Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2020 Oct 24;10(11):486. doi: 10.1007/s13205-020-02475-z

Molecular characterization and race identification of Fusarium oxysporum f. sp. lycopersici infecting tomato in India

Loganathan Murugan 1,2,✉,#, Nagendran Krishnan 1,#, V Venkataravanappa 1,3, S Saha 1,4, A K Mishra 1, B K Sharma 1, A B Rai 1
PMCID: PMC7585583  PMID: 33123453

Abstract

Fourteen isolates of Fusarium were isolated from wilt affected tomato samples collected from 10 different states of India. Characterization of the fungal cultures based on morphology and sequencing of ITS rDNA revealed that they belonged to Fusarium oxysporum f.sp. lycopersici (Fol). Pathogenicity assay on two susceptible tomato cultivars showed all the 14 isolates were pathogenic and categorized in high-, moderate- and low-virulent groups. Differential host assay on Bonny Best (no resistant gene), UC82-L (harboring I-1), Fla.MH1 (harboring I-1 and I-2) and I3R-1 (harboring I-1, I-2 and I-3) tomato genotypes and PCR amplification with race-specific primers indicated that all the Fusarium isolates infecting tomato in India were belonging to race 1. Molecular diversity analysis based on ISSR markers revealed the presence of 3 distinct groups of Fol isolates. Abundant diversity was observed among the Fol isolates in harboring the virulence-related genes (endo-polygalacturonase gene pg1 and tomatinases) and toxin production (fumonisin). However, presence of pg1 does not correlate with virulence and the isolates carrying tomatinase 4 (tom-4) in combination with other tomatinase genes were of virulent group. Detection of fumonisin gene in six isolates of Fusarium infecting tomato indicated their toxigenic nature.

Electronic supplementary material

The online version of this article (10.1007/s13205-020-02475-z) contains supplementary material, which is available to authorized users.

Keywords: Tomato, Fusarium, Wilt, Race, Characterization

Introduction

Tomato (Solanum lycopersicum L.), commonly known as ‘poor man’s apple’, is cultivated worldwide and consumed as table food and processed products. India ranks second in tomato production next to China by producing 19.75 million tones with an average productivity of 25.04 t/ha (NHB 2018). Biotic factors are the major yield limiting constraints for its cultivation, of which Fusarium wilt caused by the soil borne fungus, Fusarium oxysporum f.sp. lycopersici (Fol) is one of the most important devastating diseases all over the world (Prihatna et al. 2018). The pathogen persists in the soil without host for many years and can attack the crop when it is grown. Yield loss in tomato due to fusarial wilt is reported as 60–70% under favorable conditions (Ravindra et al. 2015). Microscopic examination of morphological characteristics such as shape and size of micro- and macro-conidia, phialides and formation of chlamydospores, etc., is the most preferred method for identification of Fusarium spp., but it requires expertise to detect the pathogen at species level (Khetarpal 2006). Molecular approaches such as PCR with species-specific primers and sequencing of conserved nucleotide regions preferably of internal transcribed spacer (ITS) regions are being employed to detect fungal pathogen at species level (Baayen et al. 2000; O’Donnell et al. 2000; Singha et al. 2016). Further phylogenetic analysis of ITS sequences showed evolutionary relationship among the strains (Nirmaladevi et al. 2016). A huge variability exists among different strains of Fusarium spp., and to study such variability molecular tools such as random amplified polymorphic DNA (RAPD) (Williams et al. 1990), amplified fragment length polymorphism (AFLP) and inter-simple sequence repeats (ISSRs) (Wilson et al. 2004; Guleria et al. 2007) etc., are commonly attempted. Polygalacturonases are cell wall-degrading enzymes produced by fungal pathogens during pathogenesis and among them, polygalacturonase gene 1 (pg1) represents the maximum genetic diversity in Fusarium infecting tomato (Hirano and Arie 2009). Fumonisin is a mycotoxin produced by fungal pathogens and 11 species of Fusarium are reported to produce the toxin which is a major concern in food crops as it harms human and animal health (Divakara et al. 2014). Tomatinases enzymes produced by Fol during pathogenesis process are required mainly to detoxify α tomatin and it could be correlated with virulence of the pathogen (Pareja-Jaime et al. 2008). Hence, in the present study for characterization of pan India collection of Fol, morphological and ITS sequencing for identification, ISSR analysis for diversity, PCR assays with specific primers of fumonisin gene to know ability of mycotoxin production and, pg1 and tomatinases genes for classification of virulence have been attempted.

Though several biocontrol agents and chemicals have been tested for the management of Fusarium wilt diseases (Song et al. 2004; Manikandan et al. 2010; Elanchezhiyan et al. 2018), complete protection of crop could not be achieved by adopting these methods (Nirmaladevi et al. 2016; Thangavelu et al. 2019). Rather host plant resistance plays a key role in the development of sustainable management. Three races of Fol (races 1, 2 and 3) infecting tomato were reported (Reis et al. 2005). Based on the prevailing pathogenic race(s) in the local environment, selection of cultivar(s)/genotype(s) resistance to the particular race is the foremost step in disease management. To the best of our knowledge, there is no comprehensive study describing races prevailing among Fol isolates infecting tomato in India. Therefore, it is further attempted to do PCR with race-specific primers and bioassay with differential hosts to define prevalent Fol race(s) in India.

Materials and methods

Collection and isolation of Fusarium isolates

Wilt-infected tomato plant samples were collected from 14 different locations of tomato growing areas covering 10 states of India (Tamil Nadu, Uttar Pradesh, Assam, Jharkhand, Jammu and Kashmir, Punjab, Haryana, Madhya Pradesh, Bihar and Chhattisgarh). For isolation of Fusarium sp. associated with wilt disease of tomato, infected root tissues were washed under running tap water to remove soil adhering on the root surface, cut in to 5–10 mm bits and surface sterilized in 1% sodium hypochlorite solution (Merck, India) for 1–2 min, rinsed three times in sterile distilled water and dried on sterile filter paper. Then sterilized tissue bits were transferred on to Potato Dextrose Agar (PDA, Himedia, India) plates amended with 50 mg/L streptomycin sulphate (Sisco Research Laboratories, India). The plates were incubated at room temperature for 5 days for mycelial growth of the fungus. From the growing point, mycelial disc was excised and sub-cultured on PDA slants. The culture slants were incubated for 5 days under room temperature and subsequently stored at 4 °C (Norhito et al. 2004) for further use.

Pathogenicity of Fusarium isolates

Pure cultures of Fusarium isolates were transferred on to PDA in Petri plates and incubated for 7 days at room temperature. Spores were harvested by scraping mycelial mat of fully-grown culture using 10–15 ml of sterile water per plate. The spore suspension was adjusted to approximately 106 spores/ml using sterile water and used for pathogenicity test. Twenty-day-old healthy tomato seedlings cv. Bonny Best and DVRT1 were inoculated by standard root dip method. Seedlings were uprooted carefully preserving the root intactness, shaken to remove the adhering particles and washed gently under tap water. The root apex (about 1 cm) was trimmed with a pair of sterile scissors and submerged for 30 min in the conidial suspension for each isolate. Seedlings dipped in sterile water served as control. The inoculated seedlings and control were transplanted to protrays (7 cm diameter) containing sterilized soil and sand 1:1 ratio. One seedling per hole was transplanted and 6 seedlings for each isolate were inoculated. Plants were maintained in a greenhouse where day and night temperatures varied from 25 to 30 °C. Symptoms started to be visible 15–20 days after artificial inoculation. The discoloration of the vascular tissue was confirmed by splitting the stem (Marlatt et al. 1996; Dubey and Shio 2008). Disease severity was calculated using standard methodology (Nirmaladevi et al. 2016). Individual plants were scored for disease grading based on expressed symptoms as 0—healthy plant; 25—initial leaf chlorosis; 50—severe leaf chlorosis and initial symptoms of wilting; 75—severe wilting symptoms and leaf chlorosis; and 100—plant total wilting, leaves completely necrotic. Average score was calculated as disease severity and based on the disease severity, the virulence of each isolate was categorized as low virulent (< 25%), moderate virulent (25–50%) and high virulent (> 50%).

Morphological characterization of Fusarium wilt isolates

Pure cultures of Fusarium wilt isolates were grown on PDA in Petri plates as described earlier and after 7 days, the cultures were observed for shape and size of conidia and chlamydospores.

Molecular characterization

DNA Extraction

Fusarium isolates were grown in Potato Dextrose Broth (PDB) at 28 °C under static conditions for 7 days. Mycelia were harvested and lyophilized using liquid nitrogen. Later 100 mg of the finely powdered mycelium was used for DNA extraction using CTAB method with minor modifications (Graham et al. 1994) and the DNA samples were stored at − 20 °C for further use.

Species specific PCR assay

Genomic DNAs of Fusarium isolates were PCR amplified with Fusarium oxysporum species specific primer pair FOF1/FOR1 (Table 1) as described by Prashant et al (2003). The PCR amplification was carried out in 25 μL reaction volume consisting of 2.5 μL 10X PCR buffer, 2 mM MgCl2, 25 mM dNTPs, 1 unit of Taq polymerase (NEB, England), 10 pM of each primer and 50–100 ng of template DNA in the MyCycler thermal cycler (BioRad, USA). The PCR programme carried out was initial denaturation at 94 °C for 4 min followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min and extension at 72 °C for 2 min, and final extension at 72 °C for 10 min. PCR amplicons were resolved on 0.8% agarose gel stained with ethidium bromide and visualized in a UV transilluminator and 1 kb ladder was used as a marker. Amplification patterns were documented using Gel Documentation system (Alpha Innotech, USA).

Table 1.

List of primers used for characterization of Fol isolates infecting tomato

S. No Primer name Sequence (5′-3′) Target Reference
1. FOF1 ACATACCACTTGTTGCCTCG Fusarium oxysporum species specific Prashant et al. (2003)
2. FOR1 CGCCAATCAATTTGAG GAACG
3. ITS1 TCCGTAGGTGAACCTGCGG Internal transcribed spacer region White et al. (1990)
4. ITS4 TCCTCCGCTTATTGATATGC
5. Endo F CCAGAGTGCCGATACCGATT pg1 gene Hirano and Arie (2006)
6. Endo R AAGTGTTGGTAGGATAGTTG
7. tom1-11X CTCAAGCAGTCAAAATCCCCT tom-1 Pareja-Jaime et al. (2008)
8. tom1-12H CGACGAGTTGTGCTACCATCT
9. tom2-1 CCACTTCTGCGACACTGCTA tom-2 Pareja-Jaime et al. (2008)
10. tom2-2 CTGTGTTTCCTGTTCGTTTCC
11. tom3-1 CTATCATTGGTCTTGCCCGTT tom-3 Pareja-Jaime et al. (2008)
12. tom3-2 TGTTGGAGGATACTGCGTCTA
13. tom4-1 ATCCCCGTCTATCCCTCCC tom-4 Pareja-Jaime et al. (2008)
14. tom4-2 AAGAGACTCCAGAATGCGTTG
15. tom5-1 TGTGTTGGTCTCGGGTCTTTT tom-5 Pareja-Jaime et al. (2008)
16. tom5-2 TAGTCTCCTCCATCGCAATAC
17. FUM1 F AGTCGTGCTGACGTCGAG Fumonisin Ramana et al. (2011)
18. FUM1 R TGCTGCTGTCGCATCATA
19. uni-F ATCATCTTGTGCCAACTTCAG Universal to amplify races 1, 2, and 3 Hirano and Arie (2006)
20. uni-R GTTTGTGATCTTTGAGTTGCCA
21. sp13-F GTCAGTCCATTGGCTCTCTC Specific to races 1 and 3 Hirano and Arie (2006)
22. sp13-R TCCTTGACACCATCACAGAG
23. sp23-F CCTCTTGTCTTTGTCTCACGA Specific to races 2 and 3 Hirano and Arie (2006)
24. sp23-R GCAACAGGTCGTGGGGAAAA
25. ISSR3 CACCACCACGC ISSR Nirmaladevi et al. (2016)
26. ISSR9 GAGAGAGAGAGAGAGAGAC ISSR Nirmaladevi et al. (2016)
27. ISSR10 GAGAGAGAGAGAGAGAGAT ISSR Nirmaladevi et al. (2016)
Open in a new tab

Internal transcribed spacer (ITS)-based characterization of Fusarium isolates

Total DNA extracted from fourteen F. oxysporum isolates were subjected to PCR amplification using universal primers ITS1 and ITS4 (Table 1; White et al. 1990). The PCR amplification was performed in a total volume of 25 μL as described in species specific PCR assay with modification in annealing temperature (55 °C). The PCR-amplified DNA fragments were purified using QIAquick Gel extraction kit (QIAGEN, Germany) according to the manufacturer’s instructions. The eluted DNA fragments were cloned in the pGEMT vector (Promega, USA) and transformed in E. coli strain DH5α. Plasmids were isolated from the transformed colonies and sequenced (Eurofins Pvt Ltd., Bengaluru, India). The sequences obtained in the present study were submitted to GenBank.

Genetic diversity among F. oxysporum isolates

Genetic diversity of fourteen F. oxysporum isolates was studied using three ISSR markers (Eurofins, Bangalore, India). The primers selected for this study were based on the production of polymorphic and reproducible bands for isolates as reported in earlier studies (Nirmaladevi et al. 2016). PCR reactions were performed in MyCycler (BioRad, USA) and the reaction volume was 25 μL consisting of 2.5 μL of 10X PCR reaction buffer, 2 mM dNTPs (each), 25 mM MgCl2, 10 pM of each primer, 1.0 U of Taq DNA polymerase (NEB, England) and 50–100 ng template DNA. For each primer, amplifications were repeated thrice to assure reproducibility of amplification. The PCR cycling conditions were carried out with an initial denaturation at 94 °C for 4 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 36–45 °C for 1 min and extension at 72 °C for 2 min with a final extension of 72 °C for 10 min. For data analysis, the presence or absence of an allele at a particular locus was scored as 1 and 0, respectively, and the pairwise distance among the strains was calculated from the binary matrix using the Jaccard’s coefficient. The resulting distance matrices were used to cluster the strains by the UPGMA (Unweighted Pair Group method using arithmetic means) method using NTSYSpc version 2.0 (Rohlf 1997).

Characterization of Fusarium isolates based on endopolygalacturonase, tomatinase and fumonisin genes

Total genomic DNA of different F. oxysporum isolates were subjected to PCR using the primers pair Endo F/ Endo R for endopolygalacturonase gene pg1 (Table 1; Hirano and Arie 2006), tom1-11X and tom1-12H for tom1, tom2-1 and tom2-2 for tom2, tom3-1 and tom3-2 for tom3, tom4-1 and tom4-2 for tom4 and tom5-1 and tom5-2 for tom5 for tomatinase genes (Pareja-Jaime et al. 2008) and FUM1 F/FUM1R (Ramana et al. 2011) for fumonisin gene (Table 1). The PCR reaction was carried out in 25 μl as described in species specific PCR assay with annealing temperature of 59 °C for endopolygalacturonase gene, 54–55 °C for tomatinase genes and 58 °C for fumonisin gene.

Race identification of Fusarium isolates

Race-specific primers were used as described by Hirano and Arie (2006) in the PCR analysis with annealing temperature of 61 °C and their details are given in Table 1. Further, in bioassay with differentials (Bonny Best, UC82-L, Fla.MH1 and I3R-1 were obtained from AVRDC, Taiwan), twenty-day-old seedlings of tomato line Bonny Best (sensitive to Fol races 1, 2 and 3); UC82-L (Solanum lycopersicum)—resistant to race 1; Fla.MH1 (S. lycopersicum)—resistant to race 1 and race 2; I3R-1(S. pennellii)—resistant to races 1, 2, 3 were inoculated with all the 14 isolates Fol as described by Sánchez-Peña et al. (2010). The plants were observed for the symptom expression up to 20 days after inoculation.

Sequence analysis

The sequences of ITS gene obtained in the present study were compared to different fungal isolates sequences retrieved from the NCBI database using nucleotide BLAST in GenBank. The phylogenetic tree was constructed by MEGA X software (Kumar et al. 2018) using the neighbor-joining method with 1000 bootstrapped replications to estimate evolutionary distances between all pairs of sequences simultaneously.

Results

Characterization of Fusarium isolates based on spore morphology

The Fusarium isolates were characterized based on the culture and spore morphology. The mycelia were white to pink with purple tinge or slightly orange on the PDA medium. All the 14 Fusarium isolates were having macroconidia (sickle shape, 3–5 cells), microconidia (slightly oval, single cell) and chlamydospores (globose, terminal or intercalary) with an average size of 10.57 × 2.92 µm, 2.42 × 6.44 µm and 5–11 µm, respectively.

Pathogenicity assay and their virulence

All the fourteen isolates of Fusarium inoculated on the susceptible cv. Bonny Best and DVRT 1 were able to produce typical symptoms of wilt after 15–20 days post inoculation. Different symptoms such as yellowing of lower leaves followed by drooping of leaves were observed in the Fusarium inoculated plants. In severe cases, brown discoloration of vascular bundles was observed upon splitting of stems followed by wilting and death of the seedlings. Koch’s postulate was proved as they could be re-isolated from the infected tissues. Based on disease severity the fourteen isolates were categorized as highly virulent (7 isolates), moderately virulent (6 isolates) and low virulent (1 isolate) (Table 2).

Table 2.

Virulence details of the Fusarium isolates used in this study

No Isolates Geographic origin Disease severity Virulence GenBank accession no. (ITS based)
Bonny best DVRT 1 Mean
1. FWT 5 Jammu, J & K 36.67 29.0 32.8 Moderate KC478624
2. FWT 8 Jammu, J & K 53.33 73.33 63.3 High KC478622
3. FWT 15 Patiala, Punjab 26.0 37.33 31.7 Moderate KC478640
4. FWT 20 Karnal, Haryana 37.33 40.0 38.7 Moderate KC478621
5. FWT 56 Samastipur, Bihar 93.33 80.0 86.7 High KC478635
6. FWT 60 Samastipur, Bihar 80.0 73.33 76.7 High KC478634
7. FWT 71 Raipur, Chhattisgarh 40.0 40.0 40.0 Moderate KC478633
8. FUS VNS 2 Varanasi, Uttar Pradesh 66.67 80.0 73.3 High KC478619
9. FUS VNS 3 Varanasi, Uttar Pradesh 68.0 52.0 60.0 High KC478629
10. FWT 74 Ranchi, Jharkhand 40.0 46.67 43.3 Moderate KC478627
11. FWT 77 Ranchi, Jharkhand 53.33 66.67 60.0 High KC478626
12. FWT 89 Jabalpur, Madhya Pradesh 27.00 40.00 33.5 Moderate KC478623
13. FUS CO-3 Coimbatore, Tamil Nadu 66.67 66.67 66.7 High KC478630
14. FOL 14 Guwahati, Assam 13.33 16.0 14.7 Low KC478631
CD 9.12
CV 10.53
SE(d) 4.43
Open in a new tab

Species-specific PCR assay

PCR amplification with species-specific primers in 14 Fusarium isolates resulted in amplification of ~ 340 bp fragments specific to the F. oxysporum in all 14 isolates.

Characterization of Fusarium isolates through amplification of ITS region

The ITS regions of fourteen Fusarium isolates were amplified using fungal-specific universal primer pair ITS1–ITS4 and obtained ~ 500 bp amplicon in all the isolates. The amplified PCR products were cloned and sequenced. The ITS rDNA sequences of all the fourteen isolates were submitted to NCBI GenBank database and their accession numbers were obtained (Table 2). The BLAST analysis of ITS rDNA sequences showed that the nucleotide identity of the isolates ranged from 98–100% with Fol infecting tomato. Phylogenetic analysis using Mega X software by neighbor-joining method with the other selective Fusarium species sequences retrieved from the GenBank revealed that the F. oxysporum isolates characterized in the present study were formed into two separate groups with F. oxysporum f.sp. lycopersici, isolates. The five isolates viz., FOL 14, FWT 60, FWT 74, FWT 89 and FWT 20 were closely clustered in one group, while another set of nine isolates (FWT 5, FWT 8, FWT 15, FWT 56, FWT 71, FWT 77, FUS-Co3, FUS VNS 2 and FUS VNS 3) were clustered separately. However, all the fourteen isolates did not group with F. udum, F. solani, F. graminearum and F. culmorum and the tree was rooted on the outgroup Alternaria solani (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Phylogenetic analysis of F. oxysporum f. sp. lycopersici strains based on rDNA ITS sequences by MEGA X software using neighbor-joining method with 1000 bootstrapped replications

Genetic diversity of Fusarium isolates infecting tomato

To study the variability among the Fusarium isolates, analysis was carried out using three ISSR markers. All the three ISSR markers (ISSR3:5′CACCACCACGC3′, ISSR9:5′GAGAGAGAGAGAGAGAGAC3′ and ISSR10: 5′GAGAGAGAGAGAGAGAGAT3′) showed high polymorphism among all the isolates (Fig. 2). The amplified fragments of each isolate were scored as 1 (present) or 0 (absent) for three ISSR makers. Co-migrating bands were considered homologous characters. Faint bands and bands showing variable levels of intensity were not considered for scoring. Number of variable bands produced by each marker varied from 12 to 15 ranging between 200 bp and 3 kb. In the phylogenetic analysis, Fusarium isolates were grouped into three major clusters A, B and C. Cluster A had three isolates (FWT 56, FWT 71 and FWT 74), B had one isolate (FUS-Co3) and remaining 10 isolates were grouped under cluster C (Fig. 3).

Fig. 2.

Fig. 2

Open in a new tab

Polymorphic DNA pattern of Fusarium isolates infecting tomato using ISSR markers

Fig. 3.

Fig. 3

Open in a new tab

Dendrogram generated using diversity analysis of Fusarium isolates infecting tomato with ISSR marker

Characterization of Fusarium isolates based on endo polygalacturonase, tomatinase and fumonisin genes

Endo polygalacturonase

Polygalacturonase gene (pg1), a virulence determinant gene in Fusarium, was amplified through PCR using pg1 gene specific primer Endo-F/R, to study the pathogenic variation in the isolates of Fusarium. Among the 14 isolates of Fusarium tested, only 11 isolates (FUS-CO3, FWT 8, FOL 14, FWT 77, FWT 5, FWT 15, FUS VNS 3, FWT 56, FWT 71, FWT 20 and FWT 60) were found to harbor the pg1 gene (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

PCR amplification of Fusarium isolates with pg1 gene primers

Tomatinase

The 14 isolates of Fusarium infecting tomato were screened for the presence of different tomatinase genes (tom-1, tom-2, tom-3, tom-4 and tom-5). Amplicon size of ~ 550 bp was amplified in all the isolates for tom-5 gene, whereas tom-4 gene with an amplification size of ~ 530 bp was detected in 7 isolates and genes tom-3 and tom-1 with ~ 600 bp amplifications were detected in 9 isolates; and tom-2 gene has been amplified (~ 520 bp) in 12 isolates of Fol (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Distribution of tomatinase genes among the Fusarium isolates infecting tomato

Fumonisin

Upon screening of fourteen Fusarium isolates infecting tomato for fumonisin genes through PCR assay using FUM1 F and FUM1R primers pairs, only six isolates (FWT 56, FWT 60, FWT 71, FUS VNS 2, FWT 89 and FUS CO-3) belonging to the Fol infecting tomato collected from Bihar, Chhattisgarh, Uttar Pradesh, Tamil Nadu and Madhya Pradesh resulted in amplicon size of ~ 780 bp.

Race identification

Fourteen isolates of Fusarium isolated from tomato were inoculated on the differential lines. All the isolates could infect Bonny Best, which is sensitive to the Fol races 1, 2 and 3 but they were unable to infect UC82-L (resistant to race 1), Fla.MH1 (resistant to races 1 and 2) and I3R1 (resistant to races 1, 2, 3). It showed that the all isolates infecting tomato were belonging to race 1. In the PCR analysis for the race identification, universal primer pair uni-F/R was used and obtained PCR amplicon size of ~ 670 bp specific to Fol in all the fourteen isolates (Fig. 6a). Further, specific primer pair (sp13-F/R) of races 1 and 3 had also amplified the amplicon of ~ 445 bp in all 14 isolates (Fig. 6b). However, the specific primer pair (sp23-F/R) of races 2 and 3 failed to amplify any of the isolates.

Fig. 6.

Fig. 6

Open in a new tab

a PCR amplification of Fol isolates using universal primer pair (uni-F/R) amplifying all 3 races. b PCR amplification of Fol isolates using primer pair (sp13-F/R) specific to race 1 and race 3

Discussion

Wilt disease of tomato is caused by three races of Fol. Races 1 and 2 of Fol are distributed worldwide, whereas race 3 has a limited geographic distribution. Several studies were focused on the management of Fusarium wilt in tomato through biological and chemical means from India, but success of these methods was very limited due to variation in pathogens. Variation is due to the presence of diversified groups of strains or difference in their virulence or existence of various races. So far, there is no comprehensive study on virulence based on genetic diversity, race differentiation, mycotoxin and toxigenic-related genes of the strains infecting tomato in different parts of the country except one report where few of the characters have been studied with Fol isolates collected from five states (Nirmaladevi et al. 2016). Here, we describe morphological, virulence and genetic diversity of Fusarium isolates infecting tomato in India collected across the country. The study also showed that isolates varied widely in their morphological characters such as pigmentation, colony morphology, growth and sporulation. Upon inoculation on the susceptible host, all the isolates produced typical wilt symptoms with different severity depicting the pathogenic nature of the isolates. Based on the severity, isolates were categorized into three groups such as low, moderate and highly virulent. Exhibition of different grades of virulence denotes the subsistence of wide range of pathogen population causing wilt disease on tomato in India. Based on disease severity on the host, 42% isolates were classified as moderately virulent and 50% were highly virulent. Similarly, Nirmaladevi et al (2016) reported virulence variation among Fol strains infecting tomato-growing areas of a part of India.

Precise identification and genetic characterization of pathogen is necessary for appropriate management of wilt diseases. Studying the variability of F. oxysporum from various agro-climatic zones is not only important in the paradigm of breeding for disease resistance but also is necessary for the selection of resistant tomato cultivars. Detection of organism through molecular markers will be robust, less time consuming and cheap with least expertise. Ramana et al (2011) developed species-specific marker to identify the different formae speciales of F. oxysporum. Further it was validated in several other studies for the identification of different formae speciales of F. oxysporum (Divakara et al. 2014; Nirmaladevi et al. 2016). To study the genetic relationship of the Fol isolates, phylogenetic tree was constructed based on the ITS region. Evolutionary relationship of these Fol isolates with the other formae speciales was clear in the phylogenetic analysis. Several studies described the Fol and other formae speciales are not monophyletic in nature (O’Donnell et al.1998; Cai et al. 2003; Nirmaladevi et al. 2016; Srinivas et al. 2019). Similarly, the present study also confirms that Fol is polyphyletic in nature as some isolates of Fol were grouped together with other Fol isolates reported earlier infecting tomato, whereas remaining isolates were forming in another cluster with Fol and other F. oxysporum.

Fol produces group of pectinolytic enzymes contributing towards the penetration and colonization inside the host plant. The production of polygalacturonase by pathogenic fungi is critical for their success and survival during host infection. Literature showed that loss of pg1 activity will be resulting in the decrease of the pathogenicity of the pathogen (Liu et al. 2017). In case of Botrytis cinerea, the disruption of endo-polygalacturonase genes Bcpg1 or Bcpg2 results in its reduced virulence on different hosts (Have et al. 1998). Similarly, it was showed that pg1 is required for infection by Phytophthora capsici and Alternaria citri (Isshiki et al. 2001; Wen et al. 2009). However, some studies also showed that disruption of few polygalacturonase genes (PG1, PG5, PGX4) in fungi did not directly affect virulence in Fusarium oxysporum and led to no virulence difference in tomato (Pietro et al. 2003; García-Maceiraet al. 2000). Similarly, in our study also no correlation could be made between pg1 and virulence among Fol isolates as in one case pg1 was absent in a high-virulent isolate (FUS VNS2), while a less-virulent strain (FOL14) was having it (Supplementary Table 1) which indicated besides pg1 activity other mechanisms might also be involved in virulence.

Role of tomatinase enzymes in the virulence of Fol has been demonstrated by several studies. Over-expressed tomatinase gene (tom1) constitutively resulted in increased symptom development. Upon disruption of tom1, tomatinase activity reduced only by 25% revealing the existence of additional putative tomatinase genes (Pareja-Jaime et al. 2008). In the present study, we detected five tomatinase genes in 14 different Fol isolates through PCR assay using specific primer pairs. Among these, tom5 was found to be present in all the isolates irrespective of their virulence status (Supplementary Table 1). Tomatinases tom1 and tom4 are having more influence on the pathogen virulence. Here, the isolates harboring tom4 gene were found to be highly virulent. Even though FWT 20, FWT 74 and FWT 89 were harboring all four tomatinase genes except tom4, they were categorized under moderately virulent strains. This shows that tom4 might be contributing more towards the virulence. Moreover, additive effect of different genes can also be observed from this study, i.e., isolates having fewer genes were found to be least virulent than the isolates with more number of genes. This needs further investigation at the expression level of genes.

As of now, there is no study depicting the effect of fumonisin produced by the F. oxysporum f.sp. lycopersici in tomato plant, fruit and its effect on human upon consumption, although several authors have demonstrated the production of fumonisin by the F. oxysporum (Seo et al. 1996; Proctor et al. 2008; Das et al. 2012; Nirmaladevi et al. 2016). Similarly, six fumonisin toxin-producing strains of F. oxysporum f.sp. cubense infecting banana were identified through PCR assay, which are targeting toxin biosynthetic pathway genes in banana (Das et al. 2012). Nirmaladevi et al (2016) identified 11 toxigenic strains among 31 pathogenic strains of Fusarium oxysporum infecting tomato which have potential to produce fumonisin mycotoxin through PCR-based assay. In the present study, fumonisin gene was detected in six isolates of Fol indicating that they have the potential to produce fumonisin.

Race identification through both race-specific PCR and bioassay indicated that all the isolates collected from different parts of India were belonging to race 1. This study will help the breeders to concentrate more on developing tomato lines or genotypes resistance against race 1 of Fol in India.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary file1 (DOC 45 kb) (45KB, doc)

Acknowledgment

The work was carried out with the financial support of Indian Council of Agricultural Research (ICAR) network project on “ ICAR-Out reach programme on Phytophthora, Fusarium and Ralstonia wilt (otherwise called as PHYTOFURA)” operated from ICAR-Indian Institute of Spices Research, Calicut, India.

Author contributions

LM, NK and VV have conceptualized study, performed experiments and wrote manuscript; AKM and BKS maintained culture and inoculums required for experiments; SS and ABR critically revised manuscript and facilitated for conducting experiments; all the authors gone through the manuscript.

Compliance with ethical standards

Conflict of interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.

Footnotes

Loganathan Murugan and Nagendran Krishnan authors contributed equally.

References

  1. Baayen RP, O’Donnell K, Bonants PJM, Cigelnik E, Kroon LPNM, Roebrock EJA, Walwijck C. Gene genealogies and AFLP analyses in the Fusarium oxysporium complex identity monophyletic and non monophyletic formae speciales causing wilt and rot disease. Phytopathology. 2000;90:891–907. doi: 10.1094/PHYTO.2000.90.8.891. [DOI] [PubMed] [Google Scholar]
  2. Cai G, Rosewich Gale L, Schneider RW, Kistler HC, Davis RM, Elias KS, Miyao EM. Origin of race 3 of Fusarium oxysporum f. sp. lycopersici at a single site in California. Phytopathology. 2003;93:1014–1022. doi: 10.1094/PHYTO.2003.93.8.1014. [DOI] [PubMed] [Google Scholar]
  3. Das A, Venkataramana M, Chandranayaka S, Murali HS, Batra HV. Molecular characterization of Fusarium oxysporum f. sp. cubense isolates from banana. Pest Manag Hortic Ecosyst. 2012;18(2):171–178. [Google Scholar]
  4. Divakara ST, Santosh M, Aiyaz M, Ramana MV, Hariprasad P, Chandra Nayaka S, Niranjana SR. Molecular identification and characterization of Fusarium spp., associated with sorghum seeds. J Sci Food Agric. 2014;94:1132–1139. doi: 10.1002/jsfa.6380. [DOI] [PubMed] [Google Scholar]
  5. Dubey SC, Shio RS. Virulence analysis and oligonucleotide fingerprinting to detect genetic diversity among Indian isolates of Fusarium oxysporum f. sp. ciceris causing chickpea wilt. Mycopathologia. 2008;165:389–406. doi: 10.1007/s11046-008-9090-7. [DOI] [PubMed] [Google Scholar]
  6. Elanchezhiyan K, Keerthana U, Nagendran K, Prabhukarthikeyan SR, Prabakar K, Raguchander T, Karthikeyan G. Multifaceted benefits of Bacillus amyloliquefaciens strain FBZ24 in the management of wilt disease in tomato caused by Fusarium oxysporum f. sp. lycopersici. Physiol Mol Plant Pathol. 2018;103:92–101. doi: 10.1016/j.pmpp.2018.05.008. [DOI] [Google Scholar]
  7. García-Maceira FI, Pietro AD, Roncero MIG. Cloning and disruption of pgx4 encoding an in planta expressed exopolygalacturonase from Fusarium oxysporum. Mol Plant Microbe Interact. 2000;13(4):359–365. doi: 10.1094/MPMI.2000.13.4.359. [DOI] [PubMed] [Google Scholar]
  8. Graham GC, Mayers P, Henry RJ. A simplified method for the preparation of fungal genomic DNA for PCR and RAPD analysis. Biotechniques. 1994;16:48–50. [PubMed] [Google Scholar]
  9. Guleria S, Aggarwal R, Thind TS, Sharma TR. Morphological and pathological variability in rice isolates of Rhizoctonia solani and molecular analysis of their genetic variability. J Phytopathol. 2007;155:654–661. doi: 10.1111/j.1439-0434.2007.01291.x. [DOI] [Google Scholar]
  10. Have AT, Mulder W, Visser J, van Kan JAL. The endopolygalacturonase gene Bcpg1 is required for full virulence of Botrytis cinerea. Mol Plant Microbe Interact. 1998;11(10):1009–1016. doi: 10.1094/MPMI.1998.11.10.1009. [DOI] [PubMed] [Google Scholar]
  11. Hirano Y, Arie T. PCR-based differentiation of Fusarium oxysporum f. sp. lycopersici and radicis-lycopersici and races of F.oxysporum f. sp. lycopersici. JGen Plant Pathol. 2006;72(5):273–283. doi: 10.1007/s10327-006-0287-7. [DOI] [Google Scholar]
  12. Hirano Y, Arie T. Variation and phylogeny of Fusarium oxysporum isolates based on nucleotide sequences of polygacturanase genes. Microbes Environ. 2009;24:113–120. doi: 10.1264/jsme2.me08554. [DOI] [PubMed] [Google Scholar]
  13. Isshiki A, Akimitsu K, Yamamoto M, Yamamoto H. Endopolygalacturonase is essential for citrus black rot caused by Alternaria citri but not brown spot caused by Alternaria alternata. Mol Plant Microbe Interact. 2001;14(6):749–757. doi: 10.1094/MPMI.2001.14.6.749. [DOI] [PubMed] [Google Scholar]
  14. Khetarpal RK. Plant pathology research and development: a gap analysis. Indian Phytopathology. 2006;59:97. [Google Scholar]
  15. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Liu C-Q, Hu K-D, Li T-T, Yang Y, Yang F, Li Y-H. Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit. PLoS ONE. 2017;12(3):e0173277. doi: 10.1371/journal.pone.0173277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Manikandan R, Saravanakumar D, Rajendran L, Raguchander T, Samiyappan R. Standardization of liquid formulation of Pseudomonas fluorescens Pf1 for its efficacy against Fusarium wilt of tomato. Biol Control. 2010;54(2):83–89. doi: 10.1016/j.biocontrol.2010.04.004. [DOI] [Google Scholar]
  18. Marlatt ML, Correll JC, Kaufmann P. Two genetically distinct populations of Fusarium oxysporum f. sp. lycopersici race 3 in the United States. Plant Dis. 1996;80:1336–1342. doi: 10.1094/PD-80-1336. [DOI] [Google Scholar]
  19. NHB (2018) Area and production of horticultural crops 2017–18. National Horticultural Board, Government of India. https://nhb.gov.in/statistics/State_Level/2017-18-(Final).pdf.
  20. Nirmaladevi D, Venkataramana M, Srivastava RK, Uppalapati SR, Gupta VK, Yli-Mattila T, Clement Tsui KM, Srinivas C, Niranjana SR, Chandra NS. Molecular phylogeny, pathogenicity and toxigenicity of Fusarium oxysporum f. sp. lycopersici. Scientific Reports. 2016;6:21367. doi: 10.1038/srep21367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Norhito Y, Jyuichi S, Mamoru S, Seizo S, Takashi S. Physiological races and vegetative compatibility groups of butter head lettuce isolates of Fusarium oxysporum f. sp. lactucae in Japan. J Gen Plant Pathol. 2004;70:308–313. doi: 10.1007/s10327-004-0142-7. [DOI] [Google Scholar]
  22. O’Donnell K, Kistler HC, Cigelnik PR. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc Natl Acad Sci USA. 1998;95:2044–2049. doi: 10.1073/pnas.95.5.2044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. O'Donnell K, Kistler HC, Tacke BK, Casper HH. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc Natl Acad Sci USA. 2000;97:7905–7910. doi: 10.1073/pnas.130193297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Pareja-Jaime Y, Roncero MI, Ruiz-Roldán MC. Tomatinase from Fusarium oxysporum f. sp. lycopersici is required for full virulence on tomato plants. Mol Plant Microbe Interact. 2008;21(6):728–736. doi: 10.1094/MPMI-21-6-0728. [DOI] [PubMed] [Google Scholar]
  25. Pietro AD, Madrid MP, Caracuel Z, Delgado-Jarana J, Roncero MIG. Fusarium oxysporum: exploring the molecular arsenal of a vascular wilt fungus. Mol Plant Pathol. 2003;4(5):315–325. doi: 10.1046/j.1364-3703.2003.00180.x. [DOI] [PubMed] [Google Scholar]
  26. Prashant KM, Roland TV, Alastair C. Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusaria. FEMS Microbiol Lett. 2003;218:329–332. doi: 10.1111/j.1574-6968.2003.tb11537.x. [DOI] [PubMed] [Google Scholar]
  27. Prihatna C, Barbetti MJ, Barker SJ. A novel tomato Fusarium wilt tolerance gene. Front Microbiol. 2018;9:1226. doi: 10.3389/fmicb.2018.01226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Proctor RH, Busman M, Jeong-Ah S, Lee YW, Plattner RD. A fumonisin biosynthetic gene cluster in Fusarium oxysporum strain O-1890 and the genetic basis for B versus C fumonisin production. Fungal Genet Biol. 2008;45:1016–1026. doi: 10.1016/j.fgb.2008.02.004. [DOI] [PubMed] [Google Scholar]
  29. Ramana MV, Balakrishna K, Murali HS, Batra HV. Multiplex PCR-based strategy to detect contamination with mycotoxigenic Fusarium species in rice and finger millet collected from southern India. J Sci Food Agric. 2011;91:1666–1673. doi: 10.1002/jsfa.4365. [DOI] [PubMed] [Google Scholar]
  30. Ravindra S, Biswas SK, Nagar D, Singh J, Singh M, Kumar MY. Sustainable integrated approach for management of Fusarium wilt of tomato caused by Fusarium oxysporium sp. lycopersici (Sacc.) Sander Hansen. Sustain Agric Res. 2015;4(1):138–147. doi: 10.5539/sar.v4n1p138. [DOI] [Google Scholar]
  31. Reis A, Costa H, Boiteux LS, Lopes CA. First report of Fusarium oxysporum f. sp. lycopersici race 3 on tomato in Brazil. Fitopatologia Brasileira. 2005;30:426–428. doi: 10.1590/S0100-41582005000400017. [DOI] [Google Scholar]
  32. Rohlf FJ. NTSYS-pc Version. 2.02i Numerical taxonomy and multivariate analysis system. Exeter Software, Setauket, New York: Applied Biostatistics Inc.; 1997. [Google Scholar]
  33. Sánchez-Peña P, Cauich-Pech SO, Núñez-Farfán J, Núñez-Cebreros RD, Hernández-Verdugo S, Parra-Terraza S, Villarreal-Romero M. Incidence of Fusarium oxysporum f. sp. lycopersici races in tomato in Sinaloa, Mexico. Plant Dis. 2010;94(11):1376–1376. doi: 10.1094/PDIS-04-10-0255. [DOI] [PubMed] [Google Scholar]
  34. Seo JA, Kim JC, Lee YW. Isolation and characterization of two new type C fumonisins produced by Fusarium oxysporum. J Nat Prod. 1996;59:1003–1005. doi: 10.1021/np960234p. [DOI] [PubMed] [Google Scholar]
  35. Singha IM, Kakoty Y, Unni BG, Das J, Kalita MC. Identification and characterization of Fusarium sp. using ITS and RAPD causing Fusarium wilt of tomato isolated from Assam, North East India. J Genet Eng Biotechnol. 2016;14:99–105. doi: 10.1016/j.jgeb.2016.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Song W, Zhou L, Yang C, Cao X, Zhang L, Liu X. Tomato Fusarium wilt and its chemical control strategies in a hydroponic system. Crop protection. 2004;23(3):243–247. doi: 10.1016/j.cropro.2003.08.007. [DOI] [Google Scholar]
  37. Srinivas C, Devi DN, Murthy KN, Mohan CD, Lakshmeesha TR, Singh B, Kalagatur NK, Niranjana SR, Hashem A, Alqarawi AA, Tabassum B. Fusarium oxysporum f. sp. lycopersici causal agent of vascular wilt disease of tomato: biology to diversity—a review. Saudi J Biol Sci. 2019;26(7):1315–1324. doi: 10.1016/j.sjbs.2019.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Thangavelu R, Mostert D, Gopi M, Ganga Devi P, Padmanaban B, Molina AB, Viljoen A. First detection of Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) on Cavendish banana in India. Eur J Plant Pathol. 2019 doi: 10.1007/s10658-019-01701-6. [DOI] [Google Scholar]
  39. Wen XS, Yong JJ, Bao ZF, O’Neill NR, Xiao PZ, Xie BY. Functional analysis of Pcipg2 from the straminopilous plant pathogen Phytophthora capsici. Genesis. 2009;47(8):535–544. doi: 10.1002/dvg.20530. [DOI] [PubMed] [Google Scholar]
  40. White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In:Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applications. Academic Press, New York, pp 315–322
  41. Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 1990;18:6531–6535. doi: 10.1093/nar/18.22.6531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Wilson A, Simpson D, Chandler E, Jennings P, Nicholson P. Development of PCR assays for the detection and differentiation of Fusarium sporotrichioides and Fusarium langsethiae. FEMS Microbiol Lett. 2004;233:69–76. doi: 10.1016/j.femsle.2004.01.040. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (DOC 45 kb) (45KB, doc)

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES