haarhuis JHI, van der Weide RH, Blomen VA, Yanez-Cuna JO, Amendola M, van Ruiten MS, et al. The Cohesin Release Factor WAPL Restricts Chromatin Loop Extension. Cell. 2017;169: 693–707. 10.1016/j.cell.2017.04.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Schwarzer W, Abdennur N, Goloborodko A, Pekowska A, Fudenberg G, Loe-mie Y, et al. Two independent modes of chromatin organization revealed by cohesin removal Wibke. Nature. 2017;551: 51–56. 10.1038/nature24281 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Dauban L, Montagne R, Thierry A, Lazar-Stefanita L, Bastié N, Gadal O, et al. Regulation of Cohesin-Mediated Chromosome Folding by Eco1 and Other Partners. Mol Cell. 2020;77: 1279–1293. 10.1016/j.molcel.2020.01.019 [DOI] [PubMed] [Google Scholar]
- 42.Sumara I, Vorlaufer E, Gieffers C, Peters BH, Peters JM. Characterization of vertebrate cohesin complexes and their regulation in prophase. J Cell Biol. 2000;151: 749–761. 10.1083/jcb.151.4.749 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Lavoie BD, Hogan E, Koshland D. In vivo dissection of the chromosome condensation machinery: Reversibility of condensation distinguishes contributions of condensin and cohesin. J Cell Biol. 2002;156: 805–815. 10.1083/jcb.200109056 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Woodman J, Hoffman M, Dzieciatkowska M, Hansen KC, Bloom KS. Phosphorylation of the Scc2 cohesin deposition complex subunit regulates chromosome condensation through cohesin integrity. 2015. 10.1091/mbc.E15-03-0165 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Shen D, Skibbens R V. Chl1 DNA helicase and Scc2 function in chromosome condensation through cohesin deposition. PLoS One. 2017;12 10.1371/journal.pone.0188739 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Wutz G, Várnai C, Nagasaka K, Cisneros DA, Stocsits RR, Tang W, et al. Topologically associating domains and chromatin loops depend on cohesin and are regulated by CTCF, WAPL, and PDS 5 proteins. EMBO J. 2017;36: 3573–3599. 10.15252/embj.201798004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Rao S, Huang SC, Glenn St Hilaire B, Engreitz JM, Perez EM, Kieffer-Kwon KR, et al. Cohesin Loss Eliminates All Loop Domains. Cell. 2017;171: 305–320. 10.1016/j.cell.2017.09.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Banerji R, Eble DM, Iovine MK, Skibbens R V. Esco2 Regulates cx43 Expression During Skeletal Regeneration in the Zebrafish Fin. Dev Dyn. 2016;245: 7–21. 10.1002/dvdy.24354 [DOI] [PubMed] [Google Scholar]
- 49.Marston AL. Chromosome Segregation in Budding Yeast: Sister Chromatid Cohesion and Related Mechanisms. Genetics. 2014;196: 31–63. 10.1534/genetics.112.145144 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Litwin I, Pilarczyk E, Wysocki R. The Emerging Role of Cohesin in the DNA Damage Response. Genes (Basel). 2018;9 10.3390/genes9120581 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Nishiyama T. Cohesion and cohesin-dependent chromatin organization. Curr Opin Cell Biol. 2019;58: 8–14. 10.1016/j.ceb.2018.11.006 [DOI] [PubMed] [Google Scholar]
- 52.Remeseiro S, Cuadrado A, Carretero M, Martinez P, Drosopoulos WC, Canamero M, et al. Cohesin-SA1 deficiency drives aneuploidy and tumourigenesis in mice due to impaired replication of telomeres. EMBO J. 2012;31: 2076–2089. 10.1038/emboj.2012.11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Lossaint G, Larroque M, Ribeyre C, Bec N, Larroque C, Decaillet C, et al. FANCD2 Binds MCM Proteins and Controls Replisome Function upon Activation of S Phase Checkpoint Signaling. Mol Cell. 2013;51: 678–690. 10.1016/j.molcel.2013.07.023 [DOI] [PubMed] [Google Scholar]
- 54.Lu S, Lee KK, Harris B, Xiong B, Bose T, Saraf A, et al. The cohesin acetyltransferase Eco1 coordinates rDNA replication and transcription. EMBO Rep. 2014;15: 609–617. 10.1002/embr.201337974 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Watrin E, Peters J. Cohesin and DNA damage repair. Exp Cell Res. 2006;312: 2687–2693. 10.1016/j.yexcr.2006.06.024 [DOI] [PubMed] [Google Scholar]
- 56.Dorsett D, Strom L. The ancient and evolving roles of cohesin in DNA repair and gene expression. Curr Biol. 2012;22: R240–250. 10.1016/j.cub.2012.02.046 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Benedict B, van Schie JJM, Oostra AB, Balk JA, Wolthuis RMF, te Riele H, et al. WAPL-Dependent Repair of Damaged DNA Replication Forks Underlies Oncogene-Induced Loss of Sister Chromatid Cohesion Article WAPL-Dependent Repair of Damaged DNA Replication Forks Underlies Oncogene-Induced Loss of Sister Chromatid Cohesion. Dev Cell. 2020;52: 683–698. 10.1016/j.devcel.2020.01.024 [DOI] [PubMed] [Google Scholar]
- 58.Tong K, Skibbens R V. Pds5 regulators segregate cohesion and condensation pathways in Saccharomyces cerevisiae. Proc Natl Acad Sci. 2015;112: 7021–7026. 10.1073/pnas.1501369112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Ben-Aroya S, Koren A, Liefshitz B, Steinlauf R, Kupiec M. ELG1, a yeast gene required for genome stability, forms a complex related to replication factor C. Proc Natl Acad Sci U S A. 2003;100: 9906–9911. 10.1073/pnas.1633757100 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Bellaoui M, Chang M, Ou J, Xu H, Boone C, Brown GW. Elg1 forms an alternative RFC complex important for DNA replication and genome integrity. EMBO J. 2003;22: 4304–4313. 10.1093/emboj/cdg406 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Kubota T, Nishimura K, Kanemaki MT, Donaldson AD. The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication. Mol Cell. 2013;50: 273–280. 10.1016/j.molcel.2013.02.012 [DOI] [PubMed] [Google Scholar]
- 62.Kubota T, Katou Y, Shirahige K, Donaldson AD. Replication-Coupled PCNA Unloading by the Elg1 Complex Occurs Genome-wide and Requires Okazaki Fragment Ligation. Cell Rep. 2015;12: 774–787. 10.1016/j.celrep.2015.06.066 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Johnson C, Gali VK, Takahashi TS, Kubota T. PCNA Retention on DNA into G2/M Phase Causes Genome Instability in Cells Lacking Elg1. CellReports. 2016;16: 684–695. 10.1016/j.celrep.2016.06.030 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Longtine MS, McKenzie III A, Demarini DJ, Shah NG, Wach A, Brachat A, et al. Additional Modules for Versatile and Economical PCR-based Gene Deletion and Modification in Saccharomyces cerevisiae. Yeast. 1998;14: 953–961. [DOI] [PubMed] [Google Scholar]
- 65.Tong K, Skibbens R V. Cohesin without cohesion: A novel role for Pds5 in Saccharomyces cerevisiae. PLoS One. 2014;9: 1–14. 10.1371/journal.pone.0100470 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Lopez-Serra L, Kelly G, Patel H, Stewart A, Uhlmann F. The Scc2–Scc4 complex acts in sister chromatid cohesion and transcriptional regulation by maintaining nucleosome-free regions. Nat Genet. 2014;46: 1147–1151. 10.1038/ng.3080 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Baetz KK, Krogan NJ, Emili A, Greenblatt J, Hieter P. The ctf13-30 / CTF13 Genomic Haploinsufficiency Modifier Screen Identifies the Yeast Chromatin Remodeling Complex RSC, Which Is Required for the Establishment of Sister Chromatid Cohesion. Molecular. 2004;24: 1232–1244. 10.1128/MCB.24.3.1232 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Huang J, Hsu JM, Laurent BC. The RSC nucleosome-remodeling complex is required for cohesin’s association with chromosome arms. Mol Cell. 2004;13: 739–750. 10.1016/s1097-2765(04)00103-0 [DOI] [PubMed] [Google Scholar]
- 69.Rowland BD, Roig MB, Nishino T, Kurze A, Uluocak P, Mishra A, et al. Building Sister Chromatid Cohesion: Smc3 Acetylation Counteracts an Antiestablishment Activity. Mol Cell. 2009;33: 763–774. 10.1016/j.molcel.2009.02.028 [DOI] [PubMed] [Google Scholar]
- 70.Sutani T, Kawaguchi T, Kanno R, Itoh T, Shirahige K. Budding Yeast Wpl1(Rad61)-Pds5 Complex Counteracts Sister Chromatid Cohesion-Establishing Reaction. Curr Biol. 2009;19: 492–497. 10.1016/j.cub.2009.01.062 [DOI] [PubMed] [Google Scholar]
- 71.Losada A, Hirano M, Hirano T. Identification of Xenopus SMC protein complexes required for sister chromatid cohesion. Genes Dev. 1998;12: 1986–1997. 10.1101/gad.12.13.1986 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Banerjee S, Myung K. Increased Genome Instability and Telomere Length in the elg1 -Deficient Saccharomyces cerevisiae Mutant Are Regulated by S-Phase Checkpoints. Eukaryot Cell. 2004;3: 1557–1566. 10.1128/EC.3.6.1557-1566.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Kanellis P, Agyei R, Durocher D. Elg1 Forms an Alternative PCNA-Interacting RFC Complex Required to Maintain Genome Stability. Curr Biol. 2003;13: 1583–1595. 10.1016/s0960-9822(03)00578-5 [DOI] [PubMed] [Google Scholar]
- 74.Smolikov S, Mazor Y, Krauskopf A. ELG1, a regulator of genome stability, has a role in telomere length regulation and in silencing. Proc Natl Acad Sci. 2004;101: 1656–1661. 10.1073/pnas.0307796100 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Davidson MB, Katou Y, Keszthelyi A, Sing TL, Xia T, Ou J, et al. Endogenous DNA replication stress results in expansion of dNTP pools and a mutator phenotype. EMBO J. 2012;31: 895–907. 10.1038/emboj.2011.485 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Koc A, Wheeler LJ, Mathews CK, Merrill GF. Hydroxyurea Arrests DNA Replication by a Mechanism That Preserves Basal dNTP Pools. J Biol Chem. 2004;279: 223–230. 10.1074/jbc.M303952200 [DOI] [PubMed] [Google Scholar]
- 77.Tittel-Elmer M, Lengronne A, Davidson MB, Bacal J, Francois P, Hohl M, et al. Cohesin association to replication sites depends on Rad50 and promotes fork restart. Mol Cell. 2012;48: 98–108. 10.1016/j.molcel.2012.07.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Delamarre A, Barthe A, de la Roche Saint-André C, Luciano P, Forey R, Padioleau I, et al. MRX Increases Chromatin Accessibility at Stalled Replication Forks to Promote Nascent DNA Resection and Cohesin Loading. Mol Cell. 2020;77: 395–410. 10.1016/j.molcel.2019.10.029 [DOI] [PubMed] [Google Scholar]
- 79.Fumasoni M, Zwicky K, Lopes M, Branzei D. Error-Free DNA Damage Tolerance and Sister Chromatid Proximity during DNA Replication Rely on the Pola/Primase/Ctf4 Complex. Mol Cell. 2015;57: 812–823. 10.1016/j.molcel.2014.12.038 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Frattini C, Villa-Hernandez S, Pellicano G, Jossen R, Katou Y, Shirahige K, et al. Cohesin Ubiquitylation and Mobilization Facilitate Stalled Replication Fork Dynamics. Mol Cell. 2017;68: 758–772. 10.1016/j.molcel.2017.10.012 [DOI] [PubMed] [Google Scholar]
- 81.Weinert TA, Kiset GL, Hartwell LH. Mitotic checkpoint eenes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 1994;8: 652–665. 10.1101/gad.8.6.652 [DOI] [PubMed] [Google Scholar]
- 82.Morrow DM, Tagle DA, Shiloh Y, Collins FS, Hieter P. TEL1, an S. cerevisiae Homolog of the Human Gene Mutated in Ataxia Telangiectasia, Is Functionally Related to the Yeast Checkpoint Gene MEC1. Cell. 1995;82: 831–840. 10.1016/0092-8674(95)90480-8 [DOI] [PubMed] [Google Scholar]
- 83.Gobbini E, Cesena D, Galbiati A, Lockhart A, Longhese MP. Interplays between ATM/Tel1 and ATR/Mec1 in sensing and signaling DNA double-strand breaks. DNA Repair (Amst). 2013;12: 791–799. 10.1016/j.dnarep.2013.07.009 [DOI] [PubMed] [Google Scholar]
- 84.Williams RM, Yates LA, Zhang X. Structures and regulations of ATM and ATR, master kinases in genome integrity. Curr Opin Struct Biol. 2020;61: 98–105. 10.1016/j.sbi.2019.12.010 [DOI] [PubMed] [Google Scholar]
- 85.Sun Z, Fay DS, Marini F, Foiani M, Stern DF. Spk1/Rad53 is regulated by Mec1-dependent protein phosphorylation in DNA replication and damage checkpoint pathways. Genes Dev. 1996;10: 395–406. 10.1101/gad.10.4.395 [DOI] [PubMed] [Google Scholar]
- 86.Terret M-E, Sherwood R, Rahman S, Qin J, Jallepalli P V. Cohesin acetylation speeds the replication fork. Nature. 2009;462: 231–234. 10.1038/nature08550 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Guillou E, Ibarra A, Coulon V, Casado-Vela J, Rico D, Casal I, et al. Cohesin organizes chromatin loops at DNA replication factories. Genes Dev. 2010;24: 2812–2822. 10.1101/gad.608210 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Morales C, Ruiz-Torres M, Rodríguez-Acebes S, Lafarga V, Rodriguez-Corsino M, Megias D, et al. PDS5 Proteins Are Required for Proper Cohesin Dynamics and Participate in Replication Fork Protection. J Biol Chem. 2020;295: 146–157. 10.1074/jbc.RA119.011099 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Carvajal-Maldonado D, Byrum AK, Jackson J, Wessel S, Lemacon D, Guitton-Sert L, et al. Perturbing cohesin dynamics drives MRE11 nuclease-dependent replication fork slowing. Nucleic Acids Res. 2019;47: 1294–1310. 10.1093/nar/gky519 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Lopez-Serra L, Lengronne A, Borges V, Kelly G, Uhlmann F. Budding yeast Wapl controls sister chromatid cohesion maintenance and chromosome condensation. Curr Biol. 2013;23: 64–69. 10.1016/j.cub.2012.11.030 [DOI] [PubMed] [Google Scholar]
- 91.Guacci V, Koshland D. Cohesin-independent segregation of sister chromatids in budding yeast. Mol Biol Cell. 2012;23: 729–739. 10.1091/mbc.E11-08-0696 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Stead K, Aguilar C, Hartman T, Drexel M, Meluh P, Guacci VA. Pds5p regulates the maintenance of sister chromatid cohesion and is sumoylated to promote the dissolution of cohesion. J Cell Biol. 2003;163: 729–741. 10.1083/jcb.200305080 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Sikdar N, Banerjee S, Lee K, Wincovitch S, Pak E, Nakanishi K, et al. DNA damage responses by human ELG1 in S phase are important to maintain genomic integrity. Cell Cycle. 2009;8: 3199–3207. 10.4161/cc.8.19.9752 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Kenna MA, Skibbens R V. Mechanical link between cohesion establishment and DNA replication: Ctf7p/Eco1p, a cohesion establishment factor, associates with three different replication factor C complexes. Mol Cell Biol. 2003;23: 2999–3007. 10.1128/mcb.23.8.2999-3007.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95.Petronczki M, Chwalla B, Siomos MF, Yokobayashi S, Helmhart W, Deutschbauer AM, et al. Sister-chromatid cohesion mediated by the alternative RF-CCtf18/Dcc1/Ctf8, the helicase Chl1 and the polymerase- -associated protein Ctf4 is essential for chromatid disjunction during meiosis II. J Cell Sci. 2004;117: 3547–3559. 10.1242/jcs.01231 [DOI] [PubMed] [Google Scholar]
- 96.Suter B, Tong A, Chang M, Yu L, Brown GW, Boone C, et al. The Origin Recognition Complex Links Replication, Sister Chromatid Cohesion and Transcriptional Silencing in Saccharomyces cerevisiae. Genetics. 2004;167: 579–591. 10.1534/genetics.103.024851 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Bylund O, Burgers PMJ. Replication Protein A-Directed Unloading of PCNA by the Ctf18 Cohesion Establishment Complex Go. 2005;25: 5445–5455. 10.1128/MCB.25.13.5445 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Borges V, Lehane C, Lopez-Serra L, Flynn H, Skehel M, Rolef Ben-Shahar T, et al. Hos1 Deacetylates Smc3 to Close the Cohesin Acetylation Cycle. Mol Cell. 2010;39: 677–688. 10.1016/j.molcel.2010.08.009 [DOI] [PubMed] [Google Scholar]
- 99.McAlear MA, Tuff KM, Holm C. The Large Subunit of Replication Factor C (Rfclp/Cdc44p) Is Required for DNA Replication and DNA Repair in Saccharomyces cerevisiae. Genetics. 1996;142: 65–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Bylund GO, Burgers PMJ. Replication Protein A-Directed Unloading of PCNA by the Ctf18 Cohesion Establishment Complex. Mol Cell Biol. 2005;25: 5445–5455. 10.1128/MCB.25.13.5445-5455.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Kang M, Ryu E, Lee S, Park J, Ha NY, Ra JS, et al. Regulation of PCNA cycling on replicating DNA by RFC and RFC-like complexes. Nat Commun. 2019;10 10.1038/s41467-019-10376-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102.Zhang J, Shi X, Li Y, Kim BJ, Jia J, Huang Z, et al. Acetylation of Smc3 by Eco1 Is Required for S Phase Sister Chromatid Cohesion in Both Human and Yeast. Mol Cell. 2008;31: 143–151. 10.1016/j.molcel.2008.06.006 [DOI] [PubMed] [Google Scholar]
- 103.Myung K, Smith S. The RAD5-dependent Postreplication Repair Pathway is Important to Suppress Gross Chromosomal Rearrangements. J Natl Cancer Inst Monogr. 2008;39: 12–15. 10.1093/jncimonographs/lgn019.The [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Li Q, Burgess R, Zhang Z. All roads lead to chromatin: Multiple pathways for histone deposition. Biochim Biophys Acta. 2012;1819: 238–246. 10.1016/j.bbagrm.2011.06.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Ulrich HD. New Insights into Replication Clamp Unloading. J Mol Biol. 2013;425: 4727–4732. 10.1016/j.jmb.2013.05.003 [DOI] [PubMed] [Google Scholar]
- 106.Inoue A, Li T, Roby SK, Valentine MB, Inoue M, Boyd K, et al. Loss of ChlR1 Helicase in Mouse Causes Lethality Due to the Accumulation of Aneuploid Cells Generated by Cohesion Defects and Placental Malformation. Cell Cycle. 2007;4101 10.4161/cc.6.13.4411 [DOI] [PubMed] [Google Scholar]
- 107.Laha S, Das SP, Hajra S, Sanyal K, Sinha P. Functional characterization of the Saccharomyces cerevisiae protein Chl1 reveals the role of sister chromatid cohesion in the maintenance of spindle length during S-phase arrest. BMC Genet. 2011;12 10.1186/1471-2156-12-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 108.Minchell NE, Keszthelyi A, Baxter J. Cohesin Causes Replicative DNA Damage by Trapping DNA Topological Stress Article Cohesin Causes Replicative DNA Damage by Trapping DNA Topological Stress. Mol Cell. 2020;78: 1–13. 10.1016/j.molcel.2020.03.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 109.Paul Solomon Devakumar LJ, Gaubitz C, Lundblad V, Kelch BA, Kubota T. Effective mismatch repair depends on timely control of PCNA retention on DNA by the Elg1 complex. Nucleic Acids Res. 2019;47: 6826–6841. 10.1093/nar/gkz441 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 110.Strom L, Lindroos HB, Shirahige K, Sjogren C. Postreplicative Recruitment of Cohesin to Double-Strand Breaks Is Required for DNA Repair. Mol Cell. 2004;16: 1003–1015. 10.1016/j.molcel.2004.11.026 [DOI] [PubMed] [Google Scholar]
- 111.Sjögren C, Ström L. S-phase and DNA damage activated establishment of Sister chromatid cohesion—importance for DNA repair. Exp Cell Res. 2010;316: 1445–1453. 10.1016/j.yexcr.2009.12.018 [DOI] [PubMed] [Google Scholar]
- 112.New L, Liu K, Crouse G. The Yeast Gene MSH3 Defines a New Class of Eukaryotic MutS Homologues. Mol Gen Genet. 1993;239: 97–108. 10.1007/BF00281607 [DOI] [PubMed] [Google Scholar]
- 113.Putnam CD, Kolodner RD. Pathways and Mechanisms that Prevent Genome. Genetics. 2017;206: 1187–1225. 10.1534/genetics.112.145805 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 114.Chakraborty U, Dinh TA, Alani E. Genomic Instability Promoted by Overexpression of Mismatch Repair Factors in Yeast: A Model for Understanding Cancer Progression. Genetics. 2018;209: 439–456. 10.1534/genetics.118.300923 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115.Uhlmann F, Nasmyth K. Cohesion between sister chromatids must be established during DNA replication. Curr Biol. 1998;8: 1095–1102. 10.1016/s0960-9822(98)70463-4 [DOI] [PubMed] [Google Scholar]
- 116.Intyre JM, Muller EGD, Weitzer S, Snydsman BE, Davis TN, Uhlmann F. In vivo analysis of cohesin architecture using FRET in the budding yeast Saccharomyces cerevisiae. EMBO J. 2007;26: 3783–3793. 10.1038/sj.emboj.7601793 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 117.Zhang N, Kuznetsov SG, Sharan SK, Li K, Rao PH, Pati D. A handcuff model for the cohesin complex. J Cell Biol. 2008;183: 1019–1031. 10.1083/jcb.200801157 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 118.Kulemzina I, Schumacher MR, Verma V, Reiter J, Metzler J, Failla AV, et al. Cohesin Rings Devoid of Scc3 and Pds5 Maintain Their Stable Association with the DNA. PLoS Genet. 2012;8 10.1371/journal.pgen.1002856 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 119.Eng T, Guacci V, Koshland D, Bloom KS. Interallelic complementation provides functional evidence for cohesin–cohesin interactions on DNA. 2015. 10.1091/mbc.E15-06-0331 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 120.Cattoglio C, Pustova I, Walther N, Ho JJ, Hantsche-grininger M, Inouye CJ, et al. Determining cellular CTCF and cohesin abundances to constrain 3D genome models. Elife. 2019;8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 121.Lengronne A, Mcintyre J, Katou Y, Kanoh Y, Hopfner K, Shirahige K, et al. Establishment of Sister Chromatid Cohesion at the S. cerevisiae Replication Fork. Mol Cell. 2006;23: 787–799. 10.1016/j.molcel.2006.08.018 [DOI] [PubMed] [Google Scholar]
- 122.Song J, Lafont A, Chen J, Wu FM, Shirahige K, Rankin S. Cohesin Acetylation Promotes Sister Chromatid Cohesion Only in Association with the Replication Machinery. J Biol Chem. 2012;287: 34325–34336. 10.1074/jbc.M112.400192 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 123.Zheng G, Kanchwala M, Xing C, Yu H. MCM2-7-dependent cohesin loading during S phase promotes sister-chromatid cohesion. Elife. 2018;7 10.7554/eLife.33920 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Second biological iteration of Fig 2. Smc3 was detected by a V5 specific antibody, and acetylated Smc3 was detected by a K112/K113 acetylation antibody. PGK was used as a loading control.
(PDF)
[A] 10-fold serial dilution of indicated yeast strains plated on selective medium plates containing no MMS, 0.03% MMS, 0.06% MMS, or 0.1% MMS, and incubated at 23°C for 3 days. [B] 10-fold serial dilution of indicated yeast strains plated on selective medium plates containing no HU, 60mM HU, 120mM HU, or 240mM HU, and incubated at 23°C for 3 days.
(PDF)
DNA content of log phase cells synchronized in G1. Temperature was then shifted to either 32°C or 37°C and cells released into media supplemented with nocodazole. Samples were collected every 15 minutes.
(PDF)
[A] Second biological replicate of Fig 5D. Wildtype cells harboring a 2μ POL30 plasmid results in elevated levels of chromatin-bound PCNA compared to wildtype cells harboring a vector plasmid and elg1Δ single mutant cells. PCNA was detected by a PCNA specific antibody. PGK and H2B was used as a loading control and control for chromatin fractionation. [B] Five times the chromatin fraction was loaded to visualize chromatin-bound PCNA in wildtype cells. [C] Second biological replicate of Fig 5F. Overexpressed PCNA via a high copy 2μ plasmid results in elevated levels of chromatin-bound PCNA compared to wildtype cells harboring a vector plasmid. PCNA was detected by a PCNA specific antibody. PGK and H2B was used as a loading control and control for chromatin fractionation.
(PDF)
(DOCX)
(DOCX)
(DOCX)
Dissection of mcd1-1 elg1Δ Smc3:3V5 mated with msh3Δ. mcd1-1 elg1Δ msh3Δ triple mutant strains are obtained at the expected frequency.
(DOCX)
Data Availability Statement
All original images (gels, blots, etc.), and underlying data and findings are available at FigShare under the following DOI: 10.6084/m9.figshare.12908282.






