Preparation of Mammalian Nascent RNA for Long Read Sequencing

Abstract

Long read sequencing technologies now allow high-quality sequencing of RNA (or their cDNAs) that are hundreds to thousands of nucleotides long. Long read sequences of nascent RNA provide single-nucleotide resolution information about co-transcriptional RNA processing events – e.g. splicing, folding, and base modifications. Here, we describe how to isolate nascent RNA from mammalian cells through subcellular fractionation of chromatin-associated RNA, as well as how to deplete polyA+ RNA and rRNA, and finally, how to generate a full-length cDNA library for use on long read sequencing platforms. This approach allows for an understanding of coordinated splicing status across multi-intron transcripts by revealing patterns of splicing or other RNA processing events that cannot be gained from traditional short read RNA sequencing.

INTRODUCTION:

Advancements in nucleotide sequencing technology now allow for much longer DNA and RNA molecules to be sequenced. Whereas previous “short read” Next Generation Sequencing (NGS) libraries consist of 50–300 nucleotide fragments, new technologies, termed “long read” sequencing, allow DNA and RNA up to hundreds of thousands of bases in length to be sequenced (van Dijk, Jaszczyszyn, Naquin, & Thermes, 2018). This technology, for instance, is able to determine the nucleotide sequence of large tracts of genomic DNA, making it a powerful tool for de novo genome assembly (Sohn & Nam, 2018). Long read sequencing additionally provides a wealth of information about the transcriptome, by revealing the identity of full-length mRNA and ncRNA transcripts, from their 5′ to their 3′ ends (Carrillo Oesterreich et al., 2016; Deveson et al., 2018; Hardwick et al., 2019; Herzel, Straube, & Neugebauer, 2018; Lagarde et al., 2017; Singh et al., 2019; Tang et al., 2020). Longer reads inherently contain more information, potentially including the unique splicing status, RNA modification status, transcript start site, and polyA cleavage site of each read. Longer reads are less ambiguous when trying to interpret patterns of alternative isoform usage, i.e. which exons are ligated together in the same transcript (Tilgner et al., 2015; Tilgner et al., 2018; Workman et al., 2019). The resulting data thereby characterize the functional genome more completely than short read NGS data and can reveal novel gene products.

We have been interested in applying long read sequencing to mammalian nascent RNA, which is being actively synthesized by RNA Polymerase II (hereafter abbreviated to Pol II) and co-transcriptionally processed by a variety of cellular machines (Carrocci & Neugebauer, 2019). Data from nascent RNA sequencing provide unique information on multiple co-transcriptional RNA processing steps simultaneously, enabling the identification of coupled reactions. For example, we and others have observed coordination among intron splicing events by using long read sequencing of nascent RNA (Drexler, Choquet, & Churchman, 2019; Herzel et al., 2018; Reimer, Mimoso, Adelman, & Neugebauer, 2020). In addition, we have identified transcripts that are fully spliced or unspliced during transcription; these “all or none” transcripts have opposite fates regarding 3′ end formation: spliced transcripts are efficiently cleaved, whereas unspliced transcripts exhibit inefficient 3′ end cleavage (Herzel et al., 2018; Reimer et al., 2020). Co-transcriptional RNA folding and nucleobase modifications, which are the subject of current intense research, can also be analyzed by long read sequencing (Ke et al., 2017; Liu et al., 2019; Parker et al., 2020; Saldi, Fong, & Bentley, 2018). Thus, by performing long read sequencing on nascent RNA, the researcher has the opportunity to track both the progression of Poll II elongation by the 3′ end of the nascent RNA sequence and relate Pol II position to the progression of RNA processing detected in the internal sequence of the nascent RNA (see Figure 1, top panel).

Figure 1.

Overview of steps described in this protocol for preparation of mammalian nascent RNA for long-read sequencing.

In this protocol, chromatin-associated RNA is purified from murine erythroleukemia (MEL) cells by first performing subcellular fractionation to physically separate chromatin (Basic Protocol 1: Subcellular Fractionation). Then, nascent RNAs are enriched by depleting polyadenylated RNA (polyA RNA) and ribosomal RNA (rRNA), and nascent RNA 3′ ends are ligated to a unique adapter to retain the position of the Pol II active site when RNAs were isolated (Basic Protocol 2: Nascent RNA Isolation and Adapter Ligation). Finally, a template-switching reverse transcriptase is used to generate a full-length cDNA copy of the nascent RNA. Minimal PCR cycles are used to amplify a cDNA library before long read sequencing (Basic Protocol 3: cDNA Amplicon Preparation). See Figure 1 for an overview of the whole protocol.

STRATEGIC PLANNING

Before beginning, the user should have MEL cells actively growing. These cells grow in suspension in DMEM + GlutaMAX (Thermo Fischer Scientific, cat. no. 10569–010) supplemented with Fetal Bovine Serum (Thermo Fischer Scientific, cat. no. 26140) and Penicillin-Streptomycin (Thermo Fischer Scientific, cat. no. 15140122) in non-treated T-25 flasks (Thermo Fischer Scientific, cat. no. 169900). For more information on MEL cell growth and induction, see Antoniou (1991). Cells should be counted with a hemocytometer to determine their density, and the culture density should be recorded for several days before beginning the protocol, to ensure consistent doubling is occurring. Cultures should be diluted back to 5 × 10⁴ cells/ml once they reach a density of 1–2 × 10⁶ cells/ml. Once cells are in active growth, they should double in number approximately every 12 hours. At this point, the cells are ready to use for this protocol.

For one replicate to be prepared using this protocol, approximately 80 million cells are needed as input: 60 million cells will be used to isolate nascent RNA and 20 million cells will be used to test the success of subcellular fractionation by western blot. This number of cells can often be gathered from 4 flasks of cells, each containing 20 million cells (10 ml culture at a density of 2 × 10⁶ cells/ml).

BASIC PROTOCOL 1: SUBCELLULAR FRACTIONATION

Here, the user will perform subcellular fractionation to separate the chromatin from the nucleoplasm and cytoplasm of mammalian cells. This approach is based on the evidence that under harsh conditions that lyse the nuclear membrane and dissociate any non-specifically bound RNA, the ternary complex of Pol II, chromatin, and nascent RNA remains intact and precipitates from solution (Wuarin & Schibler, 1994). After subcellular fractionation, the user will collect a sample from each fraction and check that characteristic marker proteins are in each fraction by western blot. If the fractionation is successful, the user will then continue to collect nascent RNA from the chromatin fraction.

Care should be taken to minimize time in between steps, especially after cell lysis and nuclear lysis steps. In order to monitor the success of fractionation, a minimum of two samples should be fractionated in parallel. For one sample, each fraction is kept for use in western blotting. For the second sample, the chromatin fraction is used to isolate RNA. All buffers used from the point of cell lysis to pelleting the chromatin contain α-amanitin, an inhibitor of Pol II, which prevents Pol II from elongating and allows the position of Pol II to be accurately captured. Note that buffers containing α-amanitin, a potent toxin, should be handled with extreme care and all buffer waste should be disposed of properly. All buffers should be freshly prepared and chilled on ice before beginning. This protocol is specific for murine erythroleukemia (MEL) cells, but has been easily adapted to other mammalian cell types in our lab. This protocol works best on freshly harvested, not frozen, cells.

Materials:

MEL cells in active growth (See Strategic Planning)

1x PBS (Americanbio, cat. no. AB11072–01000) + 1 mM EDTA (Americanbio, cat. no. AB00502–00100)

Cell lysis buffer (see recipe in Reagents and Solutions)

Sucrose buffer (see recipe in Reagents and Solutions)

Nuclear resuspension buffer (see recipe in Reagents and Solutions)

Nuclear lysis buffer (see recipe in Reagents and Solutions)

Trizol Reagent (Thermo Fischer Scientific, cat. no. 15596026)

NuPAGE 4X LDS Sample Buffer (Thermo Fischer Scientific, cat. no. NP0007)

4–12% Bis-Tris gel (Thermo Fischer Scientific, cat. no. NP0322PK2, or poured in-house)

Precision Plus Protein Dual Color Standards (BioRad, cat. no. 1610374)

NuPAGE MOPS-SDS running buffer (Thermo Fischer Scientific, cat. no. NP0001)

NuPAGE transfer buffer (Thermo Fischer Scientific, cat. no. NP0006)

5% bovine serum albumin (BSA) in 0.1% TBS-T (TBS buffer, 0.1% Tween 20)

0.1% TBS-T

3% BSA in 0.1% TBS-T

anti-GAPDH antibody (Santa Cruz, cat. no. sc-25778)

anti-U1–70K (CB7) antibody (hybridoma supernatant, available upon request)

anti-NXF1 TAP N-19 antibody (Santa Cruz, cat. no. sc-17310)

anti-Pol II (4H8) antibody (Santa Cruz, cat. no. sc-47701)

Mouse IgG, HRP-linked whole Ab (Cytiva, cat. no. NA931)

Rabbit IgG, HRP-linked whole Ab (Cytiva, cat. no. NA934)

Pierce ECL Western blotting substrate (Thermo Scientific, cat. no. 32106)

15-ml conical polypropylene tubes (Sigma, cat. no. CLS430791)

Tabletop centrifuge

Wide bore P1000 pipette tips (VWR, cat. no. 89049–166)

Refrigerated microcentrifuge

1.5-ml tubes (Dot Scientific, cat. no. RN1700-GMT)

Vortex

Sonicator (e.g. Branson, fitted with a 2 mm microtip probe)

Heat block at 95°C

0.2 μm nitrocellulose membrane (BioRad, cat. no. 1620112)

Chemiluminescent Imager

Protocol Steps:

Fractionation

• 1Count actively growing MEL cells using a hemocytometer. For each replicate, aliquot 20 million cells from each flask into a 15-ml conical tube and repeat three times, for a total of 4 tubes and 80 million cells. Centrifuge all tubes 5 min at 1,500 RPM, room temperature.

  As mentioned in the Strategic Planning section, three of the tubes will be used for nascent RNA isolation, and one tube will be used for confirming the success of subcellular fractionation by western blot. Perform all steps through step 15 on all 15-ml tubes simultaneously.

• 2Gently resuspend the cell pellet in 1 ml ice-cold PBS/1 mM EDTA by pipetting up and down ~ 5 times while using a wide bore P1000 pipette tip.
• 3Centrifuge 5 min at 1,500 rpm, 4°C.
• 4Gently resuspend the cell pellet in 250 μl cell lysis buffer.

  Pipette up and down while using a wide bore P1000 pipette tip just until cells are in a turbid suspension, ~ 10 times up and down. Some small clumps of cells are OK.

• 5Incubate for 5 min on ice.
• 6Add 500 μl of sucrose buffer to a new 1.5-ml tube and carefully layer the cell lysate on top
• 7Centrifuge the tube for 10 min at 2000 rpm, 4°C in a microcentrifuge.
• 8Aspirate the supernatant (this is the cytoplasmic fraction), and transfer to a new 1.5-ml tube. Set aside on ice.

  Be careful not to disturb the pellet at the bottom of the tube.

• 9Rinse the white nuclear pellet with 500 μl of ice-cold PBS/1mM EDTA by pipetting the solution down the side of the tube to avoid disturbing the pellet, then aspirating the solution completely.
• 10Resuspend the nuclear pellet in 100 μl of nuclear resuspension buffer by pipetting the buffer on top of the pellet, then gently flicking the closed tube.

  It is easiest to drag the tube across a bumpy surface, such as across the holes of a tube rack several times. The nuclei should easily resuspend into a somewhat turbid suspension.

• 11Add 100 μl of nuclear lysis buffer, then vortex for 5 seconds.
• 12Incubate for 3 min on ice.
• 13Centrifuge for 2 min at 14,000 rpm, 4°C.
• 14Aspirate the supernatant (this is the nucleoplasmic fraction), and transfer to a new 1.5-ml tube. Set aside on ice.
• 15Rinse the chromatin pellet left in the tube with 500 μl of ice-cold PBS/1 mM EDTA.

  Make sure to remove as much supernatant as possible to remove nucleoplasmic RNA contamination in chromatin-associated RNA. The chromatin pellet should be very stable.

• 16Add 100 μl ice-cold PBS to one of the tubes (this is the chromatin fraction sample for western blot), then set aside on ice. To the other three tubes, add 100 μl ice-cold PBS and 300 μl Trizol, then vortex briefly just until the pellet releases from the bottom of the tube.

  The chromatin pellet should be very insoluble. It will not dissolve in Trizol.

• 17Either transfer the three tubes containing Trizol to −80°C for up to 1 month or continue immediately to nascent RNA isolation (Basic Protocol 2).

Western Blot

• 18Place the 1.5-ml tubes containing the cytoplasmic fraction (from step 8), nucleoplasm fraction (from step 14), and chromatin fraction (from step 16) on ice. Adjust the volume in each tube with PBS so that the three fractions contain an approximately equal volume.

  The cytoplasmic fraction should be the largest, approximately 750 μl.

• 19For the nucleoplasm and chromatin fractions, sonicate on ice at 30% amplitude for 1 min total, with 10 seconds on followed by 20 seconds off.
• 20Centrifuge all three tubes (cytoplasm, nucleoplasm, and chromatin) for 10 min at 14,000 rpm, 4°C.
• 21Aliquot 20 μl of the supernatant from each tube into a new 1.5-ml tube.
• 22Add 5 ul 4X LDS sample buffer to each tube. Mix by pipetting up and down.

  Try to avoid creating bubbles when pipetting up and down by keeping the tip submerged.

• 23Incubate for 5 min at 95°C.
• 24Centrifuge 1 min at 14,000 rpm, room temperature.
• 25Load cytoplasm, nucleoplasm, and chromatin samples on a 4–12% Bis-Tris gel alongside 10 μl of prestained ladder. Run the gel in 1X MOPS-SDS running buffer at 180 V until the dye front is just off the bottom of the gel, approximately 50 minutes.

  Aim to load the prestained ladder in the outermost two lanes to use as a guide for cutting the membrane later. For more details on SDS gel electrophoresis, see Gallagher (2012).

• 26Transfer to a 0.2 μm nitrocellulose membrane in 1X NuPAGE transfer buffer for 2 h at 30V in a cold room at 4°C.

  For more details, see Ni, Xu, and Gallagher (2017).

• 27Rinse the nitrocellulose membrane briefly in distilled water.
• 28Block the membrane in 5% BSA in 0.1% TBS-T overnight in a cold room at 4°C on a nutator.

  Incubate the membrane in a closed container to prevent evaporation, and make sure to add enough solution to cover the membrane completely.

• 29Rinse the membrane at least 1 hour in 0.1% TBS-T at room temperature in a nutator.
• 30Cut the membrane using a sterile blade and a hard-flat edge at the 100 kDa and 50 kDa ladder marks to separate the membrane into three pieces. Incubate the membranes with the primary antibodies listed in Table 1 in 3% BSA in 0.1% TBS-T for at least 1 hour at room temperature: incubate the top portion of the blot with the anti-Pol II 4H8 antibody, the middle portion of the blot with the anti-U1–70K antibody, and the bottom portion of the blot with the anti-GAPDH antibody. After incubation, rinse at least 3 times for 10 minutes each with fresh 0.1% TBS-T in a nutator.

  The antibody concentration and time for incubation will need to be optimized for antibodies for other cell types or antigens. Note that we propose an alternative marker for the nucleoplasm, NXF1, as U1–70K does not work well in all cell types. We typically use antibody dilutions of 1:2,000 for anti-Pol II 4H8, 1:2,00 for anti-GAPDH, and 1:5 for anti-U1–70K.

• 31Incubate the membranes with secondary antibodies in 3% BSA in 0.1% TBS-T for at least 1 hour at room temperature: use anti-rabbit HRP for the GAPDH membrane, and anti-mouse HRP for the U1–70K and Pol II 4H8 membranes.

  We typically use antibody dilutions of 1:10,000 for anti-rabbit HRP, and 1:8,000 for anti-mouse HRP.

• 32Rinse the membrane a final 4 times for at least 10 minutes each in fresh 0.1% TBS-T at room temperature in a nutator after secondary antibody incubation.
• 33Cover the membrane in ~ 1 ml prepared ECL Western blotting substrate for approximately 60 seconds and expose the membrane to film or a digital chemiluminescence reader. See Figure 2 for an example of a successful fractionation.

Table 1.

Primary antibodies for verification of subcellular fractionation.

Antibody	Localization	Running Size	Source Organism
anti-GAPDH	cytoplasm	37 kDa	rabbit
anti-U1–70K	nucleoplasm	70 kDa	mouse
anti-NXF1	nucleoplasm	70 kDa	mouse
anti-Pol II (4H8)	chromatin	240 kDa	mouse

Figure 2.

Western blot after subcellular fractionation of MEL cells. Cytoplasm (CYT), nucleoplasm (NPL), and chromatin (CHR) fractions are loaded from left to right. Primary antibodies for each blot are shown to the right: GAPDH is a marker for the cytoplasm, U1–70K is a marker for the nucleoplasm, and Pol II 4HD is a marker for RNA Pol II, which should be in the chromatin fraction.

BASIC PROTOCOL 2: NASCENT RNA ISOLATION AND ADAPTER LIGATION

Nascent RNA refers to RNA which is being actively synthesized by Pol II. While subcellular fractionation enriches for RNA that is physically bound to the ternary complex of Pol II on chromatin, further purification is needed to remove contaminating mRNA (i.e. not nascent) and rRNA. In this protocol, ribosomal RNA and chromatin-associated polyadenylated RNA are depleted to enrich for nascent RNA. While a number of alternative methods are commercially available for both of these procedures, in our experience, kits with complementary oligos conjugated to magnetic beads provide the fastest and most reliable approach for both methods, and that approach is described here. After that process, a DNA adapter which is necessary for priming reverse transcription in the downstream protocol is blunt ligated to the 3′ end of each nascent RNA. This adapter sequence is used in data analysis to find the exact position where the nascent RNA 3′-OH was purified from a Pol II active site.

Materials:

Chromatin-associated RNA (from Basic Protocol 1, step 17)

Chloroform

100% ethanol, room temperature

UltraPure Glycogen (Thermo Fischer Scientific, cat. no. 10814010)

3 M sodium acetate

100% ethanol, ice-cold

70% ethanol, ice-cold

2X Novex Sample Buffer (Thermo Fischer Scientific, cat. no. LC6876)

TAE buffer (40 mM TRIS, 20 mM acetic acid, 1 mM EDTA pH 8.0)

Agarose (Sigma, cat. no. A9539)

Lonza Gelstar (Thermo Fischer Scientific, cat. no. 50535)

GeneRuler 1 kb Plus DNA ladder (Thermo Fischer Scientific, cat. no. SM1331)

DNA adapter (/5rApp/NNNNNCTGTAGGCACCATCAAT/3ddC/)

T4 RNA ligase kit (NEB, cat. no. M0351L)

Vortex

Thermomixer

Refrigerated microcentrifuge

2-ml tube (Dot Scientific, cat. no. RN2000-GMT)

RNeasy Mini kit (Qiagen, cat. no. 74104)

RNase-Free DNase Set (Qiagen, cat. no. 79254)

1.5-ml tubes (Dot Scientific, cat. no. RN1700-GMT)

Nanodrop

UV gel imaging system

DynaBeads mRNA DIRECT Micro Purification kit (Thermo Fischer Scientific, cat. no. 61021)

Magnetic 1.5-ml tube rack

Heat block at 70°C

DNA Clean and Concentrator-5 kit (Zymo Research, cat. no. D4013)

RiboMinus Eukaryote System v2 (Thermo Fischer Scientific, cat. no. A15026)

Heat block at 37°C

Heat block at 65°C

0.2-ml PCR strip tube (Dot Scientific, cat. no. 415–8PCR)

Thermocycler

Protocol Steps:

RNA Isolation

• 1Thaw the three tubes with chromatin pellets frozen in Trizol (from Basic Protocol 1, step 17) at room temperature just until samples are liquid. Vortex briefly to mix. If samples were not frozen, proceed immediately to the next step.

  Note that for MEL cells, you should plan to isolate nascent RNA from at least 3 chromatin fraction pellets (as described in the Strategic Planning section). You will isolate RNA from each of the three (or more) tubes separately, then the RNA will be combined before the PolyA + depletion. Perform all steps through step 21 on all tubes simultaneously.

• 2Incubate samples in Thermomixer at 50°C for 10 mins with shaking at 1,400 rpm.

  This aids in releasing RNA from the insoluble chromatin and improves the yield of purified RNA.

• 3Add 60 μl of chloroform to each tube. Vortex thoroughly (at least 30 seconds).

  Chloroform should be used in a fume hood. As Trizol is caustic, make sure the tube lid is closed securely before vortexing, for example, by wrapping the lid with parafilm.

• 4Incubate for 2 min at room temperature.
• 5Centrifuge for 15 min at 14,000 rpm, 4°C.
• 6Transfer the clear upper aqueous phase to a new labeled 2 ml tube. The aqueous phase should be about 250 μl.

  Make sure to avoid carrying over any interphase. Using a smaller pipette tip (P200) in multiple aliquots is easier than using a larger tip.

• 7Add 3.5 volumes of RLT buffer (from RNeasy Mini kit) to the tube, then mix by vortexing briefly.

  For example, if the aqueous phase is 250 μl, add 875 μl RLT buffer.

• 8Add 2.5 volumes of room-temperature 100% ethanol to the tube. Mix well by pipetting up and down; do not centrifuge. Spin the tube down briefly (approximately 5 seconds) to collect drops from the lid.
• 9Transfer the sample, up to 700 μl at a time, to an RNeasy Mini spin column in a collection tube.
• 10Centrifuge for 15 seconds at 14,000 rpm, room temperature. Discard flow-through and repeat this step as necessary to pass the entire sample through the column.
• 11Add 350 μl of buffer RW1 (from RNeasy Mini kit) to the RNeasy spin column, centrifuge as in step 10, and discard flow-through.
• 12For each sample, prepare 80 μl of “DNAse I incubation mix” by adding 10 μl of DNase I stock solution and 70 μl of Buffer RDD (both from the RNase-free DNase kit) to a new 1.5-ml tube.

  Make a master mix here for as many tubes as you have.

• 13Mix the DNAse I incubation mix by gently inverting the tube end over end several times. Centrifuge briefly to collect drops from the lid.

  Do not vortex to mix!

• 14Add the DNase I incubation mix (80 μl) directly to the RNeasy Mini spin column membrane.
• 15Incubate for 15 min at room temperature.
• 16Add 350 μl of Buffer RW1 to the spin column, centrifuge as in step 10, and discard the flow-through.
• 17Add 500 μl of Buffer RPE (from RNeasy Mini kit) to the spin column, centrifuge as in step 10, and discard the flow-through.
• 18Add 500 μl of Buffer RPE to the spin column, centrifuge for 2 min at 14,000 rpm at room temperature, and discard the flow-through.
• 19Carefully remove the spin column from the collection tube and transfer the column to a new 1.5-ml tube.
• 20Add 30 μl of RNase-free water directly to the center of the column membrane. Centrifuge for 1 min at 10,000 rpm at room temperature to elute the RNA.
• 21Measure the concentration of eluted RNA by Nanodrop. Measure the concentration of each sample separately, and if the 260/280 and 260/230 values are acceptable, combine the replicates for each sample into a single 1.5-ml tube.

  Users should expect a concentration of 150–200 ng/μl, with a 260/280 value of around 2.0 and a 260/230 value of around 2.1. Note that a minimum of 10 μg of nascent RNA is recommended after pooling and before continuing to PolyA+ depletion.

• 22
  Run 250–500 ng of each pooled nascent RNA sample on a 1% TAE agarose gel to confirm the integrity of the RNA (Figure 3).

  1. Aliquot the corresponding volume of nascent RNA into a new 1.5-ml tube. Adjust the volume to 5 μl with sterile water.
  2. Add 5 μl 2X Novex Sample Buffer to the 1.5-ml tube.
  3. Incubate the tube in a heat block at 65°C for 5 minutes, then immediately transfer to ice for at least 1 minute or longer.
  4. Load the sample on a 1% agarose TAE gel alongside GeneRuler 1 kb Plus DNA ladder.
  5. Run the gel at 85 V for 45 minutes, then image using a UV gel imaging system.
  6. Keep the remaining nascent RNA on ice while the gel is running before proceeding on the next step. Optionally, stop here by storing the nascent RNA at −80°C for up to one month.

Figure 3.

Agarose gel showing intact chromatin-associated RNA (lanes show two different unrelated samples). A high-quality, intact sample should appear as a smear of different sizes of RNA, and most should be larger than ~ 100 nt. Some abundant species may cause distinct bands in the nascent RNA smear, and this is OK.

PolyA+ RNA Depletion

A. Prepare Magnetic Beads

• 23Vortex the magnetic beads from the DynaBeads mRNA Direct Micro Purification kit briefly to resuspend.
• 24Prepare 50 μl of beads for each sample. Because the depletion will be performed in triplicate, prepare 3 volumes of beads plus 10% for pipetting error. Aliquot beads into a new 1.5-ml tube.

  E.g. For one sample, aliquot 50 μl × 3 × 10 % = 165 μl beads.

• 25Place the tube on a magnetic rack and allow the supernatant to clear (approximately 1 minute).
• 26Aspirate the supernatant with a P200 tip and discard. Remove the tube from the magnetic rack.
• 27Add 1 volume of lysis/binding buffer (from the DynaBeads mRNA Direct Micro Purification kit) to the tube.

  E.g. for 165 μl beads, add 165 μl buffer.

• 28Vortex briefly to mix, then centrifuge briefly (approximately 10 seconds) to collect any drops from the lid.
• 29Divide the beads equally into three 1.5-ml tubes (50 μl in each tube) and set aside.

B. PolyA+ Depletion

• 30Adjust the volume of the input chromatin-associated RNA from step 21 to 300 μl with nuclease-free water.
• 31Incubate the RNA sample for 2 min at 70°C.
• 32Add an equal volume (300 μl) of lysis binding buffer (from the DynaBeads mRNA Direct Micro Purification kit) to the RNA. Vortex briefly to mix, then centrifuge briefly to collect any drops in the lid.
• 33Pipette the RNA/buffer mixture prepared in step 31 on top of one of the 50 μl aliquots of prepared magnetic beads (from Step 29). Pipette up and down ten times to mix.
• 34Incubate the tube for 5 min at room temperature.
• 35Place the tube on a magnetic rack and allow the supernatant to clear, approximately 1 minute.
• 36Carefully aspirate the supernatant and transfer to a clean 1.5-ml tube.

  This is the polyA-depleted fraction.

• 37Incubate the polyA-depleted fraction 2 min at 70°C.
• 38Repeat steps 32–36 two more times (for a total of three rounds of incubation, with fresh beads each time), omitting the final 70°C incubation on the last round.

  This is why 3 volumes of beads were required on Step 23.

• 39Clean up the polyA depleted RNA sample using the Clean and Concentrator-5 kit, eluting in 30 μl nuclease-free water.

  Alternatively, ethanol precipitation can be used to clean up and concentrate RNA.

• 40Measure the concentration of polyA depleted RNA by Nanodrop.

  Users should expect a concentration of 350–500 ng/μl, with a 260/280 value of around 2.0 and a 260/230 value of around 2.1. Note that a minimum of 10 μg of PolyA+ depleted RNA is recommended before continuing to ribosomal RNA depletion.

Ribosomal RNA Depletion

A. Use RiboMinus™ Eukaryote Kit v2 on polyA depleted RNA

• 41Add the components from the RiboMinus Eukaryote Kit in Table 2 to a 1.5-ml tube, in the order listed.

  Note that the maximum input for the RiboMinus kit is 5 μg of RNA. You should have more than this, so you will have to split the sample and do the rRNA depletion in multiple aliquots, then combine all samples in step 59.

• 42Mix by briefly vortexing at low speed, then centrifuge briefly to collect drops from the lid.
• 43Incubate for 10 min in a heat block at 70°C to denature the RNA.
• 44Immediately transfer the tube to a second heat block at 37°C and allow the sample to cool over a period of 20 minutes. Continue to the next step while the sample is cooling.

Table 2.

RiboMinus probe hybridization reaction components.

Reagent	Amount
2X hybridization buffer	50 μl
RiboMinus Eukaryote Probe Mix v2	4 μl
polyA depleted RNA	up to 5 μg
Nuclease-free water	up to 100 μl

B. Prepare RiboMinus Magnetic Beads

• 45Resuspend the RiboMinus Magnetic Beads (from the RiboMinus Eukaryote Kit) by vortexing the bottle briefly.

  Be careful not to confuse the magnetic beads from the RiboMinus Eukaryote Kit with the previously referenced magnetic beads from the DynaBeads mRNA Direct Micro Purification Kit (step 22).

• 46For each 5 μg RNA sample, prepare 200 μl of 1X hybridization buffer in a new labelled tube by diluting the 2X hybridization buffer (from the RiboMinus Eukaryote Kit) with an equal volume of nuclease-free water. Set aside.
• 47For each 5 μg RNA sample, pipette 500 μl of magnetic beads into a new 1.5-ml tube. Place each tube on a magnetic rack to allow the supernatant to clear.
• 48Gently aspirate and discard the supernatant.
• 49Remove the tubes from the magnetic rack and wash the beads with 500 μl nuclease-free water by pipetting it down the side of the tube where the beads are collected.
• 50Place each tube on a magnetic rack to allow the supernatant to clear. Gently aspirate and discard the supernatant.
• 51Repeat washing (steps 5–6) one more time (for a total of 2 times).
• 52Resuspend the beads in 200 μl of prepared 1X hybridization buffer from step 45.
• 53Incubate the tube with beads in a heat block at 37°C for at least 5 minutes, or until the 20-minute incubation of the RNA/probe mix at 37°C is complete.

C. Capture and Remove rRNA/probe complexes

• 54Briefly centrifuge the RNA/probe mix to collect the mixture at the bottom of the tube.
• 55Add the RNA/probe mix to the prepared RiboMinus Magnetic beads from step 52. Mix by pipetting up and down ten times.
• 56Incubate the tube in a heat block at 37°C for 5 min. Centrifuge briefly to collect drops.
• 57Place the tube on a magnetic rack and allow the supernatant to clear, approximately 1 minute.
• 58Transfer the supernatant (~ 300 μl) to a new 1.5-ml tube.

  This is the rRNA depleted fraction.

• 59Concentrate and clean up the rRNA-depleted RNA by ethanol precipitation:
  Alternatively, use the magnetic bead clean up kit that comes with some versions of the RiboMinus Eukaryote Kit. In our experience, it can be difficult for inexperienced users to work with very small volumes on magnetic beads, therefore, we recommend ethanol precipitation.

  • i
    Add 1 μl glycogen (20 μg/μl), 0.1 volumes 3 M sodium acetate, and 2.5 volumes of ice-cold 100% ethanol to the tube with the RNA.
  • ii
    Adding glycogen is optional, but it helps to generate a visible pellet.
  • iii
    Mix well by pipetting up and down, then incubate for at least 30 minutes at −80°C.
  • iv
    Incubate up to overnight (16h) at −80°C.
  • v
    Centrifuge for 15 min at 14,000 rpm, 4°C.
  • vi
    Carefully aspirate and discard the supernatant without disturbing the pellet.
  • vii
    Add 500 μl of ice-cold 70% ethanol to rinse the pellet.
  • viii
    Centrifuge for 5 min at 14,000 rpm, 4°C.
  • ix
    Carefully aspirate and discard the supernatant without disturbing the pellet.
  • x
    Repeat the wash with ice-cold 70% ethanol one more time (for a total of 2 washes).
    When aspirating the supernatant the second time, be sure to remove as much ethanol as possible. It can help to use a P1000 pipette tip to remove most of the ethanol. Then, centrifuge the tube briefly and use a P10 pipette tip to remove the final few drops.
  • xi
    Air dry the pellet with the lid open for 5 min at room temperature.
• 60Resuspend the pellet in 7 μl nuclease-free water.

  Combine multiple samples (divided in step 40) into a single 1.5-ml tube at this point. Start by resuspending the first pellet in 7 μl nuclease-free water, then use this same 7 μl to resuspend further pellets.

• 61Measure the concentration of RNA by Nanodrop.

  Users should expect a concentration of 110–210 ng/ul. Note that it is very important to have at least 600 ng of nascent RNA in a volume of at most 5.5 μl for the next step, or a minimum concentration of 110 ng/μl before proceeding. For more details, see the Critical Parameters section.

Adapter Ligation

• 12Add 600 ng of nascent RNA (in a volume of up to 5.5 μl) and 50 pmol of DNA adapter (0.5 μl of a 100 pmol/μl dilution) to a 0.2-ml PCR strip tube. If necessary, adjust the volume to 6 μl with nuclease-free water. Mix by gently flicking the tube, then centrifuge briefly to collect drops.

  Note that the DNA adapter sequence (/5rApp/NNNNNCTGTAGGCACCATCAAT/3ddC/) includes an activated adenylate group at the 5′ end (5rApp), a sequence of 5 random nucleotides (NNNNN), and a dideoxynucleotide at the 3′ end (3ddC). All three of these custom features must be included when ordering this oligo from a vendor. The adapter should be diluted to 100 pmol/μl and aliquoted upon arrival, then stored at −20°C.

• 13Incubate for 10 min in a thermocycler at 65°C, then transfer to ice for at least 1 minute.
• 14During the incubation of step 63, prepare a master mix (enough for all samples) for the adapter ligation reaction from the components of the T4 RNA ligase kit, as listed in Table 3. Add the master mix components to a 1.5-ml tube.
• 15Mix very well by pipetting up and down.

  PEG is very viscous, and the success of the adapter ligation reaction can depend on how well it is mixed at this stage. Avoid incorporating bubbles by keeping the pipette tip submerged.

• 16Add 14 μl of the adapter ligation master mix to the 6 μl annealed RNA sample (from Step 63) and mix very well again by pipetting up and down. Centrifuge briefly to collect drops.
• 17Incubate in a thermocycler for 12 hours at 16°C, then hold at 4°C.
• 18Adjust the volume of the adapter ligation reaction to 100 μl with nuclease-free water.
• 19Clean up and concentrate the adapter-ligated RNA using the Clean and Concentrator-5 kit, eluting in 10 μl nuclease-free water.

  Alternatively, ethanol precipitate RNA as described above.

Table 3.

Adapter ligation reaction components.

Reagent	Amount
10X Ligase Buffer	2 μl
50% PEG 8000	10 μl
RNase OUT	1 μl
RNA ligase 2 (truncated K227Q)	1 μl

BASIC PROTOCOL 3: cDNA AMPLICON PREPARATION

This library preparation protocol generates a double-stranded cDNA molecule from each nascent RNA that retains the unique nascent RNA 3′ end adapter sequence. First, a template-switching reverse transcriptase generates both the first and second strand of cDNA in a single step (Zhu, Machleder, Chenchik, Li, & Siebert, 2001), which allows templates with heterogeneous 5′ ends to be incorporated into the library. Importantly, RNAs with a 5′ end that is TMG-capped are incorporated more efficiently than uncapped RNAs (Wulf et al., 2019), which helps enrich for full length RNAs in the library. First, a test is performed to determine the optimal number of PCR cycles to use when amplifying the cDNA. This is to avoid over-amplifying the sample and introducing a size bias in the final library. Then, a final PCR reaction is performed using the optimal number of PCR cycles, and the sample is cleaned up before continuing to generate a long-read sequencing library. This protocol is compatible with barcoding.

Materials:

Adapter-ligated nascent RNA (from Basic Protocol 2, step 69)

Custom reverse transcriptase (RT) primer, 10 μM (AAGCAGTGGTATCAACGCAGAGTACCACATATCAGAGTGCGGATTGATGGTGCCTACAG; where the region in bold is a 16-nt barcode, see the Critical Parameters section for more details)

TE buffer (10 mM TRIS, 0.1 mM EDTA, pH 8.0)

6X Orange DNA loading dye (Thermo Fischer Scientific, cat. no. R0631)

TAE buffer (40 mM TRIS, 20 mM acetic acid, 1 mM EDTA pH 8.0)

Agarose (Sigma, cat. no. A9539)

Lonza Gelstar (Thermo Fischer Scientific, cat. no. 50535)

GeneRuler 1 kb Plus DNA ladder (Thermo Fischer Scientific, cat. no. SM1331)

70% ethanol, room temperature

10 mM TRIS pH 8.5

0.2-ml PCR strip tube (Dot Scientific, cat. no. 415–8PCR)

Thermocycler

1.5-ml tubes (Dot Scientific, cat. no. RN1700-GMT)

Refrigerated microcentrifuge

DNA Clean and Concentrator-5 kit (Zymo Research, cat. no. D4013)

SMARTer PCR cDNA Synthesis Kit (Takara/Clontech, cat. no. 634925)

Advantage 2 PCR kit (Takara/Clontech, cat. no. 639137)

AMPure XP beads (Beckman Coulter, cat. no. A63880)

Vortex

Thermomixer

1.5-ml tube magnetic rack

Nanodrop

UV gel imaging system

Protocol Steps:

Reverse Transcription

• 1For each sample, add 3.5 μl of adapter-ligated RNA (from step Basic Protocol 2, step 69; approximately 210 ng) and 1 μl of custom RT primer (10 μM) to a new 0.2-ml tube labeled “+RT”. Add the same to a new 0.2-ml labeled “-RT”. Mix by gently flicking the tubes, then centrifuge briefly to collect drops.

  If multiple samples are to be barcoded, different RT primers with unique barcode sequences should be used for each sample here.

• 2Incubate tubes in a thermocycler for 3 min at 72°C, then 2 min at 42°C, then hold at 4°C until the next step is prepared.
• 3During the incubation of step 2, prepare two master mixes for the reverse transcription reaction from the components of the SMARTer PCR cDNA Synthesis Kit, as listed in Table 4. Add master mix components to a 1.5-ml tube in the order listed there. Prepare enough master mix for all samples. Make one master mix including the SMARTScribe RT enzyme and one mix without the enzyme, using nuclease-free water in its place.

  For example, if you are preparing 4 samples, prepare a 5X master mix with RT enzyme, and a 5X master mix without RT enzyme.

• 4Add 5.5. μl of master mix with SMARTScribe RT enzyme to the 0.2-ml tubes from step 1 labeled “+RT”, and add 5.5 μl of master mix without SMARTScribe RT enzyme to the 0.2-ml tubes labeled “-RT”. Mix by gently flicking the tubes, then centrifuge briefly to collect drops.
• 5Incubate in a thermocycler for 90 min at 42°C, then terminate the reaction by incubating for 10 min at 70°C, and then hold at 4°C.
• 6Dilute each reaction 1:10 with 90 μl TE buffer.
• 7Divide each reaction into 10–15 μl aliquots in labeled 0.2-ml PCR strip tubes and freeze immediately at −20°C if stopping here. Store at −20°C for up to three months. Otherwise, keep the tubes on ice and proceed immediately to PCR optimization.

Table 4.

Reverse transcription reaction components.

Reagent	Amount
5X First Strand buffer	2 μl
100 mM DTT	0.25 μl
10 mM dNTP mix	1 μl
12 uM SMARTer IIA Oligo (stored at −80°C)	1 μl
RNase Inhibitor	0.25 μl
SMARTScribe Reverse Transcriptase (100 U)	1 μl

PCR Cycle Number Optimization

• 8Assemble a master mix for PCR reactions from the components of the Advantage 2 PCR kit, as listed in Table 5. For each cDNA sample (both +RT and -RT), assemble enough master mix for one PCR reaction.
• 9Add 5 μl of each cDNA sample from step 7 to a new 0.2-ml PCR strip tube, then add 45 μl of the master mix on top. Mix by gently flicking the tube and then centrifuge briefly to collect drops.
• 10Place the PCR strip in a thermocycler with the cycle program indicated in Table 6. After the initial 8 rounds of amplification, hold the thermocycler at 4°C, open the thermocycler lid, and remove a 5 μl aliquot from each reaction. Close the lid and continue cycling for an additional 2 rounds (for a total of 10 rounds), then take out another 5 μl aliquot. Repeat until the sample has gone through a total of 18 cycles of amplification and you have a 5 μl aliquot after every 2 cycles. Keep the aliquots at 4°C until the final round is completed.

  The cycle numbers that are tested may need to be adjusted, but we recommend 8–18 cycles as a starting point.

• 11Add 1 μl of 6X gel loading dye to each aliquot and run all aliquots on a 1% TAE agarose gel at 85 V for 45 min alongside 0.2 μl of GeneRuler 1 kb plus ladder. Load reactions from corresponding +RT and -RT cDNA aliquots at each cycle number for comparison (see Figure 4). Each sample will require 12 lanes plus a ladder. Run the gel at 85 V for 45 minutes, then image using a UV gel imaging system.
• 12Select the cycle number to be used for the final PCR amplification. For all samples, the -RT reactions should be empty, and the +RT reactions should show a gradually increasing smear of cDNA with increasing cycle number. The optimal cycle number is one where the cDNA is visible, but before it gets too dark and overloaded.

  For the example shown in Figure 4, a cycle number of 14 should be chosen.

Table 5.

PCR cycle number optimization reaction components.

Reagent	Amount
cDNA	5 μl
10X Advantage 2 Buffer	5 μl
50X dNTP mix (10 mM)	1 μl
Primer IIA (12 uM)	1 μl
50X Advantage 2 Polymerase	1 μl
H2O	37 μl

Table 6.

PCR cycle number optimization thermocycler program.

Temperature (°C)	Time	Cycles
95	1 min	1
95	15 s	8, 10, 12, 14, 16,18
65	30 s
68	3 min
4	hold	--

Figure 4.

Agarose gel showing aliquots from PCR cycle number optimization reactions. On the left, “+RT” samples contained the RT enzyme in the reverse transcription reaction, and on the right, “-RT” control samples that did not contain the RT enzyme. Numbers at the top of the gel indicate the number of PCR amplification cycles. Numbers at the left of the gel indicate size of the DNA markers in the ladder (bp). The red arrow indicates the optimal cycle number in this example, based on the intensity of the cDNA smear.

Final PCR Amplification

• 13For each sample, prepare enough master mix for eight 50μl PCR reactions using the Advantage 2 PCR kit, as described in Table 5.
• 14Add 5 μl of +RT cDNA to eight 0.2-ml PCR strip tubes, then add 45 μl of master mix on top. Mix by gently flicking the tube and then centrifuge briefly to collect drops.
• 15Place the PCR strip in a thermocycler with the cycle program indicated in Table 7.
• 16Combine the 8 PCR reactions for each sample (400 μl total) into a new 1.5-ml tube, and remove a 5 μl aliquot from each sample to run on a gel.
• 17Run the 5 μl aliquot from each sample on a 1% TAE agarose gel at 85 V for 45 min to confirm that PCR amplification worked, and that the smear appears the same as in the cycle optimization test (from step 12).

Table 7.

Final PCR thermocycler program.

Temperature (°C)	Time	Cycles
95	1 min	1
95	15 s	Optimized cycle number (~15)
65	30 s
68	3 min
68	5 min	1
4	hold	--

AMPure Bead PCR Cleanup

• 18Mix AMPure beads by gently vortexing the bottle.
• 19Add 1X volume of AMPure magnetic beads to each pooled PCR sample (400 μl).
• 20Mix the beads/DNA solution thoroughly by vortexing. Centrifuge briefly to collect drops.
• 21Allow the DNA to bind to the beads by shaking in a Thermomixer at 1,400 rpm for 10 minutes at room temperature. Centrifuge the tube briefly to collect drops.
• 22Place the tube in a magnetic rack and allow the supernatant to clear (at least 1 minute).

  In our experience, these beads take slightly longer than usual to clear. If the supernatant is still cloudy after 1 minute, wait longer.

• 23With the tube still on the magnetic rack, carefully aspirate and discard the cleared supernatant. Make sure you avoid disturbing the bead pellet.
• 24Wash the beads with 500 μl of room-temperature 70% ethanol by pipetting it down the side of the tube where the beads are.
• 25With the tube still on the magnetic rack, carefully aspirate and discard the supernatant. Repeat once, for a total of 2 ethanol washes.
• 26Centrifuge the tube briefly to collect beads and residual ethanol in the bottom of the tube, then place the tube back in the magnetic rack and carefully aspirate any residual ethanol with a P10 pipette tip.

  It is important to remove as much ethanol as possible without disturbing the pellet.

• 27Open the tube lid and air dry for 1 minute at room temperature.
• 28Add 40 μl of 10 mM TRIS pH 8.5 to the beads to elute the DNA.
• 29Shake the tube in a Thermomixer for 10 minutes at 1,400 rpm at room temperature. Centrifuge the tube briefly to collect drops.
• 30Place the tube in the magnetic rack and allow the supernatant to clear (at least 1 minute).
• 31Carefully aspirate the supernatant and transfer it to a new 1.5-ml tube.

  This is the final eluted DNA sample. Be very careful not to carry over any excess magnetic beads during this step. If you are unsure, place the eluted supernatant back on the magnetic rack and repeat.

• 32Determine the concentration of the final DNA sample by Nanodrop.

  Users should expect a final concentration of 50 – 200 ng/μl, although this will vary depending on the intensity of the cDNA smear that was chosen for the optimal cycle number.

• 33If preparing multiple barcoded samples, pool all barcoded samples together in equal concentrations (i.e. put equal ng amount of each in the same tube). The final sample volume will vary depending on the library preparation service you choose, but ~ 50 μl is an approximate volume to aim for.

  Library preparation should now be completed following manufacturer’s instructions for amplicon sequencing on the long-read sequencing platform of your choice.

REAGENTS AND SOLUTIONS:

All buffers should be prepared from stock solutions up to 1 week before use and stored at 4°C, excluding α-amanitin, SUPERase.IN, and cOmplete protease inhibitor mix, which should instead be added immediately before use. All buffers should be chilled on ice before use.

Cell lysis buffer

10 mM Tris-HCl pH 7.5

0.05% NP-40

150 mM NaCl

25 uM α-amanitin (Sigma, cat. no. A2263)

40 U/ml SUPERase.IN (Thermo Fischer Scientific, cat. no. AM2694)

1x cOmplete protease inhibitor mix (Sigma, cat. no. 11697498001)

Nuclear Lysis Buffer

20 mM HEPES pH 7.5

1 mM DTT

7.5 mM MgCl₂

0.2 mM EDTA

0.3 M NaCl

1 M Urea

1% NP-40

25 uM α-amanitin (Sigma, cat. no. A2263)

40 U/ml SUPERase.IN (Thermo Fischer Scientific, cat. no. AM2694)

1x cOmplete protease inhibitor mix (Sigma, cat. no. 11697498001)

Nuclear Resuspension Buffer

20 mM Tris-HCl pH 8.0

75 mM NaCl

0.5 mM EDTA

0.85 mM DTT

50% glycerol

25 uM α-amanitin (Sigma, cat. no. A2263)

40 U/ml SUPERase.IN (Thermo Fischer Scientific, cat. no. AM2694)

1x cOmplete protease inhibitor mix (Sigma, cat. no. 11697498001)

Sucrose Buffer

Cell lysis buffer with 24% (w/v) sucrose

Add sucrose crystals to prepared cell lysis buffer and mix on a rotary spinner at room temperature until sucrose is dissolved (15 – 30 min).

COMMENTARY

BACKGROUND INFORMATION:

Long-read sequencing of nascent RNA reports the position of RNA Pol II during the process of RNA synthesis as well as the processing status (splicing, 3′ end cleavage, polyadenylation, or modification) of any given RNA (Herzel et al., 2018). This approach relies on two important advancements: first, the ability to isolate nascent RNA, and second, the maturation of long read sequencing technology.

Before the advent of biochemical nascent RNA isolation techniques, nascent RNA was first observed directly in a preparation of “chromatin spreads” by Miller and Beatty (1969). Since nascent RNA makes up such a small fraction of total RNA in the cell, the first tracking of nascent RNA molecules were performed on radioactively labeled, highly-abundant species, for example β-globin pre-mRNA, immunoglobin heavy and light chains, and SV40 viral transcripts (Kinniburgh & Ross, 1979; Lai, Dhar, & Khoury, 1978; Schibler, Marcu, & Perry, 1978). One important finding that led to the ability to biochemically fractionate nascent RNA from cells was that the ternary complex of Pol II, nascent RNA, and chromatin remains stably bound even under harsh conditions that compact the chromatin from the surrounding nucleoplasm – up to 2M urea and 0.3 M NaCl (Wuarin & Schibler, 1994). This allowed chromatin-associated nascent RNA and Pol II to be isolated by relatively low-speed centrifugation. The protocol detailed here is based on similar approaches for subcellular fractionation using chromatin purification that have been described previously (Pandya-Jones & Black, 2009) and, in particular, it has been modified to have a gentler centrifugation speed for collecting nuclei of developing erythroblasts, which have a weaker member as they begin the process of enucleation (Pimentel et al., 2016).

Other methods are available for isolating nascent RNA which involve metabolic labeling of newly-transcribed RNAs with a nucleotide analog such as 4sU (Duffy & Simon, 2016; Garibaldi, Carranza, & Hertel, 2017). While there are some drawbacks to this method, namely, difficulty in ensuring unbiased incorporation of the nucleotide analog and possible effects on RNA processing, this method could be considered as an alternative to chromatin-associated RNA purification. In our opinion, metabolic labeling and chromatin fractionation are roughly similar in cost and ease of use, however, we would caution against using metabolic labeling specifically if the downstream application is to detect splicing, since there is some debate as to how 4sU incorporation may affect splicing (Testa, Disney, Turner, & Kierzek, 1999). Additionally, some methods of nascent RNA isolation use immunoprecipitation of Pol II as a further enrichment step, and this could be considered if genetic tagging of Pol II is a viable option in your cell type of choice. However, to date, only one lab has reported using this method in conjunction with long read sequencing (Drexler et al., 2019).

The technology behind long-read sequencing was first described in 2003, where a DNA polymerase was used to incorporate fluorescent nucleotides and single-molecule sequences could be read out with fluorescent microscopy (Braslavsky, Hebert, Kartalov, & Quake, 2003). While this initial report only provided “sequence fingerprints” of 5 base pairs in length, the technology has no theoretical maximum on read length, and current read lengths upward of 2 million base pairs have been reported (Payne, Holmes, Rakyan, & Loose, 2019). Pacific Biosciences and Oxford Nanopore are the leading platforms for long read sequencing, and both platforms utilize polymerases for reading sequence information, although in slightly different manners (Midha, Wu, & Chiu, 2019). The biggest advantage of long-read sequencing for RNA is the ability to detect unique isoforms rather than having to infer isoform usage from smaller junctions. Previous methods for sequencing nascent RNA using short-read sequencing technology can, for example, provide information about the splicing status of a single intron, but the reads are not long enough to cover multiple introns, let alone an entire nascent RNA from transcription start site to Pol II active site (Khodor et al., 2011; Tilgner et al., 2012).

A key reagent in this protocol is the template-switching reverse transcriptase (Zhu et al., 2001). This enzyme is able to synthesize the first strand of cDNA from the nascent RNA template using the blunt-ligated adapter at the 3′ end. Then, once the enzyme reaches the 5′ end of the nascent RNA template, it incorporates several nucleotides through non-templated addition, which act as an annealing point for the unique template-switching oligo. The RT can then switch strands and generate the second strand all in the same reaction. Importantly, this means that the resulting cDNA molecule retains the original 5′ and 3′ ends. This is extremely informative for analysis of both Pol II position and transcription start site. The template-switching reverse transcriptase is also more efficient at switching templates in the presence of a 5′-m7G cap, which is installed on mRNAs after only 23 nucleotides of transcription (Rasmussen & Lis, 1993), enriching for full lengths cDNA molecules in the final sequencing library (Wulf et al., 2019).

CRITICAL PARAMETERS:

Attaining enough nascent RNA from cells is critical for the success of this protocol. The limiting reagent is nascent RNA that has been depleted of polyA+ RNA and rRNA, of which you need 600 ng for the downstream adapter ligation reaction. However, the polyA+ depletion and rRNA depletion steps can have a fairly low yield. The yield for polyA+ depletion is often ~ 70%, and the yield for rRNA depletion can be ~ 5–10%. Thus, we suggest not continuing to Basic Protocol 2 unless you have at least a total of 14 μg of chromatin-associated RNA at the end of Basic Protocol 1. In our experience, 20 million MEL cells yield ~ 5 μg of chromatin-associated RNA, so fractionating 3 × 20 M cells in parallel and combining the chromatin-associated RNA after isolating from Trizol should be sufficient. However, the yield of nascent RNA is variable between cell types, so this should be monitored closely. The quality of the nascent RNA is also extremely important, as this will directly affect the quality of the downstream cDNA library. The RNA 260/280 and 260/230 values should be monitored by Nanodrop where mentioned, and RNA integrity can be quickly inspected by running it on an agarose gel (Figure 3). In addition to doing this after collecting the chromatin-associated RNA (Basic Protocol 2, step 22), the user could also run the RNA on an agarose gel after polyA depletion if they suspect RNA degradation after PolyA+ depletion.

Subcellular fractionation (Basic Protocol 1) should be optimized for each cell type, and success should be monitored by western blotting. A successful fractionation is one where Pol II remains in the chromatin fraction, and the cytoplasmic and nucleoplasmic markers are strongly depleted from the chromatin fraction (Figure 2). When attempting this protocol with another cell type, the main step that will need to be optimized is the subcellular fractionation. Since this protocol is written for MEL cells which are erythroid cells, the centrifugation step to isolate nuclei has been decreased to prevent their slightly weaker nuclear membranes from bursting during centrifugation (Basic Protocol 1, step 7). For most other cell types, this centrifugation speed should be gradually increased, and the nuclei and cytoplasm fractions should be observed under a light microscope to observe that nuclei are intact. If cells that grow in monolayer are used, then they should be rinsed quickly with 1X PBS + 1 mM EDTA on the plate before using a cell scraper to harvest them (in place of Basic Protocol 1, steps 1 and 2). The yield of chromatin-associated RNA is variable between different cell types, so this should be monitored closely, and the number of input cells should be adjusted so that the protocol yields a total of ~14 μg of chromatin-associated RNA at the end of Basic Protocol 2, RNA Isolation. However, subcellular fractionation tends to work best with no more than 20 million cells in the tube, so adjust the number of tubes that are combined rather than adjusting the number of cells in the tube.

Multiple samples can be sequenced on the same flow cell if a barcode is introduced during the reverse transcription step. See Table 8 for a list of barcode sequences that can be inserted in the custom RT primer used for this step. These sequences are based on a PacBio protocol for Multiplex Isoform Sequencing (https://www.pacb.com/wp-content/uploads/2015/09/Procedure-Checklist-Isoform-Sequencing-Iso-Seq-using-the-Clontech-SMARTer-PCR-cDNA-Synthesis-Kit-and-the-BluePippin-Size-Selection-System.pdf). The barcoded RT primer can be ordered from any oligonucleotide synthesis company, but it should be ordered PAGE-purified.

Table 8.

Barcode sequences for custom RT primer.

Barcode Name	Sequence	Purification
RT_BC_01	CACATATCAGAGTGCG	PAGE
RT_BC_02	ACACACAGACTGTGAG	PAGE
RT_BC_03	ACACATCTCGTGAGAG	PAGE
RT_BC_04	CACGCACACACGCGCG	PAGE
RT_BC_05	CACTCGACTCTCGCGT	PAGE
RT_BC_06	CATATATATCAGCTGT	PAGE
RT_BC_07	TCTGTATCTCTATGTG	PAGE
RT_BC_08	ACAGTCGAGCGCTGCG	PAGE
RT_BC_09	ACACACGCGAGACAGA	PAGE
RT_BC_10	ACGCGCTATCTCAGAG	PAGE
RT_BC_11	CTATACGTATATCTAT	PAGE
RT_BC_12	ACACTAGATCGCGTGT	PAGE
RT_BC_13	CTCTCGCATACGCGAG	PAGE
RT_BC_14	CTCACTACGCGCGCGT	PAGE
RT_BC_15	CGCATGACACGTGTGT	PAGE
RT_BC_16	CATAGAGAGATAGTAT	PAGE
RT_BC_17	CACACGCGCGCTATAT	PAGE
RT_BC_18	TCACGTGCTCACTGTG	PAGE
RT_BC_19	ACACACTCTATCAGAT	PAGE
RT_BC_20	CACGACACGACGATGT	PAGE
RT_BC_21	CTATACATAGTGATGT	PAGE
RT_BC_22	CACTCACGTGTGATAT	PAGE
RT_BC_23	CAGAGAGATATCTCTG	PAGE
RT_BC_24	CATGTAGAGCAGAGAG	PAGE

During the PCR cycle number optimization, the goal is to use as few rounds of PCR amplification as possible to minimize amplification bias in the library. A cycle number of 11–15 is usually chosen, and anything more than ~ 18 cycles should be reconsidered. If this happens, consider adjusting the amount of cDNA input in the PCR reaction.

TROUBLESHOOTING:

1. Fractionation issues

All fractionation issues should be diagnosed by western blot of the cytoplasmic, nucleoplasmic, and chromatin fractions. If nucleoplasm or chromatin markers are present in the cytoplasm, the initial centrifugation speed may have been so high that nuclei lysed in the sucrose buffer purification step. Try decreasing centrifugation speed. Additionally, nuclei can be observed under a microscope after this step to ensure they are intact (visibly round). You may also try to decrease the time that cells are incubated with the cell lysis buffer. If the nuclei are difficult to resuspend after pelleting (sticky rather than loosely suspended after flicking the tube), the nuclei may have been prematurely lysed as well. Conversely, if markers for the nucleoplasm or chromatin are significantly detected in the cytoplasm, the centrifugation speed may not have been high enough to pellet the nuclei, and you may thus wish to increase the centrifugation speed.

2. RNA Isolation Issues

If at any point during RNA isolation you end up with less RNA than recommended for the next step, you may either pool multiple samples together to gain enough RNA, or freeze the RNA at −80°C for up to one month while you go back and repeat the previous steps to obtain enough RNA. If the nascent RNA appears degraded on the gel after RNA isolation (a high concentration of small RNAs, no larger RNAs), it is possible that there was RNase contamination. Throw out this RNA sample and repeat from the beginning. Make sure that you work quickly while handling the RNA samples, that you keep all tubes that contain RNA on ice unless otherwise noted, and that you are using sterile, RNAse-free materials. Also, be careful not to let the tips/tubes accidentally come into contact with non- RNAse-free surfaces.

3. Adapter ligation issues

The adapter ligation reaction is usually greater than 90% efficient (Carrillo Oesterreich et al., 2016), but the efficiency can drop if the reaction is not thoroughly mixed before incubation. If you suspect the adapter ligation reaction is not working, for example, if the downstream PCR reactions do not yield a product and you have ruled out other issues with RT or PCR (see next point), you can diagnose this problem by running a sample of nascent RNA with and without the DNA adapter included in the ligation reaction on a 10% TBE-urea denaturing gel. In a successful ligation, you should be able to see all the major bands in the nascent RNA sample shift upward when the DNA adapter is present in the reaction.

4. RT and PCR issues

If no PCR product appears even after 18 cycles of amplification, the adapter ligation reaction may not have worked efficiently. Repeat from this step, ensuring the reaction is mixed well. If there is PCR product in the -RT control lanes as well as the +RT lanes, there may be some DNA contamination in the sample. Repeat DNase I treatment if this occurs. If some RNA sequences are very abundant in your cell type, this may appear as a distinct band in the cDNA “smear” (see Figure 4) – this is OK. However, sometimes a high molecular weight smear appears (in the range of 5–20 kb), and this is generally non-specific amplification. A cycle number should be chosen before this high molecular weight smear appears.

UNDERSTANDING RESULTS:

Sequencing a cDNA library from 60 million MEL cells on one PacBio Sequel flow cell should yield up to 1 million reads, and typically 68% map uniquely to the mouse genome. Polyadenylated reads can be bioinformatically filtered, but should be minimal (typically ~ 1%). PCR duplicates can be identified by reads which contain the same barcode in the DNA adapter sequence. However, at this sequencing depth, PCR duplicates are not frequently sequenced (typically < 1%). The resulting long reads generally have a median lengths of ~ 720 nucleotides.

TIME CONSIDERATIONS:

The full protocol described here can be completed in four days. On day 1, actively growing MEL cells can be harvested and fractionated, then a diagnostic western blot can be run. On day 2, nascent RNA can be isolated from the chromatin pellet in Trizol, then polyA and rRNA depletion can be completed. Adapter ligation should also be done at the end of this day, since it is the only step that requires an overnight incubation. On day 3, the RT reaction and PCR cycle number optimization can be done. On day 4, the final PCR amplification and clean-up can be performed. However, there are flexible stopping points mentioned in the protocol. The most time-sensitive steps are on the first day – it is best to get the live cells harvested and precipitate the chromatin as fast as possible.