Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2020 Oct 19;88(11):e00527-20. doi: 10.1128/IAI.00527-20

Cigarette Smoke Exposure Promotes Virulence of Pseudomonas aeruginosa and Induces Resistance to Neutrophil Killing

Jason Chien a,b,#, John H Hwang a,b,#, Sedtavut Nilaad a,b,#, Jorge A Masso-Silva a,b,#, Sae Jeong Ahn a,b, Elisa K McEachern a,b, Alexander Moshensky a,b, Min-Kwang Byun a,b,c, Laura E Crotty Alexander a,b,✉
Editor: Victor J Torresd
PMCID: PMC7573448  PMID: 32868344

It is widely known that cigarette smoke damages host defenses and increases susceptibility to bacterial infections. Pseudomonas aeruginosa, a Gram-negative bacterium that commonly colonizes the airways of smokers and patients with chronic lung disease, can cause pneumonia and sepsis and can trigger exacerbations of lung diseases. Pseudomonas aeruginosa colonizing airways is consistently exposed to inhaled cigarette smoke. Here, we investigated whether cigarette smoke alters the ability of this clinically significant microbe to bypass host defenses and cause invasive disease.

KEYWORDS: cigarette smoke, Pseudomonas aeruginosa, neutrophil, oxidative burst, biofilm, pneumonia, bacterial virulence

ABSTRACT

It is widely known that cigarette smoke damages host defenses and increases susceptibility to bacterial infections. Pseudomonas aeruginosa, a Gram-negative bacterium that commonly colonizes the airways of smokers and patients with chronic lung disease, can cause pneumonia and sepsis and can trigger exacerbations of lung diseases. Pseudomonas aeruginosa colonizing airways is consistently exposed to inhaled cigarette smoke. Here, we investigated whether cigarette smoke alters the ability of this clinically significant microbe to bypass host defenses and cause invasive disease. We found that cigarette smoke extract (CSE) exposure enhances resistance to human neutrophil killing, but this increase in pathogenicity was not due to resistance to neutrophil extracellular traps. Instead, Pseudomonas aeruginosa exposed to CSE (CSE-PSA) had increased resistance to oxidative stress, which correlated with increased expression of tpx, a gene essential for defense against oxidative stress. In addition, exposure to CSE induced enhanced biofilm formation and resistance to the antibiotic levofloxacin. Finally, CSE-PSA had increased virulence in a model of pneumonia, with 0% of mice infected with CSE-PSA alive at day 6, while 28% of controls survived. Altogether, these data show that cigarette smoke alters the phenotype of P. aeruginosa, increasing virulence and making it less susceptible to killing by neutrophils and more capable of causing invasive disease. These findings provide further explanation of the refractory nature of respiratory illnesses in smokers and highlight cigarette smoking as a potential driver of virulence in this important airway pathogen.

INTRODUCTION

Despite dramatic reductions in prevalence, cigarette smoking continues to be one of the leading causes of death, disease, and ill health. It is estimated that direct and secondhand exposure to cigarette smoke are responsible for nearly 6 million deaths a year, causing a plethora of diseases that include lung cancer, stroke, chronic obstructive pulmonary disease (COPD), and other chronic illnesses worldwide (1).

Cigarette smokers also have higher rates of respiratory tract infections and more severe presentations (2). Prior research in this area has primarily focused on the impact of cigarette smoke on host respiratory health and airway function. Cigarette smoke contains nitric oxide, acrolein, acetaldehyde, formaldehyde, and free radical elements (3–5) that lead to structural changes in humans, including disruption of airway epithelial cells and thus reduced mucociliary clearance of potential bacterial pathogens (6, 7). Similarly, smoking leads to a hypersecretion of mucus and impediment of epithelial elastic properties that lead to chronic inflammation, a feature that is increasingly associated with higher rates of infection (8–12).

The primary innate immune cells of host defense are also adversely impacted by cigarette smoke exposure. Neutrophils, the first cells recruited to a site of infection, are vital in our immune response against bacterial pathogens. The airways of cigarette smokers have higher numbers of neutrophils due to higher rates of recruitment (13, 14). Their arsenal of antimicrobial weapons includes phagocytosis and production of reactive oxygen species (ROS), antimicrobial peptides, and neutrophil extracellular traps (NETs). In particular, neutrophils sequester phagocytosed microorganisms in phagolysosomes for degradation with ROS. In their study, Dunn et al. found that human neutrophils exposed to smoke ex vivo had greatly reduced ROS production (15, 16). In conjunction with this finding, Xu et al. showed that HL60 cells differentiated into immature neutrophils had a suppressed bacterial killing capacity when exposed to cigarette smoke during development (16). Overall, cigarette smoking impedes numerous host defense mechanisms in the lungs.

Cigarette smoke affects not only host cells but also the bacteria that are present in the airways (17). Previously, we determined that cigarette smoke directly enhanced the virulence of another common human pathogen, Staphylococcus aureus (18), which has been corroborated by other groups (19). In addition, we found that exposure of S. aureus to electronic cigarettes (e-cigarettes) also alters its virulence level through a separate mechanism (20). El Ahmer et al. found that cigarette smoke enhances the binding of multiple pathogens, such as Neisseria meningitidis, Streptococcus pneumoniae, and S. aureus, to epithelial buccal cells (21). These findings were corroborated by a separate in vivo study in which rats chronically exposed to cigarette smoke had a greater attachment of S. pneumoniae bacteria to cells of the oral airway (22).

Pseudomonas aeruginosa, a common airway pathogen which plays a prominent role in the progression and exacerbation of chronic diseases (23, 24), has also been studied. Antunes et al. showed that cigarette smoke exposure promoted pseudomonal biofilm production (25), and Goldstein-Daruech et al. showed that P. aeruginosa isolates from smokers had higher biofilm production when challenged with cigarette smoke, relative to isolates from nonsmokers (26). Simple overgrowth of this bacterium in the airways is known to drive pulmonary disease exacerbations in COPD and bronchiectasis (27–33).

To further understand the dynamic interplay between cigarette smoking, infection, and immunity, we undertook these studies to define the effects of cigarette smoke on the virulence of P. aeruginosa.

RESULTS

Cigarette smoke exposure increases pseudomonal resistance to neutrophil killing.

Because neutrophils are a key player in clearing P. aeruginosa infection, we assessed the effect of cigarette smoke on this human pathogen in terms of susceptibility to neutrophil killing. Neutrophils were isolated from the blood of healthy human subjects and infected with control P. aeruginosa strain PAO1 versus cigarette smoke extract-exposed Pseudomonas aeruginosa (CSE-PSA). Control P. aeruginosa succumbed to neutrophil killing by 60 minutes, with reduced bacterial counts compared with time 0 min, while CSE-PSA was resistant to neutrophil killing (P < 0.0001) (Fig. 1A). In addition, a single exposure to different doses of CSE prior to infection of neutrophils demonstrated a dose-dependent effect, with 75% CSE inducing more resistance to neutrophil killing than 25% CSE and 50% CSE (Fig. 1B). CSE is known to have direct cytotoxic effects on human cells (34, 35). Therefore, to exclude the possibility that residual CSE from the CSE-PSA samples could be killing the neutrophils and thus leading to the increased bacterial survival seen with CSE-PSA, we assessed neutrophil viability by propidium iodide uptake after exposure to bacterial supernatants from both control and CSE-PSA samples. Cell viability was similar across supernatant exposures (Fig. 1C), which demonstrates that the several washes of the bacteria sufficiently removed the potential cytotoxic effect of residual CSE prior to infection of the neutrophils. These data suggest that exposure of CSE to P. aeruginosa confers resistance to neutrophil killing in a dose-dependent manner.

FIG 1.

FIG 1

Pseudomonas aeruginosa becomes resistant to neutrophil killing after cigarette smoke exposure. (A) Neutrophil killing in vitro assay. P. aeruginosa was grown to mid-log phase in media with and without 75% CSE. P. aeruginosa exposed to 75% CSE for 2 hours prior to infection of human neutrophils was resistant to neutrophil killing relative to control P. aeruginosa. (B) CSE-mediated acquired resistance to neutrophil killing was dose dependent. Exposures were done in 12 wells each, for 60 minutes, and experiments repeated 6 times. (C) Incubation with bacterial supernatants did not affect neutrophil viability, as measured by propidium iodide uptake by flow cytometric analysis. Data represent relative change compared with that of controls. *, P < 0.05; ****, P < 0.001.

Cigarette smoke exposure slows pseudomonal growth.

Pseudomonal growth is crucial during infection; hence, we assessed whether CSE can affect growth. We found that exposure to CSE dampens pseudomonal growth in a dose-dependent manner. Growth curves demonstrate normal, high growth rates of control P. aeruginosa, with dose-dependent slowing as CSE concentrations are increased (Fig. 2A). Thus, increased numbers of CSE-PSA in the setting of neutrophil infection was not due to overgrowth as a result of CSE exposure. These data suggest that CSE might induce alterations in P. aeruginosa pathogenicity, which can explain the greater survival of CSE-PSA during neutrophil infection.

FIG 2.

FIG 2

Cigarette smoke suppresses pseudomonal growth and promotes biofilm production. (A) CSE impairs bacterial growth. Control P. aeruginosa (blue) was cultured in MBM, at 37°C with shaking, and absorbance at 600 nm was measured over time. Each dose was tested in triplicate, with experiments repeated 3 times. (B) Cigarette smoke exposure for 2 hours induced mild alterations in surface charge since PLL-FITC binding was similar at 0.02 μg/ml and 2 μg/ml but different at 0.2 μg/ml. Each dose was tested in triplicate, with experiments repeated 3 times. Blue and black bars represent control P. aeruginosa and CSE-PSA, respectively. (C) Overnight exposure of P. aeruginosa to CSE significantly increased the production of extracellular biofilm relative to control counterparts at 25%, 50%, and 75% doses. Absorbance values reflecting the amount of biofilm per well were generated over 9 in vitro trials. (D) Cell surface hydrophobicity assessment by adhesion to n-hexadecane. The experiment was performed three times in triplicates. ****, P < 0.0001.

Cigarette smoke exposure does not promote cationic binding to the surface of Pseudomonas aeruginosa.

Our previous research with S. aureus and methicillin-resistant S. aureus (MRSA) demonstrated that CSE induced changes in the surface of these Gram-positive bacteria, causing the bacteria to become more positively charged, which diminished the ability of antimicrobial peptides to bind to the surface and eliminate the bacteria (18). To see if similar effects of CSE occur in P. aeruginosa, we assessed binding by a positively charged molecule, poly-l-lysine (PLL) labeled with fluorescein isothiocyanate (FITC). Interestingly, PLL-FITC binding to CSE-PSA was increased relative to control P. aeruginosa at 0.2 μg/ml but not at 2 μg/ml PLL-FITC (Fig. 2B). These data show that CSE does not necessarily increase virulence by inducing P. aeruginosa to develop a more positively charged surface (Fig. 2B). Thus, although the surface charge of S. aureus strains become more positively charged in response to cigarette smoke at a concentration of 2 μg/ml PLL-FITC (18), this does not occur with the Gram-negative pathogen P. aeruginosa, and we found differences in surface charge only at a lower concentration of 0.2 μg/ml PLL-FITC.

Exposure to cigarette smoke increases P. aeruginosa biofilm formation.

The production of biofilms is a key virulence factor for many microbial pathogens. As P. aeruginosa is a prolific maker of biofilm structural components and other researchers have demonstrated increased biofilm production in response to cigarette smoke (25, 26), we sought to determine whether exposure of P. aeruginosa PAO1 to CSE in our system would lead to increased biofilm production. A comparison of biofilm production by control P. aeruginosa versus CSE-PSA demonstrated a 1.6- to 2.8-fold increase in biofilm mass in wells containing P. aeruginosa exposed to 25% to 75% CSE (P < 0.01) (Fig. 2C). Thus, in our system, a single exposure with 25% to 75% CSE can induce biofilm formation in P. aeruginosa.

Cigarette smoke does not affect hydrophobicity.

Previous studies have found that increased hydrophobicity can lead to enhance bacterial biofilm formation. Thus, we sought to evaluate whether CSE-mediated enhanced biofilm formation may be attributed to higher hydrophobicity. Hydrophobicity was determined by adhesion to n-hexadecane as previously described (36). We found that CSE does not induce significant changes in bacterial cell surface hydrophobicity (Fig. 2D), which suggests that other factors are involved in the CSE-mediated biofilm formation in P. aeruginosa.

Antibiotic resistance.

It is known that biofilm formation can confer resistance to antibiotics (37). In addition, a recent study has shown that CSE can induce antibiotic resistance in S. aureus (19). Thus, we sought to investigate for changes in pseudomonal antibiotic resistance to two different antibiotics commonly used to treat clinical infections, namely, gentamicin (an aminoglycoside) and levofloxacin (a fluoroquinolone), and also the antimicrobial peptide LL-37. MICs were determined with P. aeruginosa and CSE-PSE at a wide range of levofloxacin, gentamicin, and LL-37 doses and demonstrated that cigarette smoke exposure induced resistance to levofloxacin (Table 1). We also analyzed genes of multidrug efflux pumps that have shown to be involved in antibiotic resistance, such as mexA, mexX, and mexZ, and found that these three genes were upregulated upon exposure to CSE (Fig. 3A to C). Altogether, these data show that CSE induced resistance to levofloxacin and upregulated expression of multidrug efflux pumps.

TABLE 1.

Antimicrobial resistance of Pseudomonas aeruginosa to levofloxacin was increased by exposure to cigarette smokea

Antimicrobial MIC (μg/ml) at:
P value
0% CSE 75% CSE
Levofloxacin 3.58 ± 1.7 4.24 ± 2.16 0.018
Gentamicin 2.13 ± 0.62 2.58 ± 0.95 0.077
LL-37 44.44 ± 25.20 21.33 ± 9.23 0.21
a

Antimicrobial resistance to gentamicin and human antimicrobial peptide LL-37 was not affected by CSE exposure. MIC assays were repeated >3 times, with biological triplicates.

FIG 3.

FIG 3

Cigarette smoke upregulated genes involved in multidrug efflux pumps. CSE increased the expression of mexA (A), mexX (B), and mexZ (C). Gene expression was analyzed using the comparative CT method using rspL as a housekeeping gene. Experiments were performed three times in triplicates. **, P < 0.01; ***, P < 0.005.

Cigarette smoke generates a protective response against oxidative stress.

To assess how CSE exposure leads to the protection of P. aeruginosa from neutrophil killing, neutrophil antimicrobial mechanisms were assayed. While no differences were seen in the susceptibility of P. aeruginosa and CSE-PSA to neutrophil extracellular trap (NET)-based killing (data not shown), bacteria exposed to cigarette smoke exhibited resistance to reactive oxygen species (ROS), simulated via H2O2 exposure (P < 0.01) (Fig. 4A). Moreover, we found a CSE dose-dependent protection against neutrophil killing (Fig. 1B), which was further mirrored in H2O2 killing assays, where CSE exposure lead to a protective response, allowing CSE-PSA to survive, despite treatment with different doses of H2O2 that are lethal to control P. aeruginosa (Fig. 4B and C). Exposure to increasing concentrations of CSE induces resistance to H2O2, demonstrating a dose effect (Fig. 4B and 4C). These data suggest that exposure to CSE generates a protective response against oxidative burst, one of the primary mechanisms by which neutrophils kill pathogens within the phagolysosome (38). Finally, in order to better understand the mechanism of this CSE-mediated resistance to H2O2, we assessed the expression of four genes that are known to protect bacteria against oxidative insults, namely, thiol peroxidase (tpx) and glutathione peroxidase (gpx) and two catalases (katA and katB) (39, 40). We found that the acquired protective effect of CSE exposure (inducing resistance to oxidative burst) was associated with increased expression of tpx (Fig. 4D). Although gpx trended upward, it was not significantly increased in CSE-PSA compared with that of P. aeruginosa (Fig. 4E). Moreover, expression of the catalases katA and katB were not affected by CSE (Fig. 4F and 4G, respectively). Thus, these data suggest that the conferred resistance to neutrophil killing mediated by CSE exposure could be attributed in part through an acquired resistance to ROS, which correlates with increased gene expression of thiol peroxidase, which has been previously shown to promote bacterial resistance to oxidative stress.

FIG 4.

FIG 4

Exposure to cigarette smoke induced resistance to killing by reactive oxygen species (ROS). (A) CSE-PSA was resistant to be killed by exposure to 0.375% H2O2, compared to all control P. aeruginosa. CSE-mediated resistance to H2O2 was dose dependent, with 75% CSE conferring complete protection, 25% to 50% CSE conferring partial protection at 0.75% H2O2 (B), and 75% and 50% CSE conferring protection at twice the dose H2O2 (1.5%) (C). Experiments were repeated 6 times. In addition, the expression of genes involved in oxidative stress were evaluated and showed that thiol peroxidase (tpx) was upregulated (D), although glutathione peroxidase (gpx) (E), catalase KatA (G), and catalase KatB (G) did not change. Experiments were performed three times in triplicates.* P < 0.05, ** P < 0.01.

Cigarette smoke increases pseudomonal virulence in a murine model of pneumonia.

Finally, to assess whether the effects on P. aeruginosa virulence mechanisms induced by CSE in vitro and ex vivo may have physiologically relevant consequences, CD-1 mice were infected intranasally with control P. aeruginosa or CSE-PSA. Within 72 hours of infection, only 50% of CSE-PSA-infected mice were surviving, while all mice in the control P. aeruginosa group were alive (Fig. 4). By 6 days postinfection, all CSE-PSA-infected mice succumbed to infection, while 28% of control P. aeruginosa mice survived (P < 0.05) (Fig. 5). These data demonstrate that CSE exposure increases P. aeruginosa virulence.

FIG 5.

FIG 5

Pseudomonas aeruginosa exposed to cigarette smoke had a higher virulence in a mouse model of pneumonia. A total of 100% of mice infected with CSE-PSA died within 6 days, while 28% of mice infected with control P. aeruginosa survived. n = 7 for control group (0%), n = 8 for CSE group (75%). Experiments were performed twice.

DISCUSSION

Cigarette smoking is one of the leading causes of death, disease, and ill health (1). Some of these life-threatening diseases are related to respiratory tract infections (2), and most studies have focused on the effects of CSE on host health. However, few studies have targeted the effects of CSE on the bacterial pathogens that can infect the airways (18, 19, 21, 22). Previously, we found that CSE enhanced the virulence of Staphylococcus aureus (18), which has been corroborated by other groups (19). Despite this, there is poor knowledge about the effects of CSE on the relevant bacterial pathogen Pseudomonas aeruginosa, a common airway pathogen (23, 24).

The study presented here demonstrates that cigarette smoke exposure may drive P. aeruginosa resistance to oxidative stress and neutrophil killing. First, we found that P. aeruginosa exposed to CSE was protected from neutrophil killing (Fig. 1A) in a dose-dependent manner (Fig. 1B) with no residual cytotoxic effect present in the bacterial suspension prior to infecting neutrophils, which could account for bacterial survival (Fig. 1C). Second, in exploring this observed phenotype of resistance to neutrophil killing, we found that CSE can affect P. aeruginosa growth in vitro in a dose-dependent manner (Fig. 2A). Cigarette smoke has been previously shown to inhibit bacterial growth in vitro (41). Furthermore, we also assessed changes in cell surface charge, which might make bacteria more susceptible or resistant to antimicrobial peptides (42), and found no major differences in P. aeruginosa and CSE-PSA at high concentrations of PLL-FITC (2 μg/ml). In fact, exposure at a concentration of 0.2 μg/ml of PLL-FITC shows CSE-PSA to be more susceptible to cationic antimicrobial binding (Fig. 2B). Another important virulence mechanism of P. aeruginosa and bacteria in general is biofilm formation. Biofilms are tenaciously attached to surfaces and impede the ability of host defense molecules and cells to penetrate them (43). We found that CSE induces biofilm formation in P. aeruginosa in a dose-dependent manner (Fig. 2C). As others have shown, cigarette smoke exposure is a strong driver of biofilm production in a range of pathogenic microbes, including S. aureus and P. aeruginosa (25, 26, 44). Our biofilm studies are consistent with prior studies, demonstrating that cigarette smoke induces biofilm production in this Gram-negative bacteria, potentially as a mechanism to defend the bacteria from the toxins within cigarette smoke. Related to this information, it is known that increases in cell surface hydrophobicity can enhance biofilm formation (45), so we tested whether CSE can cause changes in cell surface hydrophobicity and found no differences (Fig. 2D). Thus, enhanced biofilm formation cannot be explained by changes in hydrophobicity and other mechanisms should be involved.

In addition, since our previous study with methicillin-resistant Staphylococcus aureus (MRSA) showed that cigarette smoke exposure increases resistance to human AMP LL-37 (18), we also assessed this effect in P. aeruginosa and found no significant differences in susceptibility to LL-37 (Table 1). We also evaluated changes in susceptibility to two different antibiotics from two different classes, namely, gentamicin (an aminoglycoside) and levofloxacin (a fluoroquinolone), finding an increase in resistance to levofloxacin alone (Table 1). An assessment of the expression of genes involved in multidrug efflux pumps (mexA, mexX, and mexZ) found upregulation of these three genes upon exposure to CSE (Fig. 3A to C). Both mexA and mexX have been shown previously to be involved in susceptibility to antibiotics in P. aeruginosa (46–48). Remarkably, previous studies have shown mexA and mexX could be critical on the virulence potential of P. aeruginosa for its invasiveness in the host (49, 50). In the case of mexZ, we observed an unexpected upregulation upon CSE exposure since mexZ is a repressor of the mexXY operon (51). Altogether, these data show that CSE does not induce resistance to gentamicin and LL-37 but induces resistance to levofloxacin, potentially via upregulation of genes of multidrug efflux pumps. Upregulation of these efflux pumps may additionally account for the enhanced virulence of CSE-exposed P. aeruginosa in our ex vivo system.

To further understand how P. aeruginosa can avoid neutrophil killing, we assessed neutrophil antimicrobial mechanisms that might be involved. Neutrophils are well known for their essential role in clearance of bacteria through different mechanisms, including NETs, antimicrobial peptides, and ROS production (52, 53). We found no difference in susceptibility to NET killing in both P. aeruginosa and CSE-PSA. However, our data show that CSE-exposed P. aeruginosa was more resistant to killing by H2O2 (a reactive oxygen species produced by neutrophils) in a dose-dependent manner (Fig. 4A to C), which suggests that in our system, ROS may be the primary mechanism behind the increased resistance to neutrophil killing. In light of this evidence, we believe that CSE is an environmental stressor for P. aeruginosa, slowing growth by forcing the bacteria to shift metabolic efforts toward defense against ROS and ultimately selecting for bacteria that are resistant to ROS. Over time, this generates a bacterial population that is resistant to oxidative stressors, such as H2O2. Related to this idea, only a few studies have shown that CSE can induce oxidative stress in bacteria (particularly in S. aureus) that might lead to adaptation and resistance to such stress (19, 44). Furthermore, seeking for an explanation of this enhanced resistance to neutrophil killing and ROS, we evaluated the expression of genes involved in protection against oxidative insults, including thiol peroxidase (tpx), glutathione peroxidase (gpx) and two catalases (KatA and KatB) (39, 40), and only tpx was significantly upregulated (Fig. 4D to H). A previous study has shown that expression of the tpx gene has a protective role against H2O2 in P. aeruginosa (39). Thus, these data suggest that the conferred resistance to neutrophil killing mediated by CSE exposure could be attributed in part through an acquired resistance to ROS, which correlates with increased gene expression of tpx.

Finally, to correlate our ex vivo and in vitro data of CSE-mediated enhanced virulence in P. aeruginosa, we assessed its virulence in a in vivo system. As a result of CSE exposure, P. aeruginosa became more virulent, leading to 100% of the mice succumbing to infection (Fig. 5). This finding correlated with our observation of increase expression of the genes involved in multidrug efflux systems, which have been shown to play a role in the invasiveness of P. aeruginosa in in vivo systems (49, 50). Thus, altogether, all our approaches indicate that CSE can promote the virulence of P. aeruginosa, which might involve resistance to oxidative stress and the expression of genes of multidrug efflux pumps.

This study has multiple limitations, including the use of high concentrations of CSE. While studies of cigarette smoke effects on mammalian cells typically use concentrations of 10% of CSE down to 0.001%, they are primarily to mimic the exposure of cells within the body to components of cigarette smoke that are absorbed into the bloodstream and then diluted throughout the body. However, bacteria that colonize the airways are exposed to full-strength cigarette smoke during inhalation. Thus, high concentrations of CSE are more physiologically relevant in studies of airway microbes. Another limitation is that P. aeruginosa has a multitude of virulence factors, with more being identified every year, and these studies were limited to changes in surface charge and hydrophobicity, biofilm formation, antibiotic resistance to three antimicrobials, drug efflux pumps, and oxidative burst resistance. It remains unknown whether the increased virulence identified here in P. aeruginosa strain PAO1 will occur with other pseudomonal strains. Also, while we assessed the ability of CSE-exposed P. aeruginosa to cause more severe invasive disease (pneumonia), it is possible that CSE-driven virulence may alter how P. aeruginosa causes other invasive diseases, such as sepsis. Further studies are needed to define how different inhalants impact airway microbes and potentially increase the susceptibility of their hosts to invasive disease, including changing the way they interact and respond to the immune system.

Our data demonstrate that exposure to cigarette smoke generates a hardier phenotype of P. aeruginosa that is more difficult for host innate immune cells to kill. In the broader sense of infection and immunity, we believe that our study demonstrates that cigarette smoke exposure not only alters P. aeruginosa characteristics, such as growth and biofilm formation, but also drives pseudomonal virulence. We believe these findings provide a valuable explanation of the refractory nature of respiratory illnesses in cigarette smokers and highlight cigarette smoking as a potential driver of virulence in an important airway pathogen. There are a number of intracellular processes that could be affected that might explain the CSE-induced effects in P. aeruginosa. Follow-up investigations seeking to expand on our current findings may be beneficial to elucidate the specific mechanisms by which P. aeruginosa becomes resistant to oxidative stress and more virulent in general.

MATERIALS AND METHODS

CSE preparation.

CSE was prepared based on prior published methods (54, 55). A total of 10 ml of appropriate control medium was drawn into a 60-ml sterile syringe. A 3R4F research cigarette with the filter removed was placed in a holder attached to tubing and a 3-way stopcock. The cigarette was lit and 40 ml of smoke (one puff over 2 seconds) was drawn into the syringe containing the 10 ml of media. The syringe was attached to a platform shaker and shaken at level 4 for 15 seconds, allowing the infusion of smoke components into the media. Smoke was “exhaled” through the stopcock and the smoking procedure repeated until less than 1 cm of the cigarette was left, an average of 12 puffs total, producing 100% CSE.

Preparation of control and CSE subcultures.

Control medium was added to 100% CSE to create different percentages of CSE (vol/vol) for each assay. Subcultures of control and CSE-PSA were created each morning by inoculating 10 ml of control media and 10 ml of 75% CSE with 1:20 and 1:100 (controls) and 1:10 (75% CSE) dilutions of the overnight P. aeruginosa (PAO1 strain) culture. Tubes were incubated at 37°C with shaking until mid-log (optical density at 600 nm [OD600] of 1.2 to 1.4) growth was reached.

Neutrophil killing of bacteria.

Control and CSE-PSA subcultures were prepared by inoculating control mammalian-based media (MBM) (RPMI + 10% fetal bovine serum [FBS] + 20% LB) with overnight cultures. FBS and LB were included, as bacterial growth is stunted in their absence. After the mid-log growth phase was reached, control and CSE-PSA subcultures were transferred into separate 50-ml conical tubes, washed with phosphate-buffered saline (PBS), and then centrifuged at 3,200 rpm for 8 min in 4°C. Supernatants were discarded, and each pellet was resuspended in 300 μl of PBS. Two glass tubes were filled with 3 ml of PBS and both slurries added until an OD600 of 1.2 to 1.4 was reached.

Under approval from the University of California San Diego (UCSD) institutional review board (IRB), 25 ml of venous blood was collected from healthy donors using a 30-ml heparinized syringe. Blood was transferred to a 50-ml conical tube and layered on top of 20 ml of Polymorphprep, taking care not to disturb the interface between the two liquids. The blood was centrifuged at 1,600 rpm for 35 min at room temperature (22°C) with no brake. The plasma and upper mononuclear cell layer were aspirated; and the polymorphonuclear leukocytes (PMNs) were transferred to a fresh 50-ml conical tube, rinsed with 50 ml with PBS, and centrifuged at 1,600 rpm for 10 min. The supernatant was discarded, and 5 ml of molecular-grade water was added and mixed via pipetting for 30 s to lyse residual red blood cells. Cells were rinsed again with 50 ml of PBS and centrifuged at 1,600 rpm for 10 min. The pellet was resuspended in 1 ml of PBS and enumerated with trypan blue on a hemocytometer.

Cells were prepared at a concentration of 5 × 106 cells/ml. A total of 50 μl was added to each row A of a flat-bottom 96-well plate, and 50 μl of RPMI +10% FBS +20% LB was added to empty wells as a growth control. Phorbol myristate acetate (PMA; activator of PMN antimicrobial pathways, including NETs) was prepared at 2× (50 nM in RPMI + 2% FBS), and 50 μl was added to all wells to a final concentration of 25 nm of PMA. Plates were incubated for 20 min at 37°C with 5% CO2, or for a pure-NET killing assay, for 3 h at 37°C with 5% CO2.

A bacterial slurry of an OD of 0.7 was prepared in 3 ml PBS as previously described. This slurry was diluted in MBM to obtain 5 × 106 CFU/ml, centrifuged at 1,600 rpm for 5 min, and resuspended in MBM at 5 × 105 CFU/ml to give a minimum of infectivity (MOI) of 0.1. Neutrophils were infected with P. aeruginosa in 50 μl, and plates were centrifuged at 1,600 rpm for 10 min to increase bacterium-PMN contact. Cells were incubated for 30 and 60 min at 37°C with 5% CO2. A total of 5 μl of 0.25% Triton X-100-PBS was added to each well, and the P. aeruginosa:PMN mixture was serially diluted. A total of 25 μl of the bottom 3 dilutions were streaked onto LB plates and incubated at 37°C overnight prior to enumeration of surviving CFU.

Cell viability.

Neutrophils were isolated as mentioned above and then treated with the supernatant of the last wash of the bacterial preparation after CSE exposure using the same volume used during the neutrophil killing assays mentioned above. Then, cells were treated with propidium iodide, and its uptake was measure using flow cytometry following the manufacturer’s protocol (Invitrogen). Cell viability was calculated as relative to control time 0 for each time point.

Surface charge change.

Pseudomonas aeruginosa was grown in 0%, 25%, 50%, and 75% CSE to an OD600 of 0.6 to 0.8. Bacteria were washed three times in 0.02 M HEPES (pH 7.5) and resuspended to an OD600 of 0.3; and poly-l-lysine (PLL)-FITC (Sigma) at 0, 0.02, 0.2, and 2 μg/ml was added. Tubes were vortexed every 5 min for 15 min in the dark. Cells were pelleted and resuspended and PLL-FITC binding was quantified via flow cytometric analysis.

Hydrophobicity.

The bacterial suspension was transferred to a microcentrifuge tube, and n-hexadecane was added to a final concentration of 20%. Tubes were vortexed for 2 min and then incubated at room temperature for 30 min. Samples from the lower aqueous layers were transferred into a 96-well plate, serial dilutions were performed in 1× PBS in triplicate, and 10 μl was plated onto LB plates and incubated at 37°C overnight prior to CFU enumeration.

Biofilm assay.

An overnight culture of P. aeruginosa was diluted 1:100 in LB (control) and CSE at 5%, 10%, 15%, 25%, 50% and 75%. A total of 100 μl of control and each CSE-PSA subculture was transferred to the middle of a 96-well round-bottom plate in replicates of 10. Outer wells of the plate were filled with PBS to minimize evaporation. The plate was incubated at 37°C with shaking for 24 hours. Supernatant, planktonic P. aeruginosa was aspirated, and the wells washed three times with 250 μl of sterile PBS, turning the plate each time and flicking gently to discard the PBS. The plate was turned upside down and allowed to dry for 5 min. A total of 200 μl of a 0.1% aqueous crystal violet (CV) solution was added into each well, and the plate was incubated for 15 min at room temperature. A PBS wash was performed three times to remove unbound CV. Following another 5-min drying period, the bound CV was extracted using 200 μl of an 80:20 (vol/vol) mixture of ethanol and acetone for 15 min. Absorbance was measured at 595 nm with a plate reader.

Antibiotic resistance assays.

Pseudomonas aeruginosa and CSE-PSA subcultures were grown to mid-log phase in RPMI with 5% Mueller-Hinton broth (MHB). Cultures were spun at 3,200 rpm for 10 minutes, and bacteria were resuspended to an OD600 of 0.8. Bacteria were diluted 1:100 in assay media and plated at 100 μl per well. Levofloxacin and gentamicin powders were suspended in RPMI with 5% MHB at 16 μg/ml and LL-37 in RPMI with 5% LB at 64 μg/ml. Antibiotics were serially diluted 9 times. A total of 100 μl of each antibiotic dose was plated in a 96-well plate, and 100 μl of RPMI with 5% MHB or RPMI with 5% LB was plated as controls. P. aeruginosa and CSE-PSA cultures were pipetted into the wells in triplicate for each concentration of antibiotic and incubated in a 37°C shaker for 24 h. A total of 5 μl of each well was then plated onto Todd Hewitt agar (THA) and incubated at 37°C for 24 hours. CFUs were counted to determine MIC.

H2O2 sensitivity.

CSE was prepared as described. Subcultures of control and CSE-PSA were created by inoculating 10 ml of control media and 10 ml of 75% CSE with 1:20 and 1:100 (controls) and 1:10 (75% CSE) dilutions of the overnight P. aeruginosa culture. Tubes were incubated at 37°C with shaking until mid-log (absorbance, 1.2 to 1.4) growth was reached. CSE and control P. aeruginosa subcultures of 0%, 25%, 50%, and 75% were created as described previously and grown to an OD600 of 1.2 to 1.4. Subcultures were washed with PBS in 50-ml conical tubes and spun at 3,200 rpm for 8 min. Bacterial pellets were resuspended in 300 μl of RPMI with 10% LB and 5% FBS to an OD600 of 0.7 to 1.0. A total of 500 μl of each bacterial subculture was added to 500 μl of 0%, 1.5%, and 3% H2O2 solutions and incubated with shaking at 37°C for 1 h. At approximately 0, 20, and 40 min, 10 μl was serially diluted in a 96-well round-bottom plate. Diluted bacteria were plated onto LB agar plates for enumeration of viable cells.

Murine pneumonia infection model.

Totals of 100 mg/kg intraperitoneal ketamine and 10 mg/kg xylazine were used to sedate 5- to 7-month-old female CD-1 mice (Charles River). Mice were infected intranasally with 5 × 106 CFU P. aeruginosa in 75 μl, with the entire volume delivered into the left nare and each mouse kept upright for 1 min postinfection. Mice were recovered in the right lateral decubitus position on heating pads until they were mobile. Mice were weighed every 24 h and mortality documented. Experiments were conducted twice. All animal studies were approved on IACUC protocols s16021 (UCSD) and A14-024 (VASDHS).

Gene expression.

RNA extraction was conducted by using an Qiagen RNeasy protect bacteria minikit following the manufacturer’s protocol, and RNA extracts were frozen in a –80°C freezer until use. Later, RNA was quantified, and quantitative PCR (qPCR) was performed using the Bio-Rad iTaq universal one-step reverse transcriptase quantitative PCR (RT-qPCR) kit and protocol in a 96-well PCR plate and run on a Applied Biosystems StepOnePlus real-time system. The gene expression data acquired were analyzed using the comparative threshold cycle (CT) method using rspL as housekeeping gene. Primers used are shown in Table 2.

TABLE 2.

Primers used in this study

Primer Sequence (5′–3′) Reference
rspL 5′ GCAAGCGCATGGTCGACAAGA 56
rspL 3′ CGCTGTGCTCTTGCAGGTTGTGA
katA 5′ ATGCGTTTCTACACCGAGCA 57
katA 3′ ATGGTCAACTGATGCAGCGA
katB 5′ GGTTTCGCCACCAAGTTCTA 57
katB 3′ CGTGGGAGAAGAAATCGAAG
tpx 5′ GAAGGATCAACGCAATGG 39
tpx 3′ ACCACGGTGTTGGCCAGC
oxyR 5′ CTCACCGAACTGCGCTACA 58
oxyR 3′ CGAGTCGGCCAGCACTT
gpx 5′ TGCGGCTTACCCCGCAGTA 59
gpx 3′ ACTTGGTGAAGTTCCACTT
mexA 5′ ACCTACGAGGCCGACTACCAGA 60
mexA 3′ GTTGGTCACCAGGGCGCCTTC
mexX 5′ TGAAGGCGGCCCTGGACATCAGC 56
mexX 3′ GATCTGCTCGACGCGGGTCAGCG
mexZ 5′ GCATGGGCTTTCTCCGCCAGTGC 56
mexZ 3′ GCGTCCGCCAGCAACAGGTAGGG

Statistical analyses.

All in vitro studies are representative of at least three replicate experiments, of which each was performed in triplicate. All averages, significance values (P values), t tests, and other parameters were analyzed using GraphPad Prism. One-way analysis of variance (ANOVA) was used to analyze neutrophil killing. Growth curves were analyzed with the Friedman test. H2O2 resistance was analyzed with the Mann-Whitney test. Antibiotic resistance was analyzed by the ratio-paired two-tailed t test. Mouse pneumonia studies were conducted once, and survival analysis was performed via a Kaplan-Meier survival curve.

ACKNOWLEDGMENTS

We have no competing interests or conflicts of interest to disclose.

L.E.C.A., J.C., J.H.H., J.A.M.-S., S.J.A., and E.K.M. designed the studies. J.C., J.H.H., J.A.M.-S., S.J.A., E.K.M., and S.N. ran the experiments and acquired the data. J.H.H., J.A.M.-S., S.A., M.-K.B., and L.E.C.A. analyzed the data. All authors drafted and edited the manuscript.

This work was funded by a VA Career Development Award (CDA)-2 (principal investigator [PI] L.E.C.A., 1IK2BX001313), VA Merit Award (PI L.E.C.A., 1I01BX004767), American Heart Association Beginning Grant-in-aid (PI L.E.C.A., 16BGIA27790079), NIH NHLBI R01 (PI L.E.C.A., HL137052-01), and an American Thoracic Society Foundation Award for Outstanding Early Career Investigators (PI L.E.C.A.).

REFERENCES

  • 1.National Center for Chronic Disease Prevention and Health Promotion. 2014. The health consequences of smoking—50 years of progress: a report of the surgeon general. Centers for Disease Control and Prevention, Atlanta, GA. [Google Scholar]
  • 2.Marcy TW, Merrill WW. 1987. Cigarette smoking and respiratory tract infection. Clin Chest Med 8:381–391. [PubMed] [Google Scholar]
  • 3.Church DF, Pryor WA. 1985. Free-radical chemistry of cigarette smoke and its toxicological implications. Environ Health Perspect 64:111–126. doi: 10.1289/ehp.8564111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hoffmann D, Hoffmann I. 1997. The changing cigarette, 1950–1995. J Toxicol Environ Health 50:307–364. doi: 10.1080/009841097160393. [DOI] [PubMed] [Google Scholar]
  • 5.Schumacher JN, Green CR, Best FW, Newell MP. 1977. Smoke composition. An extensive investigation of the water-soluble portion of cigarette smoke. J Agric Food Chem 25:310–320. doi: 10.1021/jf60210a003. [DOI] [PubMed] [Google Scholar]
  • 6.Shin S, Crotty Alexander LE. 2016. Global state of tobacco use: summary from the American Thoracic Society International Conference 2016. J Thorac Dis 8:S582–S585. doi: 10.21037/jtd.2016.07.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Xavier RF, Ramos D, Ito JT, Rodrigues FM, Bertolini GN, Macchione M, de Toledo AC, Ramos EM. 2013. Effects of cigarette smoking intensity on the mucociliary clearance of active smokers. Respiration 86:479–485. doi: 10.1159/000348398. [DOI] [PubMed] [Google Scholar]
  • 8.Nuorti JP, Butler JC, Farley MM, Harrison LH, McGeer A, Kolczak MS, Breiman RF, Active Bacterial Core Surveillance Team. 2000. Cigarette smoking and invasive pneumococcal disease. N Engl J Med 342:681–689. doi: 10.1056/NEJM200003093421002. [DOI] [PubMed] [Google Scholar]
  • 9.Brunet L, Pai M, Davids V, Ling D, Paradis G, Lenders L, Meldau R, van Zyl Smit R, Calligaro G, Allwood B, Dawson R, Dheda K. 2011. High prevalence of smoking among patients with suspected tuberculosis in South Africa. Eur Respir J 38:139–146. doi: 10.1183/09031936.00137710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.van Zyl Smit RN, Pai M, Yew WW, Leung CC, Zumla A, Bateman ED, Dheda K. 2010. Global lung health: the colliding epidemics of tuberculosis, tobacco smoking, HIV and COPD. Eur Respir J 35:27–33. doi: 10.1183/09031936.00072909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Tachfouti N, Nejjari C, Benjelloun MC, Berraho M, Elfakir S, El Rhazi K, Slama K. 2011. Association between smoking status, other factors and tuberculosis treatment failure in Morocco. Int J Tuber Lung Dis 15:838–843. doi: 10.5588/ijtld.10.0437. [DOI] [PubMed] [Google Scholar]
  • 12.Huttunen R, Laine J, Lumio J, Vuento R, Syrjanen J. 2007. Obesity and smoking are factors associated with poor prognosis in patients with bacteraemia. BMC Infect Dis 7:13. doi: 10.1186/1471-2334-7-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Drannik AG, Pouladi MA, Robbins CS, Goncharova SI, Kianpour S, Stampfli MR. 2004. Impact of cigarette smoke on clearance and inflammation after Pseudomonas aeruginosa infection. Am J Respir Crit Care Med 170:1164–1171. doi: 10.1164/rccm.200311-1521OC. [DOI] [PubMed] [Google Scholar]
  • 14.John G, Kohse K, Orasche J, Reda A, Schnelle-Kreis J, Zimmermann R, Schmid O, Eickelberg O, Yildirim AO. 2014. The composition of cigarette smoke determines inflammatory cell recruitment to the lung in COPD mouse models. Clin Sci (Lond) 126:207–221. doi: 10.1042/CS20130117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dunn JS, Freed BM, Gustafson DL, Stringer KA. 2005. Inhibition of human neutrophil reactive oxygen species production and p67phox translocation by cigarette smoke extract. Atherosclerosis 179:261–267. doi: 10.1016/j.atherosclerosis.2004.11.011. [DOI] [PubMed] [Google Scholar]
  • 16.Xu M, Scott JE, Liu KZ, Bishop HR, Renaud DE, Palmer RM, Soussi-Gounni A, Scott DA. 2008. The influence of nicotine on granulocytic differentiation—inhibition of the oxidative burst and bacterial killing and increased matrix metalloproteinase-9 release. BMC Cell Biol 9:19. doi: 10.1186/1471-2121-9-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Feldman C, Anderson R. 2013. Cigarette smoking and mechanisms of susceptibility to infections of the respiratory tract and other organ systems. J Infect 67:169–184. doi: 10.1016/j.jinf.2013.05.004. [DOI] [PubMed] [Google Scholar]
  • 18.McEachern EK, Hwang JH, Sladewski KM, Nicatia S, Dewitz C, Mathew DP, Nizet V, Crotty Alexander LE. 2015. Analysis of the effects of cigarette smoke on staphylococcal virulence phenotypes. Infect Immun 83:2443–2452. doi: 10.1128/IAI.00303-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lacoma A, Edwards AM, Young BC, Domínguez J, Prat C, Laabei M. 2019. Cigarette smoke exposure redirects Staphylococcus aureus to a virulence profile associated with persistent infection. Sci Rep 9:10798. doi: 10.1038/s41598-019-47258-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hwang JH, Lyes M, Sladewski K, Enany S, McEachern E, Mathew DP, Das S, Moshensky A, Bapat S, Pride DT, Ongkeko WM, Crotty Alexander LE. 2016. Electronic cigarette inhalation alters innate immunity and airway cytokines while increasing the virulence of colonizing bacteria. J Mol Med (Berl) 94:667–679. doi: 10.1007/s00109-016-1378-3. [DOI] [PubMed] [Google Scholar]
  • 21.El Ahmer OR, Essery SD, Saadi AT, Raza MW, Ogilvie MM, Weir DM, Blackwell CC. 1999. The effect of cigarette smoke on adherence of respiratory pathogens to buccal epithelial cells. FEMS Immunol Med Microbiol 23:27–36. doi: 10.1111/j.1574-695X.1999.tb01713.x. [DOI] [PubMed] [Google Scholar]
  • 22.Ozlu T, Celik I, Oztuna F, Bulbul Y, Ozsu S. 2008. Streptococcus pneumoniae adherence in rats under different degrees and durations of cigarette smoke. Respiration 75:333–338. doi: 10.1159/000112472. [DOI] [PubMed] [Google Scholar]
  • 23.Gellatly SL, Hancock RE. 2013. Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathog Dis 67:159–173. doi: 10.1111/2049-632X.12033. [DOI] [PubMed] [Google Scholar]
  • 24.Finch S, McDonnell MJ, Abo-Leyah H, Aliberti S, Chalmers JD. 2015. A comprehensive analysis of the impact of Pseudomonas aeruginosa colonization on prognosis in adult bronchiectasis. Ann Am Thorac Soc 12:1602–1611. doi: 10.1513/AnnalsATS.201506-333OC. [DOI] [PubMed] [Google Scholar]
  • 25.Antunes MB, Chi JJ, Liu Z, Goldstein-Daruech N, Palmer JN, Zhu J, Cohen NA. 2012. Molecular basis of tobacco-induced bacterial biofilms: an in vitro study. Otolaryngol Head Neck Surg 147:876–884. doi: 10.1177/0194599812447263. [DOI] [PubMed] [Google Scholar]
  • 26.Goldstein-Daruech N, Cope EK, Zhao KQ, Vukovic K, Kofonow JM, Doghramji L, Gonzalez B, Chiu AG, Kennedy DW, Palmer JN, Leid JG, Kreindler JL, Cohen NA. 2011. Tobacco smoke mediated induction of sinonasal microbial biofilms. PLoS One 6:e15700. doi: 10.1371/journal.pone.0015700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sethi S, Murphy TF. 2001. Bacterial infection in chronic obstructive pulmonary disease in 2000: a state-of-the-art review. Clin Microbiol Rev 14:336–363. doi: 10.1128/CMR.14.2.336-363.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Angrill J, Agusti C, de Celis R, Rano A, Gonzalez J, Sole T, Xaubet A, Rodriguez-Roisin R, Torres A. 2002. Bacterial colonisation in patients with bronchiectasis: microbiological pattern and risk factors. Thorax 57:15–19. doi: 10.1136/thorax.57.1.15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Fujitani S, Sun HY, Yu VL, Weingarten JA. 2011. Pneumonia due to Pseudomonas aeruginosa: part I: epidemiology, clinical diagnosis, and source. Chest 139:909–919. doi: 10.1378/chest.10-0166. [DOI] [PubMed] [Google Scholar]
  • 30.Sethi S, Murphy TF. 2008. Infection in the pathogenesis and course of chronic obstructive pulmonary disease. N Engl J Med 359:2355–2365. doi: 10.1056/NEJMra0800353. [DOI] [PubMed] [Google Scholar]
  • 31.Murphy TF, Brauer AL, Eschberger K, Lobbins P, Grove L, Cai X, Sethi S. 2008. Pseudomonas aeruginosa in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 177:853–860. doi: 10.1164/rccm.200709-1413OC. [DOI] [PubMed] [Google Scholar]
  • 32.Garcia-Vidal C, Almagro P, Romani V, Rodriguez-Carballeira M, Cuchi E, Canales L, Blasco D, Heredia JL, Garau J. 2009. Pseudomonas aeruginosa in patients hospitalised for COPD exacerbation: a prospective study. Eur Respir J 34:1072–1078. doi: 10.1183/09031936.00003309. [DOI] [PubMed] [Google Scholar]
  • 33.Restrepo MI, Mortensen EM, Pugh JA, Anzueto A. 2006. COPD is associated with increased mortality in patients with community-acquired pneumonia. Eur Respir J 28:346–351. doi: 10.1183/09031936.06.00131905. [DOI] [PubMed] [Google Scholar]
  • 34.Hoshino Y, Mio T, Nagai S, Miki H, Ito I, Izumi T. 2001. Cytotoxic effects of cigarette smoke extract on an alveolar type II cell-derived cell line. Am J Physiol Lung Cell Mol Physiol 281:L509–L516. doi: 10.1152/ajplung.2001.281.2.L509. [DOI] [PubMed] [Google Scholar]
  • 35.Johnson MD, Schilz J, Djordjevic MV, Rice JR, Shields PG. 2009. Evaluation of in vitro assays for assessing the toxicity of cigarette smoke and smokeless tobacco. Cancer Epidemiol Biomarkers Prev 18:3263–3304. doi: 10.1158/1055-9965.EPI-09-0965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Rosenberg M, Gutnick D, Rosenberg E. 1980. Adherence of bacteria to hydrocarbons: a simple method for measuring cell-surface hydrophobicity. FEMS Microbiology Lett 9:29–33. doi: 10.1111/j.1574-6968.1980.tb05599.x. [DOI] [Google Scholar]
  • 37.Sharma D, Misba L, Khan AU. 2019. Antibiotics versus biofilm: an emerging battleground in microbial communities. Antimicrob Resist Infect Control 8:76. doi: 10.1186/s13756-019-0533-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Slauch JM. 2011. How does the oxidative burst of macrophages kill bacteria? Still an open question. Mol Microbiol 80:580–583. doi: 10.1111/j.1365-2958.2011.07612.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Somprasong N, Jittawuttipoka T, Duang-Nkern J, Romsang A, Chaiyen P, Schweizer HP, Vattanaviboon P, Mongkolsuk S. 2012. Pseudomonas aeruginosa thiol peroxidase protects against hydrogen peroxide toxicity and displays atypical patterns of gene regulation. J Bacteriol 194:3904–3912. doi: 10.1128/JB.00347-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Fu R-Y, Chen J, Li Y. 2007. The function of the glutathione/glutathione peroxidase system in the oxidative stress resistance systems of microbial cells. Sheng Wu Gong Cheng Xue Bao 23:770–775. doi: 10.1016/s1872-2075(07)60048-x. [DOI] [PubMed] [Google Scholar]
  • 41.Ertel A, Eng R, Smith SM. 1991. The differential effect of cigarette smoke on the growth of bacteria found in humans. Chest 100:628–630. doi: 10.1378/chest.100.3.628. [DOI] [PubMed] [Google Scholar]
  • 42.Hancock REW, Diamond G. 2000. The role of cationic antimicrobial peptides in innate host defences. Trends Microbiol 8:402–410. doi: 10.1016/S0966-842X(00)01823-0. [DOI] [PubMed] [Google Scholar]
  • 43.Hirschfeld J. 2014. Dynamic interactions of neutrophils and biofilms. J Oral Microbiol 6:26102–26102. doi: 10.3402/jom.v6.26102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kulkarni R, Antala S, Wang A, Amaral FE, Rampersaud R, Larussa SJ, Planet PJ, Ratner AJ. 2012. Cigarette smoke increases Staphylococcus aureus biofilm formation via oxidative stress. Infect Immun 80:3804–3811. doi: 10.1128/IAI.00689-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Krasowska A, Sigler K. 2014. How microorganisms use hydrophobicity and what does this mean for human needs? Front Cell Infect Microbiol 4:112. doi: 10.3389/fcimb.2014.00112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Li XZ, Nikaido H, Poole K. 1995. Role of mexA-mexB-oprM in antibiotic efflux in Pseudomonas aeruginosa. Antimicrob Agents Chemother 39:1948–1953. doi: 10.1128/aac.39.9.1948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Srikumar R, Kon T, Gotoh N, Poole K. 1998. Expression of Pseudomonas aeruginosa multidrug efflux pumps MexA-MexB-OprM and MexC-MexD-OprJ in a multidrug-sensitive Escherichia coli strain. Antimicrob Agents Chemother 42:65–71. doi: 10.1128/AAC.42.1.65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Morita Y, Tomida J, Kawamura Y. 2012. MexXY multidrug efflux system of Pseudomonas aeruginosa. Front Microbiol 3:408–408. doi: 10.3389/fmicb.2012.00408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hirakata Y, Srikumar R, Poole K, Gotoh N, Suematsu T, Kohno S, Kamihira S, Hancock REW, Speert DP. 2002. Multidrug efflux systems play an important role in the invasiveness of Pseudomonas aeruginosa. J Exp Med 196:109–118. doi: 10.1084/jem.20020005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Rampioni G, Pillai CR, Longo F, Bondì R, Baldelli V, Messina M, Imperi F, Visca P, Leoni L. 2017. Effect of efflux pump inhibition on Pseudomonas aeruginosa transcriptome and virulence. Sci Rep 7:11392. doi: 10.1038/s41598-017-11892-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Kawalek A, Modrzejewska M, Zieniuk B, Bartosik AA, Jagura-Burdzy G. 2019. Interaction of ArmZ with the DNA-binding domain of MexZ induces expression of mexXY multidrug efflux pump genes and antimicrobial resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 63:e01199-19. doi: 10.1128/AAC.01199-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Giacalone VD, Margaroli C, Mall MA, Tirouvanziam R. 2020. Neutrophil adaptations upon recruitment to the lung: new concepts and implications for homeostasis and disease. Int J Mol Sci 21:851. doi: 10.3390/ijms21030851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Teng T-S, Ji A-l, Ji X-Y, Li Y-Z. 2017. Neutrophils and immunity: from bactericidal action to being conquered. J Immunol Res 2017:9671604. doi: 10.1155/2017/9671604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Holden WE, Maier JM, Malinow MR. 1989. Cigarette smoke extract increases albumin flux across pulmonary endothelium in vitro. J Appl Physiol (1985) 66:443–449. doi: 10.1152/jappl.1989.66.1.443. [DOI] [PubMed] [Google Scholar]
  • 55.Holden WE, Kishiyama SS, Dong SP, Osborne ML. 1990. Endothelium-dependent effects of cigarette smoke components on tone of porcine intrapulmonary arteries in vitro. Toxicol Appl Pharmacol 104:191–199. doi: 10.1016/0041-008X(90)90294-5. [DOI] [PubMed] [Google Scholar]
  • 56.Dumas J-L, van Delden C, Perron K, Köhler T. 2006. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol Lett 254:217–225. doi: 10.1111/j.1574-6968.2005.00008.x. [DOI] [PubMed] [Google Scholar]
  • 57.Pezzoni M, Tribelli PM, Pizarro RA, López NI, Costa CS. 2016. Exposure to low UVA doses increases KatA and KatB catalase activities, and confers cross-protection against subsequent oxidative injuries in Pseudomonas aeruginosa. Microbiology (Reading) 162:855–864. doi: 10.1099/mic.0.000268. [DOI] [PubMed] [Google Scholar]
  • 58.Vinckx T, Matthijs S, Cornelis P. 2008. Loss of the oxidative stress regulator OxyR in Pseudomonas aeruginosa PAO1 impairs growth under iron-limited conditions. FEMS Microbiol Lett 288:258–265. doi: 10.1111/j.1574-6968.2008.01360.x. [DOI] [PubMed] [Google Scholar]
  • 59.Atichartpongkul S, Vattanaviboon P, Wisitkamol R, Jaroensuk J, Mongkolsuk S, Fuangthong M. 2016. Regulation of organic hydroperoxide stress response by two OhrR homologs in Pseudomonas aeruginosa. PLoS One 11:e0161982. doi: 10.1371/journal.pone.0161982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Mesaros N, Glupczynski Y, Avrain L, Caceres NE, Tulkens PM, Van Bambeke F. 2007. A combined phenotypic and genotypic method for the detection of Mex efflux pumps in Pseudomonas aeruginosa. J Antimicrob Chemother 59:378–386. doi: 10.1093/jac/dkl504. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES