Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2020 Oct 21;15(10):e0240972. doi: 10.1371/journal.pone.0240972

Evaluation of reference genes for quantitative real-time PCR normalization in the scarab beetle Holotrichia oblita

Minghui Xie 1, Yongzhi Zhong 1, Lulu Lin 1, Guangling Zhang 1, Weihua Su 1, Wanli Ni 2, Mingjing Qu 3, Haoliang Chen 1,*
Editor: Guy Smagghe4
PMCID: PMC7577503  PMID: 33085726

Abstract

Quantitative real-time polymerase chain reaction (qPT-PCR) is commonly used to analyze gene expression, however, the accuracy of the normalized results is affected by the expression stability of reference genes. Holotrichia oblita (Coleoptera: Scarabaeidae) causes serious damage to crops. Reliable reference genes in H. oblita are needed for qRT-PCR analysis. Therefore, we evaluated 13 reference genes under biotic and abiotic conditions. RefFinder provided a comprehensive stability ranking, and geNorm suggested the optimal number of reference genes for normalization. RPL13a and RPL18 were the most suitable reference genes for developmental stages, tissues, and temperature treatments; RPL13a and RPS3 were the most suitable for pesticide and photoperiod treatments; RPS18 and RPL18 were the most suitable for the two sexes. We validated the normalized results using odorant-binding protein genes as target genes in different tissues. Compared with the selected suitable reference genes, the expression of OBP1 in antennae, abdomen, and wings, and OBP2 in antennae and wings were overestimated due to the instability of ACTb. These results identified several reliable reference genes in H. oblita for normalization, and are valuable for future molecular studies.

Introduction

Quantitative real-time polymerase chain reaction (qRT-PCR), based on fluorescent signal monitoring, is commonly used for quantitative analysis of genes [1–3]. In most molecular studies, such as RNA sequencing (RNA-Seq) or RNA interference (RNAi), qRT-PCR is required to confirm accurate transcript changes of the target genes [4]. The reliability of qRT-PCR results is influenced by the availability of the reference genes [5]. The minimum requirements for qRT-PCR indicate that the effectiveness of reference genes as internal controls must be verified by corresponding experimental design [6]. Housekeeping genes used as reference genes without experimental validation can lead to poor normalization. Shi et al. [7] found that significant differences in the expression of HSP23 in Bradysia odoriphaga could not be detected under different temperatures when using the reference gene ACTb. The RNA polymerase Ⅱ gene, which is not a housekeeping gene, had more stable expression than classical housekeeping genes in different human tissues [8]. An idealized reference gene with absolutely stable expression in all conditions could not be found. Expression levels can fluctuate because of various factors [7–10]. The use of inappropriate reference genes can bias quantitative results. Specific genes normalized by a single reference gene are not credible without proper validation [11, 12]. The stability of reference genes under specific experimental conditions must be evaluated to prevent nonbiological variations or errors [13].

Holotrichia oblita Faldermann (Coleoptera: Scarabaeidae) is widely distributed in China and causes serious damage to crops, forests, and lawns [14, 15]. H. oblita adults stay underground during the day, while flying, feeding, and mating occur at night. Larvae feed on plant roots and remain underground during their development. H. oblita has a broad host range, extended feeding period, and cryptic habits [16]. Chemical pesticides are often used to kill larvae, but these can lead to soil pollution. The use of pheromone-baited traps can reduce larval populations by trapping adults. qRT-PCR has been applied to quantitative studies of olfactory genes to increase understanding of the odor recognition mechanism of H. oblita [17–21]. The reference genes for H. oblita, however, have not been evaluated under corresponding experimental conditions. Previously, a single housekeeping gene was randomly used for normalization.

The stability and effectiveness of reference genes for H. oblita need to be systematically evaluated. We assessed 13 candidate reference genes that involved several factors. These included developmental stage, tissue, sex, temperature, pesticide treatment, and photoperiod. We used the geNorm, NormFinder, BestKeeper, ΔCt method, and RefFinder to identify the stability of candidates. We studied the expression profile of two tissue-specific genes across tissues, which were standardized by the selected reference genes and a commonly used reference gene.

Materials and methods

Insects rearing

We collected H. oblita in Feixi County (117°60′E, 31°39′N), Hefei, Anhui, China, in May 2018. No permits were required for the described study, which complied with all relevant regulations. Adults of both sexes were caught from fields at night and then placed in plastic boxes (60 × 50 × 50 cm) [16]. The bottom of the box was covered with a 20-cm deep soil layer with a moisture content of 15−18%. About 200 adults were housed in each box and the sex ratio was approximately 1:1 [22]. The adults were fed with fresh elm leaves (Ulmus pumila). We collected eggs every week and placed them in the box with the same soil. After the eggs hatched, larvae were fed with slices of fresh potato. When the larvae reached the 2nd instar, each larva was put in a separate cup. All of the insects were reared in a walk-in chamber under constant conditions of 25 ± 1°C with 60 ± 5% relative humidity and a 8:16 h (L:D) photoperiod.

Sample collection and treatment

We evaluated the candidate reference genes under the following settings: developmental stage, tissue, sex, temperature, pesticide treatment, and photoperiod. After being processed under each experimental condition, all samples were immediately put into liquid nitrogen and stored at -70°C. Each treatment had three biological replicates.

Developmental stages

The developmental stages included eggs (100 per sample), 1st instar larvae (6 per sample), 2nd instar larvae (1 per sample), 3rd instar larvae (1 per sample), pupae (1 per sample), and adults (1 male and 1 female per sample).

Tissues

Male and female adults were dissected into six body parts (antenna, head without antenna, thorax, abdomen, leg, and wing) respectively. One hundred pairs of antenna were separated and pooled as one sample. Samples of the head without antenna, abdomen, and thorax were obtained from two individuals. Leg samples were obtained from 12 individuals and wing samples were obtained from 6 individuals.

Temperatures

The 3rd instar larvae of H.oblita were exposed to 4°C, 10°C, 20°C, or 30°C for 2 h. The surviving individuals at each temperature treatment were collected and frozen. There was one individual larva per sample.

Pesticide treatments

We used clothianidin and bifenthrin insecticides in this study. They were dissolved in acetone at 2000 mg/L and 100 mg/L to produce stock solutions. The stock solutions were diluted with deionized water and used to treat soil containing 3rd instar larvae and the tests were scored at 48 h for larval mortality. At 48 h, the LC50 concentrations of clothianidin and bifenthrin were 44.668 and 0.875 mg per kg of soil, respectively. The 3rd instar larvae were then placed into soil with the LC50 concentrations for 48 h at 25°C. We collected the surviving larvae and used one individual for each sample.

Sexes

Three pairs of male and female adults were caught on the night of May 2, which is the local early emergence period. We used one individual for each sample.

Photoperiods

We used the laboratory-reared adults for the photoperiod experiments. Newly emerged H.oblita adults were immediately placed at five photoperiods, including 0:24 h (L:D), 6:18, 12:12, 16:8, and 24:0. One pair of mated adults was put into a transparent plastic box and exposed to one of the five photoperiods randomly. After 7 d, one pair of adults was taken from each photoperiod and constituted one sample.

Total RNA extraction and cDNA synthesis

We used the MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) to extract total RNA for all of the noted samples after being ground in liquid nitrogen. The purity and concentration of each RNA sample were checked by NanoVue Plus (GE Company, Fairfield, CT, USA). We used the OD value at a 260/280 nm ratio between 1.85 and 2.10 was used for further cDNA synthesis. Total RNA (1 μg per sample) was reverse transcribed following the manufacturer’s instructions for the PrimeScript®RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). We checked the cDNA concentrations on the CFX96 System using RPS6 as a reference and adjusted the Ct value of all samples to approximately 18. Then, the cDNA was stored at -20°C until used.

Primer design for candidate reference gene

We selected 13 reference genes commonly used for insect research. They included glyceraldehyde-3-phosphate (GAPDH), beta-actin (ACTb), six ribosomal protein genes (RPL13a, RPL18, RPS18, RPS6, RPS3, and RPL28), syntaxin-6 (SYN6), beta-tubulin (TUBb), alpha-tubulin (TUBa), ubiquitin-conjugating enzyme (UBC), and succinate dehydrogenase (SDHA) (Table 1). Because of the stable expression profiles, we evaluated those genes as candidate reference genes in insects [7, 18, 23–26]. The primers of all genes were designed by Primer 5.0 with an optimum Tm of 60 ± 2°C, lengths between 19 to 25 bp, and a PCR product size of 112−198 bp (Table 1). The accession numbers and primers of the genes are listed in Table 1.

Table 1. Information about two target genes and 13 candidate reference genes in Holotrichia oblita.

Accession number Gene Name Primers (5’→3) (F: Forward; R: Reverse)’ Product Length (bp) Efficieny (E) (%) Regression coefficient (R2)
GQ856258 Odorant-binding protein 1 (OBP1) F: TTGCGTTGCTCAAACTGGA 194 94.559 0.997
R: TCTGCTTTATCCTTGTATTCGTCT
GQ856257 Odorant-binding protein 2 (OBP2) F: ATTTTGTTGTATTTGCTGCATTG 167 99.071 0.991
R: TGTCGGGTATCTGTTCCTTCAT
MT213595 Ribosomal protein L13a (RPL13a) F: GAAAGAGGCAAGCAAGCATT 165 100.559 0.997
R: CCAACCGACTTCGTGAGACA
MT213596 Ribosomal protein L18 (RPL18) F: CGACCAAAGGATATGGGATG 198 102.752 0.998
R: GGACCAAAATGTTTCACTGCT
MT213597 Ribosomal protein S18 (RPS18) F: GCATGAAGAAAATTCGTGCTC 112 102.235 1.000
R: TTAGATACACCGACTGTGCGAC
MT213598 Ribosomal protein S6 (RPS6) F: GTATGGGAGCAGAAGTAGAGGC 143 99.893 0.999
R: CGATAACAGAAGACGGACACG
MT213599 Ribosomal protein S3 (RPS3) F: ACGACTACGTTGATACGGCTAC 146 102.981 0.999
R: GGGTTCCACGACGGATACA
MT213560 Syntaxin-6 (SYN6) F: CGAAATTGATAGTCCTCAAAGG 168 103.025 0.999
R: TCTAGCATTACTGCTTGCTCATC
MT213561 Beta-tubulin (TUBb) F: TATGGGCACATTACTCATCTCAA 125 91.331 0.999
R: AGGGTGGCGTTGTATGGTTC
MT213562 Alpha-tubulin (TUBa) F: ATACGACCGCCATTGCTGA 163 97.125 0.997
R: CCATACCTACTTCCTCGTAATCCT
MT213563 Ubiquitin-conjugating enzyme (UBC) F: CTTTTGTACGAGTAGTTCACCCTAT 160 93.095 1.000
R: CATTATGACTGCTTCCACCGT
MT213564 Ribosomal protein L28 (RPL28) F: AAATCGGTTGGCATAATAGATG 158 99.120 0.999
R: CAGGCGTTTCAGTTTATACAGG
MT213565 Succinate dehydrogenase (SDHA) F: AAGCCCTAAAAGATCCATTCTC 160 100.682 0.991
R: GCCATCGGTTCTAAGTCGG
Open in a new tab

The melting curve and standard curve were drawn to check the specificity and amplification efficiency. We generated the standard curve by a serial 10-fold dilution of cDNA and calculated the efficiency value (E) of all primers by the formula: E = (10[−1/slope]−1)×100 [27, 28].

qRT-PCR

Each amplification reaction (25 μL) contained 12.5 μL SYBR Premix (Takara Bio, Dalian, China), 2 μL cDNA, 1 μL of each primer (10 μM), and 8.5 μL ddH2O. According to the MIQE guidelines, we performed qRT-PCR on CFX96 System (Bio-Rad, Hercules, CA, USA) [6]. The qRT-PCR amplification conditions were set as follow: 95°C for 30 s, followed by 45 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s. We performed each treatment with three biological samples and each sample had two technical replicates.

Stability of candidate reference genes

We used five algorithms to evaluate the stability of the candidate reference genes: RefFinder [29], ΔCt method [30], BestKeeper [28], geNorm [31], and NormFinder [32]. The RefFinder program provided a proper weight for each gene and generated a comprehensive ranking. The geNorm determined the optimal reference gene number by calculating the pairwise variation (Vn/Vn+1). The stability measure (M value) of gene expression calculated by geNorm proposed 1.5 as a cut-off line. A value less than 1.5 meant that this reference gene was stably expressed. Generally, lower values calculated by these algorithms indicated higher stability.

Validation by two target genes

We used two odorant-binding protein genes (OBP1 and OBP2) to verify the stability of the reference genes [33]. We used the optimum single reference gene RPS13 (RefFinder), the best reference gene pair RPL13a/RPL18 (geNorm), and a normally used reference gene ACTb to calculate the relative expression of OBP1 and OBP2 in H. Oblita [17, 19–21]. We calculated the relative transcript levels of the two target genes according to the 2–ΔΔCT formula and conducted the significance analysis by Tukey’s b test (P = 0.05) across different tissues by SPSS 16.0 (SPSS Inc., 2007, Chicago, IL, USA).

Results

Primer amplification efficiency and specificity

Table 1 provides descriptions of the gene name, designed primer pair, product length, and primer amplification efficiency of all genes. We calculated the amplification efficiency by the slope of the standard curves. The efficiency values ranged between 91.33% (TUBb) and 103.03% (SYN6), with all regression coefficient (R2) values > 0.99. We evaluated the primer specificity of all genes by the melting curve. The melting temperatures ranged from 79.00°C (RPL28) to 85.00°C (TUBb) with a single sharp peak, which confirmed gene-specific amplification.

Cycle threshold (Ct) values and variations in candidate reference genes

For each candidate reference gene, we analyzed Ct values to reveal the level of transcription (Fig 1). Under all of the experimental conditions, raw Ct values of reference genes varied from 14.04 (ACTb among different developmental stages) to 30.51 (TUBa among different temperatures). ACTb, with the lowest median Ct value (17.23), had the highest expression among the genes, whereas SYN6 with the highest Ct values (25.22) had the lowest expression. RPS18 had the smallest variance, indicating that it was the most stable, whereas TUBa had the highest variance, indicating that it was the most variable.

Fig 1. Cycle thresholds (Ct) values of the 13 candidate reference genes for H. oblita.

Fig 1

Open in a new tab

Each box includes the percentiles that ranged from 25th (lower edge) to75th (upper edge). The whisker caps depict the minimum and maximum data. The median is denoted by a horizontal line inside the box.

Evaluation of candidate reference genes

Biotic experimental conditions

As shown in Table 2, geNorm ranked RPL13a and RPL18 as the most stable reference genes for normalization across different development stages. The M values, provided by geNorm, of ACTb, TUBa, and UBC were greater than the critical value of 1.5, and they were considered unsuitable as reference genes (Fig 2A). RPL13a and RPS6 were recommended as the most stable reference genes by NormFinder, while in the BestKeeper ranking, they were RPS3 and RPL18 (Table 2). RPS6 and RPL13a had the greatest stability by the ΔCt method (Table 2). The comprehensive ranking provided by RefFinder from the highest to lowest was as follows: RPL18, RPL13a, GAPDH, TUBb, SDHA, RPS6, RPS3, RPS18, RPL28, SYN6, UBC, ACTb, and TUBa. The pairwise values of V2/V3 calculated by geNorm below 0.15 indicated that two reference genes were enough for accurate normalization (Fig 2B). Therefore, RPL18 and RPL13a were demonstrated to be the best reference genes across the developmental stages of H. oblita (Figs 2B and 3A).

Table 2. Stability ranking of candidate reference genesunder biotic conditions, using four statistical algorithms.
Biotic conditions Rank GeNorm NormFinder BestKeeper ΔCt
Gene Stability Gene Stability Gene Stability Gene Stability
Developmental stages 1 RPL13a 0.212 RPL13a 0.074 RPS3 0.477 RPS6 0.696
2 RPL18 0.212 RPS6 0.075 RPL18 0.502 RPL13a 0.701
3 RPS6 0.223 RPS18 0.085 GAPDH 0.542 RPS18 0.723
4 RPS18 0.248 RPL18 0.123 RPL13a 0.560 RPL18 0.731
5 RPL28 0.271 TUBb 0.149 RPL28 0.577 TUBb 0.751
6 TUBb 0.289 RPL28 0.151 UBC 0.592 RPL28 0.752
7 RPS3 0.302 RPS3 0.244 TUBb 0.593 RPS3 0.780
8 SYN6 0.348 SYN6 0.301 RPS6 0.597 SYN6 0.851
9 GAPDH 0.388 GAPDH 0.376 RPS18 0.617 GAPDH 0.878
10 UBC 0.435 SDHA 0.427 SYN6 0.797 UBC 0.965
11 SDHA 0.494 UBC 0.463 SDHA 0.924 SDHA 0.997
12 ACTb 0.613 ACTb 0.823 ACTb 1.126 ACTb 1.421
13 TUBa 1.060 TUBa 2.417 TUBa 2.739 TUBa 3.520
Tissues 1 RPL13a 0.213 RPL13a 0.119 RPS3 0.574 RPL13a 0.978
2 RPL18 0.213 RPS3 0.183 RPS6 0.668 RPL18 1.013
3 RPS18 0.236 RPL18 0.201 RPL18 0.669 RPS6 1.016
4 RPS6 0.250 RPS18 0.216 RPL13a 0.747 RPS18 1.020
5 RPS3 0.280 RPS6 0.218 RPS18 0.759 RPL28 1.041
6 RPL28 0.309 TUBb 0.235 TUBb 0.790 RPS3 1.053
7 TUBb 0.404 RPL28 0.259 RPL28 0.877 TUBb 1.098
8 GAPDH 0.490 GAPDH 0.399 GAPDH 1.040 GAPDH 1.176
9 UBC 0.566 UBC 0.530 UBC 1.042 UBC 1.284
10 SYN6 0.643 SYN6 0.657 SDHA 1.099 SYN6 1.376
11 SDHA 0.736 SDHA 0.659 SYN6 1.231 SDHA 1.469
12 ACTb 1.090 ACTb 1.973 ACTb 2.484 ACTb 3.010
13 TUBa 1.468 TUBa 2.376 TUBa 2.871 TUBa 3.543
Sexes 1 RPL18 0.301 RPS18 0.053 RPS3 0.423 RPS18 0.608
2 RPS18 0.301 RPL13a 0.091 TUBb 0.506 RPL13a 0.624
3 RPL13a 0.351 RPL18 0.116 RPS6 0.506 RPL18 0.634
4 RPL28 0.377 TUBb 0.146 ACTb 0.600 TUBb 0.662
5 SYN6 0.416 SYN6 0.179 RPS18 0.619 RPL28 0.703
6 UBC 0.464 RPL28 0.200 RPL18 0.674 SYN6 0.722
7 SDHA 0.536 RPS6 0.207 RPL13a 0.688 SDHA 0.726
8 TUBb 0.590 SDHA 0.230 SYN6 0.809 RPS6 0.730
9 RPS6 0.657 RPS3 0.238 SDHA 0.813 RPS3 0.746
10 RPS3 0.723 UBC 0.306 RPL28 0.845 UBC 0.774
11 ACTb 0.781 ACTb 0.426 UBC 0.902 ACTb 0.881
12 GAPDH 1.027 GAPDH 0.461 GAPDH 0.937 GAPDH 0.916
13 TUBa 1.498 TUBa 2.422 TUBa 2.307 TUBa 3.512
Open in a new tab
Fig 2.

Fig 2

Open in a new tab

Expression stability (A) and pairwise variation (B) analysis by geNorm for the 13 reference genes in H. oblita. (Ⅰ) developmental stages, (Ⅱ) tissues, (Ⅲ) sexes, (Ⅳ) temperatures, (Ⅴ) pesticides, (Ⅵ) photoperiods, and (Ⅶ) total samples. (A) Expression stability: The value of Vn /Vn+1 < 0.15 means that the additional reference genes could not significantly optimize the normalization. (B) Pairwise variation: A M < 1.5 is considered to be adequate for normalization.

Fig 3. Comprehensive stability of the 13 reference genes in H. oblita analyzed by RefFinder.

Fig 3

Open in a new tab

The ranking value is listed across the following: (A) developmental stages, (B) tissues, (C) sexes, (D) temperatures, (E) pesticides, (F) photoperiods, and (G) total samples. A lower Geomean value indicates more stability.

For tissue samples, RPL13a and RPL18 were considered suitable reference genes using geNorm, and the M values for all reference genes were below 1.5 except for TUBa (Fig 2A, Table 2). The most stable reference genes were RPL13a according to NormFinder and the ΔCt method (Table 2). RPS3 ranked first in BestKeeper was and ranked second in NormFinder (Table 2). The general ranking, according to RefFinder, was as follows: RPL13a, RPL18, RPS3, RPS6, RPS18, RPL28, TUBb, GAPDH, UBC, SYN6, SDHA, ACTb, and TUBa (Fig 3B). On the basis of the pairwise results calculated by geNorm, RPL13a and RPL18 were selected for accurate normalization (Figs 2B and 3B).

For different sexes of adults, the top four of the stable ranking were the same using NormFinder and ΔCt (Table 2). RPS18, RPL13a, and RPL18 were recommended as the best reference genes by geNorm, NormFinder, and the ΔCt method; however, in BestKeeper, they were RPS3, TUBb, and RPS6 (Table 2). On the basis of the four statistical formulas, TUBa was confirmed as the most unstable gene under the three biotic factors (Table 2). GeNorm indicated that TUBa and ACTb were the most unstable genes because the M values were greater than 1.5 (Fig 2A). As shown in Fig 3C, RefFinder provided the ranking as RPS18, RPL18, RPL13a, TUBb, RPS3, RPL28, SYN6, RPS6, SDHA, ACTb, UBC, GAPDH, and TUBa from most stable to most unstable. According to the pairwise value of geNorm, RPS18 and RPL18 were the most suitable reference genes across sexes (Figs 2B and 3C).

Abiotic experimental conditions

For different temperatures, RPL18 and RPL13a were ranked first and third, respectively, by BestKeeper and ΔCt, and they were the top two by geNorm (Table 3). However, NormFinder showed that SDHA was the most stable reference gene (Table 3). The least stable five reference genes were the same as those calculated by the four algorithms with the sequence being RPL28, SYN6, UBC, ACTb, and TUBa (Table 3). According to the result of geNorm, the pairwise values from V2/V3 to V11/V12 were below the 0.15 cutoff line and all gene M values were below 1.5 except for TUBa (Fig 2A and 2B). RefFinder ranked RPL18 and RPL13a as the top two, so they were evaluated as the genes most suitable for temperature treatments (Figs 2B and 3D).

Table 3. Stability ranking of candidate reference genes under abiotic conditions using four statistical algorithms.
Abiotic conditions Rank GeNorm NormFinder BestKeeper ΔCt
Gene Stability Gene Stability Gene Stability Gene Stability
Temperatures 1 RPL13a 0.243 SDHA 0.097 RPL18 0.599 RPL18 0.922
2 RPL18 0.243 TUBb 0.116 GAPDH 0.634 TUBb 0.941
3 RPS6 0.287 GAPDH 0.116 RPL13a 0.672 RPL13a 0.953
4 SDHA 0.330 RPS3 0.119 RPS3 0.678 GAPDH 0.959
5 TUBb 0.350 RPL18 0.185 TUBb 0.684 SDHA 0.971
6 RPS3 0.368 RPS6 0.218 RPS6 0.735 RPS6 0.978
7 GAPDH 0.381 RPL13a 0.241 RPS18 0.781 RPS3 0.999
8 RPS18 0.418 RPS18 0.366 SDHA 0.789 RPS18 1.016
9 RPL28 0.464 RPL28 0.518 RPL28 0.885 RPL28 1.129
10 SYN6 0.538 SYN6 0.573 SYN6 0.975 SYN6 1.266
11 UBC 0.659 UBC 0.881 UBC 1.151 UBC 1.603
12 ACTb 0.813 ACTb 0.991 ACTb 1.183 ACTb 1.816
13 TUBa 1.397 TUBa 3.166 TUBa 3.387 TUBa 4.613
Pesticides 1 RPL18 0.146 RPL13a 0.067 RPS18 0.539 RPL13a 0.597
2 RPL28 0.146 RPS3 0.078 SYN6 0.544 RPS3 0.601
3 RPL13a 0.159 RPS6 0.105 RPS3 0.579 RPL18 0.607
4 SYN6 0.181 RPS18 0.140 GAPDH 0.606 RPL28 0.623
5 RPS18 0.213 RPL18 0.186 RPL18 0.658 RPS18 0.632
6 RPS3 0.231 RPL28 0.200 RPL13a 0.684 RPS6 0.641
7 SDHA 0.267 SYN6 0.224 RPL28 0.698 SYN6 0.643
8 GAPDH 0.291 UBC 0.241 SDHA 0.702 SDHA 0.662
9 RPS6 0.324 SDHA 0.251 UBC 0.756 GAPDH 0.695
10 UBC 0.373 GAPDH 0.294 TUBb 0.785 UBC 0.725
11 TUBb 0.445 TUBb 0.461 RPS6 0.824 TUBb 0.910
12 ACTb 0.524 ACTb 0.648 ACTb 1.147 ACTb 1.094
13 TUBa 0.853 TUBa 1.826 TUBa 1.461 TUBa 2.664
Photoperiods 1 RPL13a 0.330 RPL13a 0.145 RPS18 0.545 RPL13a 0.886
2 RPL18 0.330 RPS3 0.165 RPS3 0.630 RPL18 0.893
3 RPS3 0.337 RPL18 0.197 GAPDH 0.692 RPS3 0.903
4 RPS6 0.374 RPS6 0.212 UBC 0.692 RPS6 0.943
5 SDHA 0.415 RPS18 0.242 RPL13a 0.763 SDHA 0.950
6 RPS18 0.440 SDHA 0.264 RPL28 0.791 RPS18 0.961
7 RPL28 0.475 GAPDH 0.344 RPL18 0.849 RPL28 1.021
8 GAPDH 0.506 RPL28 0.355 SDHA 0.855 GAPDH 1.024
9 TUBb 0.550 TUBb 0.433 RPS6 0.897 TUBb 1.080
10 UBC 0.638 UBC 0.583 TUBb 1.052 UBC 1.274
11 ACTb 0.766 SYN6 0.913 ACTb 1.383 ACTb 1.597
12 SYN6 0.877 ACTb 0.915 SYN6 1.521 SYN6 1.619
13 TUBa 1.282 TUBa 2.382 TUBa 2.488 TUBa 3.502
Open in a new tab

For pesticide treatments, RPL13a was ranked first by NormFinder and ΔCt, whereas in geNorm the best gene was RPL18 (Table 3). GeNorm results indicated that RPL18 and RPL28 were the best reference genes (Table 3). According to geNorm, the results of pairwise values and M values were similar to those of the temperature treatments. ACTb and TUBa were demonstrated to be the most unstable genes using four analysis tools (Fig 2A). According to RefFinder’s online tool, the integrated ranking was RPL13a, RPS3, RPL18, RPS18, RPL28, SYN6, RPS6, GAPDH, SDHA, UBC, TUBb, ACTb, and TUBa (Fig 3E). Combining the results of pairwise values by geNorm, we selected RPL13a and RPS3 to be the most reliable reference genes (Figs 2B and 3E).

For different photoperiods, the top two ranked genes were RPL13a and RPL18 by geNorm and ΔCt, whereas RPL13a and RPS3 were ranked as the top two by NormFinder, RPS18 and RPS3 were ranked as the top two by BestKeeper (Table 3). According to the four algorithms, ACTb, SYN6, and TUBa were the most unstable candidate reference genes, and their M values were all higher than 1.5 (Table 3, Fig 2A). In addition, geNorm provided the pairwise value that Vn/Vn+1 were all below the 0.15 cutoff, except for V12/V13, which indicated that two reference genes were sufficient across the photoperiod treatments (Fig 2B). RefFinder indicated the ranking as RPL13a, RPS3, RPL18, RPS18, RPS6, SDHA, GAPDH, RPL28, UBC, TUBb, ACTb, SYN6, and TUBa (Fig 3F). RPL13a and RPS3 were considered to be the most suitable reference genes across different photoperiods (Figs 2B and 3F).

Total samples

For all of the experimental samples, RPL13a and RPL18 were the best reference genes in the stable ranking based on geNorm and ΔCt methods (Table 4). RPL13a and RPS6 were ranked the top two by NormFinder, whereas they were RPS3 and RPS18 by BestKeeper (Table 4). ACTb and TUBa had M values above 1.5 by geNorm analysis, but were ranked as least stable according to the four methods (Fig 2A). The general ranking generated by RefFinder was RPL13a, RPL18, RPS3, RPS18, RPS6, RPL28, TUBb, GAPDH, SDHA, UBC, SYN6, ACTb, and TUBa (Fig 3G). According to the results of the pairwise values, the two genes RPL13a and RPL18 were the best reference genes for all samples (Figs 2B and 3G).

Table 4. Stability ranking of candidate reference genes for total samples using four statistical algorithms.
Rank GeNorm NormFinder BestKeeper ΔCt
Gene Stability Gene Stability Gene Stability Gene Stability
1 RPL13a 0.301 RPL13a 0.197 RPS3 0.611 RPL13a 1.018
2 RPL18 0.301 RPS6 0.208 RPS18 0.667 RPL18 1.055
3 RPS3 0.351 RPS3 0.238 RPL18 0.718 RPS18 1.066
4 RPS18 0.377 RPS18 0.255 RPL13a 0.723 RPS3 1.076
5 RPL28 0.416 RPL18 0.268 RPL28 0.807 RPS6 1.098
6 RPS6 0.464 TUBb 0.296 RPS6 0.828 RPL28 1.110
7 TUBb 0.536 RPL28 0.314 GAPDH 0.828 TUBb 1.175
8 GAPDH 0.590 SDHA 0.474 TUBb 0.876 GAPDH 1.231
9 SDHA 0.657 GAPDH 0.510 UBC 0.913 SDHA 1.294
10 UBC 0.723 SYN6 0.636 SDHA 1.012 UBC 1.401
11 SYN6 0.781 UBC 0.671 SYN6 1.181 SYN6 1.412
12 ACTb 1.027 ACTb 1.507 ACTb 1.886 ACTb 2.443
13 TUBa 1.498 TUBa 2.768 TUBa 3.786 TUBa 4.076
Open in a new tab

Effect of reference gene selection

To evaluate the reliability of the chosen reference genes in H. oblita, we selected two odorant-binding protein genes (OBP1 and OBP2) as the target genes across different tissues (Fig 4). Despite its frequent use as a reference gene, ACTb ranked next to last among the 13 candidate genes in the different tissues (Fig 3B). The expression profiles of the two target genes normalized with RPL13a were consistent with the results of RPL13a/RPL18 (Fig 4). When calculated with ACTb, however, the expression levels of OBP1 in the antennae, abdomen, and wings and OBP2 in the antennae and wings were overestimated (Fig 4). The unstable reference genes led to more than 70-fold (head without antenna) and 60-fold (wing) errors in the quantification of OBP1 and OBP2 (Fig 4). Compared with the normalization results of RPL13a and RPL13a/RPL18, OBP1 expression in the abdomen normalized with ACTb increased by 2.83-fold and 3.14-fold, respectively.

Fig 4. Relative expressions of two odorant-binding protein genes in different tissues normalized by different reference genes.

Fig 4

Open in a new tab

(A) OBP1; (B) OBP2. Values are means ± SD based on three biological replicates. The expression levels of the legs were used as a calibrator to calculate the relative fold change in the different tissues. Different letters mean significant differences (P < 0.05).

Discussion

The reliability of qRT-PCR results is determined by components, including sample quality, primer specificity and suitable reference genes [11]. In this study, we obtained all of the samples from fresh insects that were well preserved after processing. We checked all RNA samples by A260/A280, and eliminated the DNA residues by the gDNA eraser in the reagent kit. The primers of the selected genes had good efficiencies, ranging from 91.33% to 103.03% (R2>0.99), and the corresponding melting curve contained a single sharp peak (Table 1). Our data suggested that RNA quality and primer design were adequate for qRT-PCR. The expression level of the reference gene should be within a reliable range [34]. The median Ct values were in the range of 17.23 and 25.22, which indicated that they conformed to the basic requirements for qualified reference genes (Fig 1).

The evaluation of reference genes is an important procedure for data normalization [35–37]. Tribolium castaneum was the first coleopteran insect in which reference genes were validated [2, 26]. Studies on the selection of reference genes have now been reported for several Coleoptera, including Agrilus planipennis [38], Mylabris cichorii [39], Harmonia axyridis [40], and Anomala corpulenta [18]. However, the best reference genes may vary significantly among different insect species. Also, the reference gene can be affected by biotic or abiotic factors, and no reference gene is likely to be suitable for all experiment treatments [41, 42]. ACTb is an important component of the cytoskeleton and widely distributed in cells. It has been the most common reference gene used for expression analysis [9, 43, 44]. ACTb was selected as a standardized reference gene in H. oblita [17, 19–21]. Our results showed that RPL18 was the best reference gene across different tissues of H. oblita adults, but among the tested genes, ACTb was next to last in stability (Fig 3B). We used OBP1 and OBP2 to validate the effectiveness of the candidate reference genes. Because of the instability of ACTb, the normalized results of the target genes in antennae, abdomen, or wings were overestimated (Fig 4). ACTb expression was significantly lower in antennae and wings than in other tissues. Therefore, up to 70-fold (head without antenna) and 60-fold (wing) changes were calculated in the relative expression of OBP1 and OBP2. The results show that the inappropriate selection of reference genes could lead to substantial errors in the quantitation of the target genes. Several other studies have challenged the applicability of ACTb as a reference gene for qRT-PCR [45–47]. These earlier results, and those of the present study, indicate that this “classic” gene is variable and needs to be assessed before further use as a reference gene.

Previous studies demonstrated that ribosomal protein genes exhibit high expression stability and should be considered as a source of candidate reference genes. In Cimex lectularius, RPL18 was the best reference gene among different developmental stages and tissues [48]. The expression of RPL32 was the best reference gene among developmental stages of Bactrocera (Tetradacus) minax [49]. RPL28 and RPS15 were the best reference genes under temperature stress [50]. After fungal infection, RPS3, RPS18, and RPL13a expressed stably in T. castaneum [2]. RPL10 expression was stable within populations in Spodoptera litura [23]. Ribosomal proteins are the main components of the ribosome, which is involved in cell metabolism and regulation [51]. Our results showed that RPL18 and RPL13a were always in the top three of the stability ranking, and they were the best pair at different temperatures, developmental stages, and tissues (Fig 3). In some studies, however, ribosomal protein genes had unstable expression [7, 52]. Our study showed that the gene with the most variable expression in all of the experimental conditions was TUBa (Fig 3). The M value of TUBa, determined by geNorm, was above the cutoff value of 1.5 under all experimental conditions. This finding indicates that it is unsuitable as a reference gene for H. oblita (Fig 2B). TUBa was identified as an available reference gene, however, in Tetranychus cinnabarinus [53], Drosophila melanogaster [9], and Nilaparvata lugens [54].

We used five statistical programs to analyze the stability rankings. The ΔCt method analyzes stability by calculating the pairwise variation within the candidate genes [30]. Ct raw data was used by BestKeeper to determine the stability index by ranking the standard deviation (SD) and coefficient of variance (CV) of each candidate gene [27, 28]. In contrast to BestKeeper, the Ct value should be transformed to linear relative expression for NormFinder and geNorm [31, 32, 55]. For each candidate gene, both programs measure the expression variation in pairs to provide a stability value. Because of the unique analytical methods, the statistical results of the best-ranked genes showed variation among the different tools [56]. RPS18 and RPL18 ranked in the top three most stable, across sexes, according to the three methods except for BestKeeper (Table 2). Among the tested temperatures, RPL13a and RPL18 exhibited the great stability using ΔCt, BestKeeper, and geNorm, but in NormFinder, the most stable genes were SDHA, TUBb, and GADPH (Table 2). Despite these slight differences, the overall trends of the four methods were similar in the stability rankings. GeNorm analyzed whether the pairwise variation (Vn /Vn+1) was above 0.15 and determined the optimal number for reliable normalization. In this study, the V2/3 value within all factors was below 0.15, which meant that two reference genes were sufficient as internal standards (Fig 2B). Combined with the comprehensive ranking of RefFinder, RPL13a and RPL18 were considered to be the best normalizing genes across all developmental stages, tissues, and temperature treatments; RPL13a and RPS3 across pesticide and photoperiod treatments; and RPS18 and RPL18 across sexes (Fig 3).

Conclusions

We investigated 13 candidate reference genes of H. oblita under abiotic and biotic stresses and used five algorithms to evaluate their expression stability. We found reasonable variation in stability ranking as a result of the different formulas. RefFinder synthesized the results of these algorithms and provided the final results. Combined with the optimal reference gene number provided by geNorm, RPL13a and RPL18 were the most suitable reference genes in developmental stages, tissues, and temperature treatments; RPL13a and RPS3 in pesticide and photoperiod exposure; and RPS18 and RPL18 between the two sexes. OBP1 and OBP2 were used as target genes to validate the difference between the selected optimum reference genes and a classic reference gene. The results identified suitable reference genes in H. oblita under various experimental conditions. These data will benefit future molecular studies.

Supporting information

S1 Fig. Melting curve of 13 candidate reference genes and two target genes.

(TIF)

Click here for additional data file. (1.6MB, tif)

Acknowledgments

Thanks to the reviewers for valuable comments on our paper.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This research was funded by the National Key Research and Development Program of China (No. 2018YFD0201009), Anhui Provincial Natural Science Foundation (No. 1908085QC137), and Anhui Technical System of Wheat Industry (Grant No. AHCYTX-02). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Bustin SA. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): Trends and problems. J Mol Endocrinol. 2002; 29(1): 23–39. 10.1677/jme.0.0290023 [DOI] [PubMed] [Google Scholar]
  • 2.Lord JC, Hartzer K, Toutges M, Oppert B. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge. J Microbiol Methods. 2010; 80(2): 219–221. 10.1016/j.mimet.2009.12.007 [DOI] [PubMed] [Google Scholar]
  • 3.Shakeel M, Rodriguez A, Tahir UB, Jin F. Gene expression studies of reference genes for quantitative real-time PCR: an overview in insects. Biotechnol Lett. 2017; 40(2): 227–236. 10.1007/s10529-017-2465-4 [DOI] [PubMed] [Google Scholar]
  • 4.Guénin S, Mauriat M, Pelloux J, Van Wuytswinkel O, Bellini C, Gutierrez L. Normalization of qRT-PCR data: the necessity of adopting a systematic, experimental conditions-specific, validation of references. J Exp Bot. 2009; 60(2): 487–493. 10.1093/jxb/ern305 [DOI] [PubMed] [Google Scholar]
  • 5.Scharlaken B, de Graaf DC, Goossens K, Brunain M, Peelman LJ, Jacobs FJ. Reference gene selection for insect expression studies using quantitative real-time PCR: The head of the honeybee, Apis mellifera, after a bacterial challenge. J Insect Sci. 2008; 8(33):1–10. 10.1673/031.008.3301 [DOI] [Google Scholar]
  • 6.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009; 55(4): 611–622. 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]
  • 7.Shi C, Yang F, Zhu X, Du E, Yang Y, Wang S, et al. Evaluation of housekeeping genes for quantitative real-time PCR analysis of Bradysia odoriphaga (Diptera: Sciaridae). Int J Mol Sci. 2016; 17(7): 1034 10.3390/ijms17071034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Radonić A, Thulke S, Mackay IM, Landt O, Siegert W, Nitsche A. Guideline to reference gene selection for quantitative real-time PCR. Biochem Bioph Res Co. 2004; 313(4): 856–862. 10.1016/j.bbrc.2003.11.177 [DOI] [PubMed] [Google Scholar]
  • 9.Ponton F, Chapuis M, Pernice M, Sword GA, Simpson SJ. Evaluation of potential referencegenes for reverse transcription qRT-PCR studies of physiological responses in Drosophila melanogaster. J Insect Physiol. 2011; 57(6): 840–850. 10.1016/j.jinsphys.2011.03.014 [DOI] [PubMed] [Google Scholar]
  • 10.Su YL, He WB, Wang J, Li JM, Liu SS, Wang XW. Selection of endogenous reference genes for gene expression analysis in the Mediterranean species of the Bemisiatabaci (Hemiptera: Aleyrodidae) complex. J Econ Entomol.2013; 106(3): 1446–1455. 10.1603/EC12459 [DOI] [PubMed] [Google Scholar]
  • 11.Bustin SA, Beaulieu JF, Huggett J, Jaggi R, Kibenge FS, Olsvik PA, et al. MIQE précis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments. BMC Molecular Biol. 2010; 11(1): 74 10.1186/1471-2199-11-74 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Stephan L, Tilmes V, Hülskamp M. Selection and validation of reference genes for quantitative Real-Time PCR in Arabis alpina. PloS ONE. 2019; 14(3): e0211172 10.1371/journal.pone.0211172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Huang L, Yan H, Jiang X, Zhang Y, Zhang X, Ji Y, et al. Reference gene selection for quantitative real-time reverse-transcriptase PCR in orchard grass subjected to various abiotic stresses. Gene. 2014; 553(2): 158–165. 10.1016/j.gene.2014.10.017 [DOI] [PubMed] [Google Scholar]
  • 14.Wei H, Zhang Z, Wang M. Underground pests in China. Shanghai Science and Technology Press; 1989. [Google Scholar]
  • 15.Guo W, Yan X, Zhao G, Han R. Increased efficacy of entomopathogenic nematode–insecticide combinations against Holotrichia oblita (Coleoptera: Scarabaeidae). J Econ Entom. 2016; 110(1): 41–51. 10.1093/jee/tow241 [DOI] [PubMed] [Google Scholar]
  • 16.Chen H, Lin L, Xie M.; Zhang G, Su W. Influence of Constant Temperature on Reproductive Parameters of Holotrichia oblita (Coleoptera: Scarabaeidae). J Insect Sci. 2015; 15(1): 93 10.1093/jisesa/iev070 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Li K, Wei H, Shu C, Zhang S, Cao Y, Luo C, et al. Identification and comparison of candidate odorant receptor genes in the olfactory and non-olfactory organs of Holotrichia oblita Faldermann by transcriptome analysis. Comp Biochem Physiol Part D Genomics Proteomics. 2017; 24: 1–11. 10.1016/j.cbd.2017.07.001 [DOI] [PubMed] [Google Scholar]
  • 18.Chen H, Qu M, Ali F, Lin L, Xie M, Zhang G, et al. Expression Analysis of Odorant-Binding Protein Genes and Chemosensory Protein Genes in Anomala corpulenta Motschulsky (Coleoptera: Scarabaeidae). J Kans Entomol Soc. 2019; 92(1): 376–389. 10.2317/0022-8567-92.1.376 [DOI] [Google Scholar]
  • 19.Yin J, Wang C, Fang C, Zhang S, Cao Y, Li K, et al. Functional characterization of odorant-binding proteins from the scarab beetle Holotrichia oblita based on semiochemical-induced expression alteration and gene silencing. Insect Biochem Mol Biol. 2019; 104: 11–19. 10.1016/j.ibmb.2018.11.002 [DOI] [PubMed] [Google Scholar]
  • 20.Wang B, Guan L, Zhong T, Li K, Yin J, Cao Y. Potential cooperations between odorant-binding proteins of the scarab beetle Holotrichia oblita Faldermann (Coleoptera: Scarabaeidae). PLoS ONE. 2013, 8(12): e84795 10.1371/journal.pone.0084795 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Wang C, Li J, Li E, Nyamwasa I, Li K, Zhang S, et al. Molecular and functional characterization of odorant-binding protein genes in Holotrichia oblita Faldermann. Int J Biol. Macromol.2019; 136: 359–367. 10.1016/j.ijbiomac.2019.06.013 [DOI] [PubMed] [Google Scholar]
  • 22.Li W, Yuan Y, An S, Yuan G, Luo M, Guo X. Bioassays on selection and feeding responses of Holotrichia oblita adults to different plant species. Acta Ecologica Sinica. 2009; 29(5): 293–296. 10.1016/j.chnaes.2009.09.006 [DOI] [Google Scholar]
  • 23.Lu Y, Yuan M, Gao X, Kang T, Zhan S, Wan H, et al. Identification and validation of reference genes for gene expression analysis using quantitative PCR in Spodoptera litura (Lepidoptera: Noctuidae). PLoS ONE. 2013; 8(7): e68059 10.1371/journal.pone.0068059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sang W, He L, Wang XP, Zhu-Salzman K, Lei CL. Evaluation of reference genes for RT-qPCR in Tribolium castaneum (Coleoptera: Tenebrionidae) under UVB stress. Environ Entomol. 2015; 44(2): 418–425. 10.1093/ee/nvv010 [DOI] [PubMed] [Google Scholar]
  • 25.Tan QQ, Zhu L, Li Y, Liu W, Ma WH, Lei CL, et al. A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi. PLoS ONE. 2015; 10(2): e0118693 10.1371/journal.pone.0118693 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Toutges MJ, Hartzer K, Lord J, Oppert B. Evaluation of reference genes for quantitative polymerase chain reaction across life cycle stages and tissue types of Tribolium castaneum. J Agric Food Chem. 2010; 58(16): 8948–8951. 10.1021/jf101603j [DOI] [PubMed] [Google Scholar]
  • 27.Jiang H, Qian Z, Lu W, Ding H, Yu H, Wang H, et al. Identification and characterization of reference genes for normalizing expression data from red swamp crawfish procambarus clarkii. Int J Mol Sci. 2015; 16(9): 21591–21605. 10.3390/ijms160921591 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-Based tool using pair-wise correlations. Biotechnol Lett. 2004; 26(6): 509–515. 10.1023/b:bile.0000019559.84305.47 [DOI] [PubMed] [Google Scholar]
  • 29.Xie F, Xiao P, Chen D.; Xu L, Zhang B. miRDeepFinder: a miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol Biol. 2012; 80(1): 75–84. 10.1007/s11103-012-9885-2 [DOI] [PubMed] [Google Scholar]
  • 30.Silver N, Best S, Jiang J, Thein SL. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Molecular Biol. 2006; 7(1): 33 10.1186/1471-2199-7-33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Vandesompele J, de Preter K, Pattyn F, Poppe B, van Roy N, de Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002; 3(7): research0034.1. 10.1186/gb-2002-3-7-research0034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004; 64(15): 5245–5250. 10.1158/0008-5472.CAN-04-0496 [DOI] [PubMed] [Google Scholar]
  • 33.Deng S, Yin J, Zhong T, Cao Y, Li K. Function and immunocytochemical localization of two novel odorant-binding proteins in olfactory sensilla of the scarab beetle Holotrichia oblita Faldermann (Coleoptera: Scarabaeidae). Chem Senses. 2012; 37(2): 141–150. 10.1093/chemse/bjr084 [DOI] [PubMed] [Google Scholar]
  • 34.Zhang Z, Li C, Zhang J, Chen F, Gong Y, Li Y, et al. Selection of the reference gene for expression normalization in Papaver somniferum L. under abiotic Stress and hormone Treatment. Genes, 2020; 11(2): 124 10.3390/genes11020124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Huggett J, Dheda K, Bustin S, Zumla A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005; 6(4): 279–284. 10.1038/sj.gene.6364190 [DOI] [PubMed] [Google Scholar]
  • 36.Jacob F, Guertler R, Naim S, Nixdorf S, Fedier A, Hacker NF, et al. Careful selection of reference genes is required for reliable performance of RT-qPCR in human normal and cancer cell lines. PloS ONE. 2013; 8(3): e59180 10.1371/journal.pone.0059180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Nonis A, De Nardi B, Nonis A. Choosing between RT-qPCR and RNA-seq: a back-of-the-envelope estimate towards the definition of the break-even-point. Anal Bioanal Chem.2014; 406(15): 3533–3536. 10.1007/s00216-014-7687-x [DOI] [PubMed] [Google Scholar]
  • 38.Rajarapu SP, Mamidala P, Mittapalli O. Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis). Insect Sci. 2012; 19(1): 41–46. 10.1111/j.1744-7917.2011.01447.x [DOI] [Google Scholar]
  • 39.Wang Y, Wang ZK, Huang Y, Liao YF, Yin YP. Identification of suitable reference genes for gene expression studies by qRT-PCR in the blister beetle Mylabris cichorii. J Insect Sci. 2014; 14(94):1–10. 10.1673/031.014.94 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Liang C, Han S, Han H, Zhao F, He Y. Selection of reference genes for Harmonia axyridis (Coleoptera: Coccinellidae) feeding on different diets. J Asia Pac Entomol. 2019; 22: 1115–1122. 10.1016/j.aspen.2019.07.011 [DOI] [Google Scholar]
  • 41.Li RM, Xie W, Wang SL, Wu QJ, Yang NN, Yang X, et al. Reference gene selection for qRT-PCR analysis in the sweet potato whitefly, Bemisia tabaci. (Hemiptera: Aleyrodidae). PLoS ONE. 2013; 8(1): e53006 10.1371/journal.pone.0053006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kosakyan A, Alama-Bermejo G, Bartošová-Sojková P, Born-Torrijos A, Šíma R., Nenarokova A, et al. Selection of suitable reference genes for gene expression studies in myxosporean (Myxozoa, Cnidaria) parasites. Sci rep. 2019; 9(1): 1–14. 10.1038/s41598-018-37186-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zhong H, Simons JW. Direct comparison of GAPDH, β-actin, cyclophilin, and 28S rRNA as internal standards for quantifying RNA levels under hypoxia. Biochem Biophys Res Commun. 1999; 259(3): 523–526. 10.1006/bbrc.1999.0815 [DOI] [PubMed] [Google Scholar]
  • 44.De Kok JB, Roelofs RW, Giesendorf BA, Pennings JL, Waas ET, Feuth T, et al. Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes. Lab Invest. 2005; 85(1): 154–159. 10.1038/labinvest.3700208 [DOI] [PubMed] [Google Scholar]
  • 45.Selvey S, Thompson EW, Matthaei K, Lea RA, Irving MG, Griffiths LR. β-Actin—an unsuitable internal control for RT-PCR. Mol Cell Probes. 2001; 15(5): 307–311. 10.1006/mcpr.2001.0376 [DOI] [PubMed] [Google Scholar]
  • 46.Ruan W, Lai M. Actin, a reliable marker of internal control? Clin Chim Acta. 2007; 385(1–2): 1–5. 10.1016/j.cca.2007.07.003 [DOI] [PubMed] [Google Scholar]
  • 47.Zhou SM, Tao Z, Shen C, Qian D, Wang CL, Zhou QC, et al. β-actin gene expression is variable among individuals and not suitable for normalizing mRNA levels in Portunus trituberculatus. Fish Shellfish Immunol. 2018; 81: 338–342. 10.1016/j.fsi.2018.07.021 [DOI] [PubMed] [Google Scholar]
  • 48.Mamidala P, Rajarapu SP, Jones SC, Mittapalli O. Identification and validation of reference genes for quantitative real-time polymerase chain reaction in Cimex lectularius. J Med Entomol. 2011; 48(4): 947–951. 10.1603/me10262 [DOI] [PubMed] [Google Scholar]
  • 49.Lü ZC, Wang LH, Dai RL, Zhang GF, Guo JY, Wan FH. Evaluation of endogenous reference genes of Bactrocera (Tetradacus) minax by gene expression profiling under various experimental conditions. Fla Entomol. 2014; 97(2): 597–604. 10.1653/024.097.0235 [DOI] [Google Scholar]
  • 50.Shakeel M, Zhu X, Kang TH, Wan H, Li M. Selection and evaluation of reference genes for quantitative gene expression studies in cotton bollworm, Helicoverpa armigera (Lepidoptera: Noctuidae). J Asia-PacEntomol. 2015; 18(2): 123–130. 10.1016/j.aspen.2015.01.001 [DOI] [Google Scholar]
  • 51.Lauber MA, Running WE, Reilly JP. B. subtilis ribosomal proteins: structural homology and post-translational modifications. J Proteome Res. 2009; 8(9): 4193–4206. 10.1021/pr801114k [DOI] [PubMed] [Google Scholar]
  • 52.Paim RM, Pereira MH, Ponzio RD, Rodrigues JO, Guarneri AA, Gontijo NF, et al. Validation of reference genes for expression analysis in the salivary gland and the intestine of Rhodnius prolixus (Hemiptera: Reduviidae) under different experimental conditions by quantitative real-time PCR. BMC Res Notes. 2012; 5(1): 128 10.1186/1756-0500-5-128 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Sun W, Jin Y, He L, Lu WC, Li M. Suitable reference gene selection for different strains and developmental stages of the carmine spider mite, Tetranychus cinnabarinus, using quantitative real-time PCR.J Insect Sci.2010; 10(1): 208 10.1673/031.010.20801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Yuan M, Lu Y, Zhu X, Wan H, Shakeel M, Zhan S, et al. Selection and evaluation of potential reference genes for gene expression analysis in the brown plant hopper, Nilaparvata lugens (Hemiptera: Delphacidae) using reverse-transcription quantitative PCR. PLoS ONE. 2014; 9: e86503 10.1371/journal.pone.0086503 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Ambroise V, Legay S, Guerriero G, Hausman JF, Cuypers A, Sergeant K. Selection of appropriate reference genes for gene expression analysis under abiotic stresses in Salix viminalis. Int J Mol Sci. 2019; 20(17): 4210 10.3390/ijms20174210 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Gao Z, Deng W, Zhu F. Reference gene selection for quantitative gene expression analysis in black soldier fly (Hermetia illucens). PLoS ONE. 2019; 14(8): e0221420 10.1371/journal.pone.0221420 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Melting curve of 13 candidate reference genes and two target genes.

(TIF)

Click here for additional data file. (1.6MB, tif)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES