Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2020 Sep 18;98(10):skaa311. doi: 10.1093/jas/skaa311

Dietary taurine supplementation attenuates lipopolysaccharide-induced inflammatory responses and oxidative stress of broiler chickens at an early age

Hongli Han 1, Jingfei Zhang 1, Yanan Chen 1, Mingming Shen 1, Enfa Yan 1, Chengheng Wei 1, Caiyun Yu 1, Lili Zhang 1, Tian Wang 1,✉
PMCID: PMC7584273  PMID: 32954422

Abstract

This study was conducted to investigate the effect of taurine as a prophylactic treatment on antioxidant function and inflammatory responses of broilers challenged with lipopolysaccharide (LPS). A total of 256 one-day-old male Arbor Acres broiler chicks were randomly assigned to four treatments with eight replicates of eight birds (eight birds per cage). Four treatment groups were designated as follows: 1) in the CON group, broilers fed a basal diet; 2) in the LPS group, LPS-challenged broilers fed a basal diet; 3) in the LPS + T1 group, LPS-challenged broilers fed a basal diet supplemented with 5.0 g/kg taurine; and 4) in the LPS + T2 group, LPS-challenged broilers fed a basal diet supplemented with 7.5 g/kg taurine. The LPS-challenged broilers were intraperitoneally injected with 1 mg/kg body weight (BW) of LPS at 16, 18, and 20 d of age, whereas the CON group received an injection of sterile saline. The results showed that broilers injected with LPS exhibited decreased (P < 0.05) the average daily gain (ADG) and the 21-d BW (P < 0.05), while taurine supplementation alleviated the negative effects of LPS. Additionally, the LPS-induced increases (P < 0.05) in serum alanine transaminase and aspartate transaminase activities were reversed by taurine supplementation. The taurines could alleviate the hepatic oxidative stress, with the presence of lower content of malondialdehyde (P < 0.05), higher content of glutathione (P < 0.05), and an increased glutathione peroxidase (GSH-Px) activity (P < 0.05). The concentrations of interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) in the liver were measured by ELISA kits, and the result showed that dietary taurine supplementation prevented these cytokines increases in the liver of LPS-induced broilers. Taurine reduced the genes expression of IL-1β, TNF-α, IL-6, cyclooxygenase-2, and inducible nitric oxide synthase, whereas it boosted the expression levels of antioxidant-related genes (nuclear factor erythroid 2-related factor 2, heme oxygenase-1, glutamate-cysteine ligase catalytic subunit, and GSH-Px) in the liver of LPS-induced broilers. In conclusion, dietary taurine supplementation in broilers mitigated LPS-induced defects in ADG, oxidative stress, and inflammatory responses.

Keywords: broiler, immunological stress, lipopolysaccharide, liver injury, oxidative damage, taurine

Introduction

The endotoxin lipopolysaccharide (LPS) is one of the major constituents of the outer coats in Gram-negative bacteria. Orally or abdominally injected LPS can increase the accumulation of proinflammatory mediators, leading to the production of cytokines and oxidative stress, which, in turn, causes hepatic inflammation (Hou et al., 2013; Wang et al., 2018). The LPS can trigger inflammatory responses in diverse species by activating signal pathways and promoting gene expressions, such as chickens (Chen et al., 2018), mouse (Zhang et al., 2020), and pig (Xia et al., 2018), which are characterized by reduced feed intake, decreased growth performance, and increased release of reactive oxygen species (ROS) and proinflammatory cytokine production (Takahashi et al., 2008; Munyaka et al., 2013; Gadde et al., 2017). It has been extensively used as a model to mimic bacterial infection and immunological stress in laboratory animals. The mechanisms of LPS-induced inflammatory responses have been widely explored. Toll-like receptor 4 (TLR4) serves as a signaling receptor for LPS, which leads to an activation of myeloid differentiation factor 88 (MyD88). The triggering of MyD88 pathways activates the nuclear factor-kappa B (NF-κB) signaling cascade, which promotes the biosynthesis of proinflammatory cytokines (Liu et al., 2017a). Moreover, inflammation and oxidative stress are tightly intertwined, because the overproduction of proinflammatory cytokines can generate ROS, ultimately inflicting oxidative injury in multiple organ systems (Godbout et al., 2005; Faheem et al., 2015). In the modern poultry industry, intensive production and feeding conditions increase the risks of exposure to pathogens and stressors. In recent years, the damage caused by immunological and oxidative stress in livestock production has gained considerable attention (Panda et al., 2009; Remus et al., 2014; Salami et al., 2015; Tan et al., 2015; Yang et al., 2019). Immunological and oxidative stress can change the partitioning of nutrients, decrease the growth potential of animals, induce various diseases, and even result in death (Eugeni et al., 1992; Min et al., 2018). Therefore, it is of great importance to understand the LPS-induced immune reaction, which would be helpful to alleviate the harmful consequences of stress and maintain the growth performance of broilers.

Taurine, as a nontoxic endogenous antioxidant, has become an attractive candidate for attenuating various toxins and drug-induced liver disease (Joydeep et al., 2011; Das et al., 2012). Taurine is an amino acid with antioxidant (Cassol et al., 2010), lipid-lowering (De Carvalho et al., 2018), anti-inflammatory, and immunomodulatory functions (Janusz and Ewa, 2014). Lu et al. (2019a) revealed that supplementation with taurine significantly decreased the level of malondialdehyde (MDA) in breast meat of heat-stressed broilers. Growing evidence shows that taurine appears to act as nonspecific radical oxygen species scavenger and a regulator of antioxidant defense system to reduce the occurrence of oxidative stress (De Luca et al., 2015; Coutinho et al., 2017). In addition, taurine can attenuate immune and oxidative damage via downregulating the components of the NF-κB signaling pathway and its downstream inflammatory target genes (Liu et al., 2017b; Abd-Elhakim et al., 2020; Jangra et al., 2020). Taurine can react with hypochlorous acid to produce taurine monochloramine in vivo, which, in turn, reduces or blocks the production of proinflammatory mediators (Schuller-Levis and Park, 2003, 2004). Inhibition of the release of proinflammatory cytokines by taurine in vitro (Nakajima et al., 2010) has also been reported. However, whether taurine exerts beneficial effects to regulate the broilers’ immunosuppressive status due to stress still remains unclear.

Based on the findings above, we used a typical immune stress model by intraperitoneal administration of LPS to investigate the effects of taurine on growth performance, hepatic antioxidant function, and inflammatory responses in LPS-challenged broiler chickens at an early age. Our results will provide useful insights for taurine to alleviate the adverse effects of production stress in broiler chickens.

Materials and Methods

All experimental procedures were conducted according to the guidelines on the Ethical Treatment of Experimental Animals set by the Ministry of Science and Technology in China. The experimental protocol was approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University.

Animals, diets, and experimental design

LPS from Escherichia coli serotype O55:B5 was purchased from Sigma-Aldrich Chemical Co. (#L2880; St. Louis, MO, USA). The LPS was dissolved in 0·86% (w/v) sterile saline solution to prepare 1 mg/mL LPS solution. Taurine (purity > 98.5%) was purchased from Jiangyin Huachang Food Biotechnology Co. Ltd. (Jiangyin, Zhejiang, China). A total of 256 one-day-old male Arbor Acres broiler chicks (Hewei Company, Xuancheng, Anhui, China) were randomly distributed into four treatment groups with eight replicates of eight birds. At 16, 18, and 20 d, the LPS-challenged groups were intraperitoneally injected with a dose of 1 mg/kg body weight (BW) LPS solution, whereas the CON group received an equivalent volume sterile saline injection. All birds were allocated into four treatments: 1) broilers fed a basal diet (CON); 2) LPS-challenged broilers fed a basal diet (LPS); 3) LPS-challenged broilers fed a basal diet and supplemented with 5.0 g/kg taurine (LPS + T1); and 4) LPS-challenged broilers fed a basal diet and supplemented with 7.5 g/kg taurine (LPS + T2). The dosage and its administration routine of LPS were referred to available findings (Chen et al., 2018; Jiang et al., 2019). The supplemental taurine levels were determined according to previous studies (Lu et al., 2019b; Xu et al., 2020).

Housing

During the trial period, birds had free access to feed and water in three-layer cages (120 × 60 × 50 cm; 0.09 m2 per chick) with 23:1 (L:D) per day. Meanwhile, the brooding temperature was maintained at 32 to 35 °C for the first 5 d and then gradually decreased by 0.5 °C every day until decreased to 26 °C and then kept constant. In addition, all birds were vaccinated according to a routine immunization program. The basal diet was formulated in accordance with the National Research Council (1994) nutrient requirements of the broiler, and its ingredient composition and nutrient level are listed in Table 1.

Table 1.

Ingredients and nutrient composition of broiler diets on fed basis

Ingredients Contents, % Calculated nutrient levels4 Contents, %
Corn 56.58 Apparent metabolizable energy, MJ/kg 12.52
Soybean meal 29.76 Crude protein 21.60
Corn gluten meal 4.96 Lysine 1.18
Soybean oil 3.97 Methionine 0.52
Limestone 1.19 Calcium 1.08
Dicalcium phosphate 1.49 Total phosphorus 0.70
Alanine1 0.54 Analyzed composition
Microcrystalline cellulose2 0.21 Crude protein 21.33
Salt 0.30 Crude fat 4.81
Premix3 1 Calcium 1.00
Total 100.00 Total phosphorus 0.66
Open in a new tab

1Alanine, the purity was 99%, was used to balance the nitrogen in all diets.

2Microcrystalline cellulose, the purity was 99%, was used to balance the different percentages of supplemental taurine.

3The premix provided per kilogram of diet: retinyl acetate for vitamin A 10,000 IU, cholecalciferol for vitamin D3 3,000 IU, dl-α-tocopheryl acetate for vitamin E 30 IU, menadione sodium bisulphate 1.3 mg, thiamin 2.2 mg, riboflavin 8.0 mg, nicotinamide 40 mg, choline chloride 600 mg, calcium pantothenate 10 mg, pyridoxine HCl 4 mg, biotin 0.04 mg, folic acid 1 mg, vitamin B12 (cobalamin) 0.013 mg, Zn 60 mg, Fe 80 mg, Cu 8.0 mg, Mn 110 mg, I 1.1 mg, and Se 0.3 mg.

4Calculated value.

Growth performance measurement

On days 1, 15, and 21 of the experiment, the BW and the total feed consumption of broilers were recorded to calculate average daily feed intake (ADFI), average daily gain (ADG), and gain to feed ratio (G:F) before (from 1 to 15 d of age) and after the LPS challenge (from 16 to 21 d of age). The G:F = ADG:ADFI.

Sample collection

At 21 d of age, one bird from each replicate was selected for slaughter, and blood samples were collected in a non-anticoagulant sterile blood vessel from the jugular vein. After centrifugation at 4,000 × g for 15 min at 4 °C, the top serum in the tube was collected and stored at −80 °C for analysis. After blood sampling, the birds were euthanized by cervical dislocation immediately. The liver tissues were immediately removed, thoroughly washed with phosphate-buffered saline (PBS), stored in liquid nitrogen, and then preserved at −80 °C for further analysis.

Analysis of serum aminotransferase activities

The serum was sampled to measure aspartate transaminase (AST, #C010-1-1) and alanine transaminase (ALT, #C010-2-2) activities. The kits were purchased from Nanjing Jiancheng Institute of Bioengineering (Nanjing, Jiangsu, China), and all experimental procedures were performed according to the manufacturer’s instructions.

Assay of antioxidant enzymes

One gram of liver tissue preserved at −80 °C was homogenized by Ultra-Turrax homogenizer (Tekmar Co, Cincinnati, OH, USA) with 9 mL of 0.9% ice-cold sodium chloride buffer and then centrifuged at 4,000 × g for 10 min at 4 °C, and the supernatant was collected and analyzed quickly (Ge et al., 2019). The total antioxidant capacity (T-AOC, #A015-2–3), superoxide dismutase (SOD, #A003-2–4), glutathione peroxidase (GSH-Px, #A002-1–2), and catalase (CAT, #A007-1–3) activities, as well as glutathione (GSH, #A001-2-2) and MDA (#A007-3-2) contents, were all measured using commercial assay kits (Nanjing Jiancheng Institute of Bioengineering) according to the manufacturer’s instructions.

Determination of inflammatory cytokines

Approximately, 0.5 g of liver tissue was homogenized with PBS (PH 7.4) for 30 s, using Ultra-Turrax homogenizer. After that, the homogenization was centrifuged at 3,000 × g for 20 min at 4 °C, and the supernatant was collected in tubes, which were immediately stored at −20 °C for the subsequent analysis. The concentrations of interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-10 (IL-10) in the liver samples were measured by ELISA using chicken-specific quantification kits purchased from Shanghai Yili Biological Technology Co, Ltd (Shanghai, China).

Quantification of messenger ribonucleic acid by real-time PCR

Total RNA from the liver sample (about 50 to 100 mg) was extracted by the addition of 1 mL of TRIzol-reagent (#R601-03; TaKaRa Biotechnology, Dalian, Liaoning, China) according to the manufacturer’s instructions. The concentration and purity of the total RNA were assessed using a spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Subsequently, the RNA was reverse transcribed to cDNA using the PrimeScripte RT reagent Kit (Perfect Real Time, SYBR PrimeScriP TaKaRa, China, #3894A) according to the manufacturer’s instructions. The cDNA samples were amplified by real-time quantitative polymerase chain reaction with SYBR Premix Ex Taq reagents (Takara Biotechnology). The real-time PCR cycling conditions were as follows: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 30 s (Lu et al., 2019a). The messenger ribonucleic acid (mRNA) expression of target genes relative to beta-actin (β-actin) was calculated using 2−ΔΔCT method (Livak and Schmittgen, 2001). All of the primer sequences are listed in Table 2 and synthesized by Sangon Biotech Co. Ltd. (Shanghai, China).

Table 2.

Primer sequences used for quantitative real-time PCR

Gene name Primers sequence (5′-3′) Accession number
Nrf2 Forward GAGCCCATGGCCTTTCCTAT NM_001007858.1
Reverse CACAGAGGCCCTGACTCAAA
HO-1 Forward AAACTTCGCAGCCACACAAC NM_205344.1
Reverse GACCAGCTTGAACTCGTGGA
GSH-Px Forward GACCAACCCGCAGTACATCA NM_001277853.1
Reverse GAGGTGCGGGCTTTCCTTTA
SOD1 Forward CCGGCTTGTCTGATGGAGAT NM_205064.1
Reverse TGCATCTTTTGGTCCACCGT
GCLC Forward TGCGGTTCTGCACAAAATGG XM_419910.3
Reverse TGCTGTGCGATGAATTCCCT
GCLM Forward CCAGAACGTCAAAGCACACG NM_001007953.1
Reverse TCCTCCCATCCCCCAGAAAT
IL-1β Forward GTACCGAGTACAACCCCTGC NM_204524.1
Reverse AGCAACGGGACGGTAATGAA
TNF-α Forward CCCCTACCCTGTCCCACAA NM204267
Reverse TGAGTACTGCGGAGGGTTCAT
IL-6 Forward CAGCTGCAGGACGAGATGTGCAA AJ309540
Reverse GCACAGGACTCGACGTTCTGCT
IL-10 Forward GGAGCTGAGGGTGAAGTTTGA NM_001004414.2
Reverse GACACAGACTGGCAGCCAAA
TLR4 Forward TTCAGAACGGACTCTTGAGTGG AY064697
Reverse CAACCGAATAGTGGTGACGTTG
COX-2 Forward TGTCCTTTCACTGCTTTCCAT NM_001167718.1
Reverse TTCCATTGCTGTGTTTGAGGT
iNOS Forward CTCAATGGTCAAGAAGAAGCCT U46504
Reverse CTTGTCCATCTCTTGTCCTGTA
β-Actin Forward TGCTGTGTTCCCATCTATCG NM_205518.1
Reverse TTGGTGACAATACCGTGTTCA
Open in a new tab

Statistical analysis

All data were preliminarily processed using Excel 2010. The statistical analyses were performed using statistical software SPSS 22.0 (SPSS Inc, Chicago, IL, USA) with replicates (n = 8) as an experimental unit, and the results were presented as means  ±  SEM. Data were normally distributed (Shapiro–Wilk test) and tested for homogeneity of variance (Levene’s test). Statistical analyses were carried out using one-way analysis of variance followed by the Duncan’s multiple test. Differences were regarded as significant at P < 0.05.

Results

Growth performance

Before the LPS challenge (1 to 15 d of age), there were no dietary effects on bird growth performance (P  >  0.05; Table 3). Compared with the CON group, during the LPS challenge (16 to 21 d of age) significantly decreased the ADG (P < 0.001) of broilers (Table 3), while the ADG of LPS-challenged broilers was increased (P < 0.001) by taurine administration.

Table 3.

Effects of taurine supplementation on the growth performance of LPS-challenged broilers1

Treatment2
Item CON LPS LPS + T1 LPS + T2 P-value
1 to 15 d (before the LPS challenge)
1 d BW, g 43.61 ± 0.11 43.73 ± 0.10 43.66 ± 0.07 43.81 ± 0.07 0.415
15 d BW, g 524.08 ± 2.99 523.66 ± 7.97 564.64 ± 20.84 541.33 ± 15.30 0.135
ADG, g/d 30.03 ± 0.19 30.00 ± 0.50 32.56 ± 1.30 31.10 ± 0.96 0.136
ADFI, g/d 47.51 ± 0.61 47.23 ± 0.39 48.95 ± 2.16 47.49 ± 0.44 0.717
G:F, g/g 0.63 ± 0.01 0.64 ± 0.01 0.67 ± 0.02 0.65 ± 0.01 0.283
16 to 21 d (during the LPS challenge)
21 d BW, g 743.58 ± 11.93ab 720.16 ± 9.35a 782.64 ± 21.09b 763.08 ± 14.65ab 0.038
ADG, g/d 43.90 ± 1.01a 39.30 ± 0.38b 43.60 ± 0.99a 44.35 ± 0.52a <0.001
ADFI, g/d 69.15 ± 1.52 65.48 ± 0.80 68.95 ± 1.37 68.61 ± 0.97 0.127
G:F, g/g 0.64 ± 0.01ab 0.60 ± 0.01b 0.63 ± 0.02ab 0.65 ± 0.01a 0.055
Open in a new tab

1Data are means ± SEM, n = 8.

2CON, control basal diet; LPS, LPS challenged broilers fed CON; LPS+T1, LPS challenged broilers fed CON supplemented with 5 g/kg taurine; LPS+T2, LPS challenged broilers fed CON supplemented with 7.5 g/lg taurine.

a,bMeans within the same row with no common superscript differ significantly (P < 0.05).

Activities of serum AST and ALT

The serum activities of AST and ALT are shown in Figure 1. Compared with the CON group, the serum activities of ALT and AST were significantly increased (P < 0.05) in the LPS group, whereas dietary inclusion with taurine decreased the serum activities of ALT and AST (P < 0.05).

Figure. 1.

Figure. 1.

Open in a new tab

Effects of taurine supplementation on the activities of AST(a) and ALT(b) in the serum of LPS-challenged broilers. The results are expressed as the mean ± SEM, n = 8. Histograms labeled with different superscript letters are significantly different (P < 0.05).

Hepatic redox status

As shown in Table 4, compared with the non-challenged broilers, LPS injection decreased the activities of GSH-Px, SOD, and the content of GSH, but increased the content of MDA. Dietary taurine supplementation significantly increased (P < 0.05) the GSH-Px activity and decreased (P < 0.05) the concentration of MDA concentration in the liver of broilers in comparison with the LPS-induced group (P < 0.05). Also, broilers in the LPS + T1 group had a higher (P < 0.05) content of GSH than the LPS-induced group. In addition, there were no changes in the level of T-AOC and the activity of CAT among all the groups (P > 0.05).

Table 4.

Effects of taurine supplementation on liver oxidative status of LPS-challenged broilers1

Treatment2
Item CON LPS LPS + T1 LPS + T2 P-value
T-AOC, units/mg protein 0.90 ± 0.02 0.81 ± 0.03 0.90 ± 0.05 0.82 ± 0.05 0.197
SOD, units/mg protein 372.87 ± 9.73a 339.68 ± 9.11b 350.01 ± 8.62ab 366.23 ± 12.18ab 0.101
GSH-Px, units/mg protein 58.25 ± 1.82a 51.30 ± 1.46b 56.15 ± 1.21a 57.82 ± 1.92a 0.021
GSH, nmol/mg protein 2.86 ± 0.12a 2.11 ± 0.24b 2.67 ± 0.10a 2.40 ± 0.12ab 0.03
CAT, units/mg protein 8.07 ± 0.17 7.54 ± 0.17 7.90 ± 0.11 7.85 ± 0.38 0.441
MDA, nmol/mg protein 1.02 ± 0.07b 1.33 ± 0.07a 1.02 ± 0.06b 1.08 ± 0.09b 0.021
Open in a new tab

1Data are means ± SEM, n = 8.

2CON, control basal diet; LPS, LPS challenged broilers fed CON; LPS+T1, LPS challenged broilers fed CON supplemented with 5 g/kg taurine; LPS+T2, LPS challenged broilers fed CON supplemented with 7.5 g/lg taurine.

a,bMeans within the same row with no common superscript differ significantly (P < 0.05).

Hepatic inflammatory cytokine concentrations

As indicated in Table 5, after injected with LPS, the hepatic concentrations of IL-1β, IL-6, and TNF-α were significantly increased (P < 0.05) in the LPS group compared with the CON group. In contrast, taurine supplementation alleviated the inflammatory responses in LPS-challenged broilers, as evidenced by the decreases in IL-1β, IL-6, and TNF-α concentrations in the liver of LPS-challenged broilers after receiving taurine (P < 0.05).

Table 5.

Effects of taurine supplementation on liver cytokines concentrations of LPS-challenged broilers1

Treatment2
Item CON LPS LPS + T1 LPS + T2 P-value
IL-1β, ng/g protein 148.79 ± 10.04d 317.68 ± 22.13a 260.07 ± 19.96b 175.77 ± 15.36c <0.01
IL-6, ng/g protein 12.15 ± 1.27c 26.48 ± 1.06a 19.21 ± 1.09b 14.91 ± 1.37c <0.01
TNF-α, ng/g protein 75.18 ± 3.59c 132.32 ± 7.33a 100.19 ± 5.33b 102.64 ± 3.71b <0.01
IL-10, ng/g protein 39.48 ± 3.37 40.00 ± 2.73 39.19 ± 2.57 42.51 ± 2.81 0.842
Open in a new tab

1Data are means ± SEM, n = 8.

2CON, control basal diet; LPS, LPS challenged broilers fed CON; LPS+T1, LPS challenged broilers fed CON supplemented with 5 g/kg taurine; LPS+T2, LPS challenged broilers fed CON supplemented with 7.5 g/lg taurine.

a–dMeans within the same row with no common superscript differ significantly (P < 0.05).

Hepatic antioxidant gene expression

The mRNA expression of antioxidant genes in the liver of broilers are shown in Table 6. Compared with the CON birds, the LPS injection declined (P < 0.05) the mRNA expression levels of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), SOD1, GSH-Px, and glutamate-cysteine ligase catalytic subunit (GCLC) in the liver of broilers. However, except for SOD1, taurine supplementation reversed these genes expression (P < 0.05). No changes were observed in glutamate-cysteine ligase modifier subunit (GCLM) mRNA among the four groups (P > 0.05).

Table 6.

Effects of taurine supplementation on antioxidant gene expression in the liver of LPS-challenged broilers1

Treatment2
Item3 CON LPS LPS + T1 LPS + T2 P-value
Nrf2 1.00 ± 0.06a 0.70 ± 0.04b 0.93 ± 0.06a 0.90 ± 0.05a 0.003
HO-1 1.00 ± 0.10a 0.71 ± 0.07b 0.99 ± 0.09a 1.03 ± 0.09a 0.060
SOD1 1.00 ± 0.04a 0.71 ± 0.04b 0.92 ± 0.11ab 0.83 ± 0.08ab 0.061
GSH-Px 1.00 ± 0.06a 0.74 ± 0.05b 0.91 ± 0.03a 0.93 ± 0.05a 0.004
GCLC 1.00 ± 0.13a 0.63 ± 0.04b 1.22 ± 0.15a 1.23 ± 0.08a 0.001
GCLM 1.00 ± 0.14 1.02 ± 0.10 1.12 ± 0.06 1.08 ± 0.12 0.869
Open in a new tab

1Data are means ± SEM, n = 8.

2CON, control basal diet; LPS, LPS challenged broilers fed CON; LPS+T1, LPS challenged broilers fed CON supplemented with 5 g/kg taurine; LPS+T2, LPS challenged broilers fed CON supplemented with 7.5 g/lg taurine.

3Expressed in arbitrary units. The expression of each target gene for the CON group was assigned a value of 1 and normalized against beta-actin.

a,bMeans within the same row with no common superscript differ significantly (P < 0.05).

Hepatic inflammatory gene expression

The data of mRNA expression of inflammatory genes in the liver of broilers are shown in Table 7. Compared with CON broilers, LPS injection increased the mRNA expression levels of TLR4, IL-1β, TNF-α, cyclooxygenase-2 (COX-2), and inducible nitric oxide synthase (iNOS) in the liver of broilers (P < 0.05). In contrast, taurine treatment decreased these genes expression (P < 0.05).

Table 7.

Effects of taurine supplementation on inflammatory gene expression in the liver of LPS-challenged broilers1

Treatment2
Item3 CON LPS LPS + T1 LPS + T2 P-value
TLR4 1.00 ± 0.15b 1.40 ± 0.10a 0.90 ± 0.07b 1.05 ± 0.11b 0.021
IL-1β 1.00 ± 0.13b 2.09 ± 0.24a 1.31 ± 0.12b 1.48 ± 0.17b 0.001
TNF-α 1.00 ± 0.16b 1.56 ± 0.10a 1.01 ± 0.17b 1.13 ± 0.12b 0.030
IL-6 1.00 ± 0.15b 1.99 ± 0.42a 1.16 ± 0.20b 1.31 ± 0.19ab 0.062
COX-2 1.00 ± 0.25b 1.74 ± 0.12a 1.12 ± 0.07b 1.20 ± 0.11b 0.010
iNOS 1.00 ± 0.17b 1.57 ± 0.23a 0.99 ± 0.11b 1.02 ± 0.06b 0.033
IL-10 1.00 ± 0.20 0.84 ± 0.06 0.92 ± 0.12 0.96 ± 0.23 0.923
Open in a new tab

1Data are means ± SEM, n = 8.

2CON, control basal diet; LPS, LPS challenged broilers fed CON; LPS+T1, LPS challenged broilers fed CON supplemented with 5 g/kg taurine; LPS+T2, LPS challenged broilers fed CON supplemented with 7.5 g/lg taurine.

3Expressed in arbitrary units. The expression of each target gene for the CON group was assigned a value of 1 and normalized against beta-actin.

a,bMeans within the same row with no common superscript differ significantly (P < 0.05).

Discussion

Broilers under an immunosuppressive status exhibit reduced feed intake, weight gain, and feed conversion ratio (He et al., 2007), which causes a loss to poultry production. Accumulating evidence have demonstrated that dietary taurine supplementation could improve the growth performance of broiler chickens (Tufft and Jensen, 1992; Lee et al., 2004; Lv et al., 2017; Faraji et al., 2019), but little is known about the effect of taurine on broilers growth performance under immune stress. In this study, we found that an LPS challenge induced growth retardation of broilers, as evidenced by reduced ADG. Similarly, numerous previous studies have also shown that LPS injection damages compromised growth performance of broilers (Li et al., 2015; Wang et al., 2015; Zheng et al., 2016). The reason is mainly due to the LPS injection increased the synthesis of various inflammatory cytokines, which leads to the diversion of available nutrients show a tendency to support immune-related processes instead of growth and development (Yang et al., 2011; Tan et al., 2014). Also, this study found that supplementation with taurine could alleviate the inhibition of the ADG of the LPS-challenged broilers, indicating that taurine may exert a protective effect on the growth as evidenced by an increase in ADG of broilers under immunological stress.

Moreover, many studies have shown that LPS administration causes liver injury and dysfunction in broilers (Morris et al., 2014; Qu et al., 2019; Jangra et al., 2020; Mei et al., 2020). The activities of AST and ALT in the serum are usually used clinically as specific indicators reflecting the liver injury (Senior, 2012). Our results showed that the serum activities of ALT and AST in the CON broilers were similar to the taurine groups but higher in the LPS group. Consistent with our results, Zhang et al. (2020) reported that LPS caused significant increases in the activities of AST and ALT. Reduced AST and ALT activities in serum suggested that LPS-induced hepatic injury was ameliorated by taurine administration. These findings together indicate that taurine could protect the hepatic integrity of broilers. This protective effect may be attributed to its ability to stabilize biomembranes (You and Chang, 1998; Adedara et al., 2017) and scavenge reactive oxygen derivatives (Marcinkiewicz et al., 2000).

Antioxidants in birds play an important role in controlling the negative effects of oxidative stress and further prevent immunopathological damage to host tissues (Costantini and Møller, 2009). The GSH is the main endogenous nonenzymatic antioxidant and helps to prevent lipid peroxidation through a reaction catalyzed by GSH-Px (Fang et al., 2002). When the activity of GSH-Px was attenuated, excessive free radicals produced in the organism attack polyunsaturated fatty acids and cause lipid peroxidation to form lipid peroxide, such as MDA. In the present study, the administration of LPS resulted in reduced GSH, GSH-Px, and SOD activities, but increased MDA level, indicating that an oxidative stress is present in the liver of LPS-injected broilers. In contrast, we noted that dietary taurine supplementation alleviated the oxidative stress in LPS-challenged broilers, as evidenced by reduced MDA content, increased activity of GSH-Px, and increased content of GSH in the liver of LPS-challenged broilers after receiving taurine. Numerous studies have confirmed that taurine supplementation significantly improved GSH-Px activity, decreased MDA content, and then inhibited lipid peroxidation (Winiarska et al., 2009; Yang et al., 2010). Similarly, Xiao et al. (2018) showed that taurine reversed LPS-induced oxidative damage. These findings indicate that taurine improving hepatic antioxidant function may be due to the enhanced level of GSH and the increased activity of GSH-Px (Tabassum et al., 2006). We examined the expression levels of genes associated with hepatic redox status. The Nrf2 is a key regulator of cellular defenses against oxidative stress. In response to stress, Nrf2 is activated and translocates to the nucleus (Ma, 2013), resulting in the induction of many antioxidant genes including HO-1 (Hou et al., 2020). In our study, broilers injected with LPS leads to a sharp decline in the expression of genes, including Nrf2, HO-1, SOD1, GSH-Px, and GCLC, while taurine administration protects against LPS-induced liver injury by upregulating the mRNA levels of Nrf2 and its downstream HO-1, GCLC, and GSH-Px. Alterations of GCLC gene expression in the liver of broilers, which partly, verify the capacity of taurine to enhance the synthesis of GSH and to replenish GSH supplies after LPS-induced depletion. Similarly, it has been reported that taurine could alleviate oxidative impairment caused by hydrogen peroxide via activating the Nrf2 pathway (Jang et al., 2009). Sun et al. (2018) observed that in human neuroblastoma cells, taurine also activated Nrf2 to protect against corticosterone-induced cell death. Therefore, we inferred that taurine improved the antioxidant properties of broilers by regulating the Nrf2 signaling pathway, increasing the activity of GSH-Px, enhancing the synthesis of GSH, and preventing lipid peroxidation.

Besides oxidative stress, substantial evidence have reported that the LPS stimulation could induce classical microglial activation through the activation of neutrophils and macrophages to produce a large number of proinflammatory cytokines that include TNF-α, IL-1β, and IFN-γ, which, in turn, releases free radicals and causes cell and tissue damage (Kobayashi et al., 2013; Zheng et al., 2016). TLR4 serves as a signaling receptor for LPS and is a transmembrane signal transporter that activates intracellular NF-κB (Lu et al., 2008). The NF-κB signaling pathway plays a crucial role in regulating inflammation and cell death (Sun et al., 2015). This molecule played a pivotal role in the development of inflammation by synthesizing and releasing proinflammatory cytokines (TNF-α, IL-1β, and IL-6) and inducible proinflammatory enzymes (COX-2 and iNOS; Okorji et al., 2016), which, in turn, releases free radicals and causes cell and tissue damage.

Proinflammatory cytokines have crucial influences on systemic immune and inflammatory responses. Production of these proinflammatory cytokines results in a wide range of diseases, such as dyslipidemia (Chen et al., 2019), febrile (Liu et al., 2019), diarrhea (Wang et al., 2014), infection (Withanage et al., 2005), inflammation and oxidation (Li et al., 2014), enteric diseases (Swaggerty et al., 2016), immune dysfunction, further tissue damage, or even death (Barton, 2008). The result showed that LPS injection increased the concentrations of IL-1β, IL-6, and TNF-α, and these increases were inhibited by taurine supplementation. From the molecular point of view, the mRNA expression of IL-1β, IL-6, TNF-α, COX-2, and iNOS was significantly increased in the liver of LPS-challenged broilers, which was consistent with enhanced mRNA expression of TLR4. Our results were in accordance with the report of Mei et al. (2020) in which LPS increased the mRNA expression of NF-κB, IL-1β, IL-6, IFN-γ, and iNOS in the liver of broilers. Similar results were observed by Li et al. (2015) and Liu et al. (2015). Ali et al. (2020) reported that LPS treatment significantly increased the levels of cytokines (TNF-α, IL-1β, and IL-6) and enhanced NF-κB phosphorylation in mice. These results suggest that LPS induced change in cytokine patterns possibly by the activation of TLR4 and the regulation of NF-κB (Liu et al., 2015). Notably, in this study, we observed that taurine treatment decreased the mRNA expression of TLR4 in the liver of LPS-treated broilers along with an accompanying decrease in the production of IL-1β, IL-6, TNF-α, COX-2, and iNOS. In agreement with our findings, Lin et al. (2015) showed that taurine attenuates hepatic inflammation in chronic alcohol-fed rats through the inhibition of TLR4 signaling to reduce the mRNA expression of iNOS,  TNF-α, IL-6, and IL-1β. Marcinkiewicz and Kontny (2014) found that taurine inhibited the production of proinflammatory cytokines to provide anti-inflammatory effects and protected cells from the cytotoxic effects of inflammation. These results suggest that a possible mechanism by which taurine mitigates hepatic inflammation is associated with the regulation of the TLR4 and NF-κB pathway. The HO-1 plays an important role in oxidative stress and inflammation (Wagener et al., 2003), which can reduce the synthesis of proinflammatory heme proteins such as COX-2 and iNOS (Ryter et al., 2002). Furthermore, Lee et al. (2008) demonstrated that the production of proinflammatory cytokines was associated with HO-1 deficiency in the HO-1 knockout mice model. Taken together, both our findings and aforementioned investigations show that taurine alleviates the anti-inflammatory process through the regulation of the TLR-4/NF-κB pathway and promotes the mRNA expression of HO-1 to reduce the large-scale production of proinflammatory cytokines after the LPS challenge.

In conclusion, the present study demonstrates that dietary taurine supplementation improves ADG, enhances hepatic antioxidant status, and ameliorates inflammation in the liver of broiler chickens under immunological stress.

Acknowledgment

This research was financially supported by the National Experimental Teaching Demonstration Center of Animal Science.

Glossary

Abbreviations

ADFI

average daily feed intake

ADG

average daily gain

ALT

alanine transaminase

AST

aspartate transaminase

BW

body weight

CAT

catalase

COX-2

cyclooxygenase-2

G:F

gain:feed

GCLC

glutamate-cysteine ligase catalytic subunit

GCLM

glutamate-cysteine ligase modifier subunit

GSH

glutathione

GSH-Px

glutathione peroxidase

HO-1

heme oxygenase-1

IL-10

interleukin-10

IL-1β

interleukin-1β

IL-6

interleukin-6

iNOS

inducible nitric oxide synthase

LPS

lipopolysaccharide

MDA

malondialdehyde

mRNA

messenger ribonucleic acid

MyD88

myeloid differentiation factor 88

NF-κB

nuclear factor-kappa B

Nrf2

nuclear factor erythroid 2-related factor 2

PBS

phosphate-buffered saline

ROS

reactive oxygen species

SOD

superoxide dismutase

T-AOC

total antioxidant capacity

TLR4

toll-like receptor 4

TNF-α

tumor necrosis factor-α

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships and that there was no conflict of interest.

Literature Cited

  1. Abd-Elhakim Y M, Ghoneim M H, Ebraheim L L M, and Imam T S. . 2020. Taurine and hesperidin rescues carbon tetrachloride-triggered testicular and kidney damage in rats via modulating oxidative stress and inflammation. Life Sci. 254:117782. doi: 10.1016/j.lfs.2020.117782 [DOI] [PubMed] [Google Scholar]
  2. Adedara I A, Olabiyi B F, Ojuade T D, Idris U F, Onibiyo E M, and Farombi E O. . 2017. Taurine reverses sodium fluoride-mediated increase in inflammation, caspase-3 activity, and oxidative damage along the brain-pituitary-gonadal axis in male rats. Can. J. Physiol. Pharmacol. 95:1019–1029. doi: 10.1139/cjpp-2016-0641 [DOI] [PubMed] [Google Scholar]
  3. Ali T, Rahman S U, Hao Q, Li W, Liu Z, Ali Shah F, Murtaza I, Zhang Z, Yang X, Liu G, . et al.  2020. Melatonin prevents neuroinflammation and relieves depression by attenuating autophagy impairment through FOXO3a regulation. J. Pineal Res. 69:e12667. doi: 10.1111/jpi.12667 [DOI] [PubMed] [Google Scholar]
  4. Barton G M. 2008. A calculated response: control of inflammation by the innate immune system. J. Clin. Invest. 118(2):413–420. doi: 10.1172/JCI34431 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cassol O J, Rezin G T, Petronilho F C, Scaini G, Gonçalves C L, Ferreira G K, Roesler R, Schwartsmann G, Dal-Pizzol F, and Streck E L. . 2010. Effects of N-acetylcysteine/deferoxamine, taurine and RC-3095 on respiratory chain complexes and creatine kinase activities in rat brain after sepsis. Neurochem. Res. 35(4):515–521. doi: 10.1007/s11064-009-0089-3 [DOI] [PubMed] [Google Scholar]
  6. Chen Y, Yu C Y, and Deng W M. . 2019. The role of pro-inflammatory cytokines in lipid metabolism of metabolic diseases. Int. Rev. Immunol. 38:249–266. doi: 10.1080/08830185.2019.1645138 [DOI] [PubMed] [Google Scholar]
  7. Chen Y P, Zhang H, Cheng Y F, Li Y, Wen C, and Zhou Y M. . 2018. Dietary  l-threonine supplementation attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage of broiler chickens at an early age. Br. J. Nutr. 119(11):1254–1262. doi: 10.1017/s0007114518000740 [DOI] [PubMed] [Google Scholar]
  8. Costantini D, and Møller A P. . 2009. Does immune response cause oxidative stress in birds? A meta-analysis. Comp. Biochem. Physiol. A. Mol. Integr. Physiol. 153:339–344. doi: 10.1016/j.cbpa.2009.03.010 [DOI] [PubMed] [Google Scholar]
  9. Coutinho F, Simoes R, Monge-Ortiz R, Furuya W M, Pousao-Ferreira P, Kaushik S, Oliva-Teles A, and Peres H. . 2017. Effects of dietary methionine and taurine supplementation to low-fish meal diets on growth performance and oxidative status of European sea bass (Dicentrarchus labrax) juveniles. Aquaculture  479:447–454. doi: 10.1016/j.aquaculture.2017.06.017 [DOI] [Google Scholar]
  10. Das J, Vasan V, and Sil P C. . 2012. Taurine exerts hypoglycemic effect in alloxan-induced diabetic rats, improves insulin-mediated glucose transport signaling pathway in heart and ameliorates cardiac oxidative stress and apoptosis. Toxicol. Appl. Pharmacol. 258:296–308. doi: 10.1016/j.taap.2011.11.009 [DOI] [PubMed] [Google Scholar]
  11. De Carvalho F G, Barbieri R A, Carvalho M B, Dato C C, Campos E Z, Gobbi R B, Papoti M, Silva A S R, and de Freitas E C. . 2018. Taurine supplementation can increase lipolysis and affect the contribution of energy systems during front crawl maximal effort. Amino Acids  50:189–198. doi: 10.1007/s00726-017-2505-3 [DOI] [PubMed] [Google Scholar]
  12. De Luca A, Pierno S, and Camerino D C. . 2015. Taurine: the appeal of a safe amino acid for skeletal muscle disorders. J. Transl. Med. 13:243. doi: 10.1186/s12967-015-0610-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Eugeni R, Josep H, and Klasing K C. . 1992. Prevention of immunologic stress contributes to the growth-permitting ability of dietary antibiotics in chicks. J. Nutr. 122(12):2383–2390. doi: 10.1093/jn/122.12.2383 [DOI] [PubMed] [Google Scholar]
  14. Faheem U, Tahir A, Najeeb U, and Myeong O K. . 2015. Caffeine prevents  d-galactose-induced cognitive deficits, oxidative stress, neuroinflammation and neurodegeneration in the adult rat brain. Neurochem. Int. 90:114–124. doi: 10.1016/j.neuint.2015.07.001 [DOI] [PubMed] [Google Scholar]
  15. Fang Y Z, Yang S, and Wu G. . 2002. Free radicals, antioxidants, and nutrition. Nutrition  18:872–879. doi: 10.1016/s0899-9007(02)00916-4 [DOI] [PubMed] [Google Scholar]
  16. Faraji M, Dehkordi S K, Moghadam A K Z, Ahmadipour B, and Khajali F. . 2019. Combined effects of guanidinoacetic acid, coenzyme Q and taurine on growth performance, gene expression and ascites mortality in broiler chickens. J. Anim. Physiol. Anim. Nutr. (Berl). 103(1):162–169. doi: 10.1111/jpn.13020 [DOI] [PubMed] [Google Scholar]
  17. Gadde U D, Oh S, Lee Y, Davis E, Zimmerman N, Rehberger T, and Lillehoj H S. . 2017. Dietary Bacillus subtilis-based direct-fed microbials alleviate LPS-induced intestinal immunological stress and improve intestinal barrier gene expression in commercial broiler chickens. Res. Vet. Sci. 114:236–243. doi: 10.1016/j.rvsc.2017.05.004 [DOI] [PubMed] [Google Scholar]
  18. Ge X K, Wang A A, Ying Z X, Zhang L G, Su W P, Cheng K, Feng C C, Zhou Y M, Zhang L L, and Wang T. . 2019. Effects of diets with different energy and bile acids levels on growth performance and lipid metabolism in broilers. Poult. Sci. 98:887–895. doi: 10.3382/ps/pey434 [DOI] [PubMed] [Google Scholar]
  19. Godbout J P, Chen J, Abraham J, Richwine A F, Berg B M, Kelley K W, and Johnson R W. . 2005. Exaggerated neuroinflammation and sickness behavior in aged mice following activation of the peripheral innate immune system. FASEB J. 19:1329–1331. doi: 10.1096/fj.05-3776fje [DOI] [PubMed] [Google Scholar]
  20. He X, Yang X J, and Guo Y M. . 2007. Effects of different dietary oil sources on immune function in cyclophosphamide immunosuppressed chickens. Anim. Feed Sci. Tech. 139(3–4):186–200. doi: 10.1016/j.anifeedsci.2007.01.009 [DOI] [Google Scholar]
  21. Hou Y, Wang L, Yi D, Ding B, Yang Z, Li J, Chen X, Qiu Y, and Wu G. . 2013. N-acetylcysteine reduces inflammation in the small intestine by regulating redox, EGF and TLR4 signaling. Amino Acids  45:513–522. doi: 10.1007/s00726-012-1295-x [DOI] [PubMed] [Google Scholar]
  22. Hou W, Wang Y, Zheng P, and Cui R. . 2020. Effects of ginseng on neurological disorders. Front. Cell. Neurosci. 14:55. doi: 10.3389/fncel.2020.00055 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jang J S, Piao S Y, Cha Y N, and Kim C Y. . 2009. Taurine chloramine activates Nrf2, increases HO-1 expression and protects cells from death caused by hydrogen peroxide. J. Clin. Biochem. Nutr. 45(1):37–43. doi: 10.3164/jcbn.08-262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Jangra A, Rajput P, Dwivedi D K, and Lahkar M. . 2020. Amelioration of repeated restraint stress-induced behavioral deficits and hippocampal anomalies with taurine treatment in mice. Neurochem. Res. 45:731–740. doi: 10.1007/s11064-019-02945-8 [DOI] [PubMed] [Google Scholar]
  25. Janusz M, and Ewa K. . 2014. Taurine and inflammatory diseases. Amino Acids. 46(1):7–20. doi: 10.1007/s00726-012-1361-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Jiang J L, Qi L N, Lv Z P, Song J, Wei X H, and Shi F X. . 2019. Dietary stevioside supplementation alleviates lipopolysaccharide-induced intestinal mucosal damage through anti-inflammatory and antioxidant effects in broiler chickens. Antioxidants (Basel). 8(12):575. doi: 10.3390/antiox8120575 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Joydeep D, Jyotirmoy G, Prasenjit M, and Sil P C. . 2011. Taurine suppresses doxorubicin-triggered oxidative stress and cardiac apoptosis in rat via up-regulation of PI3-K/Akt and inhibition of p53, p38-JNK. Biochem. Pharmacol. 81(7):891–909. doi: 10.1016/j.bcp.2011.01.008 [DOI] [PubMed] [Google Scholar]
  28. Kobayashi K, Imagama S, Ohgomori T, Hirano K, Uchimura K, Sakamoto K, Hirakawa A, Takeuchi H, Suzumura A, Ishiguro N, . et al.  2013. Minocycline selectively inhibits M1 polarization of microglia. Cell Death Dis. 4:e525. doi: 10.1038/cddis.2013.54 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lee D N, Cheng Y H, Chuang Y S, Shive J L, Lian Y M, Wei H W, and Weng C F. . 2004. Effects of dietary taurine supplementation on growth performance, serum constituents and antibody production of broilers. Asian-Australas. J. Anim. Sci. 17(1):109–115. doi: 10.5713/ajas.2004.109 [DOI] [Google Scholar]
  30. Lee J W, Lee Y K, Yuk D Y, Choi D Y, Ban S B, Oh K W, and Hong J T. . 2008. Neuro-inflammation induced by lipopolysaccharide causes cognitive impairment through enhancement of beta-amyloid generation. J. Neuroinflammation  5:37. doi: 10.1186/1742-2094-5-37 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Li Y, Ma Q G, Zhao L H, Wei H, Duan G X, Zhang J Y, and Ji C. . 2014. Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets. Int. J. Mol. Sci. 15:5649–5662. doi: 10.3390/ijms15045649 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li Y, Zhang H, Chen Y P, Yang M X, Zhang L L, Lu Z X, Zhou Y M, and Wang T. . 2015. Bacillus amyloliquefaciens supplementation alleviates immunological stress in lipopolysaccharide-challenged broilers at early age. Poult. Sci. 94(7):1504–1511. doi: 10.3382/ps/pev124 [DOI] [PubMed] [Google Scholar]
  33. Lin C J, Chiu C C, Chen Y C, Chen M L, Hsu T C, and Tzang B S. . 2015. Taurine attenuates hepatic inflammation in chronic alcohol-fed rats through inhibition of TLR4/MyD88 signaling. J. Med. Food  18:1291–1298. doi: 10.1089/jmf.2014.3408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Liu Y Y, Li F, Zhang L, Wu J F, Wang Y M, and Yu H. . 2017b. Taurine alleviates lipopolysaccharide-induced liver injury by anti-inflammation and antioxidants in rats. Mol. Med. Rep. 16(5):6512–6517. doi: 10.3892/mmr.2017.7414 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Liu L, Shen J, Zhao C, Wang X, Yao J, Gong Y, and Yang X. . 2015. Dietary Astragalus polysaccharide alleviated immunological stress in broilers exposed to lipopolysaccharide. Int. J. Biol. Macromol. 72:624–632. doi: 10.1016/j.ijbiomac.2014.08.057 [DOI] [PubMed] [Google Scholar]
  36. Liu S D, Song M H, Yun W, Lee J H, Kim H B, and Cho J H. . 2019. Effect of carvacrol essential oils on immune response and inflammation-related genes expression in broilers challenged by lipopolysaccharide. Poult. Sci. 98:2026–2033. doi: 10.3382/ps/pey575 [DOI] [PubMed] [Google Scholar]
  37. Liu T, Zhang L Y, Joo D, and Sun S C. . 2017a. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2:17023. doi: 10.1038/sigtrans.2017.23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Livak K J, and Schmittgen T D. . 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods  25:402–408. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  39. Lu Z, He X F, Ma B B, Zhang L, Li J L, Jiang Y, Zhou G H, and Gao F. . 2019a. Dietary taurine supplementation improves breast meat quality in chronic heat-stressed broilers via activating the Nrf2 pathway and protecting mitochondria from oxidative attack. J. Sci. Food Agric. 99(3):1066–1072. doi: 10.1002/jsfa.9273 [DOI] [PubMed] [Google Scholar]
  40. Lu Z, He X F, Ma B B, Zhang L, Li J L, Jiang Y, Zhou G H, and Gao F. . 2019b. Dietary taurine supplementation decreases fat synthesis by suppressing the liver X receptor alpha pathway and alleviates lipid accumulation in the liver of chronic heat-stressed broilers. J. Sci. Food Agric. 99(13):5631–5637. doi: 10.1002/jsfa.9817 [DOI] [PubMed] [Google Scholar]
  41. Lu Y C, Yeh W C, and Ohashi P S. . 2008. LPS/TLR4 signal transduction pathway. Cytokine  42:145–151. doi: 10.1016/j.cyto.2008.01.006 [DOI] [PubMed] [Google Scholar]
  42. Lv Q, Sun L, Cui Y, Yang J, Yang Q, Yu X, Liu M, Ning Z, and Hu J. . 2017. Effects of replacement of methionine in diets with taurine on growth performance and blood index in broilers. Adv. Exp. Med. Biol. 975 (Pt 2):989–1000. doi: 10.1007/978-94-024-1079-2_78 [DOI] [PubMed] [Google Scholar]
  43. Ma Q. 2013. Role of Nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 53:401–426. doi: 10.1146/annurev-pharmtox-011112-140320 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Marcinkiewicz J, Chain B, Nowak B, Grabowska A, Bryniarski K, and Baran J. . 2000. Antimicrobial and cytotoxic activity of hypochlorous acid: interactions with taurine and nitrite. Inflamm. Res. 49:280–289. doi: 10.1007/PL00000208 [DOI] [PubMed] [Google Scholar]
  45. Marcinkiewicz J, and Kontny E. . 2014. Taurine and inflammatory diseases. Amino Acids  46:7–20. doi: 10.1007/s00726-012-1361-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Mei W Q, Hao Y R, Xie H L, Ni Y D, and Zhao R Q. . 2020. Hepatic inflammatory response to exogenous LPS challenge is exacerbated in broilers with fatty liver disease. Animals  10(3):514. doi: 10.3390/ani10030514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Min Y N, Niu Z Y, Sun T T, Wang Z P, Jiao P X, Zi B B, Chen P P, Tian D L, and Liu F Z. . 2018. Vitamin E and vitamin C supplementation improves antioxidant status and immune function in oxidative-stressed breeder roosters by up-regulating expression of GSH-Px gene. Poult. Sci. 97(4):1238–1244. doi: 10.3382/ps/pex417 [DOI] [PubMed] [Google Scholar]
  48. Morris A, Shanmugasundaram R, Lilburn M S, and Selvaraj R K. . 2014. 25-Hydroxycholecalciferol supplementation improves growth performance and decreases inflammation during an experimental lipopolysaccharide injection. Poult. Sci. 93:1951–1956. doi: 10.3382/ps.2014-03939 [DOI] [PubMed] [Google Scholar]
  49. Munyaka P M, Tactacan G, Jing M, House K O J D, St Paul M, Sharif S, and Rodriguez-Lecompte J C. . 2013. Response of older laying hens to an Escherichia coli lipopolysaccharide challenge when fed diets with or without supplemental folic acid. Poult. Sci. 92:105–113. doi: 10.3382/ps.2012-02579 [DOI] [PubMed] [Google Scholar]
  50. Nakajima Y, Osuka K, Seki Y, Gupta R C, Hara M, Takayasu M, and Wakabayashi T. . 2010. Taurine reduces inflammatory responses after spinal cord injury. J. Neurotrauma  27:403–410. doi: 10.1089/neu.2009.1044 [DOI] [PubMed] [Google Scholar]
  51. NRC.  1994. Nutrient requirements of poultry. 9th rev. ed.  Washington (DC):  The National Academies Press. [Google Scholar]
  52. Okorji U P, Velagapudi R, El-Bakoush A, Fiebich B L, and Olajide O A. . 2016. Antimalarial drug artemether inhibits neuroinflammation in BV2 microglia through Nrf2-dependent mechanisms. Mol. Neurobiol. 53:6426–6443. doi: 10.1007/s12035-015-9543-1 [DOI] [PubMed] [Google Scholar]
  53. Panda A K, Rao S V R, Raju M, and Sunder G S. . 2009. Effect of butyric acid on performance, gastrointestinal tract health and carcass characteristics in broiler chickens. Asian-Australas. J. Anim. Sci. 22(7):1026–1031. doi: 10.5713/ajas.2009.80298 [DOI] [Google Scholar]
  54. Qu J R, Wang W, Zhang Q J, and Li S. . 2019. Inhibition of lipopolysaccharide-induced inflammation of chicken liver tissue by selenomethionine via TLR4-NF-kappaB-NLRP3 signaling pathway. Biol. Trace. Elem. Res. 195(1):205–214. doi: 10.1007/s12011-019-01841-0 [DOI] [PubMed] [Google Scholar]
  55. Remus A, Hauschild L, Andretta I, Kipper M, Lehnen C R, and Sakomura N K. . 2014. A meta-analysis of the feed intake and growth performance of broiler chickens challenged by bacteria. Poult. Sci. 93:1149–1158. doi: 10.3382/ps.2013-03540 [DOI] [PubMed] [Google Scholar]
  56. Ryter S W, Otterbein L E, Morse D, and Choi A M. . 2002. Heme oxygenase/carbon monoxide signaling pathways: regulation and functional significance. Mol. Cell. Biochem. 234-235:249–263. doi: 10.1023/a:1015957026924 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Salami S A, Majoka M A, Saha S, Garber A, and Gabarrou J F. . 2015. Efficacy of dietary antioxidants on broiler oxidative stress, performance and meat quality: science and market. Avian Biol. Res. 8(2):65–78. doi: 10.3184/175815515X14291701859483 [DOI] [Google Scholar]
  58. Schuller-Levis G B, and Park E. . 2003. Taurine: new implications for an old amino acid. FEMS Microbiol. Lett. 226:195–202. doi: 10.1016/S0378-1097(03)00611-6 [DOI] [PubMed] [Google Scholar]
  59. Schuller-Levis G B, and Park E. . 2004. Taurine and its chloramine: modulators of immunity. Neurochem. Res. 29:117–126. doi: 10.1023/b:nere.0000010440.37629.17 [DOI] [PubMed] [Google Scholar]
  60. Senior J R. 2012. Alanine aminotransferase: a clinical and regulatory tool for detecting liver injury-past, present, and future. Clin. Pharmacol. Ther. 92(3):332–339. doi: 10.1038/clpt.2012.108 [DOI] [PubMed] [Google Scholar]
  61. Sun Q, Jia N, Yang J, and Chen G. . 2018. Nrf2 Signaling pathway mediates the antioxidative effects of taurine against corticosterone-induced cell death in human SK-N-SH cells. Neurochem. Res. 43:276–286. doi: 10.1007/s11064-017-2419-1 [DOI] [PubMed] [Google Scholar]
  62. Sun X J, Li X Q, Wang X L, Tan W F, and Wang J K. . 2015. Sevoflurane inhibits nuclear factor-κB activation in lipopolysaccharide-induced acute inflammatory lung injury via toll-like receptor 4 signaling. PLoS One. 10:e0122752. doi: 10.1371/journal.pone.0122752 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Swaggerty C L, McReynolds J L, Byrd J A, Pevzner I Y, Duke S E, Genovese K J, He H, and Kogut M H. . 2016. Selection for pro-inflammatory mediators produces chickens more resistant to Clostridium perfringens-induced necrotic enteritis. Poult. Sci. 95:370–374. doi: 10.3382/ps/pev348 [DOI] [PubMed] [Google Scholar]
  64. Tabassum H, Rehman H, Banerjee B D, Raisuddin S, and Parvez S. . 2006. Attenuation of tamoxifen-induced hepatotoxicity by taurine in mice. Clin. Chim. Acta. 370:129–136. doi: 10.1016/j.cca.2006.02.006 [DOI] [PubMed] [Google Scholar]
  65. Takahashi K, Aoki A, Takimoto T, and Akiba Y. . 2008. Dietary supplementation of glycine modulates inflammatory response indicators in broiler chickens. Br. J. Nutr. 100:1019–1028. doi: 10.1017/S0007114508966125 [DOI] [PubMed] [Google Scholar]
  66. Tan J Z, Guo Y M, Applegate T J, Du E C, and Zhao X. . 2015. Dietary  l-arginine modulates immunosuppression in broilers inoculated with an intermediate strain of infectious bursa disease virus. J. Sci. Food Agric. 95:126–135. doi: 10.1002/jsfa.6692 [DOI] [PubMed] [Google Scholar]
  67. Tan J, Liu S, Guo Y, Applegate T J, and Eicher S D. . 2014. Dietary  l-arginine supplementation attenuates lipopolysaccharide-induced inflammatory response in broiler chickens. Br. J. Nutr. 111:1394–1404. doi: 10.1017/S0007114513003863 [DOI] [PubMed] [Google Scholar]
  68. Tufft L S, and Jensen L S. . 1992. Influence of dietary taurine on performance and fat retention in broilers and turkey poults fed varying levels of fat. Poult. Sci. 71:880–885. doi: 10.3382/ps.0710880 [DOI] [PubMed] [Google Scholar]
  69. Wagener F A, Volk H D, Willis D, Abraham N G, Soares M P, Adema G J, and Figdor C G. . 2003. Different faces of the heme-heme oxygenase system in inflammation. Pharmacol. Rev. 55:551–571. doi: 10.1124/pr.55.3.5 [DOI] [PubMed] [Google Scholar]
  70. Wang D, Gao Q, Zhao G, Kan Z, Wang X, Wang H, Huang J, Wang T, Qian F, Ho C T, . et al.  2018. Protective effect and mechanism of theanine on lipopolysaccharide-induced inflammation and acute liver injury in mice. J. Agric. Food Chem. 66:7674–7683. doi: 10.1021/acs.jafc.8b02293 [DOI] [PubMed] [Google Scholar]
  71. Wang X F, Li Y L, Shen J, Wang S Y, Yao J H, and Yang X J. . 2015. Effect of Astragalus polysaccharide and its sulfated derivative on growth performance and immune condition of lipopolysaccharide-treated broilers. Int. J. Biol. Macromol. 76:188–194. doi: 10.1016/j.ijbiomac.2015.02.040 [DOI] [PubMed] [Google Scholar]
  72. Wang X, Shen J, Li S, Zhi L, Yang X, and Yao J. . 2014. Sulfated Astragalus polysaccharide regulates the inflammatory reaction in LPS-infected broiler chicks. Int. J. Biol. Macromol. 69:146–150. doi: 10.1016/j.ijbiomac.2014.05.004 [DOI] [PubMed] [Google Scholar]
  73. Winiarska K, Szymanski K, Gorniak P, Dudziak M, and Bryla J. . 2009. Hypoglycaemic, antioxidative and nephroprotective effects of taurine in alloxan diabetic rabbits. Biochimie  91:261–270. doi: 10.1016/j.biochi.2008.09.006 [DOI] [PubMed] [Google Scholar]
  74. Withanage G S, Wigley P, Kaiser P, Mastroeni P, Brooks H, Powers C, Beal R, Barrow P, Maskell D, and McConnell I. . 2005. Cytokine and chemokine responses associated with clearance of a primary Salmonella enterica serovar Typhimurium infection in the chicken and in protective immunity to rechallenge. Infect. Immun. 73:5173–5182. doi: 10.1128/IAI.73.8.5173-5182.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Xia B, Meng Q, Feng X, Tang X, Jia A, Feng J, Zhang S, and Zhang H. . 2018. Probing the molecular regulation of lipopolysaccharide stress in piglet liver by comparative proteomics analysis. Electrophoresis  39:2321–2331. doi: 10.1002/elps.201700467 [DOI] [PubMed] [Google Scholar]
  76. Xiao M, Mi Y, Liu L, Lv C, Zeng W, Zhang C, and Li J. . 2018. Taurine regulates mucosal barrier function to alleviate lipopolysaccharide-induced duodenal inflammation in chicken. Amino Acids  50:1637–1646. doi: 10.1007/s00726-018-2631-6 [DOI] [PubMed] [Google Scholar]
  77. Xu S W, Lu Z, Ma B B, Xing T, Li J L, Zhang L, Jiang Y, and Gao F. . 2020. Dietary taurine supplementation enhances antioxidative capacity and improves breast meat quality of broiler chickens. Br. Poult. Sci. 61:140–145. doi: 10.1080/00071668.2019.1691147 [DOI] [PubMed] [Google Scholar]
  78. Yang X J, Li W L, Feng Y, and Yao J H. . 2011. Effects of immune stress on growth performance, immunity, and cecal microflora in chickens. Poult. Sci. 90:2740–2746. doi: 10.3382/ps.2011-01591 [DOI] [PubMed] [Google Scholar]
  79. Yang L, Liu G, Zhu X, Luo Y, Shang Y, and Gu X L. . 2019. The anti-inflammatory and antioxidant effects of leonurine hydrochloride after lipopolysaccharide challenge in broiler chicks. Poult. Sci. 98(4):1648–1657. doi: 10.3382/ps/pey532 [DOI] [PubMed] [Google Scholar]
  80. Yang S F, Tzang B S, Yang K T, Hsiao Y C, Chang Y Y, Chan C H, Fu S G, and Chen Y C. . 2010. Taurine alleviates dyslipidemia and liver damage induced by a high-fat/cholesterol-dietary habit. Food Chem. 120:156–162. doi: 10.1021/jf103167u [DOI] [Google Scholar]
  81. You J S, and Chang K J. . 1998. Taurine protects the liver against lipid peroxidation and membrane disintegration during rat hepatocarcinogenesis. Adv. Exp. Med. Biol. 442:105–112. doi: 10.1007/978-1-4899-0117-0_14 [DOI] [PubMed] [Google Scholar]
  82. Zhang Y, Jia H, Jin Y, Liu N, Chen J, Yang Y, Dai Z, Wang C, Wu G, and Wu Z. . 2020. Glycine attenuates LPS-induced apoptosis and inflammatory cell infiltration in mouse liver. J. Nutr. 150:1116–1125. doi: 10.1093/jn/nxaa036 [DOI] [PubMed] [Google Scholar]
  83. Zheng X C, Wu Q J, Song Z H, Zhang H, Zhang J F, Zhang L L, Zhang T Y, Wang C, and Wang T. . 2016. Effects of oridonin on growth performance and oxidative stress in broilers challenged with lipopolysaccharide. Poult. Sci. 95:2281–2289. doi: 10.3382/ps/pew161 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES