Coinfection with Porcine Circovirus Type 2 (PCV2) and Streptococcus suis Serotype 2 (SS2) Enhances the Survival of SS2 in Swine Tracheal Epithelial Cells by Decreasing Reactive Oxygen Species Production

Porcine circovirus type 2 (PCV2) and Streptococcus suis serotype 2 (SS2) clinical coinfection cases have been frequently detected. The respiratory epithelium plays a crucial role in host defense against a variety of inhaled pathogens. Reactive oxygen species (ROS) are involved in killing of bacteria and host immune response. The aim of this study is to assess whether PCV2 and SS2 coinfection in swine tracheal epithelial cells (STEC) affects ROS production and investigate the roles of ROS in bacterial survival and the inflammatory response.

ABSTRACT

Porcine circovirus type 2 (PCV2) and Streptococcus suis serotype 2 (SS2) clinical coinfection cases have been frequently detected. The respiratory epithelium plays a crucial role in host defense against a variety of inhaled pathogens. Reactive oxygen species (ROS) are involved in killing of bacteria and host immune response. The aim of this study is to assess whether PCV2 and SS2 coinfection in swine tracheal epithelial cells (STEC) affects ROS production and investigate the roles of ROS in bacterial survival and the inflammatory response. Compared to SS2 infection, PCV2/SS2 coinfection inhibited the activity of NADPH oxidase, resulting in lower ROS levels. Bacterial intracellular survival experiments showed that coinfection with PCV2 and SS2 enhanced SS2 survival in STEC. Pretreatment of STEC with N-acetylcysteine (NAC) also helps SS2 intracellular survival, indicating that PCV2/SS2 coinfection enhances the survival of SS2 in STEC through a decrease in ROS production. In addition, compared to SS2-infected STEC, PCV2/SS2 coinfection and pretreatment of STEC with NAC prior to SS2 infection both downregulated the expression of the inflammatory cytokines interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), and IL-1β. Further research found that activation of p38/MAPK promoted the expression of inflammatory cytokines in SS2-infected STEC; however, PCV2/SS2 coinfection or NAC pretreatment of STEC inhibited p38 phosphorylation, suggesting that coinfection of STEC with PCV2 and SS2 weakens the inflammatory response to SS2 infection through reduced ROS production. Collectively, coinfection of STEC with PCV2 and SS2 enhances the intracellular survival of SS2 and weakens the inflammatory response through decreased ROS production, which might exacerbate SS2 infection in the host.

INTRODUCTION

Porcine circovirus type 2 (PCV2) is the primary causative agent of postweaning multisystemic wasting syndrome (PMWS) and other porcine circovirus-associated disease (PCVAD) (1). As an immunosuppressive pathogen, PCV2 infection often increases the risk of infection with other viruses and bacteria (2). In clinical settings, PCV2 infection rarely occurs alone and rarely results in disease (3, 4). Streptococcus suis is a common swine bacterial pathogen, causing septicemia, meningitis, pneumonia, and arthritis in pigs (5). A total of 29 serotypes have been identified, and serotype 2 (SS2) has worldwide prevalence and is frequently isolated (6). In recent years, PCV2 and SS2 coinfection cases have been commonly detected in clinical settings (7). Both PCV2 and SS2 can cause infection via the respiratory tract (8, 9).

The respiratory epithelium is the initial site where the inhaled pathogens interact with the host. It is generally believed that microbial pathogens enter into epithelial mucosa, exploiting the rich nutritional environment to replicate and avoiding host immune detection, thereby promoting invasion and infection. The respiratory epithelium has been implicated as a frontline defense against a wide range of pathogens (10, 11). It forms a physical barrier to defend against pathogens, and in addition, it stimulates innate and adaptive immune responses when appropriate (10, 12). Reactive oxygen species (ROS) include superoxide, hydrogen peroxide, hypochlorous acid, and other aerobic metabolites (13). ROS are associated with the host immune response, including killing of pathogens (14), signal transduction (15), and inflammatory response regulation (16). There are a number of ROS-generation systems (17). NADPH oxidase is widely expressed in airway epithelial cells (17) and is an important source of ROS (18, 19). A total of seven isoforms of NADPH oxidase have been found, NOX1, NOX2, NOX3, NOX4, NOX5, DUOX1, and DUOX2 (20). NOX1, NOX2, DUOX1, and DUOX2 have been reported to express in respiratory epithelial cells (17, 20, 21).

In a previous study, we established a PCV2 and SS2-coinfected cell model using swine tracheal epithelial cells (STEC) (22). In this study, this STEC-coinfected cell model was used to evaluate the levels of ROS in STEC coinfected with PCV2 and SS2, and the roles of ROS in the intracellular survival of SS2 and the expression of inflammatory cytokines were studied.

RESULTS

PCV2 and SS2 coinfection decreased ROS production in STEC.

STEC were uninfected or infected with PCV2 for 24 h or 48 h; uninfected cells were then left untreated or pretreated with N-acetylcysteine (NAC) (5 mM) for 1 h before being infected with SS2 strain ZY05719 for 2 h, 4 h, or 6 h. After the indicated infection periods, cells were washed, and the intracellular ROS levels were detected. As shown in Fig. 1, SS2 induced ROS production in STEC as early as 2 h after infection, and the ROS production reached a peak at 4 h and was decreased at 6 h of infection. ROS levels in STEC coinfected with PCV2 and SS2 were lower than those infected with only SS2 at 4 h and 6 h postinfection of SS2. The results indicated that coinfection of STEC with PCV2 and SS2 decreased ROS production compared with STEC infected with only SS2.

FIG 1.

Intracellular ROS generation in STEC. (A and B) STEC were either left uninfected or infected with PCV2 for 24 h (A) or 48 h (B), the uninfected STEC were untreated or pretreated with NAC (5 mM) for 1 h, and then cells were infected with SS2 strain ZY05719 for 2 h, 4 h, or 6 h. ROS production was visualized using fluorescence microscopy and analyzed using ImageJ software. ROS generation in coinfected cells was significantly decreased compared with that in SS2-infected cells. CT, the control group; SS, the SS2-infected group; PS, the PCV2+SS2-infected group; NS, the NAC+SS2-infected group. Data shown are representative of five individual experiments. The results are described as the mean ± SD of five independent experiments. Significant differences were determined using Student’s t test analysis. *, P < 0.05; ***, P < 0.001.

Effects of NADPH oxidase on ROS generation in SS2-infected STEC.

STEC were grown on 24-well plates and pretreated with the NADPH oxidase inhibitor diphenyleneiodonium chloride (DPI) at different concentrations (0 μM, 1 μM, 2 μM, 5 μM, and 10 μM) for 1 h. STEC were then infected with SS2 for 4 h, and ROS levels were assessed afterward. The results showed that ROS levels in SS2-infected STEC were significantly decreased after DPI treatment in a concentration-dependent manner (Fig. 2), suggesting that SS2-induced ROS generation was NADPH oxidase dependent.

FIG 2.

Effects of NADPH oxidase on ROS production in SS2-infected STEC. STEC were untreated or pretreated with the NADPH oxidase inhibitor DPI at the indicated concentrations for 1 h, and the cells were then infected with ZY05719 for 4 h. (A) ROS production in STEC was detected. Data shown are representative of five individual experiments. (B) ROS levels in STEC were quantified. Integrated density was measured using ImageJ software. The results were described as the mean ± SD of five independent experiments. Significant differences were determined using one-way ANOVA. ***, P < 0.001.

PCV2 and SS2-coinfected STEC inhibited cell membrane NADPH oxidase activity and downregulated NOX1 and NOX2 mRNA levels.

PCV2 and SS2 coinfection decreased ROS production in STEC, and SS2-induced ROS production was NADPH oxidase dependent. To evaluate whether coinfection with PCV2 and SS2 affects NADPH oxidase activity, the activity of NADPH oxidase was detected and the mRNA levels of NADPH oxidase homologs were determined. SS2 infection in STEC increased NADPH oxidase activity, and compared with SS2 infection alone, coinfection with PCV2 and SS2 significantly inhibited the activity of NADPH oxidase (Fig. 3A). Moreover, reverse transcription-quantitative PCR (qRT-PCR) assays showed that the mRNA levels of NADPH oxidase isoforms NOX1 and NOX2 in the coinfected STEC were downregulated compared with SS2-infected STEC (Fig. 3B). Meanwhile, the mRNA levels of NADPH oxidase isoforms DUOX1 and DUOX2 in the coinfected STEC were not different from those in the SS2-infected STEC (data not shown). These results indicated that PCV2 and SS2 coinfection in STEC suppressed NADPH oxidase activity and downregulated the mRNA levels of NOX1 and NOX2.

FIG 3.

(A and B) Detection of NADPH oxidase activity and expression of NOX1 and NOX2. STEC were uninfected or infected with PCV2 for 48 h, the uninfected STEC were untreated or pretreated with DPI (10 μM) for 1 h, and cells were then infected with ZY05719 for 4 h. (A) NADPH oxidase activity was detected using a cell NADPH oxidase luminometric assay kit. The NADPH oxidase activity was inhibited when STEC were preinfected with PCV2. (B) qRT-PCR analysis of NOX1 and NOX2 mRNA levels. mRNA of NOX1 and NOX2 were downregulated in coinfected STEC compared with SS2-infected cells. Data are expressed as the mean ± SD of three independent experiments. Significant differences were determined using one-way ANOVA. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

PCV2 and SS2 coinfection enhanced SS2 survival in STEC.

ROS play a vital role in the killing of bacteria (19, 23). In our study, PCV2 and SS2 coinfection inhibited ROS production in STEC. To examine whether the production of ROS is essential for killing of invasive SS2 in STEC, intracellular survival rates of SS2 were calculated in SS2-infected STEC and PCV2/SS2-coinfected STEC. NAC and DPI were used to limit the intracellular ROS levels. The numbers of bacteria recovered from STEC after incubation with antibiotics are shown in Table 1. The results showed that SS2 survival rates in coinfected STEC or STEC treated with NAC or DPI prior to SS2 infection were significantly increased compared with SS2-infected STEC and those not treated with NAC (Fig. 4A). In addition, as shown in Fig. 4A and Table 1, the number of live SS2 in PCV2 and SS2-coinfected STEC was significantly higher than that in STEC pretreated with NAC or DPI after 2 h of antibiotic treatment (P < 0.001). These data suggested that PCV2 and SS2 coinfection increased the survival rate of SS2 in STEC through their effect in decreasing the production of ROS, although there may be other mechanisms that could contribute to increased survival.

TABLE 1.

CFU numbers of recovered bacteria from STEC per well^a

Incubation time of antibiotics	No. of CFU for cells infected with:
	SS2	PCV2+SS2	NAC+SS2	DPI+SS2
1 h	(29.191 ± 5.706) × 103	(21.100 ± 4.307) × 103	(27.133 ± 8.961) × 103	(26.386 ± 4.317) × 103
2 h	(2.042 ± 0.334) × 103	(8.518 ± 2.224) × 103	(4.301 ± 0.437) × 103	(4.968 ± 1.002) × 103
4 h	(0.507 ± 0.119) × 103	(0.916 ± 0.262) × 103	(0.983 ± 0.148) × 103	(0.919 ± 0.143) × 103

^aThe results shown are the mean ± SD of five independent experiments.

FIG 4.

Intracellular survival of SS2 and expression of proinflammatory cytokines. (A) STEC were uninfected or infected with PCV2 for 48 h, and the uninfected cells were pretreated with NAC (5 mM) for 1 h. Then, cells were infected with SS2 for 2 h before being treated with antibiotics for 1 h, 2 h, or 4 h. The results are described as the mean ± SD of five independent experiments. (B) mRNA levels of cytokines IL-6, TNF-α, and IL-1β in different groups were assessed through qRT-PCR assays. The infection time of PCV2 was 48 h, and the infection time of SS2 was 4 h. Data are shown as the mean ± SD of three independent experiments. Significant differences were determined using one-way ANOVA. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

PCV2 and SS2-coinfected STEC downregulated mRNA levels of inflammatory cytokines.

ROS are thought to be involved in the regulation of cytokines (21). In this study, mRNA levels of inflammatory cytokines were determined by qRT-PCR assays. As shown in Fig. 4B, mRNA levels of interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), and IL-1β in SS2-infected STEC were significantly higher than they were in the control STEC (P < 0.001). Interestingly, mRNA levels of inflammatory cytokines in PCV2/SS2-coinfected cells were lower than in SS2-infected cells. In addition, mRNA levels of cytokines were significantly downregulated when STEC were treated with NAC prior to SS2 infection (P < 0.001). These results indicated that the downregulation of inflammatory cytokines in coinfected STEC is related to the low ROS levels.

PCV2 and SS2-coinfected STEC inhibited p38 activation.

As we know, activation of the mitogen-activated protein kinase (MAPK) pathway is important for expression of cytokine in immune cells and epithelial cells (24). ROS was reported to be associated with MAPK activation and MAPK-mediated cytokine expression (15, 25). In the current study, Western blot analysis showed that SS2 infection in STEC induced the phosphorylation of p38 (Fig. 5A). In contrast, the phosphorylation of p38 was significantly inhibited in PCV2/SS2-coinfected STEC or those treated with NAC prior to SS2 infection; the band intensities of p-p38 compared to β-actin were assessed (Fig. 5B), which indicated that PCV2/SS2 coinfection could inhibit the activation of the p38/MAPK signaling pathway through a decrease of ROS production in STEC. In addition, our previous study showed that PCV2 infection in STEC would not induce the phosphorylation of p38 (22).

FIG 5.

Effects of PCV2 and SS2 coinfection on activation of p38 and roles of p38 on expression of proinflammatory cytokines in SS2-infected STEC. (A) STEC were uninfected or infected with PCV2 for 24 h or 48 h, and the uninfected cells were pretreated with NAC (5 mM) for 1 h. The cells were then infected with SS2 for 4 h. Activation of p38, ERK, and JNK in STEC was detected by Western blotting. CT, the control group; SS, the SS2-infected group; PS, the PCV2+SS2-infected group; NS, the NAC+SS2-infected group. (B) Band densities of p-p38 in different groups were analyzed using ImageJ. (C) Cells were untreated or pretreated with different concentrations of p38 inhibitor SB203580 before SS2 infection. mRNA levels of cytokines IL-6, TNF-α, and IL-1β were assessed with qRT-PCR assays. Data are shown as the mean ± SD of three independent experiments. Significant differences were determined using one-way ANOVA. ns, not significant; **, P < 0.01; ***, P < 0.001.

Inhibition of p38/MAPK reduced mRNA levels of inflammatory cytokines in SS2-infected STEC.

To investigate whether the phosphorylation of p38 is essential for expression of inflammatory cytokines in SS2-infected STEC, cells were treated with different concentrations of the p38 inhibitor SB203580 (1 μM, 2 μM, and 10 μM) prior to SS2 infection. The total RNA was isolated, and qRT-PCR assays were performed. The results showed that inhibition of p38 with 2 μM or 10 μM SB203580 significantly reduced mRNA levels of IL-6, TNF-α, and IL-1β (Fig. 5C). In the above studies, we found that STEC coinfected with PCV2 and SS2 or STEC treated with NAC prior to SS2 infection inhibited the phosphorylation of p38 and reduced the mRNA levels of cytokines; these data indicate that PCV2/SS2 coinfection in STEC reduced ROS production, resulting in inhibition of p38/MAPK and lower expression of proinflammatory cytokines compared with SS2 infection alone.

DISCUSSION

ROS are commonly present in living organisms (26). In fact, host production of ROS is a strategy for responding to pathogens (27, 28). ROS can destroy pathogens through direct or indirect interaction with key components of microorganisms; ROS can alter the DNA, RNA, proteins, and lipids of pathogens and stimulate the production of proteases by changing the surrounding environment of invading pathogens, resulting in the destruction of proteins (23). NADPH oxidase is a major source of ROS in both immune cells and epithelial cells (20, 29). In this study, SS2 infection resulted in mRNA upregulation of the NADPH oxidase isoforms, NOX1 and NOX2, and increased the activity of NADPH oxidase. NOX are membrane-bound proteins and function to transfer electrons across the membrane and generate superoxide (19). SS2 infection resulted in the induction of ROS production in STEC through activation of NADPH oxidase. Compared to SS2 infection, PCV2/SS2 coinfection in STEC significantly suppressed NADPH oxidase activity and reduced the ROS levels.

Adhesion and invasion of epithelial cells of the host are the first steps of colonization by mucosal pathogens (9). In our previous and present studies, PCV2 infection did not increase the adhesion or invasion of SS2 to STEC (22). Intracellular survival data showed that reducing the levels of ROS in STEC with NAC or DPI was beneficial for the intracellular survival of SS2, indicating that the increased intracellular survival rate of SS2 in PCV2/SS2-coinfected STEC is related to the lower ROS levels. Similarly, a previous study showed that inhibition of NADPH oxidase-dependent ROS production in intestinal epithelial cells promoted the intracellular survival of Vibrio parahaemolyticus (30). Intracellular survival of bacteria in respiratory epithelium facilitates bacterial replication, escape from phagocytosis by phagocytic cells, and shelter from antimicrobial drugs (11).

Additionally, ROS are used as signaling molecules in immunity (14). ROS have been reported as capable of activating MAPK signaling pathways, which comprised p38, extracellular signal-regulated kinase (ERK) 1/2, and Jun N-terminal protein kinase (JNK). MAPK signaling pathways are essential regulatory components of inflammatory responses (31). For instance, activation of p38 in herpes simplex virus-infected murine microglia was shown to be ROS-dependent and to regulate cytokine and chemokine production (15); lipopolysaccharide from Gram-negative bacteria was shown to upregulate ROS levels and induce phosphorylation of p38/MAPK; in turn, p38 regulates TNF-α production in alveolar epithelial cells (25). Oxidative stress of airway epithelial cells regulates the TRPC6-mediated Ca²⁺ cascade, leading to the activation of the ERK signaling pathway and causing inflammation (32). In the current study, SS2 infection was shown to activate the p38/MAPK signaling pathway by producing ROS, resulting in upregulation of the inflammatory cytokines IL-6, TNF-α, and IL-1β. Compared to SS2 infection, PCV2/SS2-coinfected or NAC-pretreated STEC reduced intracellular ROS levels, inhibited the phosphorylation of p38, and downregulated expression levels of inflammatory cytokine. These results suggested that coinfection with PCV2 and SS2 could inhibit the activation of the p38/MAPK signaling pathway and lead to downregulation of inflammatory cytokines through decreased ROS production in STEC. It is well known that proper inflammatory response helps protect against pathogen infection. While PCV2/SS2 coinfection in STEC limited the production of cytokines, this might contribute to the survival of SS2 in the early stage of infection and promotes the occurrence and development of disease.

Taken together, compared to SS2-infected STEC, PCV2/SS2-coinfected STEC promoted SS2 intracellular survival and reduced the expression of inflammatory cytokines IL-6, TNF-α, and IL-1β by decreasing ROS production, which might facilitate SS2 infection in vivo. This study will help us further understand the pathogenic mechanism of coinfection with PCV2 and SS2 and might provide new insight for the control of PCV2 and SS2 coinfections in clinical settings.

MATERIALS AND METHODS

Cell lines, virus, and bacteria.

The porcine kidney 15 (PK15) cells and immortalized STEC used in this study were maintained in Dulbecco Modified Eagle medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) at 37°C with 5% CO₂.

The PCV2 strain used in this study was originally isolated from Anhui, China, and propagated in PK15 cells. The virus stock was prepared in PK15 cells with a titer of 10^6.5 50% tissue culture infective dose (TCID₅₀)/ml.

The SS2 strain used in this study, ZY05719, was isolated from a diseased pig in Sichuan, China, in 2005. Bacteria were grown on Todd-Hewitt agar (THA) plates or in Todd-Hewitt broth (THB; BD, USA) at 37°C.

Cell infection experiments.

STEC were seeded on 24-well plates and cultured to approximately 80 to 90% confluence at 37°C in 5% CO₂. Cells were uninfected or infected with PCV2 at a multiplicity of infection (MOI) of 1 for 24 h or 48 h. SS2 strain ZY05719 was cultured in THB to log-phase (optical density at 600 nm [OD₆₀₀], 0.7). After three washes with phosphate-buffered saline (PBS), the bacteria were suspended in DMEM without FBS. The cells were then infected with ZY05719 at an MOI of 30 (1.5 × 10⁷ CFU/well). To determine this MOI, different MOIs were performed, and the numbers of surviving SS2 and cell viability were assessed (data not shown). The cell plates were centrifuged at 800 × g for 10 min at room temperature and incubated at 37°C with 5% CO₂ to designated time points.

Determination of intracellular ROS levels.

Intracellular ROS levels of STEC were detected using a ROS assay kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. The same measuring method is described in the reference (33). Briefly, at designated time points, cells were washed twice with DMEM and incubated in 500 μl DMEM containing 10 μM 2′, 7′-dichlorodihydrofluorescein diacetate (DCFH-DA) for 30 min at 37°C with 5% CO₂ in the dark. Afterward, cells were washed twice with DMEM, fluorescence was imaged using a fluorescence microscope (Zeiss, Germany), and the fluorescence intensity was analyzed using ImageJ software (National Institutes of Health, USA). Experiments were performed as five independent replicates.

Intracellular survival assays.

STEC were uninfected or infected with PCV2 for 48 h, and the uninfected cells were untreated or treated with 5 mM NAC (a ROS scavenger; Beyotime, Shanghai, China) or 10 μM DPI (NADPH oxidase inhibitor; MCE, USA) for 1 h (34). STEC were then incubated with ZY05719 for 2 h. Cells were washed with PBS to remove nonadherent bacteria and incubated in DMEM containing 5 μg/ml penicillin (Solarbio, Beijing, China) and 100 μg/ml gentamicin (Solarbio, Beijing, China) for 1 h, 2 h, and 4 h. After the incubation, cells were washed again with PBS to remove the antimicrobials. The infected STEC were lysed with double-distilled water (ddH₂O), and the lysate was serially diluted for spot plating to determine the number of intracellular bacteria. The intracellular survival rate was expressed as CFU_{2 h}/CFU_{1 h} × 100% and CFU_{4 h}/CFU_{1 h}. Experiments were performed as five independent replicates.

Measurement of NADPH oxidase activity.

STEC were cultured to approximately 80 to 90% confluence on 100-mm cell plates. Both uninfected STEC and those infected with PCV2 for 48 h were untreated or pretreated with 10 μM DPI (MCE, USA) for 1 h and then infected with SS2 for 4 h (35). After experimental treatments, NADPH oxidase activity was determined using a cell NADPH oxidase luminometric assay kit (GenMed Scientifics, Inc., USA) according to the manufacturer’s instructions. The absorbance value at 340 nm directly reflects NADPH oxidase activity and was measured with Tecan Infinite 200 Pro. Data were obtained from three separate experiments.

RNA isolation and qRT-PCR assays.

Total RNA was extracted from STEC using TRIzol (TaKaRa, Japan), and cDNA was generated using the HiScript Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China) according to the manufacturer’s instructions.

qRT-PCR assays were performed in triplicate using ChamQ Universal SYBR qPCR master mix (Vazyme, Nanjing, China) and an ABI StepOne real-time PCR system (Applied Biosystems, USA). GAPDH was used as an internal control. The primer sequences are listed in Table 2. The relative gene expression was calculated based on the 2^−ΔΔCT method. Assays were performed as three independent experiments.

TABLE 2.

Primers used in this study

Primer	Sequence (5′–3′)
NOX1 F	TCTTAGGGTAGGGCTGGTCT
NOX1 R	AGATGCACACCTACCCACAA
NOX2 F	TGAGTCACAGGCCAATCACT
NOX2 R	TCTGGTAGTGGGGTGTTGAC
DUOX1 F	AGGTGGAGATCAGTGTGGTG
DUOX1 R	TCAGTGTGAAGGGGTGGTAC
DUOX2 F	CTCTGATAGGTCCCCGTGTC
DUOX2 R	ACCCTGTCCTCCCTCAAATG
IL-6 F	GGAGACCTGCTTGATGAGAATC
IL-6 R	CAGCCTCGACATTTCCCTTAT
TNF-α F	CCTACTGCACTTCGAGGTTATC
TNF-α R	ACGGGCTTATCTGAGGTTTG
IL-1β F	TGAATTCGAGTCTGCCCTGT
IL-1β R	AGTCCCCTTCTGTCAGCTTC
GAPDH F	GATGCTGGTGCTGAGTATGT
GAPDH R	GGCAGAGATGATGACCCTTT

Western blotting.

For coinfection, STEC were infected with PCV2 for 24 h or 48 h and then infected with SS2 for 4 h; for SS2 single infection, NAC-pretreated or -untreated STEC were infected with SS2 for 4 h. STEC were washed with PBS and lysed in SDS-PAGE sample loading buffer (Beyotime, Shanghai, China) with protease inhibitor cocktail (MCE, USA) on ice. After being heated at 95°C for 15 min, samples were centrifuged at 12,000 × g for 10 min at 4°C. Equal amounts of lysates were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). The membranes were blocked with 5% (wt/vol) nonfat milk in TBST (0.01 M Tris-buffered saline containing 0.05% Tween 20) for 2 h at 37°C and incubated with primary antibodies overnight at 4°C. The primary antibodies used in the study are as follows: phospho-p38 MAPK (Thr180/Tyr182) rabbit monoclonal antibody (MAb) and p38 MAPK rabbit MAb, phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) rabbit MAb and p44/42 MAPK (Erk1/2) rabbit MAb, phospho-SAPK/JNK (Thr183/Tyr185) rabbit MAb and JNK rabbit MAb (1:1,000; Cell Signaling Technology, USA), and anti-beta actin mouse MAb (1:5,000; CMCTAG, USA). After antibody incubation, the membranes were washed with TBST and incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at 37°C, including HRP-goat anti-rabbit IgG H+L and HRP-goat anti-mouse IgG H+L (1:5,000; CMCTAG, USA). The protein bands were detected with ECL Pico-Detect Western blotting substrate (CMCTAG, USA) according to the manufacturer’s instructions. Band intensities were analyzed by Image J software.

Inhibition assays.

For NADPH oxidase activity inhibition, in our study, STEC were pretreated with different concentrations of DPI inhibitor (MCE, USA) for 1 h before SS2 infection; treatments of equal volumes of DMSO served as controls. For limiting ROS levels, STEC were pretreated with 5 mM NAC (Beyotime, Shanghai, China) for 1 h before SS2 infection (34). To inhibit the activity of p38, different concentrations of p38 MAPK inhibitor SB203580 (MCE, USA) were added, and STEC were incubated for 1 h before SS2 infection.

Statistical analysis.

All data are described as the mean ± standard deviation (SD) of at least 3 independent experiments. Each experiment was performed in triplicate. Statistical analysis was performed using Student’s t test and one-way analysis of variance (ANOVA). GraphPad Prism 5 (GraphPad Software, Inc., USA) was used for statistical analysis of data and generation of figures. A P value of <0.05 was considered statistically significant.