Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2020 Oct 19;88(11):e00400-20. doi: 10.1128/IAI.00400-20

Limited Role of Mincle in the Host Defense against Infection with Cryptococcus deneoformans

Yuki Sato a, Ko Sato b,✉, Hideki Yamamoto a,*, Jun Kasamatsu b, Tomomitsu Miyasaka c, Daiki Tanno a,*, Anna Miyahara a, Takafumi Kagesawa a, Akiho Oniyama a, Kotone Kawamura a, Rin Yokoyama a,*, Yuki Kitai a, Aya Umeki a, Shigenari Ishizuka a, Kazuki Takano a, Ryuhei Shiroma a, Nana Nakahata a, Kaori Kawakami c, Emi Kanno d, Hiromasa Tanno d, Sho Yamasaki e,f,g,h, Hiromitsu Hara i, Keiko Ishii a, Kazuyoshi Kawakami a,b
Editor: Mairi C Noverrj
PMCID: PMC7573449  PMID: 32868343

Cryptococcus deneoformans is an opportunistic fungal pathogen that frequently causes fatal meningoencephalitis in patients with impaired cell-mediated immune responses such as AIDS. Caspase-associated recruitment domain 9 (CARD9) plays a critical role in the host defense against cryptococcal infection, suggesting the involvement of one or more C-type lectin receptors (CLRs). In the present study, we analyzed the role of macrophage-inducible C-type lectin (Mincle), one of the CLRs, in the host defense against C. deneoformans infection.

KEYWORDS: Cryptococcus deneoformans, Mincle, Th22, host defense

ABSTRACT

Cryptococcus deneoformans is an opportunistic fungal pathogen that frequently causes fatal meningoencephalitis in patients with impaired cell-mediated immune responses such as AIDS. Caspase-associated recruitment domain 9 (CARD9) plays a critical role in the host defense against cryptococcal infection, suggesting the involvement of one or more C-type lectin receptors (CLRs). In the present study, we analyzed the role of macrophage-inducible C-type lectin (Mincle), one of the CLRs, in the host defense against C. deneoformans infection. Mincle expression in the lungs of wild-type (WT) mice was increased in the early stage of cryptococcal infection in a CARD9-dependent manner. In Mincle gene-disrupted (Mincle KO) mice, the clearance of this fungus, pathological findings, Th1/Th2 response, and antimicrobial peptide production in the infected lungs were nearly comparable to those in WT mice. However, the production of interleukin-22 (IL-22), tumor necrosis factor alpha (TNF-α), and IL-6 and the expression of AhR were significantly decreased in the lungs of Mincle KO mice compared to those of WT mice. In in vitro experiments, TNF-α production by bone marrow-derived dendritic cells was significantly decreased in Mincle KO mice. In addition, the disrupted lysates of C. deneoformans, but not those of whole yeast cells, activated Mincle-triggered signaling in an assay with a nuclear factor of activated T cells (NFAT)-green fluorescent protein (GFP) reporter cells expressing this receptor. These results suggest that Mincle may be involved in the production of Th22-related cytokines at the early stage of cryptococcal infection, although its role may be limited in the host defense against infection with C. deneoformans.

INTRODUCTION

The two sister species Cryptococcus neoformans (formerly C. neoformans var. grubii serotype A) and Cryptococcus deneoformans (formerly C. neoformans var. neoformans serotype D) are yeast-type opportunistic fungal pathogens with thick polysaccharide capsules. These fungi cause life-threatening meningoencephalitis in patients with impaired immunity such as AIDS (1–4). Both of these Cryptococcus spp. are intracellularly growing yeasts, and the cellular immune mechanism plays a central role in eradication of these fungi, which is critically regulated by Th1-Th2 immune balance (2, 5–8). Th1-related cytokines accelerate the killing of Cryptococcus via macrophages by inducing the production of nitric oxide (NO) (9–11). In contrast, the Th2 immune response disturbs the host defense against this infection by suppressing macrophage killing and granuloma formation (8, 9, 12). It remains to be clarified how Th17-related cytokines, such as interleukin-17A (IL-17A), IL-22, and IL-23, contribute to the host defense against this infection (13–18).

Pathogen-associated molecular patterns (PAMPs) are recognized by the host immune cells via pattern recognition receptors (PRRs), which trigger the inflammatory responses (19). C-type lectin receptors (CLRs) act as a sensor molecule for polysaccharides rich in the cell wall of fungal pathogens (20). Previously, we demonstrated that caspase-associated recruitment domain 9 (CARD9), a common adaptor molecule for CLR-mediated signaling, plays a critical role in the host defense to cryptococcal infection (21). The key members of CLRs, Dectin-1, Dectin-2, and Dectin-3 (also known as MCL, Clec4D, and Clecsf8) and macrophage-inducible C type lectin (Mincle), were found to participate in the immune response to fungal pathogens (22–29). In our previous studies (30–32), elimination of cryptococcal yeast cells in the infected lungs was not affected by the genetic defect of either Dectin-1 or Dectin-2 that recognizes β-1,3-glucan or high-mannose polysaccharides, respectively, although the Dectin-2 ligand is likely expressed in the cell wall of C. deneoformans. Huang et al. demonstrated that Dectin-3 recognizes glucuronoxylomannan of C. neoformans hybrid serotype AD and Cryptococcus gattii serotype B, but not C. neoformans, C. deneoformans, or C. gattii serotype C (33). In addition, Campuzano et al. revealed that Dectin-3 is not required for protection against infection with C. neoformans or C. deneoformans (34). These findings suggest that some CLR other than these molecules may be involved in the host defense against infection with C. deneoformans.

Mincle, a type II transmembrane protein with a short cytoplasmic tail and an extracellular ligand-binding domain, delivers activation signals through the Fc receptor γ-chain molecule containing immunoreceptor tyrosine-based activation motif (ITAM) (35, 36). This CLR recognizes a wide range of PAMPs and damage-associated molecular patterns (DAMPs), such as trehalose-6,6-dimycolate (TDM) of Mycobacterium tuberculosis, β-glucosyl-diacylglycerol of Streptococcus pneumoniae, spliceosome-associated protein 130 (SAP130), and mammalian β-glucosyl ceramide (β-GlcCer) (36–39). Wells et al. demonstrated that Mincle deficiency showed significantly increased susceptibility to systemic candidiasis (40). Yamasaki et al. analyzed more than 50 species of pathogenic fungi for their possession of Mincle-binding ligands and revealed that Mincle recognizes specific structures of α-mannosyl residues on Malassezia species (41). However, the role of Mincle in the host defense against cryptococcal infection has not been clarified. Thus, in the present study, we examined the effect of Mincle deficiency on the host protection and immune response against C. deneoformans using a mouse model of pulmonary infection.

RESULTS

Kinetics in the expression of Mincle after infection with C. deneoformans.

Mincle expression is strongly induced in response to several inflammatory stimuli, such as infection (35). To clarify the kinetics of Mincle expression after infection with C. deneoformans, we first measured the expression of this mRNA in the lungs at various time points. Such expression was increased to a peak level on day 3 and then decreased to the basal level on day 7 after infection (Fig. 1a). In addition, the Mincle expression was significantly lower in CARD9 Mincle gene-disrupted (KO) mice than in wild-type (WT) mice on day 3 (Fig. 1b). To elucidate the localization of Mincle-expressing cells, we observed the immunostained tissues in the lungs of WT and Mincle KO mice on days 0 and 3 after cryptococcal infection. Although the positive cells were scarcely detected in the uninfected lungs, the Mincle-expressing cells were increased in the area surrounding this fungal pathogen in the infected lungs (Fig. 1c). Furthermore, in a flow cytometry analysis, we examined the expression of Mincle on various populations of leukocytes in the lungs. Mincle was expressed on inflammatory monocytes, patrolling monocytes, neutrophils, and B cells but not on alveolar macrophages, NK cells, and T cells in the lungs of uninfected mice, although the expression was slight (Fig. 1d). Inflammatory monocytes, patrolling monocytes, and neutrophils expressed higher levels of Mincle (Fig. 1d), and the number of these cells was markedly increased on day 3 after cryptococcal infection (Fig. 1e). These results suggest that the accelerated expression of Mincle may be due to an increased proportion of myeloid cells expressing this molecule and to an accumulation of these inflammatory cells in the lungs after infection with C. deneoformans.

FIG 1.

FIG 1

Mincle expression in lungs after infection with C. deneoformans. (a) WT mice were infected intratracheally with C. deneoformans. Expression of Mincle mRNA in the lungs was measured on days 0, 3, and 7 postinfection. Each column represents the mean ± SD of three to five mice. Experiments were repeated twice with similar results, and representative results are shown. (b) WT and CARD9 KO mice were infected intratracheally with C. deneoformans. Expression of Mincle mRNA in the lungs was measured on day 3 postinfection. Each column represents the mean ± SD of three to five mice. Experiments were repeated twice with similar results, and representative results are shown. (c) WT and Mincle KO mice were infected intratracheally with C. deneoformans. Lung tissue sections of WT and Mincle KO mice uninfected and 3 days after infection were immunostained with anti-CLEC4E antibody and observed under a light microscope at ×400 magnification. Mincle KO mice were used as a negative control. Scale bars: 25 μm. Closed arrows, yeast cells; open arrows, Mincle-expressing cells. Representative pictures of four mice are shown. (d and e) WT mice were infected intratracheally with C. deneoformans. Lung leukocytes were prepared in uninfected mice and at 3 days postinfection, and Mincle expression in these cells was analyzed using a flow cytometer (d). AMφ, alveolar macrophages; IM, inflammatory monocytes; PM, patrolling monocytes; Neu, neutrophils; B, B cells; NK, natural killer cells; T, T cells; IC, isotype control. Representative histograms of four mice are shown. (e) The number in each cell subset was calculated. Each column represents the mean ± SD of four mice. *, P < 0.05.

Effect of Mincle deficiency on the host protection and inflammatory response against cryptococcal infection.

Next, we examined the effect of Mincle deficiency on the host defense to cryptococcal infection. None of these mice died during the observation periods (up to day 56). The fungal burdens in the lungs were not significantly different between WT and Mincle KO mice on days 1, 3, 7, 14, 28, and 56 postinfection (Fig. 2a). Similarly, the fungal burdens in the brain were not increased in Mincle KO mice compared to those in WT mice on day 56 postinfection (Fig. 2b). In addition, we investigated how Mincle deficiency affected the inflammatory response in the lungs after cryptococcal infection. There was not an apparent difference in the infiltration of inflammatory cells or formation of granulomatous lesions in hematoxylin and eosin (H&E)-stained lung tissues between WT and Mincle KO mice on days 3 and 14 (Fig. 2c). In periodic acid-Schiff (PAS)-stained lung tissues, the fungal burdens also did not clearly differ between the two mouse strains (Fig. 2c).

FIG 2.

FIG 2

Effect of Mincle deficiency on C. deneoformans infection. WT and Mincle KO mice were infected intratracheally with C. deneoformans. (a and b) The numbers of live colonies in the lungs on days 1, 3, 7, 14, 28, and 56 (a) and in the brains on day 56 postinfection (b) were counted. Each symbol represents a separate mouse, and bars indicate the mean ± SD of three to seven mice. Experiments were repeated twice with similar results, and representative results are shown. (c) Sections of the lungs on days 3 and 14 postinfection were stained with H&E or PAS and observed under a light microscope at ×40 magnification. Scale bars: 250 μm. Representative pictures of three to five mice are shown. NS, not significant.

Effect of Mincle deficiency on the production of TNF-α and IL-12 by BM-DCs.

During infection with various microorganisms, proinflammatory cytokines play a central role in the initiation of the inflammatory response (42). Therefore, we examined how Mincle deficiency affected the in vitro production of proinflammatory cytokines, tumor necrosis factor alpha (TNF-α) and IL-12p40, by bone marrow-derived dendritic cells (BM-DCs) upon stimulation with C. deneoformans. TNF-α production was slightly, but significantly, decreased in Mincle KO mice compared to in WT mice. However, IL-12p40 production was not decreased in Mincle KO mice. BM-DCs significantly produced these cytokines when stimulated with TDM, a well-known ligand for Mincle (Fig. 3).

FIG 3.

FIG 3

Effect of Mincle deficiency on the production of proinflammatory cytokines by BM-DCs. BM-DCs were prepared from WT and Mincle KO mice and stimulated with the indicated dose of C. deneoformans, LPS (1 μg/ml), or TDM (1 μg/ml) for 24 h. Production of TNF-α and IL-12p40 in the culture supernatants was analyzed. Each column represents the mean ± SD of triplicate cultures. Experiments were repeated twice with similar results, and representative results are shown. *, P < 0.05. MOI, multiplicity of infection.

Suppressed IL-22 production in Mincle KO mice after infection with C. deneoformans.

Host defense to cryptococcal infection is largely regulated by a balance between the Th1 and Th2 immune responses (8, 9). In the next series of experiments, the effect of Mincle deficiency on the cytokine and chemokine production in responses to C. deneoformans was examined by measuring their concentration and mRNA expression in the lungs on days 1, 3, 7, 14, and 28 after infection. In the Th1/Th2-related cytokines, production of IL-12p40 was significantly decreased in Mincle KO mice compared to WT mice on day 7, whereas there was no significant difference in the production of interferon-γ (IFN-γ), IL-4, IL-5, and IL-13 and the expression of IL-12p35 mRNA at any time points (Fig. 4a and b). Production of proinflammatory cytokines (IL-6 and TNF-α), with the exception of IL-1β, was significantly reduced in Mincle KO mice compared to WT mice on day 3 (Fig. 4a). Production and expression of anti-inflammatory cytokines (IL-10 and transforming growth factor β [TGF-β]) and inflammatory chemokines (keratinocyte-derived chemokine [KC], macrophage inflammatory protein [MIP]-1α, MIP-2, and regulated on activation, normal T cell expressed and secreted [RANTES]) were not significantly different between the two mouse strains at any time points (Fig. 3a and b). In the Th17-related cytokines, IL-17A production and IL-23p19 mRNA expression were not significantly different between the two mouse strains at any time points, whereas production of IL-22 was significantly decreased in Mincle KO mice on days 1 and 3 (Fig. 4a and b). The aryl hydrocarbon receptor (AhR) is a transcription factor that enhances the production of IL-22 (43). Therefore, we examined the expression of AhR mRNA in the lungs on day 3 after infection with C. deneoformans. AhR expression showed a tendency of suppression in Mincle KO mice compared to WT mice, although this difference was not statistically significant (Fig. 4c).

FIG 4.

FIG 4

Effects of Mincle deficiency on the production of cytokines and chemokines in the lungs after infection with C. deneoformans. WT and Mincle KO mice were infected intratracheally with C. deneoformans. (a) IFN-γ, IL-12p40, IL-4, IL-5, IL-13, IL-17A, IL-22, IL-6, TNF-α, IL-1β, and IL-10 production in lung homogenates was measured on days 1, 3, 7, 14, and 28 postinfection. Each column represents the mean ± SD of three to seven mice. Experiments were repeated twice with similar results, and representative results are shown. (b) Expression of IL-12p35, IL-23p19, TGF-β, KC, MIP-1α, MIP-2, and RANTES mRNA in the lungs was measured on day 3 postinfection. Each column represents the mean ± SD of three to five mice. Experiments were repeated twice with similar results, and representative results are shown. (c) Expression of AhR mRNA in the lungs was measured on day 3 postinfection. Each column represents the mean ± SD of three mice. Experiments were repeated twice with similar results, and representative results are shown. *, P < 0.05. NS, not significant.

Effect of Mincle deficiency on the production of antimicrobial peptides.

IL-22 is known to induce the secretion of antimicrobial peptides, such as S100A8, S100A9, β-defensin, and RegIIIγ, involved in the host defense in the skin, airway, and intestine (44, 45). To clarify how Mincle deficiency affects such production, we examined the production of S100A8, S100A9, β1-defensin, α1-defensin, cathelicidin, and RegIIIγ in the lungs on days 1 and 3 after infection with C. deneoformans. As shown in Fig. 5a, expression of these antimicrobial peptide mRNAs was not significantly different between Mincle KO and WT mice on day 3 after infection (Fig. 5a). In addition, consistent with mRNA expression, there was no significant difference in production of S100A8 peptide between the two mouse strains on days 1 and 3 after infection (Fig. 5b).

FIG 5.

FIG 5

Effects of Mincle deficiency on the secretion of antimicrobial peptides in the lungs after infection with C. deneoformans. WT and Mincle KO mice were infected intratracheally with C. deneoformans. (a) Expression of S100A8, S100A9, cathelicidin, RegIIIγ, β1-defensin, and α1-defensin mRNA in the lungs was measured on day 3 postinfection. Each column represents the mean ± SD of three to five mice. Experiments were repeated twice with similar results, and representative results are shown. (b) Production of S100A8 in lung homogenates was measured on days 1 and 3 postinfection. Each column represents the mean ± SD of three to five mice. NS, not significant.

Activation of Mincle-triggered signal by C. deneoformans.

We examined whether C. deneoformans directly triggered an activation signal via Mincle using an NFAT-GFP reporter assay. As shown in Fig. 6a, whole C. deneoformans yeast cells did not induce GFP expression in this reporter assay (data not shown), and the disrupted lysates of these yeast cells activated the reporter cells, although such response was not marked. These results suggested that some putative Mincle ligands might exist within the yeast cells but not on their surface. Mammalian β-GlcCer, which differs in structure from that of yeasts, has been reported as one of the Mincle ligands (37, 46). Thus, we finally examined whether fungal β-GlcCer, which was derived from Candida utilis and showed the same structure as that from Cryptococcus (46, 47), affected this Mincle reporter assay. As shown in Fig. 6b, the fungal β-GlcCer apparently activated the reporter cells to induce GFP expression, whereas ethanol EtOH, a β-GlcCer solvent, did not affect the expression of GFP.

FIG 6.

FIG 6

Activation of Mincle reporter cells by C. deneoformans lysates and β-GlcCer. (a and b) The NFAT-GFP reporter cells expressing Mincle were cultured with the indicated dose of disrupted C. deneoformans lysates (a) or β-GlcCer (50 μg/ml) (b), and the expression of GFP was analyzed using a flow cytometer. BCG (MOI, 5) and ethanol (EtOH, 0.3%), a β-GlcCer solvent, were used as a positive control. Experiments were repeated twice with similar results, and representative results are shown. MOI, multiplicity of infection.

DISCUSSION

In the present study, we demonstrated that Mincle was quickly expressed in the lungs in a CARD9-dependent manner during the innate immune phase after infection with C. deneoformans. The expression of Mincle is positively regulated by signaling through macrophage C-type lectin (MCL), one of the CLRs, which leads to enhancement of Mincle-mediated signaling (48). These reports suggest that Mincle or MCL ligand may be present in this fungal pathogen. In addition, Kerscher et al. revealed that Mincle was induced by signaling through a myeloid differentiation primary response gene 88 (MyD88), a canonical adaptor molecule delivering signals triggered by Toll-like receptors (TLRs) (49). Nakamura et al. demonstrated that cryptococcal DNA was recognized by TLR9 (50), suggesting that the expression of Mincle might be induced via a TLR9-dependent pathway. Further investigation is necessary to focus on the cross talk between Mincle and the putative counterpart signaling molecules such as TLR9. To date, Mincle has been shown to be largely expressed on myeloid cells, including macrophages, monocytes, DCs, and neutrophils (51). Similarly, in the current study, Mincle was expressed largely in inflammatory monocytes, patrolling monocytes, and neutrophils in the lungs infected with C. deneoformans.

Recently, Mincle has garnered a lot of attention in the host defense against infection with various microorganisms. Behler-Janbeck et al. demonstrated that Mincle is a receptor for glucosyl-diacylglycerol from S. pneumoniae and that deficiency of this molecule leads to increased bacterial loads and decreased survival rates after pneumococcal infection (39). Sharma et al. revealed the protective role of Mincle in the host defense against Klebsiella pneumoniae pneumonia by promoting the bacterial clearance mechanism of neutrophils (52). Wells et al. demonstrated that Mincle deficiency significantly increased susceptibility to systemic infection with Candida albicans (40). In Mycobacterium tuberculosis infection, TNF-α and MIP-2 were produced by bone marrow-derived macrophages upon in vitro stimulation with TDM in a Mincle-dependent manner, whereas Mincle-deficient mice mounted an efficient granulomatous and protective immune response in vivo (38, 53). Among these studies, similar to Mycobacterium tuberculosis infection, in the current study, in vitro production of TNF-α by BM-DCs stimulated with C. deneoformans and several cytokine syntheses (TNF-α, IL-6, IL-12p40, and IL-22) in vitro in the lungs after cryptococcal infection were decreased in Mincle KO mice, while Mincle deficiency did not affect the granuloma formation and fungal clearance. These observations suggest that some compensatory mechanism for the defect of Mincle may operate through other PRRs, such as TLR9, which may make the role of Mincle in these responses unclear.

IL-22 is produced by CD4+ T, γδT, NK, and NK T cells and promotes antimicrobial immunity, inflammation, and tissue repair at barrier surfaces, including the skin, pancreas, intestine, liver, lung, and kidney (42, 54–56). The expansion of IL-22-producing cells appears to be regulated by the AhR transcription factor (43, 56). In addition, the expression of AhR is regulated by TNF-α (57). In the current study, IL-22 and TNF-α production and AhR expression in the lungs were decreased in Mincle KO mice during the innate immune phase after cryptococcal infection, which suggests that the AhR/IL-22 axis may be regulated by Mincle-dependent production of TNF-α. IL-22 and IL-17A are known to induce the secretion of antimicrobial peptides, such as S100A8, S100A9, and β-defensin, which are involved in the local host defense to microorganisms in the skin, airway, and intestine (44, 45). Mambula et al. demonstrated that calprotectin, a complex of S100A8 and S100A9, expresses anticryptococcal activity via nutritional deprivation of zinc (58). However, Wozniak et al. revealed that IL-22-deficient mice are resistant to infection with C. neoformans, as shown by equivalent levels of antimicrobial peptide production and survival rates compared to WT mice (17). In the current study, production of S100A8, S100A9, and β-defensin was not decreased in Mincle KO mice, although IL-22 production was reduced. These results suggest that some compensatory mechanism may operate to keep the secretion levels of antimicrobial peptides unchanged at the mucosal area in the skin, airway, and intestine. Although the precise mechanism remains unclear, other cytokines such as IL-17A may be candidates for such compensation (43, 44).

In the final series of experiments, we addressed the possibility that C. deneoformans may possess some ligand for Mincle to deliver activation signals in the immune cells. Although whole C. deneoformans did not activate the reporter cells expressing Mincle, its disrupted lysates showed small, but significant, activity in this reporter assay. These results suggest the possible existence of a Mincle ligand inside the yeast cells but not on their surface. Yamasaki et al. showed that three strains of Cryptococcus spp. fail to activate the reporter cell expression (41), which could be explained by the possible existence of Mincle ligands inside this fungus. On the other hand, it has been reported that mammalian β-GlcCer activates the Mincle-mediated signaling pathway by acting as DAMPs (37, 46). In addition, β-GlcCer is located at the cell membrane and masked by the capsule in this fungus (59). In the current study, we showed that β-GlcCer derived from C. utilis activated the reporter cells expressing Mincle, although β-GlcCer from C. deneoformans was not used. In previous studies, the structure of β-GlcCer was not reported to differ between C. utilis and C. neoformans (46, 47). These results suggest that β-GlcCer could be a candidate molecule to trigger the Mincle-mediated signaling pathway and induce the inflammatory response during infection with C. deneoformans. Further investigations are required to clarify this possibility.

In conclusion, the present study demonstrated that Mincle expression in lungs is induced in a CARD9-dependent manner at the early stage of cryptococcal infection and suggested that Mincle may be involved in the production of Th22-related cytokines, including IL-22, TNF-α, and IL-6. C. deneoformans may possess some ligand such as β-GlcCer for Mincle to trigger the activation signals through CARD9, a common adapter molecule for CLRs (60). However, Mincle deficiency did not affect the fungal elimination, Th1/Th2 cytokine balance, or secretion of antimicrobial peptides, suggesting that Mincle may not be essential and that some compensational mechanism may exist for promoting the host protective response against C. deneoformans infection. Thus, this study may provide important implications for better understanding the mechanism involved in the recognition of this fungal pathogen by host immune cells.

MATERIALS AND METHODS

Ethics statement.

This study was performed in strict accordance with the Fundamental Guidelines for Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions under the jurisdiction of the Ministry of Education, Culture, Sports, Science, and Technology in Japan, 2006. All experimental procedures involving animals followed the Regulations for Animal Experiments and Related Activities at Tohoku University, Sendai, Japan, and were approved by the Institutional Animal Care and Use Committee at Tohoku University. All experiments were performed under anesthesia, and all efforts were made to minimize the suffering of the animals.

Mice.

C57BL/6 mice, purchased from CLEA (Tokyo, Japan), were used as controls (WT). Mincle gene-disrupted (KO) and CARD9 KO mice were generated and established as described previously (41, 61) and backcrossed to C57BL/6 mice for more than eight generations. Male or female mice at 6 to 8 weeks of age and 16 to 24 g of weight were used in the experiments. Mice were allocated to each experimental group randomly. All mice were kept under specific pathogen-free conditions at the Institute for Animal Experimentation, Tohoku University Graduate School of Medicine. The conditions of the breeding room were as follows: room temperature, 20 to 29°C; humidity, 30 to 70%; light/dark cycle, 12 h; and ad libitum availability of water and food. Microbial monitoring of mice was regularly carried out by the Central Institute for Experimental Animals. We took the utmost care to alleviate any pain and suffering on the part of the mice. Mice were sacrificed by cervical dislocation prior to analysis.

Cryptococcus deneoformans.

A strain of C. deneoformans, designated B3501 (a kind gift from Kwong Chung, National Institutes of Health, Bethesda, MD, USA) was used. The yeast cells were cultured on potato dextrose agar (PDA; Eiken, Tokyo, Japan) plates for 2 to 3 days before use. Mice were anaesthetized by an intraperitoneal injection of 70 mg/kg of pentobarbital (Abbott Laboratory, North Chicago, IL, USA) and restrained on a small board. Live C. deneoformans (1 × 106 cells) was inoculated at 50 μl into the trachea of each mouse using a 24-gauge catheter (Terumo, Tokyo, Japan).

Preparation of lung leukocytes.

Pulmonary intraparenchymal leukocytes were prepared as previously described (62). Briefly, the chest of the mouse was opened, and the lung vascular bed was flushed by injecting 3 ml of chilled physiological saline into the right ventricle. The lungs were then excised and washed in physiological saline. The lungs, teased apart with a 40-μm cell strainer (BD Falcon, Bedford, MA, USA), were incubated in RPMI 1640 medium (Sigma-Aldrich, St. Louis, MO, USA) with 5% fetal calf serum (FCS; BioWest, Nuaillé, France), 100 U/ml penicillin G, 100 μg/ml streptomycin, 10 mM HEPES, 50 μM 2-mercaptoethanol (ME; Sigma-Aldrich), and 2 mM l-glutamine containing 20 U/ml collagenase and 1 μg/ml DNase I (Sigma-Aldrich). After incubation for 60 min at 37°C accompanied by vigorous shaking, the tissue fragments and the majority of dead cells were removed by passing the mixture through a 40-μm cell strainer. After centrifugation, the cell pellet was resuspended in 4 ml of 40% (vol/vol) Percoll (Pharmacia, Uppsala, Sweden) and layered onto 4 ml of 80% (vol/vol) Percoll. After centrifugation at 600 × g for 20 min at 15°C, the cells at the interface were collected, washed three times, and counted using a hemocytometer.

Histological examination.

Lung specimens obtained from mice were fixed in 10% neutral buffered formalin, dehydrated, and embedded in paraffin. Sections were cut and stained with hematoxylin and eosin (H&E) or periodic acid-Schiff (PAS) stain using standard staining procedures at the Biomedical Research Core, Animal Pathology Platform of the Tohoku University Graduate School of Medicine. The stained sections were observed using a Leica DM750 microscope (Leica Microsystems, Wetzlar, Germany). The photographs were taken with a Leica ICC50 HD camera and analyzed with Leica LAS EZ software (Leica Microsystems).

Immunohistochemical analysis.

Lung tissues were fixed in 10% neutral buffered formalin. After paraffin-embedded blocks had been cut into 5-μm sections and mounted onto slides, the specimens were deparaffinized and rehydrated. High-temperature antigen retrieval involved boiling the slides in citrate buffer (10 mM, pH 6.0) for 5 min followed by blocking with 10% rabbit serum. The samples were incubated with rabbit anti-CLEC4E polyclonal antibody (Bioss Antibody, USA) at a dilution of 1:400 overnight at 4°C. Endogenous peroxidase activity was blocked by treatment with 30% H2O2 blocking solution for 20 min. After washing, slides were incubated with Simple Stain Mouse MAX-PO (Nichirei, Tokyo, Japan) and were then incubated with horseradish peroxidase-conjugated streptavidin (Nichirei) and washed. The slides were incubated with diaminobenzidine substrate and counterstained with Carrazzi’s hematoxylin solution (Wako, Osaka, Japan).

Preparation and culture of BM-DCs.

Dendritic cells (DCs) were prepared from bone marrow (BM) cells as described by Lutz et al. (63). Briefly, BM cells from mice were cultured at 2 × 105/ml in 10 ml RPMI 1640 medium supplemented with 10% FCS, 100 U/ml penicillin G, 100 μg/ml streptomycin, and 50 μM 2ME containing 20 ng/ml murine granulocyte-macrophage colony-stimulating factor (GM-CSF) (Wako). On day 3, 10 ml of the same medium was added, followed by a half change with the GM-CSF-containing culture medium on day 6. On day 8, nonadherent cells were collected and used as BM-DCs. The obtained cells were cultured with C. deneoformans, lipopolysaccharide (LPS) (Sigma-Aldrich), or TDM (Sigma-Aldrich) for 24 h at 37°C in a 5% CO2 incubator. The culture supernatants and cell pellets were collected and stored at −70°C before use.

Extraction of RNA and quantitative real-time RT-PCR.

Total RNA was extracted using Isogen (Wako Pure Chemical, Osaka, Japan), and the first-strand cDNA was synthesized using a PrimeScript first-strand cDNA synthesis kit (TaKaRa Bio, Otsu, Japan) according to the manufacturer’s instructions. Quantitative real-time RT-PCR was performed in a volume of 20 μl using gene-specific primers and FastStart Essential DNA Green Master (Roche Applied Science, Branford, CT, USA) in a LightCycler Nano system (Roche Applied Science). The primer sequences for amplification are shown in Table 1. Reaction efficiency with each primer set was determined using standard amplifications. Target gene expression levels and those of hypoxanthine-guanine phosphoribosyltransferase (HPRT) as a reference gene were calculated for each sample using the reaction efficiency. The results were analyzed using a relative quantification procedure and illustrated as relative expression compared with HPRT expression.

TABLE 1.

Primers for PCR

Genea Forward primer (5′–3′) Reverse primer (5′–3′)
Mincle CAGTGGCAATGGGTGGATGATAC AGTCCCTTATGGTGGCACAGTC
IL-12p35 GAGTTCCAGGCCATCAACGCA GCTTCTCCCACAGGAGGTTTCTG
IL-23p19 CTCAGCCAACTCCTCCAGCCAG CTGCTCCGTGGGCAAAGACC
TGF-β TGGACCGCAACAACGCCATCTATGAGAAAACC TGGAGCTGAAGCAATAGTTGGTATCCAGGGCT
KC GACCCTGAAGCTCCCTTGGTTC GACAGGTGCCATCAGAGCAGTC
RANTES TCTTCTCTGGGTTGGCACACAC CCTCACCATCATCCTCACTGCA
MIP-2 CTGAACAAAGGCAAGGCTAACTGAC CACATCAGGTACGATCCAGGCTTC
MIP-1α CACCCTCTGTCACCTGCTCAACATC GGTTCCTCGCTGCCTCCAAGACTCT
AhR GTCAAATCCTTCTAAGCGACACA AACCAGCACAAAGCCATTCA
S100A8 ACAAGGAAATCACCATGCCCTCTAC ATGCCACACCCACTTTTATCACCA
S100A9 CAACATCTGTGACTCTTTAGCCTTG ACTGTGCTTCCACCATTTGTCT
Cathelicidin GACACCAATCTCTACCGTCTCCT TGCCTTGCCACATACAGTCTCCT
RegIIIγ CCTAGCCACAAGCAAGATCCCAA AGGGAAGGGCCAGAGAAGGAGA
β1-defensin CTTTTCTCCCAGATGGAGCCAG CCTCCATGTTGAAGGCATTTGTATTG
α1-defensin CTTTGCCCTTGTCCTGCTTGGC TCTTCTCCTGGCTGCTCCTCAG
HPRT CGTTGGGCTTACCTCACTGC ATCGCTAATCACGACGCTGG
a

TGF, transforming growth factor; KC, keratinocyte-derived chemokine; RANTES, regulated on activation, normal T cell expressed and secreted; MIP, macrophage inflammatory protein; AhR, aryl hydrocarbon receptor; HPRT, hypoxanthine-guanine phosphoribosyltransferase.

Enumeration of viable C. deneoformans.

Mice were sacrificed 1, 2, 4, and 8 weeks after infection, and the lungs and brains were dissected carefully and excised and then homogenized separately in 5 ml and 1 ml, respectively, of distilled water by teasing with a stainless-steel mesh at room temperature. The homogenates were diluted appropriately with distilled water and inoculated at 100 μl on PDA plates and cultured for 2 to 3 days before the resulting colonies were counted.

Cytokine assay.

Mice were sacrificed on days 1, 3, 7, 14, and 28 after infection, and the lungs were excised and then homogenized separately in 5 ml of phosphate-buffered saline (PBS) by teasing through a stainless-steel mesh. After centrifugation, the supernatants were collected and stored at −70°C before use. Concentrations of IFN-γ, IL-12p40, IL-4, IL-5, IL-13, IL-17A, IL-22, IL-6, TNF-α, IL-1β, and IL-10 in lung homogenates and the culture supernatants were measured using each particular enzyme-linked immunosorbent assay (ELISA) kit (BioLegend for IFN-γ, IL-12p40, IL-4, IL-5, IL-17A, IL-22, IL-6, TNF-α, and IL-1β and eBioscience [San Diego, CA, USA] for IL-13).

Mincle-NFAT-GFP reporter assay.

T cell hybridoma 2B4 was transfected with the NFAT-GFP construct prepared by fusing three tandem NFAT-binding sites with enhanced GFP cDNA (64). This cell line was transfected with Mincle and FcRγ genes, and a Mincle-free version of the same cell line was used as a control. These cells were stimulated for 20 h at 2.5 × 105/ml with disrupted lysates of C. neoformans, which had been prepared using a multibead shocker (Yasui Kikai, Osaka, Japan) according to the manufacturer’s instructions, β-GlcCer derived from Candida utilis (a kind gift from Toshiya Sato, Kojin Life Sciences, Tokyo, Japan), and Bacille de Calmette et Guérin (BCG; Japan BCG Laboratory, Tokyo, Japan), and the expression of GFP was analyzed on the CD3+ cells, but not on dead 7-aminoactinomycin D (7-AAD)-stained cells, by flow cytometry.

Flow cytometry.

The cells were washed three times in PBS containing 1% FCS and 0.1% sodium azide and then stained with 7-AAD, PE-anti-F4/80 monoclonal antibody (MAb) (clone BM8; BioLegend, San Diego, CA, USA), APC-anti-CD11c MAb (clone N418; BioLegend), Pacific Blue-anti-Ly6c MAb (clone HK1.4; BioLegend), APC/Cy7-anti-Ly6G MAb (clone 1A8; BioLegend), PE-anti-CD45R/B220 MAb (clone RA3-6B2; BioLegend), PE/Cy7-anti-NK1.1 MAb (clone PK136; BioLegend), APC-anti-CD3ε MAb (clone 145-2C11; BioLegend), anti-Mincle-MAb (clone 1B6; MBL Life Science, Nagoya, Japan), and fluorescein isothiocyanate (FITC)-anti-rat IgG polyclonal antibody (pAb) (MBL Life Science). Isotype-matched IgG was used for control staining. The stained cells were analyzed using a BD FACS Canto II flow cytometer (BD Bioscience). Data were collected from 20,000 to 30,000 individual cells using forward-scatter and side-scatter parameters to set a gate on the lymphocyte or myeloid cell populations.

Statistical analysis.

Data were analyzed using JMP Pro 11.2.0 software (SAS Institute Japan, Tokyo, Japan). Data are expressed as the mean ± standard deviation (SD). Differences between groups were examined for statistical significance using Welch’s t test. A P value less than 0.05 was considered significant.

ACKNOWLEDGMENTS

We thank the Biomedical Research Unit of Tohoku University Hospital for providing technical support and Toshiya Sato (Kohjin Life Sciences, Tokyo, Japan) for providing the β-GlcCer. This work was supported in part by a Grant-in-Aid for Scientific Research (B) (18H02851) and Early-Career Scientists (19K17920) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan; by the Research Program on Emerging and Reemerging Infectious Diseases from the Japan Agency for Medical Research and Development, AMED (JP19fk0108094 and JP20fk0108094); by the Strategic International Collaborative Research Program (SICORP), AMED (JP19jm0210073 and 20jm0210074); by the MSD Life Science Foundation, Public Interest Incorporated Foundation (ID-014); and by the Joint Usage/Research Program of the Medical Mycology Research Center, Chiba University (20-2).

We declare no conflict of interest.

REFERENCES

  • 1.Hagen F, Khayhan K, Theelen B, Kolecka A, Polacheck I, Sionov E, Falk R, Parnmen S, Lumbsch HT, Boekhout T. 2015. Recognition of seven species in the Cryptococcus gattii/Cryptococcus neoformans species complex. Fungal Genet Biol 78:16–48. doi: 10.1016/j.fgb.2015.02.009. [DOI] [PubMed] [Google Scholar]
  • 2.Perfect JR, Casadevall A. 2002. Cryptococcosis. Infect Dis Clin North Am 16:837–874, v–vi. doi: 10.1016/S0891-5520(02)00036-3. [DOI] [PubMed] [Google Scholar]
  • 3.Cunha BA. 2001. Central nervous system infections in the compromised host: a diagnostic approach. Infect Dis Clin North Am 15:567–590. doi: 10.1016/s0891-5520(05)70160-4. [DOI] [PubMed] [Google Scholar]
  • 4.Jarvis JN, Harrison TS. 2007. HIV-associated cryptococcal meningitis. AIDS 21:2119–2129. doi: 10.1097/QAD.0b013e3282a4a64d. [DOI] [PubMed] [Google Scholar]
  • 5.Feldmesser M, Tucker S, Casadevall A. 2001. Intracellular parasitism of macrophages by Cryptococcus neoformans. Trends Microbiol 9:273–278. doi: 10.1016/s0966-842x(01)02035-2. [DOI] [PubMed] [Google Scholar]
  • 6.Gilbert AS, Wheeler RT, May RC. 2014. Fungal pathogens: survival and replication within macrophages. Cold Spring Harb Perspect Med 5:a019661. doi: 10.1101/cshperspect.a019661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lim TS, Murphy JW. 1980. Transfer of immunity to cryptococcosis by T-enriched splenic lymphocytes from Cryptococcus neoformans-sensitized mice. Infect Immun 30:5–11. doi: 10.1128/IAI.30.1.5-11.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Koguchi Y, Kawakami K. 2002. Cryptococcal infection and Th1-Th2 cytokine balance. Int Rev Immunol 21:423–438. doi: 10.1080/08830180213274. [DOI] [PubMed] [Google Scholar]
  • 9.Arora S, Olszewski MA, Tsang TM, McDonald RA, Toews GB, Huffnagle GB. 2011. Effect of cytokine interplay on macrophage polarization during chronic pulmonary infection with Cryptococcus neoformans. Infect Immun 79:1915–1926. doi: 10.1128/IAI.01270-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Tohyama M, Kawakami K, Futenma M, Saito A. 1996. Enhancing effect of oxygen radical scavengers on murine macrophage anticryptococcal activity through production of nitric oxide. Clin Exp Immunol 103:436–441. doi: 10.1111/j.1365-2249.1996.tb08299.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hardison SE, Ravi S, Wozniak KL, Young ML, Olszewski MA, Wormley FL. 2010. Pulmonary infection with an interferon-gamma-producing Cryptococcus neoformans strain results in classical macrophage activation and protection. Am J Pathol 176:774–785. doi: 10.2353/ajpath.2010.090634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Müller U, Stenzel W, Köhler G, Werner C, Polte T, Hansen G, Schütze N, Straubinger RK, Blessing M, McKenzie ANJ, Brombacher F, Alber G. 2007. IL-13 induces disease-promoting type 2 cytokines, alternatively activated macrophages and allergic inflammation during pulmonary infection of mice with Cryptococcus neoformans. J Immunol 179:5367–5377. doi: 10.4049/jimmunol.179.8.5367. [DOI] [PubMed] [Google Scholar]
  • 13.Zhang Y, Wang F, Tompkins KC, McNamara A, Jain AV, Moore BB, Toews GB, Huffnagle GB, Olszewski MA. 2009. Robust Th1 and Th17 immunity supports pulmonary clearance but cannot prevent systemic dissemination of highly virulent Cryptococcus neoformans H99. Am J Pathol 175:2489–2500. doi: 10.2353/ajpath.2009.090530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Murdock BJ, Huffnagle GB, Olszewski MA, Osterholzer JJ. 2014. Interleukin-17A enhances host defense against cryptococcal lung infection through effects mediated by leukocyte recruitment, activation, and gamma interferon production. Infect Immun 82:937–948. doi: 10.1128/IAI.01477-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Szymczak WA, Sellers RS, Pirofski L. 2012. IL-23 dampens the allergic response to Cryptococcus neoformans through IL-17-independent and -dependent mechanisms. Am J Pathol 180:1547–1559. doi: 10.1016/j.ajpath.2011.12.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hardison SE, Wozniak KL, Kolls JK, Wormley FL. 2010. Interleukin-17 is not required for classical macrophage activation in a pulmonary mouse model of Cryptococcus neoformans infection. Infect Immun 78:5341–5351. doi: 10.1128/IAI.00845-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wozniak KL, Hole CR, Yano J, Fidel PL, Wormley FL. 2014. Characterization of IL-22 and antimicrobial peptide production in mice protected against pulmonary Cryptococcus neoformans infection. Microbiology (Reading) 160:1440–1452. doi: 10.1099/mic.0.073445-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sato K, Yamamoto H, Nomura T, Kasamatsu J, Miyasaka T, Tanno D, Matsumoto I, Kagesawa T, Miyahara A, Zong T, Oniyama A, Kawamura K, Yokoyama R, Kitai Y, Ishizuka S, Kanno E, Tanno H, Suda H, Morita M, Yamamoto M, Iwakura Y, Ishii K, Kawakami K. 2020. Production of IL-17A at innate immune phase leads to decreased Th1 immune response and attenuated host defense against infection with Cryptococcus deneoformans. J Immunol 205:686–698. doi: 10.4049/jimmunol.1901238. [DOI] [PubMed] [Google Scholar]
  • 19.Takeda K, Kaisho T, Akira S. 2003. Toll-like receptors. Annu Rev Immunol 21:335–376. doi: 10.1146/annurev.immunol.21.120601.141126. [DOI] [PubMed] [Google Scholar]
  • 20.Willment JA, Brown GD. 2008. C-type lectin receptors in antifungal immunity. Trends Microbiol 16:27–32. doi: 10.1016/j.tim.2007.10.012. [DOI] [PubMed] [Google Scholar]
  • 21.Yamamoto H, Nakamura Y, Sato K, Takahashi Y, Nomura T, Miyasaka T, Ishii K, Hara H, Yamamoto N, Kanno E, Iwakura Y, Kawakami K. 2014. Defect of CARD9 leads to impaired accumulation of gamma interferon-producing memory phenotype T cells in lungs and increased susceptibility to pulmonary infection with Cryptococcus neoformans. Infect Immun 82:1606–1615. doi: 10.1128/IAI.01089-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Romani L. 2011. Immunity to fungal infections. Nat Rev Immunol 11:275–288. doi: 10.1038/nri2939. [DOI] [PubMed] [Google Scholar]
  • 23.Dambuza IM, Brown GD. 2015. C-type lectins in immunity: recent developments. Curr Opin Immunol 32:21–27. doi: 10.1016/j.coi.2014.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Brown GD, Taylor PR, Reid DM, Willment JA, Williams DL, Martinez-Pomares L, Wong SYC, Gordon S. 2002. Dectin-1 is a major beta-glucan receptor on macrophages. J Exp Med 196:407–412. doi: 10.1084/jem.20020470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Taylor PR, Tsoni SV, Willment JA, Dennehy KM, Rosas M, Findon H, Haynes K, Steele C, Botto M, Gordon S, Brown GD. 2007. Dectin-1 is required for beta-glucan recognition and control of fungal infection. Nat Immunol 8:31–38. doi: 10.1038/ni1408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Saijo S, Ikeda S, Yamabe K, Kakuta S, Ishigame H, Akitsu A, Fujikado N, Kusaka T, Kubo S, Chung S, Komatsu R, Miura N, Adachi Y, Ohno N, Shibuya K, Yamamoto N, Kawakami K, Yamasaki S, Saito T, Akira S, Iwakura Y. 2010. Dectin-2 recognition of α-mannans and induction of Th17 cell differentiation is essential for host defense against Candida albicans. Immunity 32:681–691. doi: 10.1016/j.immuni.2010.05.001. [DOI] [PubMed] [Google Scholar]
  • 27.Sato K, Yang X, Yudate T, Chung J-S, Wu J, Luby-Phelps K, Kimberly RP, Underhill D, Cruz PD, Ariizumi K. 2006. Dectin-2 is a pattern recognition receptor for fungi that couples with the Fc receptor gamma chain to induce innate immune responses. J Biol Chem 281:38854–38866. doi: 10.1074/jbc.M606542200. [DOI] [PubMed] [Google Scholar]
  • 28.Graham LM, Gupta V, Schafer G, Reid DM, Kimberg M, Dennehy KM, Hornsell WG, Guler R, Campanero-Rhodes MA, Palma AS, Feizi T, Kim SK, Sobieszczuk P, Willment JA, Brown GD. 2012. The C-type lectin receptor CLECSF8 (CLEC4D) is expressed by myeloid cells and triggers cellular activation through Syk kinase. J Biol Chem 287:25964–25974. doi: 10.1074/jbc.M112.384164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bugarcic A, Hitchens K, Beckhouse AG, Wells CA, Ashman RB, Blanchard H. 2008. Human and mouse macrophage-inducible C-type lectin (Mincle) bind Candida albicans. Glycobiology 18:679–685. doi: 10.1093/glycob/cwn046. [DOI] [PubMed] [Google Scholar]
  • 30.Nakamura K, Kinjo T, Saijo S, Miyazato A, Adachi Y, Ohno N, Fujita J, Kaku M, Iwakura Y, Kawakami K. 2007. Dectin-1 is not required for the host defense to Cryptococcus neoformans. Microbiol Immunol 51:1115–1119. doi: 10.1111/j.1348-0421.2007.tb04007.x. [DOI] [PubMed] [Google Scholar]
  • 31.Nakamura Y, Sato K, Yamamoto H, Matsumura K, Matsumoto I, Nomura T, Miyasaka T, Ishii K, Kanno E, Tachi M, Yamasaki S, Saijo S, Iwakura Y, Kawakami K. 2015. Dectin-2 deficiency promotes Th2 response and mucin production in the lungs after pulmonary infection with Cryptococcus neoformans. Infect Immun 83:671–681. doi: 10.1128/IAI.02835-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Tanno D, Yokoyama R, Kawamura K, Kitai Y, Yuan X, Ishii K, De Jesus M, Yamamoto H, Sato K, Miyasaka T, Shimura H, Shibata N, Adachi Y, Ohno N, Yamasaki S, Kawakami K. 2019. Dectin-2-mediated signaling triggered by the cell wall polysaccharides of Cryptococcus neoformans. Microbiol Immunol 63:500–512. doi: 10.1111/1348-0421.12746. [DOI] [PubMed] [Google Scholar]
  • 33.Huang H-R, Li F, Han H, Xu X, Li N, Wang S, Xu J-F, Jia X-M. 2018. Dectin-3 recognizes glucuronoxylomannan of Cryptococcus neoformans serotype AD and Cryptococcus gattii serotype B to initiate host defense against cryptococcosis. Front Immunol 9:1781. doi: 10.3389/fimmu.2018.01781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Campuzano A, Castro-Lopez N, Wozniak KL, Leopold Wager CM, Wormley FL. 2017. Dectin-3 is not required for protection against Cryptococcus neoformans infection. PLoS One 12:e0169347. doi: 10.1371/journal.pone.0169347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Matsumoto M, Tanaka T, Kaisho T, Sanjo H, Copeland NG, Gilbert DJ, Jenkins NA, Akira S. 1999. A novel LPS-inducible C-type lectin is a transcriptional target of NF-IL6 in macrophages. J Immunol 163:5039–5048. [PubMed] [Google Scholar]
  • 36.Yamasaki S, Ishikawa E, Sakuma M, Hara H, Ogata K, Saito T. 2008. Mincle is an ITAM-coupled activating receptor that senses damaged cells. Nat Immunol 9:1179–1188. doi: 10.1038/ni.1651. [DOI] [PubMed] [Google Scholar]
  • 37.Williams SJ. 2017. Sensing lipids with Mincle: structure and function. Front Immunol 8:1662. doi: 10.3389/fimmu.2017.01662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ishikawa E, Ishikawa T, Morita YS, Toyonaga K, Yamada H, Takeuchi O, Kinoshita T, Akira S, Yoshikai Y, Yamasaki S. 2009. Direct recognition of the mycobacterial glycolipid, trehalose dimycolate, by C-type lectin Mincle. J Exp Med 206:2879–2888. doi: 10.1084/jem.20091750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Behler-Janbeck F, Takano T, Maus R, Stolper J, Jonigk D, Tort Tarrés M, Fuehner T, Prasse A, Welte T, Timmer MSM, Stocker BL, Nakanishi Y, Miyamoto T, Yamasaki S, Maus UA. 2016. C-type lectin Mincle recognizes glucosyl-diacylglycerol of Streptococcus pneumoniae and plays a protective role in pneumococcal pneumonia. PLoS Pathog 12:e1006038. doi: 10.1371/journal.ppat.1006038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wells CA, Salvage-Jones JA, Li X, Hitchens K, Butcher S, Murray RZ, Beckhouse AG, Lo Y-L-S, Manzanero S, Cobbold C, Schroder K, Ma B, Orr S, Stewart L, Lebus D, Sobieszczuk P, Hume DA, Stow J, Blanchard H, Ashman RB. 2008. The macrophage-inducible C-type lectin, Mincle, is an essential component of the innate immune response to Candida albicans. J Immunol 180:7404–7413. doi: 10.4049/jimmunol.180.11.7404. [DOI] [PubMed] [Google Scholar]
  • 41.Yamasaki S, Matsumoto M, Takeuchi O, Matsuzawa T, Ishikawa E, Sakuma M, Tateno H, Uno J, Hirabayashi J, Mikami Y, Takeda K, Akira S, Saito T. 2009. C-type lectin Mincle is an activating receptor for pathogenic fungus, Malassezia. Proc Natl Acad Sci U S A 106:1897–1902. doi: 10.1073/pnas.0805177106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Chen L, Deng H, Cui H, Fang J, Zuo Z, Deng J, Li Y, Wang X, Zhao L. 2018. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 9:7204–7218. doi: 10.18632/oncotarget.23208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zhang N, Pan H-F, Ye D-Q. 2011. Th22 in inflammatory and autoimmune disease: prospects for therapeutic intervention. Mol Cell Biochem 353:41–46. doi: 10.1007/s11010-011-0772-y. [DOI] [PubMed] [Google Scholar]
  • 44.Liang SC, Tan X-Y, Luxenberg DP, Karim R, Dunussi-Joannopoulos K, Collins M, Fouser LA. 2006. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J Exp Med 203:2271–2279. doi: 10.1084/jem.20061308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Eyerich S, Wagener J, Wenzel V, Scarponi C, Pennino D, Albanesi C, Schaller M, Behrendt H, Ring J, Schmidt-Weber CB, Cavani A, Mempel M, Traidl-Hoffmann C, Eyerich K. 2011. IL-22 and TNF-α represent a key cytokine combination for epidermal integrity during infection with Candida albicans. Eur J Immunol 41:1894–1901. doi: 10.1002/eji.201041197. [DOI] [PubMed] [Google Scholar]
  • 46.Rodrigues ML, Travassos LR, Miranda KR, Franzen AJ, Rozental S, de Souza W, Alviano CS, Barreto-Bergter E. 2000. Human antibodies against a purified glucosylceramide from Cryptococcus neoformans inhibit cell budding and fungal growth. Infect Immun 68:7049–7060. doi: 10.1128/iai.68.12.7049-7060.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Mor V, Farnoud AM, Singh A, Rella A, Tanno H, Ishii K, Kawakami K, Sato T, Del Poeta M. 2016. Glucosylceramide administration as a vaccination strategy in mouse models of cryptococcosis. PLoS One 11:e0153853. doi: 10.1371/journal.pone.0153853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Miyake Y, Masatsugu O, Yamasaki S. 2015. C-type lectin receptor MCL facilitates Mincle expression and signaling through complex formation. J Immunol 194:5366–5374. doi: 10.4049/jimmunol.1402429. [DOI] [PubMed] [Google Scholar]
  • 49.Kerscher B, Dambuza IM, Christofi M, Reid DM, Yamasaki S, Willment JA, Brown GD. 2016. Signalling through MyD88 drives surface expression of the mycobacterial receptors MCL (Clecsf8, Clec4d) and Mincle (Clec4e) following microbial stimulation. Microbes Infect 18:505–509. doi: 10.1016/j.micinf.2016.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Nakamura K, Miyazato A, Xiao G, Hatta M, Inden K, Aoyagi T, Shiratori K, Takeda K, Akira S, Saijo S, Iwakura Y, Adachi Y, Ohno N, Suzuki K, Fujita J, Kaku M, Kawakami K. 2008. Deoxynucleic acids from Cryptococcus neoformans activate myeloid dendritic cells via a TLR9-dependent pathway. J Immunol 180:4067–4074. doi: 10.4049/jimmunol.180.6.4067. [DOI] [PubMed] [Google Scholar]
  • 51.Patin EC, Orr SJ, Schaible UE. 2017. Macrophage inducible C-type lectin as a multifunctional player in immunity. Front Immunol 8:861. doi: 10.3389/fimmu.2017.00861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sharma A, Steichen AL, Jondle CN, Mishra BB, Sharma J. 2014. Protective role of Mincle in bacterial pneumonia by regulation of neutrophil mediated phagocytosis and extracellular trap formation. J Infect Dis 209:1837–1846. doi: 10.1093/infdis/jit820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Heitmann L, Schoenen H, Ehlers S, Lang R, Hölscher C. 2013. Mincle is not essential for controlling Mycobacterium tuberculosis infection. Immunobiology 218:506–516. doi: 10.1016/j.imbio.2012.06.005. [DOI] [PubMed] [Google Scholar]
  • 54.Sonnenberg GF, Fouser LA, Artis D. 2011. Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22. Nat Immunol 12:383–390. doi: 10.1038/ni.2025. [DOI] [PubMed] [Google Scholar]
  • 55.Zenewicz LA, Flavell RA. 2011. Recent advances in IL-22 biology. Int Immunol 23:159–163. doi: 10.1093/intimm/dxr001. [DOI] [PubMed] [Google Scholar]
  • 56.Rutz S, Eidenschenk C, Ouyang W. 2013. IL-22, not simply a Th17 cytokine. Immunol Rev 252:116–132. doi: 10.1111/imr.12027. [DOI] [PubMed] [Google Scholar]
  • 57.Drozdzik A, Dziedziejko V, Kurzawski M. 2014. IL-1 and TNF-α regulation of aryl hydrocarbon receptor (AhR) expression in HSY human salivary cells. Arch Oral Biol 59:434–439. doi: 10.1016/j.archoralbio.2014.02.003. [DOI] [PubMed] [Google Scholar]
  • 58.Mambula SS, Simons ER, Hastey R, Selsted ME, Levitz SM. 2000. Human neutrophil-mediated nonoxidative antifungal activity against Cryptococcus neoformans. Infect Immun 68:6257–6264. doi: 10.1128/.68.11.6257-6264.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Caballero Van Dyke MC, Wormley FL Jr. 2018. A call to arms: quest for a cryptococcal vaccine. Trends Microbiol 26:436–446. doi: 10.1016/j.tim.2017.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Iliev ID, Leonardi I. 2017. Fungal dysbiosis: immunity and interactions at mucosal barriers. Nat Rev Immunol 17:635–646. doi: 10.1038/nri.2017.55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Hara H, Ishihara C, Takeuchi A, Imanishi T, Xue L, Morris SW, Inui M, Takai T, Shibuya A, Saijo S, Iwakura Y, Ohno N, Koseki H, Yoshida H, Penninger JM, Saito T. 2007. The adaptor protein CARD9 is essential for the activation of myeloid cells through ITAM-associated and Toll-like receptors. Nat Immunol 8:619–629. doi: 10.1038/ni1466. [DOI] [PubMed] [Google Scholar]
  • 62.Kawakami K, Kohno S, Morikawa N, Kadota J, Saito A, Hara K. 1994. Activation of macrophages and expansion of specific T lymphocytes in the lungs of mice intratracheally inoculated with Cryptococcus neoformans. Clin Exp Immunol 96:230–237. doi: 10.1111/j.1365-2249.1994.tb06547.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Lutz MB, Kukutsch N, Ogilvie AL, Rössner S, Koch F, Romani N, Schuler G. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods 223:77–92. doi: 10.1016/s0022-1759(98)00204-x. [DOI] [PubMed] [Google Scholar]
  • 64.Ohtsuka M, Arase H, Takeuchi A, Yamasaki S, Shiina R, Suenaga T, Sakurai D, Yokosuka T, Arase N, Iwashima M, Kitamura T, Moriya H, Saito T. 2004. NFAM1, an immunoreceptor tyrosine-based activation motif-bearing molecule that regulates B cell development and signaling. Proc Natl Acad Sci U S A 101:8126–8131. doi: 10.1073/pnas.0401119101. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES